WorldWideScience

Sample records for single-stranded rna plant

  1. Characterization of a novel single-stranded RNA virus, closely related to fusariviruses, infecting the plant pathogenic fungus Alternaria brassicicola.

    Science.gov (United States)

    Zhong, Jie; Shang, Hong Hong; Zhu, Chuan Xia; Zhu, Jun Zi; Zhu, Hong Jian; Hu, Yan; Gao, Bi Da

    2016-06-02

    The alternaria blackspot of rapeseed is one of the most prominent diseases of rapeseed. It is caused by three species of the genus Alternaria: Alternaria brassicicola, Alternaria brassicae, and Alternaria raphanin. Here we report a novel positive-sense RNA virus from an A. brassicicola strain 817-14. The virus has a 6639 nucleotide (nt) long genome, excluding a poly (A)-tail, and was predicted to contain three putative open reading frames (ORF1, ORF2, and ORF3). The large ORF1 encoded a 174-kDa polyprotein (composed of 1522 amino acid residues) containing a conserved RNA-dependent RNA polymerase (RdRp) domain and a helicase domain. The other two smaller ORFs encoded polypeptides with unknown function. Homology search and phylogenetic analysis, based on the RdRp and helicase domains, suggest that this virus is related to and grouped with Sclerotinia sclerotiorum fusarivirus 1 (SsFV1), Rosellinia necatrix fusarivirus 1 (RnFV1), Fusarium graminearum virus-DK21 (FgV1), and Penicillium roqueforti RNA mycovirus 1 (PrRV1), all of which belong to a newly proposed family Fusariviridae. For this study, we designed the virus as "Alternaria brassicicola fusarivirus 1" (AbFV1). Virus elimination revealed that AbFV1 has no conspicuous impact on the biological properties of its host. Copyright © 2016. Published by Elsevier B.V.

  2. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth

    2014-01-01

    . We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices......Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells...

  3. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids.

    Science.gov (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R

    2015-04-08

    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  4. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses.

    Science.gov (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn

    2011-06-01

    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  5. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  6. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif

    Science.gov (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  7. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol

    2010-05-01

    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  8. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.

    1987-01-01

    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  9. Role of electrostatics in the assembly pathway of a single-stranded RNA virus.

    Science.gov (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M

    2014-09-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  10. Selective binding and reverse transcription inhibition of single-strand poly(A) RNA by metal TMPyP complexes.

    Science.gov (United States)

    Zhou, Zhu-Xin; Gao, Feng; Chen, Xing; Tian, Xiang-Jing; Ji, Liang-Nian

    2014-10-06

    Ni-, Cu-, and Zn-TMPyP are capable of binding to single-strand poly(A) RNA with high preference and affinity and inhibiting the reverse transcription of RNA by both M-MuLV and HIV-1 reverse transcriptase. With 10 nM azidothymidine, the IC50 value of M-TMPyP could be lowered to 10(-1) μM order.

  11. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues

    Science.gov (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak

    2006-01-01

    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  12. Highly stable triple helix formation by homopyrimidine (l)-acyclic threoninol nucleic acids with single stranded DNA and RNA

    DEFF Research Database (Denmark)

    Kumar, Vipin; Kesavan, Venkitasamy; Gothelf, Kurt Vesterager

    2015-01-01

    Acyclic (l)-threoninol nucleic acid (aTNA) containing thymine, cytosine and adenine nucleobases were synthesized and shown to form surprisingly stable triplexes with complementary single stranded homopurine DNA or RNA targets. The triplex structures consist of two (l)-aTNA strands and one DNA...... or RNA, and these triplexes are significantly stronger than the corresponding DNA or RNA duplexes as shown in competition experiments. As a unique property the (l)-aTNAs exclusively form triplex structures with DNA and RNA and no duplex structures are observed by gel electrophoresis. The results were...... compared to the known enantiomer (d)-aTNA, which forms much weaker triplexes depending upon temperature and time. It was demonstrated that (l)-aTNA triplexes are able to stop primer extension on a DNA template, showing the potential of (l)-aTNA for antisense applications....

  13. A single-stranded RNA copy of the Giardia lamblia virus double-stranded RNA genome is present in the infected Giardia lamblia.

    OpenAIRE

    Furfine, E S; White, T C; Wang, A L; Wang, C C

    1989-01-01

    An isolate of Giardia lamblia infected with the double-stranded RNA virus (GLV) has two major species of RNA that are not present in an uninfected isolate. One of these species is the previously characterized double-stranded RNA genome of GLV (1). The second species of RNA appears to be a full length copy of one strand of the double-stranded RNA genome. This full length single-stranded RNA is not present in viral particles isolated from the growth medium. The cellular concentration of the sin...

  14. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-01

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  15. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin.

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-13

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecule, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G • U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G • U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  16. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA

    Science.gov (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana

    2009-04-01

    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  17. Capillary electrophoresis ribosomal RNA single-stranded conformation polymorphism: a new approach for characterization of low-diversity microbial communities.

    Science.gov (United States)

    Nai, Yi H; Zemb, Oliver; Gutierrez-Zamora, Maria-Luisa; Manefield, Mike; Powell, Shane M; Breadmore, Michael C

    2012-10-01

    Capillary electrophoresis (CE) has been the principle system for nucleic acid analysis since the early 1990s due to its inherent advantages such as fast analysis time, high resolution and efficiency, minimal sample requirement, high detection sensitivity, and automation. In the past few decades, microbial community fingerprinting methods such as terminal restriction fragment length polymorphism and single-stranded conformation polymorphism (SSCP) have migrated to CE to utilize its advantages over conventional slab gel electrophoresis. Recently, a gel-based direct rRNA fingerprint method was demonstrated. Different from other existing microbial community characterization approaches, this novel approach is polymerase chain reaction free and capable of providing information on the relative abundance of rRNA from individual phylotypes in low-diversity samples. As a gel-based method, it has a long analysis time and relatively large reagent and sample requirements. Here, we addressed these limitations by transferring the RNA fingerprint approach to the CE platform. Analysis time significantly improved from 24 h to 60 min, and the use of a fluorescently labeled hybridization probe as the detection strategy decreased the sample requirement by ten-fold. The combination of fast analysis time, low sample requirement, and sensitive fluorescence detection makes CE-RNA-SSCP an appealing new approach for characterizing low-diversity microbial communities.

  18. Role of Electrostatics in the assembly pathway of a single-stranded RNA virus

    NARCIS (Netherlands)

    Garmann, R.F.; Comas-Garcia, M.; Koay, M.S.T.; Cornelissen, Jeroen Johannes Lambertus Maria; Knobler, C.M.; Gelbart, W.M.

    2014-01-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318–3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of

  19. Toxin MqsR Cleaves Single-Stranded mRNA with Various 5 Ends

    Science.gov (United States)

    2016-08-24

    decreases persisence about 2400- fold (Harrison et al. 2009). Another type II TA toxin, MazF, induces growth arrest that results in up to a 700- fold...Life Technologies, Waltham, MA). In brief, 25 pmol of RNA was first treated with 0.1 U of calf intestine alkaline phosphatase (CIP, 0.1 U/μL) for 1...MqsR/MqsA regulate toxin CspD. Environ. Microbiol. 12:1105–1121. Kwan, B. W., J. A. Valenta, M. J. Benedik, and T. K. Wood. 2013. Arrested protein

  20. Characterization of a Novel Megabirnavirus from Sclerotinia sclerotiorum Reveals Horizontal Gene Transfer from Single-Stranded RNA Virus to Double-Stranded RNA Virus.

    Science.gov (United States)

    Wang, Minghong; Wang, Yong; Sun, Xiangzhong; Cheng, Jiasen; Fu, Yanping; Liu, Huiquan; Jiang, Daohong; Ghabrial, Said A; Xie, Jiatao

    2015-08-01

    Mycoviruses have been detected in all major groups of filamentous fungi, and their study represents an important branch of virology. Here, we characterized a novel double-stranded RNA (dsRNA) mycovirus, Sclerotinia sclerotiorum megabirnavirus 1 (SsMBV1), in an apparently hypovirulent strain (SX466) of Sclerotinia sclerotiorum. Two similarly sized dsRNA segments (L1- and L2-dsRNA), the genome of SsMBV1, are packaged in rigid spherical particles purified from strain SX466. The full-length cDNA sequence of L1-dsRNA/SsMBV1 comprises two large open reading frames (ORF1 and ORF2), which encode a putative coat protein and an RNA-dependent RNA polymerase (RdRp), respectively. Phylogenetic analysis of the RdRp domain clearly indicates that SsMBV1 is related to Rosellinia necatrix megabirnavirus 1 (RnMBV1). L2-dsRNA/SsMBV1 comprises two nonoverlapping ORFs (ORFA and ORFB) encoding two hypothetical proteins with unknown functions. The 5'-terminal regions of L1- and L2-dsRNA/SsMBV1 share strictly conserved sequences and form stable stem-loop structures. Although L2-dsRNA/SsMBV1 is dispensable for replication, genome packaging, and pathogenicity of SsMBV1, it enhances transcript accumulation of L1-dsRNA/SsMBV1 and stability of virus-like particles (VLPs). Interestingly, a conserved papain-like protease domain similar to a multifunctional protein (p29) of Cryphonectria hypovirus 1 was detected in the ORFA-encoded protein of L2-dsRNA/SsMBV1. Phylogenetic analysis based on the protease domain suggests that horizontal gene transfer may have occurred from a single-stranded RNA (ssRNA) virus (hypovirus) to a dsRNA virus, SsMBV1. Our results reveal that SsMBV1 has a slight impact on the fundamental biological characteristics of its host regardless of the presence or absence of L2-dsRNA/SsMBV1. Mycoviruses are widespread in all major fungal groups, and they possess diverse genomes of mostly ssRNA and dsRNA and, recently, circular ssDNA. Here, we have characterized a novel dsRNA virus

  1. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples.

    Science.gov (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J

    2006-03-01

    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  2. Activation of 2'-5' oligoadenylate synthetase by single-stranded and double-stranded RNA aptamers

    DEFF Research Database (Denmark)

    Hartmann, R; Norby, P L; Martensen, P M

    1998-01-01

    A number of small RNA molecules that are high affinity ligands for the 46-kDa form of human 2'-5' oligoadenylate synthetase have been identified by the SELEX method. Surface plasmon resonance analysis indicates that these RNAs bind to the enzyme with dissociation constants in the nanomolar range....... Competition experiments indicate that the binding site for the small RNAs on the 2'-5' oligoadenylate synthetase molecule at least partially overlaps that for the synthetic double-stranded RNA, poly(I).poly(C). Several of the RNAs function as potent activators of 2'-5' oligoadenylate synthetase in vitro......-stranded RNA, can also be activated by RNA ligands with little secondary structure. Since 2'-5' oligoadenylate synthetase possesses no homology to other known RNA-binding proteins, the development of small specific ligands by SELEX should facilitate studies of RNA-protein interactions and may reveal novel...

  3. RNA binding to APOBEC3G induces the disassembly of functional deaminase complexes by displacing single-stranded DNA substrates

    Science.gov (United States)

    Polevoda, Bogdan; McDougall, William M.; Tun, Bradley N.; Cheung, Michael; Salter, Jason D.; Friedman, Alan E.; Smith, Harold C.

    2015-01-01

    APOBEC3G (A3G) DNA deaminase activity requires a holoenzyme complex whose assembly on nascent viral reverse transcripts initiates with A3G dimers binding to ssDNA followed by formation of higher-order A3G homo oligomers. Catalytic activity is inhibited when A3G binds to RNA. Our prior studies suggested that RNA inhibited A3G binding to ssDNA. In this report, near equilibrium binding and gel shift analyses showed that A3G assembly and disassembly on ssDNA was an ordered process involving A3G dimers and multimers thereof. Although, fluorescence anisotropy showed that A3G had similar nanomolar affinity for RNA and ssDNA, RNA stochastically dissociated A3G dimers and higher-order oligomers from ssDNA, suggesting a different modality for RNA binding. Mass spectrometry mapping of A3G peptides cross-linked to nucleic acid suggested ssDNA only bound to three peptides, amino acids (aa) 181–194 in the N-terminus and aa 314–320 and 345–374 in the C-terminus that were part of a continuous exposed surface. RNA bound to these peptides and uniquely associated with three additional peptides in the N- terminus, aa 15–29, 41–52 and 83–99, that formed a continuous surface area adjacent to the ssDNA binding surface. The data predict a mechanistic model of RNA inhibition of ssDNA binding to A3G in which competitive and allosteric interactions determine RNA-bound versus ssDNA-bound conformational states. PMID:26424853

  4. Data mining cDNAs reveals three new single stranded RNA viruses in Nasonia (Hymenopetera:Pteromalidae)

    Science.gov (United States)

    Hymenopteran viruses may provide insights into colony collapse disorder in honey bees and other insect species. Three novel small RNA viruses were discovered during the genomics effort for the beneficial parasitoid of flies in the genus Nasonia (Hymenoptera). Genomics provides a great deal of inform...

  5. Cuprolinic Blue: a specific dye for single-stranded RNA in the presence of magnesium chloride. I. Fundamental aspects

    NARCIS (Netherlands)

    Tas, J.; MENDELSON, D.; NOORDEN, C. J. F.

    1983-01-01

    Qualitative and quantitative aspects of the cationic dye Cuprolinic Blue were investigated with model films of polyacrylamide gel in which RNA, DNA and other biological polyanionic compounds had been incorporated. In the presence of 1 M MgCl2, Curpolinic Blue was found to bind specifically to

  6. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.

    1978-01-01

    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  7. Site-specific binding of viral plus single-stranded RNA to replicase-containing open virus-like particles of yeast.

    OpenAIRE

    Esteban, R; Fujimura, T; Wickner, R B

    1988-01-01

    X double-stranded RNA is a deletion mutant of L-A double-stranded RNA and is encapsidated in viral particles by the L-A-encoded major coat protein. X double-stranded RNA has all the cis sites necessary to be transcribed, encapsidated, and replicated. We have cloned X double-stranded RNA and sequenced it. The complete X double-stranded RNA sequence deduced indicates that the first 25 bases of the X plus-strand 5' end originated from the 5' end of the L-A plus strand and that most, if not all, ...

  8. Ro60-associated single-stranded RNA links inflammation with fetal cardiac fibrosis via ligation of TLRs: a novel pathway to autoimmune-associated heart block.

    Science.gov (United States)

    Clancy, Robert M; Alvarez, David; Komissarova, Elena; Barrat, Franck J; Swartz, Jordan; Buyon, Jill P

    2010-02-15

    Activation of TLR by ssRNA after FcgammaR-mediated phagocytosis of immune complexes (IC) may be relevant in autoimmune-associated congenital heart block (CHB) where the obligate factor is a maternal anti-SSA/Ro Ab and the fetal factors, protein/RNA on an apoptotic cardiocyte and infiltrating macrophages. This study addressed the hypothesis that Ro60-associated ssRNAs link macrophage activation to fibrosis via TLR engagement. Both macrophage transfection with noncoding ssRNA that bind Ro60 and an IC generated by incubation of Ro60-ssRNA with an IgG fraction from a CHB mother or affinity purified anti-Ro60 significantly increased TNF-alpha secretion, an effect not observed using control RNAs or normal IgG. Dependence on TLR was supported by the significant inhibition of TNF-alpha release by IRS661 and chloroquine. The requirement for FcgammaRIIIa-mediated delivery was provided by inhibition with an anti-CD16a Ab. Fibrosis markers were noticeably increased in fetal cardiac fibroblasts after incubation with supernatants generated from macrophages transfected with ssRNA or incubated with the IC. Supernatants generated from macrophages with ssRNA in the presence of IRS661 or chloroquine did not cause fibrosis. In a CHB heart, but not a healthy heart, TLR7 immunostaining was localized to a region near the atrioventricular groove at a site enriched in mononuclear cells and fibrosis. These data support a novel injury model in CHB, whereby endogenous ligand, Ro60-associated ssRNA, forges a nexus between TLR ligation and fibrosis instigated by binding of anti-Ro Abs to the target protein likely accessible via apoptosis.

  9. A G-C-rich palindromic structural motif and a stretch of single-stranded purines are required for optimal packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA.

    Science.gov (United States)

    Jaballah, Soumeya Ali; Aktar, Suriya J; Ali, Jahabar; Phillip, Pretty Susan; Al Dhaheri, Noura Salem; Jabeen, Aayesha; Rizvi, Tahir A

    2010-09-03

    During retroviral RNA packaging, two copies of genomic RNA are preferentially packaged into the budding virus particles whereas the spliced viral RNAs and the cellular RNAs are excluded during this process. Specificity towards retroviral RNA packaging is dependent upon sequences at the 5' end of the viral genome, which at times extend into Gag sequences. It has earlier been suggested that the Mason-Pfizer monkey virus (MPMV) contains packaging sequences within the 5' untranslated region (UTR) and Gag. These studies have also suggested that the packaging determinants of MPMV that lie in the UTR are bipartite and are divided into two regions both upstream and downstream of the major splice donor. However, the precise boundaries of these discontinuous regions within the UTR and the role of the intervening sequences between these dipartite sequences towards MPMV packaging have not been investigated. Employing a combination of genetic and structural prediction analyses, we have shown that region "A", immediately downstream of the primer binding site, is composed of 50 nt, whereas region "B" is composed of the last 23 nt of UTR, and the intervening 55 nt between these two discontinuous regions do not contribute towards MPMV RNA packaging. In addition, we have identified a 14-nt G-C-rich palindromic sequence (with 100% autocomplementarity) within region A that has been predicted to fold into a structural motif and is essential for optimal MPMV RNA packaging. Furthermore, we have also identified a stretch of single-stranded purines (ssPurines) within the UTR and 8 nt of these ssPurines are duplicated in region B. The native ssPurines or its repeat in region B when predicted to refold as ssPurines has been shown to be essential for RNA packaging, possibly functioning as a potential nucleocapsid binding site. Findings from this study should enhance our understanding of the steps involved in MPMV replication including RNA encapsidation process. Copyright (c) 2010 Elsevier Ltd

  10. A novel single-stranded RNA virus isolated from a phytopathogenic filamentous fungus, Rosellinia necatrix, with similarity to hypo-like viruses

    Directory of Open Access Journals (Sweden)

    Rui eZhang

    2014-07-01

    Full Text Available Here we report a biological and molecular characterization of a novel positive-sense RNA virus isolated from a field isolate (NW10 of a filamentous phytopathogenic fungus, the white root rot fungus that is designated as Rosellinia necatrix fusarivirus 1 (RnFV1. A recently developed technology using zinc ions allowed us to transfer RnFV1 to two mycelially incompatible Rosellinia necatrix strains. A biological comparison of the virus-free and -recipient isogenic fungal strains suggested that RnFV1 infects latently and thus has no potential as a virocontrol agent. The virus has an undivided positive-sense RNA genome of 6286 nucleotides excluding a poly (A tail. The genome possesses two non-overlapping open reading frames (ORFs: a large ORF1 that encodes polypeptides with RNA replication functions and a smaller ORF2 that encodes polypeptides of unknown function. A lack of coat protein genes was suggested by the failure of virus particles from infected mycelia. No evidence was obtained by Northern analysis or classical 5'-RACE for the presence of subgenomic RNA for the downstream ORF. Sequence similarities were found in amino-acid sequence between RnFV1 putative proteins and counterparts of a previously reported mycovirus, Fusarium graminearum virus 1 (FgV1. Interestingly, several related sequences were detected by BLAST searches of independent transcriptome assembly databases one of which probably represents an entire virus genome. Phylogenetic analysis based on the conserved RNA-dependent RNA polymerase showed that RnFV1, FgV1, and these similar sequences are grouped in a cluster distinct from distantly related hypoviruses. It is proposed that a new taxonomic family termed Fusariviridae be created to include RnFV1and FgV1.

  11. Design and Assessment of a Real Time Reverse Transcription-PCR Method to Genotype Single-Stranded RNA Male-Specific Coliphages (Family Leviviridae).

    Science.gov (United States)

    A real-time, reverse transcription-PCR (RT-qPCR) assay was developed to differentiate the four genogroups of male-specific ssRNA coliphages (FRNA) (family Leviviridae). As FRNA display a trend of source-specificity (human sewage or animal waste) at the genogroup level, this assa...

  12. Isolation and characterization of Nylanderia fulva virus 1, a positive-sense, single-stranded RNA virus infecting the tawny crazy ant, Nylanderia fulva

    Energy Technology Data Exchange (ETDEWEB)

    Valles, Steven M., E-mail: steven.valles@ars.usda.gov [Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, 1600 SW 23rd Drive, Gainesville, FL 32608 (United States); Oi, David H.; Becnel, James J. [Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, 1600 SW 23rd Drive, Gainesville, FL 32608 (United States); Wetterer, James K. [Wilkes Honors College, Florida Atlantic University, 5353 Parkside Drive, Jupiter, FL 33458 (United States); LaPolla, John S. [Department of Biological Sciences, Towson University, 8000 York Road, Towson, MD 21252 (United States); Firth, Andrew E. [Department of Pathology, University of Cambridge, Cambridge CB2 1QP (United Kingdom)

    2016-09-15

    We report the discovery of Nylanderia fulva virus 1 (NfV-1), the first virus identified and characterized from the ant, Nylanderia fulva. The NfV-1 genome (GenBank accession KX024775) is 10,881 nucleotides in length, encoding one large open reading frame (ORF). Helicase, protease, RNA-dependent RNA polymerase, and jelly-roll capsid protein domains were recognized within the polyprotein. Phylogenetic analysis placed NfV-1 in an unclassified clade of viruses. Electron microscopic examination of negatively stained samples revealed particles with icosahedral symmetry with a diameter of 28.7±1.1 nm. The virus was detected by RT-PCR in larval, pupal, worker and queen developmental stages. However, the replicative strand of NfV-1 was only detected in larvae. Vertical transmission did not appear to occur, but horizontal transmission was facile. The inter-colonial field prevalence of NfV-1 was 52±35% with some local infections reaching 100%. NfV-1 was not detected in limited samples of other Nylanderia species or closely related ant species. - Highlights: • A new positive-strand RNA virus was discovered in the ant, Nylanderia fulva. • The Nylanderia fulva virus 1 genome was comprised of 10,881 nucleotides. • NfV-1 was detected in larval, pupal, queen and worker ants, but not eggs. • Replication of NfV-1 appeared to be limited to the larval stage.

  13. Programmable autonomous synthesis of single-stranded DNA

    Science.gov (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

    2018-02-01

    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  14. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  15. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase.

    Science.gov (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias

    2017-06-02

    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  17. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

    2015-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA)...

  18. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    Science.gov (United States)

    Hong, Ka Lok

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  19. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.

    1985-01-01

    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  20. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)

    student

    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  1. Changes in the composition of the RNA virome mark evolutionary transitions in green plants.

    Science.gov (United States)

    Mushegian, Arcady; Shipunov, Alexey; Elena, Santiago F

    2016-08-15

    The known plant viruses mostly infect angiosperm hosts and have RNA or small DNA genomes. The only other lineage of green plants with a relatively well-studied virome, unicellular chlorophyte algae, is mostly infected by viruses with large DNA genomes. Thus RNA viruses and small DNA viruses seem to completely displace large DNA virus genomes in late branching angiosperms. To understand better the expansion of RNA viruses in the taxonomic span between algae and angiosperms, we analyzed the transcriptomes of 66 non-angiosperm plants characterized by the 1000 Plants Genomes Project. We found homologs of virus RNA-dependent RNA polymerases in 28 non-angiosperm plant species, including algae, mosses, liverworts (Marchantiophyta), hornworts (Anthocerotophyta), lycophytes, a horsetail Equisetum, and gymnosperms. Polymerase genes in algae were most closely related to homologs from double-stranded RNA viruses leading latent or persistent lifestyles. Land plants, in addition, contained polymerases close to the homologs from single-stranded RNA viruses of angiosperms, capable of productive infection and systemic spread. For several polymerases, a cognate capsid protein was found in the same library. Another virus hallmark gene family, encoding the 30 K movement proteins, was found in lycophytes and monilophytes but not in mosses or algae. The broadened repertoire of RNA viruses suggests that colonization of land and growth in anatomical complexity in land plants coincided with the acquisition of novel sets of viruses with different strategies of infection and reproduction.

  2. Improved single-strand DNA sizing accuracy in capillary electrophoresis.

    OpenAIRE

    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B

    1997-01-01

    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  3. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela

    2015-01-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  4. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Science.gov (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  5. Bioinformatics Study of Structural Patterns in Plant MicroRNA Precursors.

    Science.gov (United States)

    Miskiewicz, J; Tomczyk, K; Mickiewicz, A; Sarzynska, J; Szachniuk, M

    2017-01-01

    According to the RNA world theory, RNAs which stored genetic information and catalyzed chemical reactions had their contribution in the formation of current living organisms. In recent years, researchers studied this molecule diversity, i.a. focusing on small non-coding regulatory RNAs. Among them, of particular interest is evolutionarily ancient, 19-24 nt molecule of microRNA (miRNA). It has been already recognized as a regulator of gene expression in eukaryotes. In plants, miRNA plays a key role in the response to stress conditions and it participates in the process of growth and development. MicroRNAs originate from primary transcripts (pri-miRNA) encoded in the nuclear genome. They are processed from single-stranded stem-loop RNA precursors containing hairpin structures. While the mechanism of mature miRNA production in animals is better understood, its biogenesis in plants remains less clear. Herein, we present the results of bioinformatics analysis aimed at discovering how plant microRNAs are recognized within their precursors (pre-miRNAs). The study has been focused on sequential and structural motif identification in the neighbourhood of microRNA.

  6. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  7. RNA virus interference via CRISPR/Cas13a system in plants

    KAUST Repository

    Aman, Rashid

    2018-01-04

    CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single-stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants.CRISPR/Cas13a produces interference against green fluorescent protein (GFP)-expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. CRISPR RNA (crRNAs) targeting the HC-Pro and GFP sequences exhibit better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs.Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses and for other RNA manipulations in plants.

  8. Suppressors of RNA silencing encoded by tomato leaf curl ...

    Indian Academy of Sciences (India)

    2013-01-06

    Jan 6, 2013 ... step in the RNA-silencing pathway that occurs after siRNA production (Zrachya et al. 2007). Geminiviruses (family Geminiviridae) are a diverse group of plant viruses with circular single-stranded DNA genomes that are composed of one or two components of 2700–. 3000 bp length which are encapsidated ...

  9. RNA virus interference via CRISPR/Cas13a system in plants

    KAUST Repository

    Aman, Rashid

    2017-11-04

    CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants. CRISPR/Cas13a produced interference against green fluorescent protein (GFP) expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. crRNAs targeting the HC-Pro and GFP sequences exhibited better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs. Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses, and for other RNA manipulations in plants.

  10. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    Science.gov (United States)

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  11. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora.

    Science.gov (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E

    2003-08-01

    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  12. Elastic properties of alternative versus single-stranded leveling archwires.

    Science.gov (United States)

    Rucker, Brian K; Kusy, Robert P

    2002-11-01

    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  13. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.

    1976-02-01

    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  14. RNA editing machinery in plant organelles.

    Science.gov (United States)

    Yan, Junjie; Zhang, Qunxia; Yin, Ping

    2018-02-01

    RNA editing is a type of post-transcriptional modification that includes nucleotide insertion/deletion or conversion. Different categories of RNA editing have been widely observed in distinct RNAs from divergent organisms. In flowering plants, RNA editing usually alters cytidine to uridine in plastids and mitochondria, playing important roles in various plant developmental processes, including organelle biogenesis, adaptation to environmental changes, and signal transduction. Numerous studies have demonstrated that a number of factors are involved in plant RNA editing, such as pentatricopeptide repeat (PPR) proteins, multiple organelle RNA editing factors (MORF, also known as RIP), organelle RNA recognition motif (ORRM) containing proteins, protoporphyrinogen IX oxidase 1 (PPO1) and organelle zinc finger 1 (OZ1). These factors play diverse roles in plant RNA editing due to their distinct characteristics. In this review, we discuss the functional roles of the individual editing factors and their associations in plant RNA editing.

  15. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.

    1984-01-01

    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  16. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes

    Science.gov (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.

    2015-01-01

    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  17. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-05

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity*

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.

    2015-01-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  19. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  20. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela

    2010-01-01

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  1. Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages.

    Science.gov (United States)

    Kodaira, K; Godson, N G; Taketo, A

    1995-01-25

    The minus origins for complementary strand DNA synthesis (-ori) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, phi K, alpha 3, and St-1 closely resemble each other in DNA structure and contain two potential secondary hairpin loops (I and II) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the -ori regions of phi K and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the phi K mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several phi K and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway.

  2. RNA editing in plants and its evolution.

    Science.gov (United States)

    Takenaka, Mizuki; Zehrmann, Anja; Verbitskiy, Daniil; Härtel, Barbara; Brennicke, Axel

    2013-01-01

    RNA editing alters the identity of nucleotides in RNA molecules such that the information for a protein in the mRNA differs from the prediction of the genomic DNA. In chloroplasts and mitochondria of flowering plants, RNA editing changes C nucleotides to U nucleotides; in ferns and mosses, it also changes U to C. The approximately 500 editing sites in mitochondria and 40 editing sites in plastids of flowering plants are individually addressed by specific proteins, genes for which are amplified in plant species with organellar RNA editing. These proteins contain repeat elements that bind to cognate RNA sequence motifs just 5' to the edited nucleotide. In flowering plants, the site-specific proteins interact selectively with individual members of a different, smaller family of proteins. These latter proteins may be connectors between the site-specific proteins and the as yet unknown deaminating enzymatic activity.

  3. Advances in imaging RNA in plants

    DEFF Research Database (Denmark)

    Christensen, Nynne Meyn; Oparka, Karl J.; Tilsner, Jens

    2010-01-01

    targeting allows local protein synthesis and the asymmetric distribution of transcripts during cell polarisation. In plants, intercellular RNA trafficking also plays an additional role in plant development and pathogen defence. Methods that allow the visualisation of RNA sequences within a cellular context...

  4. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2003-01-01

    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  5. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.

    OpenAIRE

    Barany, F; Boeke, J D

    1983-01-01

    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  6. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks.

    Science.gov (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P

    2012-09-01

    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  7. RNA trafficking in parasitic plant systems

    Directory of Open Access Journals (Sweden)

    Megan L LeBlanc

    2012-08-01

    Full Text Available RNA trafficking in plants contributes to local and long-distance coordination of plant development and response to the environment. However, investigations of mobile RNA identity and function are hindered by the inherent difficulty of tracing a given molecule of RNA from its cell of origin to its destination. Several methods have been used to address this problem, but all are limited to some extent by constraints associated with accurately sampling phloem sap or detecting trafficked RNA. Certain parasitic plant species form symplastic connections to their hosts and thereby provide an additional system for studying RNA trafficking. The haustorial connections of Cuscuta and Phelipanche species are similar to graft junctions in that they are able to transmit mRNAs, viral RNAs, siRNAs and proteins from the host plants to the parasite. In contrast to other graft systems, these parasites form connections with host species that span a wide phylogenetic range, such that a high degree of nucleotide sequence divergence may exist between host and parasites and allow confident identification of most host RNAs in the parasite system. The ability to identify host RNAs in parasites, and vice versa, will facilitate genomics approaches to understanding RNA trafficking. This review discusses the nature of host parasite connections and the potential significance of host RNAs for the parasite. Additional research on host-parasite interactions is needed to interpret results of RNA trafficking studies, but parasitic plants may provide a fascinating new perspective on RNA trafficking.

  8. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol

    2013-01-01

    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  9. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms.

    Science.gov (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A

    2012-05-01

    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Messenger RNA 3' end formation in plants.

    Science.gov (United States)

    Hunt, A G

    2008-01-01

    Messenger RNA 3' end formation is an integral step in the process that gives rise to mature, translated messenger RNAs in eukaryotes. With this step, a pre-messenger RNA is processed and polyadenylated, giving rise to a mature mRNA bearing the characteristic poly(A) tract. The poly(A) tract is a fundamental feature of mRNAs, participating in the process of translation initiation and being the focus of control mechanisms that define the lifetime of mRNAs. Thus messenger RNA 3' end formation impacts two steps in mRNA biogenesis and function. Moreover, mRNA 3' end formation is something of a bridge that integrates numerous other steps in mRNA biogenesis and function. While the process is essential for the expression of most genes, it is also one that is subject to various forms of regulation, such that both quantitative and qualitative aspects of gene expression may be modulated via the polyadenylation complex. In this review, the current status of understanding of mRNA 3' end formation in plants is discussed. In particular, the nature of mRNA 3' ends in plants is reviewed, as are recent studies that are beginning to yield insight into the functioning and regulation of plant polyadenylation factor subunits.

  11. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism.

    Science.gov (United States)

    Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong

    2016-07-01

    A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.

  12. RNA interference in plant parasitic nematodes

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-04

    Aug 4, 2008 ... nematodes. RNAi should help identify gene and, hence, protein targets for nematode control strategies. Key words: RNA interference, RNAi, gene expression, plant parasitic nematodes. INTRODUCTION. Plant parasitic nematodes are found as pests of crops throughout the world with many having a severe ...

  13. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi

    1990-01-01

    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  14. Emaravirus: A Novel Genus of Multipartite, Negative Strand RNA Plant Viruses

    Science.gov (United States)

    Mielke-Ehret, Nicole; Mühlbach, Hans-Peter

    2012-01-01

    Ringspot symptoms in European mountain ash (Sorbus aucuparia L.), fig mosaic, rose rosette, raspberry leaf blotch, pigeonpea sterility mosaic (Cajanus cajan) and High Plains disease of maize and wheat were found to be associated with viruses that share several characteristics. They all have single-stranded multipartite RNA genomes of negative orientation. In some cases, double membrane-bound virus-like particles of 80 to 200 nm in diameter were found in infected tissue. Furthermore, at least five of these viruses were shown to be vectored by eriophyid mites. Sequences of European mountain ash ringspot-associated virus (EMARaV), Fig mosaic virus (FMV), rose rosette virus (RRV), raspberry leaf blotch virus (RLBV), pigeonpea sterility mosaic virus and High Plains virus strongly support their potential phylogenetic relationship. Therefore, after characterization of EMARaV, the novel genus Emaravirus was established, and FMV was the second virus species assigned to this genus. The recently sequenced RRV and RLBV are supposed to be additional members of this new group of plant RNA viruses. PMID:23170170

  15. Emaravirus: A Novel Genus of Multipartite, Negative Strand RNA Plant Viruses

    Directory of Open Access Journals (Sweden)

    Hans-Peter Mühlbach

    2012-09-01

    Full Text Available Ringspot symptoms in European mountain ash (Sorbus aucuparia L., fig mosaic, rose rosette, raspberry leaf blotch, pigeonpea sterility mosaic (Cajanus cajan and High Plains disease of maize and wheat were found to be associated with viruses that share several characteristics. They all have single-stranded multipartite RNA genomes of negative orientation. In some cases, double membrane-bound virus-like particles of 80 to 200 nm in diameter were found in infected tissue. Furthermore, at least five of these viruses were shown to be vectored by eriophyid mites. Sequences of European mountain ash ringspot-associated virus (EMARaV, Fig mosaic virus (FMV, rose rosette virus (RRV, raspberry leaf blotch virus (RLBV, pigeonpea sterility mosaic virus and High Plains virus strongly support their potential phylogenetic relationship. Therefore, after characterization of EMARaV, the novel genus Emaravirus was established, and FMV was the second virus species assigned to this genus. The recently sequenced RRV and RLBV are supposed to be additional members of this new group of plant RNA viruses.

  16. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  17. Complex shapes self-assembled from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng

    2012-05-30

    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  18. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  19. Suppression of RNAi by dsRNA-degrading RNaseIII enzymes of viruses in animals and plants.

    Directory of Open Access Journals (Sweden)

    Isabel Weinheimer

    2015-03-01

    Full Text Available Certain RNA and DNA viruses that infect plants, insects, fish or poikilothermic animals encode Class 1 RNaseIII endoribonuclease-like proteins. dsRNA-specific endoribonuclease activity of the RNaseIII of rock bream iridovirus infecting fish and Sweet potato chlorotic stunt crinivirus (SPCSV infecting plants has been shown. Suppression of the host antiviral RNA interference (RNAi pathway has been documented with the RNaseIII of SPCSV and Heliothis virescens ascovirus infecting insects. Suppression of RNAi by the viral RNaseIIIs in non-host organisms of different kingdoms is not known. Here we expressed PPR3, the RNaseIII of Pike-perch iridovirus, in the non-hosts Nicotiana benthamiana (plant and Caenorhabditis elegans (nematode and found that it cleaves double-stranded small interfering RNA (ds-siRNA molecules that are pivotal in the host RNA interference (RNAi pathway and thereby suppresses RNAi in non-host tissues. In N. benthamiana, PPR3 enhanced accumulation of Tobacco rattle tobravirus RNA1 replicon lacking the 16K RNAi suppressor. Furthermore, PPR3 suppressed single-stranded RNA (ssRNA--mediated RNAi and rescued replication of Flock House virus RNA1 replicon lacking the B2 RNAi suppressor in C. elegans. Suppression of RNAi was debilitated with the catalytically compromised mutant PPR3-Ala. However, the RNaseIII (CSR3 produced by SPCSV, which cleaves ds-siRNA and counteracts antiviral RNAi in plants, failed to suppress ssRNA-mediated RNAi in C. elegans. In leaves of N. benthamiana, PPR3 suppressed RNAi induced by ssRNA and dsRNA and reversed silencing; CSR3, however, suppressed only RNAi induced by ssRNA and was unable to reverse silencing. Neither PPR3 nor CSR3 suppressed antisense-mediated RNAi in Drosophila melanogaster. These results show that the RNaseIII enzymes of RNA and DNA viruses suppress RNAi, which requires catalytic activities of RNaseIII. In contrast to other viral silencing suppression proteins, the RNaseIII enzymes are

  20. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.

    1992-01-01

    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  1. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der

    1988-01-01

    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  2. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.

    2002-01-01

    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit...

  3. Ion assisted structural collapse of a single stranded DNA: A molecular dynamics approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Soumadwip; Dixit, Himanshu; Chakrabarti, Rajarshi, E-mail: rajarshi@chem.iitb.ac.in

    2015-09-28

    Highlights: • The dynamics of a single-stranded DNA in presence of different concentrations of Mg{sup 2+} is investigated. • The initial DNA chain collapse is characterized by the formation of non-sequentially stacked base pairs. • The DNA chain re-swells at high concentrations of Mg{sup 2+} as a consequence of overcharging. - Abstract: The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counterions. It is well known that the structural collapse of DNA is favoured in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl{sub 2}) single stranded DNA with base sequence 5′-CGCGAATTCGCG-3′ (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  4. Dynamics of RecA filaments on single-stranded DNA

    NARCIS (Netherlands)

    Van Loenhout, M.T.J.; Van der Heijden, T.; Kanaar, R.; Wyman, C.; Dekker, C.

    2009-01-01

    RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on

  5. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2001-01-01

    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  6. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP

    1996-01-01

    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  7. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  8. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket.

    Science.gov (United States)

    Pham, Hanh T; Bergoin, Max; Tijssen, Peter

    2013-03-14

    The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  9. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket

    OpenAIRE

    Pham, Hanh T.; Bergoin, Max; Tijssen, Peter

    2013-01-01

    International audience; The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  10. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.

    1983-01-01

    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  11. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B

    2006-01-01

    by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  12. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud

    2012-06-01

    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  13. The Adsorption of Short Single-Stranded DNA Oligomers on Mineral Surfaces

    Science.gov (United States)

    Kopstein, M.; Sverjensky, D. A.; Hazen, R. M.; Cleaves, H. J.

    2009-12-01

    Previous studies have described feasible pathways for the synthesis of simple organic building blocks such as formaldehyde and hydrogen cyanide, and their reaction to form more complex biomolecules such as nucleotide bases, amino acids and sugars (Miller and Orgel 1974, Miller and Cleaves 2006). However, the polymerization of monomers into a useful genetic material remains problematic (Orgel 2004). Organic building blocks were unlikely to polymerize from very dilute aqueous solution in the primitive oceans. Mineral surface adsorption has been suggested as a possible mechanism for concentrating the necessary building blocks (Bernal 1951). This study focused on the adsorption behavior of single-stranded DNA homo-oligomers of adenine and thymine (including the monomers, dimers, tetramers, hexamers, octomers, and decamers) with five different mineral surfaces (pyrite, rutile, hematite, olivine and calcite). Adsorption was studied in 0.1 M pH 8.1 KHCO3 with0.05 M NaCl as background electrolyte. Solutions were mixed for 24 hours at room temperature, centrifuged and the supernatants analyzed by UV/visible spectrophotometry. Equilibrium solution concentrations were measured and used to determine the number of moles adsorbed per square meter. Langmuir isotherms were constructed using the experimental data. It was found that adenine-containing molecules tend to bind much more strongly than thymine-containing molecules. It was also found that the number of moles adsorbed at saturation tends to fall with increasing chain length, while adsorption affinity tends to rise. Oligomer length appears to affect adsorption more than the mineral type. These results may have implications for the primordial organization of the first nucleic acid molecules as the persistence of extra-cellular nucleic acids in the environment. References Bernal, J. D. (1951) The Physical Basis of Life (Routledge, London). Miller S.L. and Cleaves, H.J. (2006) Prebiotic chemistry on the primitive Earth. In

  14. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)

    2015-04-22

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  15. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.

    1985-01-01

    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  16. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    Science.gov (United States)

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  17. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.

    1982-01-01

    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  18. Role of RNA interference in plant improvement.

    Science.gov (United States)

    Jagtap, Umesh Balkrishna; Gurav, Ranjit Gajanan; Bapat, Vishwas Anant

    2011-06-01

    Research to alter crops for their better performance involving modern technology is underway in numerous plants, and achievements in transgenic plants are impacting crop improvements in unparalleled ways. Striking progress has been made using genetic engineering technology over the past two decades in manipulating genes from diverse and exotic sources, and inserting them into crop plants for inducing desirable characteristics. RNA interference (RNAi) has recently been identified as a natural mechanism for regulation of gene expression in all higher organisms from plants to humans and promises greater accuracy and precision to plant improvement. The expression of any gene can be down-regulated in a highly explicit manner exclusive of affecting the expression of any other gene by using RNAi technologies. Additional research in this field has been focused on a number of other areas including microRNAs, hairpin RNA, and promoter methylation. Manipulating new RNAi pathways, which generate small RNA molecules to amend gene expression in crops, can produce new quality traits and having better potentiality of protection against abiotic and biotic stresses. Nutritional improvement, change in morphology, or enhanced secondary metabolite synthesis are some of the other advantages of RNAi technology. In addition to its roles in regulating gene expression, RNAi is also used as a natural defense mechanism against molecular parasites such as jumping genes and viral genetic elements that affect genome stability. Even though much advancement has been made on the field of RNAi over the preceding few years, the full prospective of RNAi for crop improvement remains to be fully realized. The intricacy of RNAi pathway, the molecular machineries, and how it relates to plant development are still to be explained.

  19. Role of RNA interference in plant improvement

    Science.gov (United States)

    Jagtap, Umesh Balkrishna; Gurav, Ranjit Gajanan; Bapat, Vishwas Anant

    2011-06-01

    Research to alter crops for their better performance involving modern technology is underway in numerous plants, and achievements in transgenic plants are impacting crop improvements in unparalleled ways. Striking progress has been made using genetic engineering technology over the past two decades in manipulating genes from diverse and exotic sources, and inserting them into crop plants for inducing desirable characteristics. RNA interference (RNAi) has recently been identified as a natural mechanism for regulation of gene expression in all higher organisms from plants to humans and promises greater accuracy and precision to plant improvement. The expression of any gene can be down-regulated in a highly explicit manner exclusive of affecting the expression of any other gene by using RNAi technologies. Additional research in this field has been focused on a number of other areas including microRNAs, hairpin RNA, and promoter methylation. Manipulating new RNAi pathways, which generate small RNA molecules to amend gene expression in crops, can produce new quality traits and having better potentiality of protection against abiotic and biotic stresses. Nutritional improvement, change in morphology, or enhanced secondary metabolite synthesis are some of the other advantages of RNAi technology. In addition to its roles in regulating gene expression, RNAi is also used as a natural defense mechanism against molecular parasites such as jumping genes and viral genetic elements that affect genome stability. Even though much advancement has been made on the field of RNAi over the preceding few years, the full prospective of RNAi for crop improvement remains to be fully realized. The intricacy of RNAi pathway, the molecular machineries, and how it relates to plant development are still to be explained.

  20. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification

    OpenAIRE

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-01-01

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen...

  1. In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides

    International Nuclear Information System (INIS)

    Oppenheim, Amos B.; Rattray, Alison J.; Bubunenko, Mikhail; Thomason, Lynn C.; Court, Donald L.

    2004-01-01

    We demonstrate that the bacteriophage λ Red functions efficiently recombine linear DNA or single-strand oligonucleotides (ss-oligos) into bacteriophage λ to create specific changes in the viral genome. Point mutations, deletions, and gene replacements have been created. While recombineering with oligonucleotides, we encountered other mutations accompanying the desired point mutational change. DNA sequence analysis suggests that these unwanted mutations are mainly frameshift deletions introduced during oligonucleotide synthesis

  2. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis.

    Science.gov (United States)

    Olszewski, Marcin; Mickiewicz, Małgorzata; Kur, Józef

    2008-07-01

    The thermophilic bacterium Thermoanaerobacter tengcongensis has two single-stranded DNA-binding (SSB) proteins, designated TteSSB2 and TteSSB3. In a SSB complementation assay in Escherichia coli, only TteSSB3 took over the in vivo function of EcoSSB. We have cloned the ssb genes obtained by PCR and have developed E. coli overexpression systems. The TteSSB2 and TteSSB3 consist of 153 and 150 amino acids with a calculated molecular mass of 17.29 and 16.96 kDa, respectively. They are the smallest known bacterial SSB proteins. The homology between amino acid sequences of these proteins is 40% identity and 53% similarity. They are functional as homotetramers, with each monomer encoding one single-stranded DNA binding domain (OB-fold). In fluorescence titrations with poly(dT), both proteins bind single-stranded DNA with a binding site size of about 40 nt per homotetramer. Thermostability with half-life of about 30 s at 95 degrees C makes TteSSB3 similar to the known SSB of Thermus aquaticus (TaqSSB). The TteSSB2 was fully active even after 6 h incubation at 100 degrees C. Here, we show for the first time paralogous thermostable homotetrameric SSBs, which could be an attractive alternative for known homodimeric thermostable SSB proteins in their applications for molecular biology methods and analytical purposes.

  3. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana.

    Science.gov (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L

    2005-04-01

    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  4. Intercalation of single-strand oligonucleotides between nucleolipid anionic membranes: a neutron diffraction study.

    Science.gov (United States)

    Milani, Silvia; Berti, Debora; Dante, Silvia; Hauss, Thomas; Baglioni, Piero

    2009-04-07

    This contribution presents a neutron diffraction investigation of anionic lamellar phases composed of mixtures of 1-palmitoyl, 2-oleoyl phosphatidyl-nucleosides (POPN, where N is either adenosine or uridine), and POPC (1-palmitoyl,2-oleoyl-phosphatidyl-choline). Their behavior is studied for two different mole ratios and in the presence of nucleic acids. The samples are formed by the evaporation of liposomal dispersions prepared in water or in solutions containing single-strand oligonucleotides. Previous small angle X-ray scattering (SAXS) experiments on the system POPA/polyU (polyuridylic acid, high degree of polymerization, synthetic ribonucleic acid) proved that the insertion and ordering of the biopolymer in the phospholipid lamellae were driven by molecular recognition. In the present study, we extend the previous investigation to single-strand monodisperse oligonucleotides (50-mers). Structural details of the membranes were obtained from the analysis of the neutron diffraction scattering length density profiles. The evidence of direct and specific interactions, driven by molecular recognition between the nucleic polar heads of the nucleolipid and the single-strand nucleic acid, is strengthened by the comparison with identically charged bilayers formed by POPG/POPC. These results contribute to the understanding of the parameters governing the interactions between nucleolipid membranes and oligonucleotides, providing a novel strategy for the design of lipid-based vehicles for nucleic acids.

  5. Stretching and controlled motion of single-stranded DNA in locally heated solid-state nanopores.

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B; Aksimentiev, Aleksei

    2013-08-27

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4-8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA.

  6. Characterization of Botrytis cinerea negative-stranded RNA virus 1, a new mycovirus related to plant viruses, and a reconstruction of host pattern evolution in negative-sense ssRNA viruses.

    Science.gov (United States)

    Donaire, Livia; Pagán, Israel; Ayllón, María A

    2016-12-01

    The molecular characterization of a novel negative single-stranded RNA virus infecting the plant pathogenic fungus Botrytis cinerea is reported here. Comparison of the sequence of Botrytis cinerea negative-stranded RNA virus 1 (BcNSRV-1) showed a strong identity with RNA dependent RNA polymerases (RdRps) of plant pathogenic emaraviruses and tospoviruses. We have also found all the molecular signatures present in the RdRp of the genus Emaravirus and in other genera of family Bunyaviridae: the conserved TPD triplet and RY dinucleotide, the three basic residues in premotif A and the conserved motifs A, B, C, D, and E. Our results showed that BcNSRV-1 is phylogenetically close to members of the genus Emaravirus and of the family Bunyaviridae, and an ancestral state reconstruction using the conserved RdRp motifs of type members of each family of (-)ssRNA viruses indicated that BcNSRV-1 could possibly derive from an invertebrate and vertebrate-infecting virus. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Repair of ultraviolet light damage in Saccharomyces cerevisiae as studied with double- and single-stranded incoming DNAs

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, D.; Hieda, K.

    1992-01-01

    Purified double- and single-stranded DNAs of the autonomously replicating vector M13RK9-T were irradiated with ultraviolet light (UV) in vitro and introduced into competent whole cells of Saccharomyces cerevisiae. Incoming double-stranded DNA was more sensitive to UV in excision repair-deficient rad2-1 cells than in proficient repair RAD + cells, while single-stranded DNA exhibited high sensitivity in both host cells. The results indicate that in yeast there is no effective rescue of UV-incoming single-stranded DNA by excision repair or other constitutive dark repair processes

  8. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks.

    Science.gov (United States)

    Pachkowski, Brian; Nakamura, Jun

    2013-01-01

    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  9. Plant organellar DNA primase-helicase synthesizes RNA primers for organellar DNA polymerases using a unique recognition sequence.

    Science.gov (United States)

    Peralta-Castro, Antolín; Baruch-Torres, Noe; Brieba, Luis G

    2017-10-13

    DNA primases recognize single-stranded DNA (ssDNA) sequences to synthesize RNA primers during lagging-strand replication. Arabidopsis thaliana encodes an ortholog of the DNA primase-helicase from bacteriophage T7, dubbed AtTwinkle, that localizes in chloroplasts and mitochondria. Herein, we report that AtTwinkle synthesizes RNA primers from a 5'-(G/C)GGA-3' template sequence. Within this sequence, the underlined nucleotides are cryptic, meaning that they are essential for template recognition but are not instructional during RNA synthesis. Thus, in contrast to all primases characterized to date, the sequence recognized by AtTwinkle requires two nucleotides (5'-GA-3') as a cryptic element. The divergent zinc finger binding domain (ZBD) of the primase module of AtTwinkle may be responsible for template sequence recognition. During oligoribonucleotide synthesis, AtTwinkle shows a strong preference for rCTP as its initial ribonucleotide and a moderate preference for rGMP or rCMP incorporation during elongation. RNA products synthetized by AtTwinkle are efficiently used as primers for plant organellar DNA polymerases. In sum, our data strongly suggest that AtTwinkle primes organellar DNA polymerases during lagging strand synthesis in plant mitochondria and chloroplast following a primase-mediated mechanism. This mechanism contrasts to lagging-strand DNA replication in metazoan mitochondria, in which transcripts synthesized by mitochondrial RNA polymerase prime mitochondrial DNA polymerase γ. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. RNA regulatory elements and polyadenylation in plants

    Directory of Open Access Journals (Sweden)

    Arthur G. Hunt

    2012-01-01

    Full Text Available Alternative poly(A site choice (also known as alternative polyadenylation, or APA has the potential to affect gene expression in qualitative and quantitative ways. Alternative polyadenylation may affect as many as 82% of all expressed genes in a plant. The consequences of APA include the generation of transcripts with differing 3’-UTRs (and thus differing potential regulatory potential and of transcripts with differing protein-coding potential. Genome-wide studies of possible APA suggest a linkage with pre-mRNA splicing, and indicate a coincidence of and perhaps cooperation between RNA regulatory elements that affect splicing efficiency and the recognition of novel intronic poly(A sites. These studies also raise the possibility of the existence of a novel class of polyadenylation-related cis elements that are distinct from the well-characterized plant polyadenylation signal. Many potential APA events, however, have not been associated with identifiable cis elements. The present state of the field reveals a broad scope of APA, and also numerous opportunities for research into mechanisms that govern both choice and regulation of poly(A sites in plants.

  11. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.

    1980-01-01

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  12. Viral counterdefense on RNA silencing : analysis of RNA silencing suppressors from arthropod-borne negative strand RNA plant viruses

    NARCIS (Netherlands)

    Schnettler, E.

    2010-01-01

    This thesis describes that RNA silencing suppressor (RSS) proteins encoded by negative-stranded RNA plant viruses are able to interfere with different RNA silencing pathways in a variety of organisms by interacting with double stranded (ds)RNA molecules. These RSS proteins are able to counteract the

  13. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted

    2014-01-01

    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  14. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams

    2014-01-01

    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  15. EFFECTOR OF TRANSCRIPTION2 is involved in xylem differentiation and includes a functional DNA single strand cutting domain.

    Science.gov (United States)

    Ivanov, Rumen; Tiedemann, Jens; Czihal, Andreas; Schallau, Anna; Diep, Le Hong; Mock, Hans-Peter; Claus, Bernhard; Tewes, Annegret; Bäumlein, Helmut

    2008-01-01

    EFFECTORS OF TRANSCRIPTION2 (ET) are plant-specific regulatory proteins characterized by the presence of two to five C-terminal DNA- and Zn-binding repeats, and a highly conserved cysteine pattern. We describe the structural characterization of the three member Arabidopsis thaliana ET gene family and reveal some allelic sequence polymorphisms. A mutation analysis showed that AtET2 affects the expression of various KNAT genes involved in the maintenance of the undifferentiated state of cambial meristem cells. It also plays a role in the regulation of GA5 (gibberellin 3-beta-dioxygenase) and the cell-cycle-related GASA4. A correlation was established between AtET2 expression and the cellular differentiation state. AtET-GFP fusion proteins shuttle between the cytoplasm and nucleus, with the AtET2 product prevented from entering the nucleus in non-differentiating cells. Within the nucleus, AtET2 probably acts via a single strand cutting domain. A more general regulatory role for ET factors is proposed, governing cell differentiation in cambial meristems, a crucial process for the development of plant vascular tissues.

  16. Endogenous Small RNA Clusters in Plants

    Directory of Open Access Journals (Sweden)

    Yong-Xin Liu

    2014-04-01

    Full Text Available In plants, small RNAs (sRNAs usually refer to non-coding RNAs (ncRNAs with lengths of 20–24 nucleotides. sRNAs are involved in the regulation of many essential processes related to plant development and environmental responses. sRNAs in plants are mainly grouped into microRNAs (miRNAs and small interfering RNAs (siRNAs, and the latter can be further classified into trans-acting siRNAs (ta-siRNAs, repeat-associated siRNAs (ra-siRNAs, natural anti-sense siRNAs (nat-siRNAs, etc. Many sRNAs exhibit a clustered distribution pattern in the genome. Here, we summarize the features and functions of cluster-distributed sRNAs, aimed to not only provide a thorough picture of sRNA clusters (SRCs in plants, but also shed light on the identification of new classes of functional sRNAs.

  17. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng

    2015-05-08

    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  18. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    Science.gov (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification.

    Science.gov (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-10-07

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  20. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast.

    Science.gov (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A

    2010-08-05

    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  1. Efficient Detection of Long dsRNA in Vitro and in Vivo Using the dsRNA Binding Domain from FHV B2 Protein

    Directory of Open Access Journals (Sweden)

    Baptiste Monsion

    2018-02-01

    Full Text Available Double-stranded RNA (dsRNA plays essential functions in many biological processes, including the activation of innate immune responses and RNA interference. dsRNA also represents the genetic entity of some viruses and is a hallmark of infections by positive-sense single-stranded RNA viruses. Methods for detecting dsRNA rely essentially on immunological approaches and their use is often limited to in vitro applications, although recent developments have allowed the visualization of dsRNA in vivo. Here, we report the sensitive and rapid detection of long dsRNA both in vitro and in vivo using the dsRNA binding domain of the B2 protein from Flock house virus. In vitro, we adapted the system for the detection of dsRNA either enzymatically by northwestern blotting or by direct fluorescence labeling on fixed samples. In vivo, we produced stable transgenic Nicotiana benthamiana lines allowing the visualization of dsRNA by fluorescence microscopy. Using these techniques, we were able to discriminate healthy and positive-sense single-stranded RNA virus-infected material in plants and insect cells. In N. benthamiana, our system proved to be very potent for the spatio-temporal visualization of replicative RNA intermediates of a broad range of positive-sense RNA viruses, including high- vs. low-copy number viruses.

  2. Empirical model for matching spectrophotometric reflectance of yarn windings and multispectral imaging reflectance of single strands of yarns.

    Science.gov (United States)

    Luo, Lin; Shen, Hui-Liang; Shao, Si-Jie; Xin, John

    2015-08-01

    The state-of-the-art multispectral imaging system can directly acquire the reflectance of a single strand of yarn that is impossible for traditional spectrophotometers. Instead, the spectrophotometric reflectance of a yarn winding, which is constituted by yarns wound on a background card, is regarded as the yarn reflectance in textile. While multispectral imaging systems and spectrophotometers can be separately used to acquire the reflectance of a single strand of yarn and corresponding yarn winding, the quantitative relationship between them is not yet known. In this paper, the relationship is established based on models that describe the spectral response of a spectrophotometer to a yarn winding and that of a multispectral imaging system to a single strand of yarn. The reflectance matching function from a single strand of yarn to corresponding yarn winding is derived to be a second degree polynomial function, which coefficients are the solutions of a constrained nonlinear optimization problem. Experiments on 100 pairs of samples show that the proposed approach can reduce the color difference between yarn windings and single strands of yarns from 2.449 to 1.082 CIEDE2000 units. The coefficients of the optimal reflection matching function imply that the reflectance of a yarn winding measured by a spectrophotometer consists of not only the intrinsic reflectance of yarn but also the nonignorable interreflection component between yarns.

  3. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  4. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan

    2015-01-01

    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  5. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik

    1992-04-01

    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  6. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.

    1987-01-01

    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  7. Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Gust, I.D.; Feinstone, S.M.; Purcell, R.H.; Alter, H.J.

    1980-01-01

    A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

  8. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata).

    Science.gov (United States)

    Jackson, Elliot W; Bistolas, Kalia S I; Button, Jason B; Hewson, Ian

    2016-01-01

    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates.

  9. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.

    1980-01-01

    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  10. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux

    2016-12-01

    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  11. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  12. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA.

    Science.gov (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee

    2011-03-24

    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  13. Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1

    DEFF Research Database (Denmark)

    Yang, Jay; Bachrati, Csanad Z; Ou, Jiongwen

    2010-01-01

    -passage mechanism. We generated single-stranded catenanes that resemble the proposed dissolution intermediate recognized by human topoisomerase IIIalpha. We demonstrate that human topoisomerase IIIalpha is a single-stranded DNA decatenase that is specifically stimulated by the BLM-RMI1 pair. In addition, RMI1......Human topoisomerase IIIalpha is a type IA DNA topoisomerase that functions with BLM and RMI1 to resolve DNA replication and recombination intermediates. BLM, human topoisomerase IIIalpha, and RMI1 catalyze the dissolution of double Holliday junctions into noncrossover products via a strand...

  14. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.

    1988-01-01

    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  15. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.

    2012-01-01

    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  16. Nuclear pre-mRNA processing in plants

    Energy Technology Data Exchange (ETDEWEB)

    Reddy, A.S.N. [Colorado State Univ., Fort Collins, CO (United States). Dept. of Biology and Program in Molecular Plant Biology; Golovkin, M. (eds.) [Thomas Jefferson Univ., Philadelphia, PA (United States). Dept. of Microbiology

    2008-07-01

    This volume of CTMI, entitled Nuclear premRNA Processing in Plants, with 16 chapters from leading scientists in this area, summarizes recent advances in nuclear pre-mRNA processing and its role in plant growth and development. It provides researchers in the field, as well as those in related areas, with an up-to-date and comprehensive, yet concise, overview of the current status and future potential of this research in understanding plant biology. The first four chapters focus on spliceosome composition, genome-wide alternative splicing, and splice site requirements for U1 and U12 introns using computational and empirical approaches. Analysis of sequenced plant genomes has revealed that 80% of all protein-coding nuclear genes contain one or more introns. The lack of an in vitro plant splicing system has made it difficult to identify general and plant-specific components of splicing machinery in plants. The next three chapters focus on serine/arginine-rich (SR) proteins, a family of highly conserved proteins, which are known to play key roles in constitutive and regulated splicing of pre-mRNA and other aspects of RNA metabolism in metazoans. These proteins engage both in RNA binding and protein.protein interactions and function as splicing regulators at multiple stages of spliceosome assembly. This family of proteins has expanded considerably in plants with several plant-specific SR proteins. Several serendipitous discoveries made using forward genetics are indicating that RNA metabolism (alternative splicing, alternative polyadenylation, mRNA transport) plays an important role in many aspects of plant growth and development and in plant responses to biotic and abiotic stresses. The next seven chapters focus on these aspects of RNA metabolism. The plant hormone abscisic acid (ABA) regulates a number of physiological processes during plant growth and development. The next chapter or A.B. Rose discusses the ways introns affect gene expression both positively and

  17. Phosphatidic acid produced by phospholipase D promotes RNA replication of a plant RNA virus.

    Directory of Open Access Journals (Sweden)

    Kiwamu Hyodo

    2015-05-01

    Full Text Available Eukaryotic positive-strand RNA [(+RNA] viruses are intracellular obligate parasites replicate using the membrane-bound replicase complexes that contain multiple viral and host components. To replicate, (+RNA viruses exploit host resources and modify host metabolism and membrane organization. Phospholipase D (PLD is a phosphatidylcholine- and phosphatidylethanolamine-hydrolyzing enzyme that catalyzes the production of phosphatidic acid (PA, a lipid second messenger that modulates diverse intracellular signaling in various organisms. PA is normally present in small amounts (less than 1% of total phospholipids, but rapidly and transiently accumulates in lipid bilayers in response to different environmental cues such as biotic and abiotic stresses in plants. However, the precise functions of PLD and PA remain unknown. Here, we report the roles of PLD and PA in genomic RNA replication of a plant (+RNA virus, Red clover necrotic mosaic virus (RCNMV. We found that RCNMV RNA replication complexes formed in Nicotiana benthamiana contained PLDα and PLDβ. Gene-silencing and pharmacological inhibition approaches showed that PLDs and PLDs-derived PA are required for viral RNA replication. Consistent with this, exogenous application of PA enhanced viral RNA replication in plant cells and plant-derived cell-free extracts. We also found that a viral auxiliary replication protein bound to PA in vitro, and that the amount of PA increased in RCNMV-infected plant leaves. Together, our findings suggest that RCNMV hijacks host PA-producing enzymes to replicate.

  18. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos

    2015-09-01

    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  19. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair

    Science.gov (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.

    2009-01-01

    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  20. Substrate-assisted 2D DNA lattices and algorithmic lattices from single-stranded tiles.

    Science.gov (United States)

    Kim, Junghoon; Ha, Tai Hwan; Park, Sung Ha

    2015-08-07

    We present a simple route to circumvent kinetic traps which affect many types of DNA nanostructures in their self-assembly process. Using this method, a new 2D DNA lattice made up of short, single-stranded tile (SST) motifs was created. Previously, the growth of SST DNA assemblies was restricted to 1D (tubes and ribbons) or finite-sized 2D (molecular canvases). By utilizing the substrate-assisted growth method, sets of SSTs were designed as unit cells to self-assemble into periodic and aperiodic 2D lattices which continuously grow both along and orthogonal to the helical axis. Notably, large-scale (∼1 μm(2)) fully periodic 2D lattices were fabricated using a minimum of just 2 strand species. Furthermore, the ability to create 2D lattices from a few motifs enables certain rules to be encoded into these SSTs to carry out algorithmic self-assembly. A set of these motifs was designed to execute simple 1-input 1-output COPY and NOT algorithms, the space-time manifestations which were aperiodic 2D algorithmic SST lattices. The methodology presented here can be straightforwardly applied to other motifs which fall into this type of kinetic trap to create novel DNA crystals.

  1. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.

    2007-01-01

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  2. Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems.

    Science.gov (United States)

    Musumeci, Domenica; Rozza, Lucia; Merlino, Antonello; Paduano, Luigi; Marzo, Tiziano; Massai, Lara; Messori, Luigi; Montesarchio, Daniela

    2015-08-21

    The interaction of the anticancer Ru(iii) complex AziRu - in comparison with its analogue NAMI-A, currently in advanced clinical trials as an antimetastatic agent - with DNA model systems, both single stranded and duplex oligonucleotides, was investigated using a combined approach, including absorption UV-vis spectroscopy, circular dichroism (CD) and electrospray mass spectrometry (ESI-MS) techniques. UV-vis absorption spectra of the Ru complexes were recorded at different times in a pseudo-physiological solution, to monitor the ligand exchange processes in the absence and in the presence of the examined oligonucleotides. CD experiments provided information on the overall conformational changes of the DNA model systems induced by these metal complexes. UV- and CD-monitored thermal denaturation studies were performed to analyse the effects of AziRu and NAMI-A on the stability of the duplex structures. ESI-MS experiments, carried out on the oligonucleotide/metal complex mixtures under investigation, allowed us to detect the formation of stable adducts between the guanine-containing oligomers and the ruthenium complexes. These data unambiguously demonstrate that both AziRu and NAMI-A can interact with the DNA model systems. Although very similar in their structures, the two metal compounds manifest a markedly different reactivity with the examined sequences, respectively, with either a naked Ru(3+) ion or a Ru(Im)(3+) (Im = imidazole) fragment being incorporated into the oligonucleotide structure via stable linkages.

  3. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop.

    Science.gov (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S

    2009-05-01

    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  4. Biophysical characterization of the association of histones with single-stranded DNA.

    Science.gov (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier

    2017-11-01

    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong

    2008-01-01

    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  6. Effect of Conformational Entropy on the Nanomechanics of Microcantilever-Based Single-Stranded DNA Sensors

    Directory of Open Access Journals (Sweden)

    Zou-Qing Tan

    2014-09-01

    Full Text Available An entropy-controlled bending mechanism is presented to study the nanomechanics of microcantilever-based single-stranded DNA (ssDNA sensors. First; the conformational free energy of the ssDNA layer is given with an improved scaling theory of thermal blobs considering the curvature effect; and the mechanical energy of the non-biological layer is described by Zhang’s two-variable method for laminated beams. Then; an analytical model for static deflections of ssDNA microcantilevers is formulated by the principle of minimum energy. The comparisons of deflections predicted by the proposed model; Utz–Begley’s model and Hagan’s model are also examined. Numerical results show that the conformational entropy effect on microcantilever deflections cannot be ignored; especially at the conditions of high packing density or long chain systems; and the variation of deflection predicted by the proposed analytical model not only accords with that observed in the related experiments qualitatively; but also appears quantitatively closer to the experimental values than that by the preexisting models. In order to improve the sensitivity of static-mode biosensors; it should be as small as possible to reduce the substrate stiffness.

  7. In vitro selection and characterization of single stranded DNA aptamers for luteolin: A possible recognition tool.

    Science.gov (United States)

    Tuma Sabah, Jinan; Zulkifli, Razauden Mohamed; Shahir, Shafinaz; Ahmed, Farediah; Abdul Kadir, Mohammed Rafiq; Zakaria, Zarita

    2018-03-06

    Distinctive bioactivities possessed by luteolin (3', 4', 5, 7-tetrahydroxy-flavone) are advantageous for sundry practical applications. This paper reports the in vitro selection and characterization of single stranded-DNA (ssDNA) aptamers, specific for luteolin (LUT). 76-mer library containing 1015 randomized ssDNA were screened via systematic evolution of ligands by exponential enrichment (SELEX). The recovered ssDNA pool from the 8th round was amplified with unlabeled primers and cloned into PSTBlue-1 vector prior to sequencing. 22 of LUT-binding aptamer variants were further classified into one of the seven groups based on their N40 random sequence regions, wherein one representative from each group was characterized. The dissociation constant of aptamers designated as LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively with high binding affinity towards LUT. Prediction analysis of the secondary structure suggested discrete features with typical loop and stem motifs. Furthermore, LUT#3 displayed higher specificity with insignificant binding toward kaempferol and quercetin despite its structural and functional similarity compared to LUT#28 and LUT#20. Further LUT#3 can detect free luteolin within 0.2-1 mM in solution. It was suggested that LUT#3 aptamer were the most suitable for LUT recognition tool at laboratory scale based on the condition tested. Copyright © 2018. Published by Elsevier Inc.

  8. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska

    2017-12-01

    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  9. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.

    1985-01-01

    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  10. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  11. psRNATarget: a plant small RNA target analysis server.

    Science.gov (United States)

    Dai, Xinbin; Zhao, Patrick Xuechun

    2011-07-01

    Plant endogenous non-coding short small RNAs (20-24 nt), including microRNAs (miRNAs) and a subset of small interfering RNAs (ta-siRNAs), play important role in gene expression regulatory networks (GRNs). For example, many transcription factors and development-related genes have been reported as targets of these regulatory small RNAs. Although a number of miRNA target prediction algorithms and programs have been developed, most of them were designed for animal miRNAs which are significantly different from plant miRNAs in the target recognition process. These differences demand the development of separate plant miRNA (and ta-siRNA) target analysis tool(s). We present psRNATarget, a plant small RNA target analysis server, which features two important analysis functions: (i) reverse complementary matching between small RNA and target transcript using a proven scoring schema, and (ii) target-site accessibility evaluation by calculating unpaired energy (UPE) required to 'open' secondary structure around small RNA's target site on mRNA. The psRNATarget incorporates recent discoveries in plant miRNA target recognition, e.g. it distinguishes translational and post-transcriptional inhibition, and it reports the number of small RNA/target site pairs that may affect small RNA binding activity to target transcript. The psRNATarget server is designed for high-throughput analysis of next-generation data with an efficient distributed computing back-end pipeline that runs on a Linux cluster. The server front-end integrates three simplified user-friendly interfaces to accept user-submitted or preloaded small RNAs and transcript sequences; and outputs a comprehensive list of small RNA/target pairs along with the online tools for batch downloading, key word searching and results sorting. The psRNATarget server is freely available at http://plantgrn.noble.org/psRNATarget/.

  12. Catalyzing plant science research with RNA-seq

    Science.gov (United States)

    Next generation DNA sequencing technologies are driving increasingly rapid, affordable and high resolution analyses of plant transcriptomes through sequencing of the associated cDNA populations; an analytical platform commonly referred to as RNA-sequencing (RNA-seq). Since its first adoption only a ...

  13. Antiviral RNA silencing viral counter defense in plants

    NARCIS (Netherlands)

    Bucher, E.C.

    2006-01-01

    The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing

  14. Techniques for RNA in vivo imaging in plants.

    Science.gov (United States)

    Tilsner, Jens

    2015-04-01

    Since the discovery of small RNAs and RNA silencing, RNA biology has taken a centre stage in cell and developmental biology. Small RNAs, but also mRNAs and other types of cellular and viral RNAs are processed at specific subcellular localizations. To fully understand cellular RNA metabolism and the various processes influenced by it, techniques are required that permit the sequence-specific tracking of RNAs in living cells. A variety of methods for RNA visualization have been developed since the 1990s, but plant cells pose particular challenges and not all approaches are applicable to them. On the other hand, plant RNA metabolism is particularly diverse and RNAs are even transported between cells, so RNA imaging can potentially provide many valuable insights into plant function at the cellular and tissue level. This Short Review briefly introduces the currently available techniques for plant RNA in vivo imaging and discusses their suitability for different biological questions. © 2014 The Authors Journal of Microscopy © 2014 Royal Microscopical Society.

  15. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy

    2008-01-01

    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  16. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray.

    Science.gov (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino

    2008-08-25

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  17. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Science.gov (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino

    2008-01-01

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  18. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system.

    Science.gov (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus

    2011-04-06

    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  19. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.

    1995-01-01

    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  20. Distinct circular single-stranded DNA viruses exist in different soil types.

    Science.gov (United States)

    Reavy, Brian; Swanson, Maud M; Cock, Peter J A; Dawson, Lorna; Freitag, Thomas E; Singh, Brajesh K; Torrance, Lesley; Mushegian, Arcady R; Taliansky, Michael

    2015-06-15

    The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  1. A high throughput system for the preparation of single stranded templates grown in microculture.

    Science.gov (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M

    1994-01-01

    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  2. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)

    1994-09-01

    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  3. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  4. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

    Science.gov (United States)

    Richardson, Tomas T; Harran, Omar; Murray, Heath

    2016-06-16

    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

  5. PmiRKB: a plant microRNA knowledge base.

    Science.gov (United States)

    Meng, Yijun; Gou, Lingfeng; Chen, Dijun; Mao, Chuanzao; Jin, Yongfeng; Wu, Ping; Chen, Ming

    2011-01-01

    MicroRNAs (miRNAs), one type of small RNAs (sRNAs) in plants, play an essential role in gene regulation. Several miRNA databases were established; however, successively generated new datasets need to be collected, organized and analyzed. To this end, we have constructed a plant miRNA knowledge base (PmiRKB) that provides four major functional modules. In the 'SNP' module, single nucleotide polymorphism (SNP) data of seven Arabidopsis (Arabidopsis thaliana) accessions and 21 rice (Oryza sativa) subspecies were collected to inspect the SNPs within pre-miRNAs (precursor microRNAs) and miRNA-target RNA duplexes. Depending on their locations, SNPs can affect the secondary structures of pre-miRNAs, or interactions between miRNAs and their targets. A second module, 'Pri-miR', can be used to investigate the tissue-specific, transcriptional contexts of pre- and pri-miRNAs (primary microRNAs), based on massively parallel signature sequencing data. The third module, 'MiR-Tar', was designed to validate thousands of miRNA-target pairs by using parallel analysis of RNA end (PARE) data. Correspondingly, the fourth module, 'Self-reg', also used PARE data to investigate the metabolism of miRNA precursors, including precursor processing and miRNA- or miRNA*-mediated self-regulation effects on their host precursors. PmiRKB can be freely accessed at http://bis.zju.edu.cn/pmirkb/.

  6. Electrical conduction and photoresponses of gamma-ray-irradiated single-stranded DNA/single-walled carbon nanotube composite systems

    Energy Technology Data Exchange (ETDEWEB)

    Hong, W.; Lee, E.M.; Kim, D.W.; Lee, Cheol Eui, E-mail: rscel@korea.ac.kr

    2015-04-15

    Highlights: •Effects of gamma-ray irradiation on single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. •Barrier for thermally activated conduction in the composite systems modified by the gamma-ray irradiation. •Photoresponses reveal photoexcitation and oxygen photodesorption modified by gamma-ray irradiation. -- Abstract: Effects of gamma-ray irradiation on the electrical conductivity and photoresponse have been studied for single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. The temperature-dependent electrical conductivity of the ssDNA/SWNT composite films, well described by a fluctuation-induced tunneling model, indicated modification of the barrier for thermally activated conduction by the gamma-ray irradiation. Besides, the photoresponse measurements indicated modified photoexcited charge carrier generation and oxygen photodesorption in the composite systems due to the gamma-ray irradiation.

  7. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.

    2006-01-01

    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  8. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    Science.gov (United States)

    2014-09-30

    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  9. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.

    2013-01-01

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  10. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.

    1977-01-01

    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  11. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong

    2011-04-01

    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  12. Recent patents in RNA silencing in plants: constructs, methods and applications in plant biotechnology.

    Science.gov (United States)

    López-Gomollón, Sara; Dalmay, Tamas

    2010-11-01

    RNA silencing is a recently discovered mechanism to regulate gene expression at transcriptional and posttranscriptional levels. It is based on the recognition and methylation of target genes or cleavage of target mRNAs by small RNA molecules, with length varying from 21 to 24 nucleotides. RNA silencing plays an important role modulating most of the important cell processes, such as growth, development or stress response. During the past few years, diverse strategies have been applied to exploit RNA silencing as a tool to create plants with enhanced economical properties or able to cope with pathogens or abiotic stress. This review describes the most important patents related to RNA silencing in plants, which disclose vectors designed to induce RNA silencing by hairpin RNAs, amplicons or virus-based plasmids, methods for detection and quantification of silencing as well as general uses in plant biotechnology.

  13. MicroRNA-based biotechnology for plant improvement.

    Science.gov (United States)

    Zhang, Baohong; Wang, Qinglian

    2015-01-01

    MicroRNAs (miRNAs) are an extensive class of newly discovered endogenous small RNAs, which negatively regulate gene expression at the post-transcription levels. As the application of next-generation deep sequencing and advanced bioinformatics, the miRNA-related study has been expended to non-model plant species and the number of identified miRNAs has dramatically increased in the past years. miRNAs play a critical role in almost all biological and metabolic processes, and provide a unique strategy for plant improvement. Here, we first briefly review the discovery, history, and biogenesis of miRNAs, then focus more on the application of miRNAs on plant breeding and the future directions. Increased plant biomass through controlling plant development and phase change has been one achievement for miRNA-based biotechnology; plant tolerance to abiotic and biotic stress was also significantly enhanced by regulating the expression of an individual miRNA. Both endogenous and artificial miRNAs may serve as important tools for plant improvement. © 2014 Wiley Periodicals, Inc.

  14. RNA silencing can explain chlorotic infection patterns on plant leaves

    Directory of Open Access Journals (Sweden)

    Hogeweg Paulien

    2008-11-01

    Full Text Available Abstract Background RNA silencing has been implicated in virus symptom development in plants. One common infection symptom in plants is the formation of chlorotic tissue in leaves. Chlorotic and healthy tissue co-occur on a single leaf and form patterns. It has been shown that virus levels in chlorotic tissue are high, while they are low in healthy tissue. Additionally, the presence of siRNAs is confined to the chlorotic spots and the boundaries between healthy and infected tissue. These results strongly indicate that the interaction between virus growth and RNA silencing plays a role in the formation of infection patterns on leaves. However, how RNA silencing leads to the intricate patterns is not known. Results Here we elucidate the mechanisms leading to infection patterns and the conditions which lead to the various patterns observed. We present a modeling approach in which we combine intra- and inter-cellular dynamics of RNA silencing and viral growth. We observe that, due to the spread of viruses and the RNA silencing response, parts of the tissue become infected while other parts remain healthy. As is observed in experiments high virus levels coincide with high levels of siRNAs, and siRNAs are also present in the boundaries between infected and healthy tissue. We study how single- and double-stranded cleavage by Dicer and amplification by RNA-dependent RNA polymerase can affect the patterns formed. Conclusion This work shows that RNA silencing and virus growth within a cell, and the local spread of virions and siRNAs between cells can explain the heterogeneous spread of virus in leaf tissue, and therewith the observed infection patterns in plants.

  15. Phylogenetic distribution of plant snoRNA families.

    Science.gov (United States)

    Patra Bhattacharya, Deblina; Canzler, Sebastian; Kehr, Stephanie; Hertel, Jana; Grosse, Ivo; Stadler, Peter F

    2016-11-24

    Small nucleolar RNAs (snoRNAs) are one of the most ancient families amongst non-protein-coding RNAs. They are ubiquitous in Archaea and Eukarya but absent in bacteria. Their main function is to target chemical modifications of ribosomal RNAs. They fall into two classes, box C/D snoRNAs and box H/ACA snoRNAs, which are clearly distinguished by conserved sequence motifs and the type of chemical modification that they govern. Similarly to microRNAs, snoRNAs appear in distinct families of homologs that affect homologous targets. In animals, snoRNAs and their evolution have been studied in much detail. In plants, however, their evolution has attracted comparably little attention. In order to chart the phylogenetic distribution of individual snoRNA families in plants, we applied a sophisticated approach for identifying homologs of known plant snoRNAs across the plant kingdom. In response to the relatively fast evolution of snoRNAs, information on conserved sequence boxes, target sequences, and secondary structure is combined to identify additional snoRNAs. We identified 296 families of snoRNAs in 24 species and traced their evolution throughout the plant kingdom. Many of the plant snoRNA families comprise paralogs. We also found that targets are well-conserved for most snoRNA families. The sequence conservation of snoRNAs is sufficient to establish homologies between phyla. The degree of this conservation tapers off, however, between land plants and algae. Plant snoRNAs are frequently organized in highly conserved spatial clusters. As a resource for further investigations we provide carefully curated and annotated alignments for each snoRNA family under investigation.

  16. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes

    OpenAIRE

    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  17. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity.

    Science.gov (United States)

    Monnet, Jordan; Kozelka, Jiří

    2012-10-01

    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris

    2016-01-01

    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA-binding pro......Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...... leads to enhanced cooperative binding to DNA.Conclusions: Our findings contribute to the emerging picture that bacterial proteins, exemplified here by SsbA, undergo phosphorylation at multiple residues. This results in a complex regulation of cellular functions, and suggests that the complexity...

  19. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  20. Development of an Interaction Assay between Single-Stranded Nucleic Acids Trapped with Silica Particles and Fluorescent Compounds

    Directory of Open Access Journals (Sweden)

    R. Maeda

    2012-09-01

    Full Text Available Biopolymers are easily denatured by heating, a change in pH or chemical substances when they are immobilized on a substrate. To prevent denaturation of biopolymers, we developed a method to trap a polynucleotide on a substrate by hydrogen bonding using silica particles with surfaces modified by aminoalkyl chains ([A-AM silane]/SiO2. [A-AM silane]/SiO2 was synthesized by silane coupling reaction of N-2-(aminoethyl-3-aminopropyltrimethoxysilane (A-AM silane with SiO2 particles with a diameter of 5 μm at 100 °C for 20 min. The surface chemical structure of [A-AM silane]/SiO2 was characterized by Fourier transform infrared spectroscopy and molecular orbital calculations. The surface of the silica particles was modified with A-AM silane and primary amine groups were formed. [A-AM silane]/SiO2 was trapped with single-stranded nucleic acids [(Poly-X; X = A (adenine, G (guanine and C (cytosine] in PBS solution at 37 °C for 1 h. The single-stranded nucleic acids were trapped on the surface of the [A-AM silane]/SiO2 by hydrogen bonding to form conjugated materials. The resulting complexes were further conjugated by derivatives of acridine orange (AO as fluorescent labels under the same conditions to form [AO:Poly-X:A-AM silane]/SiO2 complexes. Changes in the fluorescence intensity of these complexes originating from interactions between the single-stranded nucleic acid and aromatic compounds were also evaluated. The change in intensity displayed the order [AO: Poly-G: A-AM silane]/SiO2 > [AO:Poly-A:A-AM silane]/SiO2 >> [AO:Poly-C:A-AM silane]/SiO2. This suggests that the single-stranded nucleic acids conjugated with aminoalkyl chains on the surfaces of SiO2 particles and the change in fluorescence intensity reflected the molecular interaction between AO and the nucleic-acid base in a polynucleotide.

  1. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide

    Science.gov (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio

    1998-01-01

    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  2. Simultaneous identification of seven foodborne pathogens and Escherichia coli (pathogenic and nonpathogenic) using capillary electrophoresis-based single-strand conformation polymorphism coupled with multiplex PCR.

    Science.gov (United States)

    Oh, Mi-Hwa; Paek, Se-Hee; Shin, Gi Won; Kim, Hae-Yeong; Jung, Gyoo Yeol; Oh, Sangsuk

    2009-06-01

    The objective of this study was to develop a novel technique for parallel analysis of eight important foodborne microbes using capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) coupled with multiplex PCR. Specific primers for multiplex PCR amplification of the 16S rRNA gene were designed, corresponding to eight species of bacteria, including Escherichia coli, Clostridium perfringens, Campylobacter jejuni, Salmonella enterica, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Bacillus cereus, for the species-specific identification and optimal separation of their PCR products in subsequent analysis by CE-SSCP. Multiplex PCR conditions including annealing temperature, extension time, the number of PCR cycles, and primer concentrations were then optimized for simultaneous detection of all target foodborne bacteria. The diagnostic system using CE-SSCP combined with multiplex PCR developed here can be used for rapid investigation of causative agents of foodborne illness. The simplicity and high sensitivity of the method may lead to improved management of safety and illness related to food.

  3. Genome-wide identification and characterization of tRNA-derived RNA fragments in land plants.

    Science.gov (United States)

    Alves, Cristiane S; Vicentini, Renato; Duarte, Gustavo T; Pinoti, Vitor F; Vincentz, Michel; Nogueira, Fabio T S

    2017-01-01

    The manuscript by Alves et al. entitled "Genome-wide identification and characterization of tRNA-derived RNA fragments in land plants" describes the identification and characterization of tRNAderived sRNA fragments in plants. By combining bioinformatic analysis and genetic and molecular approaches, we show that tRF biogenesis does not rely on canonical microRNA/siRNA processing machinery (i.e., independent of DICER-LIKE proteins). Moreover, we provide evidences that the Arabidopsis S-like Ribonuclease 1 (RNS1) might be involved in the biogenesis of tRFs. Detailed analyses showed that plant tRFs are sorted into different types of ARGONAUTE proteins and that they have potential target candidate genes. Our work advances the understanding of the tRF biology in plants by providing evidences that plant and animal tRFs shared common features and raising the hypothesis that an interplay between tRFs and other sRNAs might be important to fine-tune gene expression and protein biosynthesis in plant cells. Small RNA (sRNA) fragments derived from tRNAs (3'-loop, 5'-loop, anti-codon loop), named tRFs, have been reported in several organisms, including humans and plants. Although they may interfere with gene expression, their biogenesis and biological functions in plants remain poorly understood. Here, we capitalized on small RNA sequencing data from distinct species such as Arabidopsis thaliana, Oryza sativa, and Physcomitrella patens to examine the diversity of plant tRFs and provide insight into their properties. In silico analyzes of 19 to 25-nt tRFs derived from 5' (tRF-5s) and 3'CCA (tRF-3s) tRNA loops in these three evolutionary distant species showed that they are conserved and their abundance did not correlate with the number of genomic copies of the parental tRNAs. Moreover, tRF-5 is the most abundant variant in all three species. In silico and in vivo expression analyses unraveled differential accumulation of tRFs in Arabidopsis tissues/organs, suggesting that they are

  4. Characterization of the single-stranded DNA binding protein pV(VGJΦ) of VGJΦ phage from Vibrio cholerae.

    Science.gov (United States)

    Falero, Alina; Caballero, Andy; Trigueros, Sonia; Pérez, Celso; Campos, Javier; Marrero, Karen; Fando, Rafael

    2011-09-01

    pV(VGJΦ), a single-stranded DNA binding protein of the vibriophage VGJΦ was subject to biochemical analysis. Here, we show that this protein has a general affinity for single-stranded DNA (ssDNA) as documented by Electrophoretic Mobility Shift Assay (EMSA). The apparent molecular weight of the monomer is about 12.7kDa as measured by HPLC-SEC. Moreover, isoelectrofocusing showed an isoelectric point for pV(VGJΦ) of 6.82 pH units. Size exclusion chromatography in 150mM NaCl, 50mM sodium phosphate buffer, pH 7.0 revealed a major protein species of 27.0kDa, suggesting homodimeric protein architecture. Furthermore, pV(VGJΦ) binds ssDNA at extreme temperatures and the complex was stable after extended incubation times. Upon frozen storage at -20°C for a year the protein retained its integrity, biological activity and oligomericity. On the other hand, bioinformatics analysis predicted that pV(VGJΦ) protein has a disordered C-terminal, which might be involved in its functional activity. All the aforementioned features make pV(VGJΦ) interesting for biotechnological applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles.

    Science.gov (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng

    2015-11-21

    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  6. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  7. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.

    1978-01-01

    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  8. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: skim1@lsuhsc.edu [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  9. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee

    2012-01-01

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  10. Genomic sequences of two novel Levivirus single-stranded RNA coliphages (family Leviviridae): Evidence for recombination in environmental strains

    Science.gov (United States)

    Bacteriophages are likely the most abundant entities in the aquatic environment, yet knowledge of their ecology is limited. During a fecal source-tracking study, two genetically novel Leviviridae strains were discovered. Although the novel strains were isolated from coastal wat...

  11. Anti-viral RNA silencing: do we look like plants ?

    Directory of Open Access Journals (Sweden)

    Lecellier Charles-Henri

    2006-01-01

    Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.

  12. Nascent RNA sequencing reveals distinct features in plant transcription.

    Science.gov (United States)

    Hetzel, Jonathan; Duttke, Sascha H; Benner, Christopher; Chory, Joanne

    2016-10-25

    Transcriptional regulation of gene expression is a major mechanism used by plants to confer phenotypic plasticity, and yet compared with other eukaryotes or bacteria, little is known about the design principles. We generated an extensive catalog of nascent and steady-state transcripts in Arabidopsis thaliana seedlings using global nuclear run-on sequencing (GRO-seq), 5'GRO-seq, and RNA-seq and reanalyzed published maize data to capture characteristics of plant transcription. De novo annotation of nascent transcripts accurately mapped start sites and unstable transcripts. Examining the promoters of coding and noncoding transcripts identified comparable chromatin signatures, a conserved "TGT" core promoter motif and unreported transcription factor-binding sites. Mapping of engaged RNA polymerases showed a lack of enhancer RNAs, promoter-proximal pausing, and divergent transcription in Arabidopsis seedlings and maize, which are commonly present in yeast and humans. In contrast, Arabidopsis and maize genes accumulate RNA polymerases in proximity of the polyadenylation site, a trend that coincided with longer genes and CpG hypomethylation. Lack of promoter-proximal pausing and a higher correlation of nascent and steady-state transcripts indicate Arabidopsis may regulate transcription predominantly at the level of initiation. Our findings provide insight into plant transcription and eukaryotic gene expression as a whole.

  13. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail: meicun2006@163.com; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

    2016-12-01

    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  14. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  15. Mismatched single stranded antisense oligonucleotides can induce efficient dystrophin splice switching

    Directory of Open Access Journals (Sweden)

    Kole Ryszard

    2011-10-01

    Full Text Available Abstract Background Antisense oligomer induced exon skipping aims to reduce the severity of Duchenne muscular dystrophy by redirecting splicing during pre-RNA processing such that the causative mutation is by-passed and a shorter but partially functional Becker muscular dystrophy-like dystrophin isoform is produced. Normal exons are generally targeted to restore the dystrophin reading frame however, an appreciable subset of dystrophin mutations are intra-exonic and therefore have the potential to compromise oligomer efficiency, necessitating personalised oligomer design for some patients. Although antisense oligomers are easily personalised, it remains unclear whether all patient polymorphisms within antisense oligomer target sequences will require the costly process of producing and validating patient specific compounds. Methods Here we report preclinical testing of a panel of splice switching antisense oligomers, designed to excise exon 25 from the dystrophin transcript, in normal and dystrophic patient cells. These patient cells harbour a single base insertion in exon 25 that lies within the target sequence of an oligomer shown to be effective at removing exon 25. Results It was anticipated that such a mutation would compromise oligomer binding and efficiency. However, we show that, despite the mismatch an oligomer, designed and optimised to excise exon 25 from the normal dystrophin mRNA, removes the mutated exon 25 more efficiently than the mutation-specific oligomer. Conclusion This raises the possibility that mismatched AOs could still be therapeutically applicable in some cases, negating the necessity to produce patient-specific compounds.

  16. Small RNA Library Preparation and Illumina Sequencing in Plants.

    Science.gov (United States)

    Bilichak, Andriy; Golubov, Andrey; Kovalchuk, Igor

    2017-01-01

    The discovery of small RNAs in plants and animals almost two decades ago attracted a significant interest towards epigenetic regulation of gene expression and the practical implementation of the gained knowledge in applied studies. New and sometimes unexpected functions have been ascribed to sRNAs almost every couple of years since their discovery, hence indicating that the complete role of sRNAs in plant and animal physiology is still barely understood. Next-generation sequencing technologies allow to generate high-resolution profiles of sRNAs for the consequent analysis and possibly to discover novel functions of sRNAs. In this chapter, we provide brief guidelines for sRNA library preparation in plants and a practical approach that can be implemented to overcome possible difficulties with sequencing library generation.

  17. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample.

    Science.gov (United States)

    Cui, Lunbiao; Wu, Binyao; Zhu, Xiaojuan; Guo, Xiling; Ge, Yiyue; Zhao, Kangchen; Qi, Xian; Shi, Zhiyang; Zhu, Fengcai; Sun, Lixin; Zhou, Minghao

    2017-11-01

    Metagenomic analysis through high-throughput sequencing is a tool for detecting both known and novel viruses. Using this technique, a novel circular single-stranded DNA (ssDNA) virus genome was discovered in respiratory secretions from a febrile traveler. The virus, named human respiratory-associated PSCV-5-like virus (HRAPLV), has a genome comprising 3,018 bases, with two major putative ORFs inversely encoding capsid (Cap) and replicase (Rep) protein and separated by two intergenic regions. One stem-loop structure was predicted in the larger intergenic region (LIR). The predicted amino acid sequences of the Cap and Rep proteins of HRAPLV showed highest identity to those of porcine stool-associated circular virus 5 isolate CP3 (PoSCV 5) (53.0% and 48.9%, respectively). The host tropism of the virus is unknown, and further study is warranted to determine whether this novel virus is associated with human disease.

  18. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Vrushali S. [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Gokhale, Suresh P.; Patil, Kashinath R. [Physical and Material Chemistry Division, National Chemical Laboratory, Pune (India); Haram, Santosh K., E-mail: haram@chem.unipune.ernet.i [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)

    2010-02-15

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 +- 2 mum and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, alpha-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k{sup 0}) and electron transfer coefficient (alpha) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  19. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    International Nuclear Information System (INIS)

    Joshi, Vrushali S.; Gokhale, Suresh P.; Patil, Kashinath R.; Haram, Santosh K.

    2010-01-01

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 ± 2 μm and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, α-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k 0 ) and electron transfer coefficient (α) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  20. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  1. Quenching of Single-Walled Carbon Nanotube Fluorescence by Dissolved Oxygen Reveals Selective Single-Stranded DNA Affinities.

    Science.gov (United States)

    Zheng, Yu; Bachilo, Sergei M; Weisman, R Bruce

    2017-05-04

    The selective interactions between short oligomers of single-stranded DNA (ssDNA) and specific structures of single-walled carbon nanotubes have been exploited in powerful methods for nanotube sorting. We report here that nanotubes coated with ssDNA also display selective interactions through the selective quenching of nanotube fluorescence by dissolved oxygen. In aqueous solutions equilibrated under 1 atm of O 2 , emission intensity from semiconducting nanotubes is reduced by between 9 and 40%, varying with the combination of ssDNA sequence and nanotube structure. This quenching reverses promptly and completely on the removal of dissolved O 2 and may be due to physisorption on nanotube surfaces. Fluorescence quenching offers a simple, nondestructive approach for studying the structure-selective interactions of ssDNA with single-walled carbon nanotubes and identifying recognition sequences.

  2. Surface treatment on amorphous InGaZnO4 thin film for single-stranded DNA biosensing

    Science.gov (United States)

    Sun, Dali; Matsui, Hiroaki; Wu, Chun-Nan; Tabata, Hitoshi

    2015-01-01

    Amorphous InGaZnO4 (aIGZO) has been widely used as a transparent semiconductor. However, no research has been found yet applying aIGZO to biosensing. This paper examined the single strand DNA (ssDNA) immobilization on aIGZO by absorption with a comparison to ITO, which is the first step for many biosensing schemas. The DNA quantification by florescence intensity shows that the absorption capacity of aIGZO film to ssDNA is 6.7 times greater than that of ITO. XPS and contact angle analysis proved the high DNA absorption affinity on aIGZO film is related to its high effectiveness to OH- attachment. A feasible method to immobilized ssDNA on aIGZO thin film is evaluated in this paper, and consequently, enables a possible approach to apply aIGZO in biosensing.

  3. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana.

    Science.gov (United States)

    Olszewski, Marcin; Grot, Anna; Wojciechowski, Marek; Nowak, Marta; Mickiewicz, Małgorzata; Kur, Józef

    2010-10-15

    In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. We report the characterization of single-stranded DNA binding proteins (SSBs) from the thermophilic bacteria Thermotoga maritima (TmaSSB) and Thermotoga neapolitana (TneSSB). They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively). They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold) in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC) the melting temperature (Tm) was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR).

  4. Charge enhancement of single-stranded DNA in negative electrospray ionization using the supercharging reagent meta-nitrobenzyl alcohol.

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1% m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1% m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  5. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  6. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB).

    Science.gov (United States)

    van Loon, Barbara; Samson, Leona D

    2013-03-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  7. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata

    2010-10-01

    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  8. Aptamer based voltammetric determination of ampicillin using a single-stranded DNA binding protein and DNA functionalized gold nanoparticles.

    Science.gov (United States)

    Wang, Jun; Ma, Kui; Yin, Huanshun; Zhou, Yunlei; Ai, Shiyun

    2017-12-20

    An aptamer based method is described for the electrochemical determination of ampicillin. It is based on the use of DNA aptamer, DNA functionalized gold nanoparticles (DNA-AuNPs), and single-stranded DNA binding protein (ssDNA-BP). When the aptamer hybridizes with the target DNA on the AuNPs, the ssDNA-BP is captured on the electrode surface via its specific interaction with ss-DNA. This results in a decreased electrochemical signal of the redox probe Fe(CN) 6 3- which is measured best at a voltage of 0.188 mV (vs. reference electrode). In the presence of ampicillin, the formation of aptamer-ampicillin conjugate blocks the further immobilization of DNA-AuNPs and ssDNA-BP, and this leads to an increased response. The method has a linear reposne that convers the 1 pM to 5 nM ampicillin concentration range, with a 0.38 pM detection limit (at an S/N ratio of 3). The assay is selective, stable and reproducible. It was applied to the determination of ampicillin in spiked milk samples where it gave recoveries ranging from 95.5 to 105.5%. Graphical abstract Schematic of a simple and sensitive electrochemical apta-biosensor for ampicillin detection. It is based on the use of gold nanoparticles (AuNPs), DNA aptamer, DNA functionalized AuNPs (DNA-AuNPs), and single-strand DNA binding protein (SSBP).

  9. The family Rhabdoviridae: Mono- and bipartite negative-sense RNA viruses with diverse genome organization and common evolutionary origins

    Science.gov (United States)

    Dietzgen, Ralf G.; Kondo, Hideki; Goodin, Michael M.; Kurath, Gael; Vasilakis, Nikos

    2017-01-01

    The family Rhabdoviridae consists of mostly enveloped, bullet-shaped or bacilliform viruses with a negative-sense, single-stranded RNA genome that infect vertebrates, invertebrates or plants. This ecological diversity is reflected by the diversity and complexity of their genomes. Five canonical structural protein genes are conserved in all rhabdoviruses, but may be overprinted, overlapped or interspersed with several novel and diverse accessory genes. This review gives an overview of the characteristics and diversity of rhabdoviruses, their taxonomic classification, replication mechanism, properties of classical rhabdoviruses such as rabies virus and rhabdoviruses with complex genomes, rhabdoviruses infecting aquatic species, and plant rhabdoviruses with both mono- and bipartite genomes.

  10. Heterochromatin Reorganization during Early Mouse Development Requires a Single-Stranded Noncoding Transcript

    Directory of Open Access Journals (Sweden)

    Miguel Casanova

    2013-09-01

    Full Text Available The equalization of pericentric heterochromatin from distinct parental origins following fertilization is essential for genome function and development. The recent implication of noncoding transcripts in this process raises questions regarding the connection between RNA and the nuclear organization of distinct chromatin environments. Our study addresses the interrelationship between replication and transcription of the two parental pericentric heterochromatin (PHC domains and their reorganization during early embryonic development. We demonstrate that the replication of PHC is dispensable for its clustering at the late two-cell stage. In contrast, using parthenogenetic embryos, we show that pericentric transcripts are essential for this reorganization independent of the chromatin marks associated with the PHC domains. Finally, our discovery that only reverse pericentric transcripts are required for both the nuclear reorganization of PHC and development beyond the two-cell stage challenges current views on heterochromatin organization.

  11. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.

    1994-01-01

    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  12. Distinct Effects of p19 RNA Silencing Suppressor on Small RNA Mediated Pathways in Plants.

    Directory of Open Access Journals (Sweden)

    Levente Kontra

    2016-10-01

    Full Text Available RNA silencing is one of the main defense mechanisms employed by plants to fight viruses. In change, viruses have evolved silencing suppressor proteins to neutralize antiviral silencing. Since the endogenous and antiviral functions of RNA silencing pathway rely on common components, it was suggested that viral suppressors interfere with endogenous silencing pathway contributing to viral symptom development. In this work, we aimed to understand the effects of the tombusviral p19 suppressor on endogenous and antiviral silencing during genuine virus infection. We showed that ectopically expressed p19 sequesters endogenous small RNAs (sRNAs in the absence, but not in the presence of virus infection. Our presented data question the generalized model in which the sequestration of endogenous sRNAs by the viral suppressor contributes to the viral symptom development. We further showed that p19 preferentially binds the perfectly paired ds-viral small interfering RNAs (vsiRNAs but does not select based on their sequence or the type of the 5' nucleotide. Finally, co-immunoprecipitation of sRNAs with AGO1 or AGO2 from virus-infected plants revealed that p19 specifically impairs vsiRNA loading into AGO1 but not AGO2. Our findings, coupled with the fact that p19-expressing wild type Cymbidium ringspot virus (CymRSV overcomes the Nicotiana benthamiana silencing based defense killing the host, suggest that AGO1 is the main effector of antiviral silencing in this host-virus combination.

  13. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    Science.gov (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Therapeutic Effect of Novel Single-Stranded RNAi Agent Targeting Periostin in Eyes with Retinal Neovascularization

    Directory of Open Access Journals (Sweden)

    Takahito Nakama

    2017-03-01

    Full Text Available Retinal neovascularization (NV due to retinal ischemia remains one of the principal causes of vision impairment in patients with ischemic retinal diseases. We recently reported that periostin (POSTN may play a role in the development of preretinal fibrovascular membranes, but its role in retinal NV has not been determined. The purpose of this study was to examine the expression of POSTN in the ischemic retinas of a mouse model of oxygen-induced retinal NV. We also studied the function of POSTN on retinal NV using Postn KO mice and human retinal endothelial cells (HRECs in culture. In addition, we used a novel RNAi agent, NK0144, which targets POSTN to determine its effect on the development of retinal NV. Our results showed that the expression of POSTN was increased in the vascular endothelial cells, pericytes, and M2 macrophages in ischemic retinas. POSTN promoted the ischemia-induced retinal NV by Akt phosphorylation through integrin αvβ3. NK0144 had a greater inhibitory effect than canonical double-stranded siRNA on preretinal pathological NV in vivo and in vitro. These findings suggest a causal relationship between POSTN and retinal NV, and indicate a potential therapeutic role of intravitreal injection of NK0144 for retinal neovascular diseases.

  15. Genetic evidence for single-strand lesions initiating Nbs1-dependent homologous recombination in diversification of Ig v in chicken B lymphocytes.

    Directory of Open Access Journals (Sweden)

    Makoto Nakahara

    2009-01-01

    Full Text Available Homologous recombination (HR is initiated by DNA double-strand breaks (DSB. However, it remains unclear whether single-strand lesions also initiate HR in genomic DNA. Chicken B lymphocytes diversify their Immunoglobulin (Ig V genes through HR (Ig gene conversion and non-templated hypermutation. Both types of Ig V diversification are initiated by AID-dependent abasic-site formation. Abasic sites stall replication, resulting in the formation of single-stranded gaps. These gaps can be filled by error-prone DNA polymerases, resulting in hypermutation. However, it is unclear whether these single-strand gaps can also initiate Ig gene conversion without being first converted to DSBs. The Mre11-Rad50-Nbs1 (MRN complex, which produces 3' single-strand overhangs, promotes the initiation of DSB-induced HR in yeast. We show that a DT40 line expressing only a truncated form of Nbs1 (Nbs1(p70 exhibits defective HR-dependent DSB repair, and a significant reduction in the rate--though not the fidelity--of Ig gene conversion. Interestingly, this defective gene conversion was restored to wild type levels by overproduction of Escherichia coli SbcB, a 3' to 5' single-strand-specific exonuclease, without affecting DSB repair. Conversely, overexpression of chicken Exo1 increased the efficiency of DSB-induced gene-targeting more than 10-fold, with no effect on Ig gene conversion. These results suggest that Ig gene conversion may be initiated by single-strand gaps rather than by DSBs, and, like SbcB, the MRN complex in DT40 may convert AID-induced lesions into single-strand gaps suitable for triggering HR. In summary, Ig gene conversion and hypermutation may share a common substrate-single-stranded gaps. Genetic analysis of the two types of Ig V diversification in DT40 provides a unique opportunity to gain insight into the molecular mechanisms underlying the filling of gaps that arise as a consequence of replication blocks at abasic sites, by HR and error

  16. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian

    2012-07-06

    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  17. Cloning and profiling of small RNAs from cucumber mosaic virus satellite RNA.

    Science.gov (United States)

    Fang, Yuan-Yuan; Smith, Neil A; Zhao, Jian-Hua; Lee, Joanne R M; Guo, Hui-Shan; Wang, Ming-Bo

    2015-01-01

    RNA silencing is not only a gene regulation mechanism that is conserved in a broad range of eukaryotes but also an adaptive immune response against foreign nucleic acids including viruses in plants. A major feature of RNA silencing is the production of small RNA (sRNA) of 21-24 nucleotides (nt) in length from double-stranded (ds) or hairpin-like (hp) RNA by Dicer-like (DCL) proteins. These sRNAs guide the binding and cleavage of cognate single-stranded (ss) RNA by an RNA silencing complex. Like all plant viruses and subviral agents, replication of viral satellite RNAs (satRNAs) is associated with the accumulation of 21-24 nt viral small interfering RNA (vsiRNA) derived from the whole region of a satRNA genome in both plus and minus-strand polarities. These satRNA-derived siRNAs (satsiRNAs) have recently been shown to play an important role in the trilateral interactions among host plants, helper viruses and satRNAs. Here, we describe the cloning and profile analysis of satsiRNAs from satRNAs of Cucumber mosaic virus (CMV). We also describe a method to minimize the strand bias that often occurs during vsiRNA cloning and sequencing.

  18. Identification and characterization of single-stranded DNA-binding protein from the facultative psychrophilic bacteria Pseudoalteromonas haloplanktis.

    Science.gov (United States)

    Olszewski, Marcin; Nowak, Marta; Cyranka-Czaja, Anna; Kur, Józef

    2014-01-01

    Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism such as DNA replication, repair, and recombination, and is essential for cell survival. This study reports on the ssb-like gene cloning, gene expression and characterization of a single-stranded DNA-binding protein of Pseudoalteromonas haloplanktis (PhaSSB) and is the first report of such a protein from psychrophilic microorganism. PhaSSB possesses a high sequence similarity to Escherichia coli SSB (48% identity and 57% similarity) and has the longest amino acid sequence (244 amino acid residues) of all the known bacterial SSBs with one OB-fold per monomer. An analysis of purified PhaSSB by means of chemical cross-linking experiments, sedimentation analysis and size exclusion chromatography revealed a stable tetramer in solution. Using EMSA, we characterized the stoichiometry of PhaSSB complexed with a series of ssDNA homopolymers, and the size of the binding site was determined as being approximately 35 nucleotides long. In fluorescence titrations, the occluded site size of PhaSSB on poly(dT) is 34 nucleotides per tetramer under low-salt conditions (2mM NaCl), but increases to 54-64 nucleotides at higher-salt conditions (100-300mM NaCl). This suggests that PhaSSB undergoes a transition between ssDNA binding modes, which is observed for EcoSSB. The binding properties of PhaSSB investigated using SPR technology revealed that the affinity of PhaSSB to ssDNA is typical of SSB proteins. The only difference in the binding mode of PhaSSB to ssDNA is a faster association phase, when compared to EcoSSB, though compensated by faster dissociation rate. When analyzed by differential scanning calorimetry (DSC), the melting temperature (Tm) was determined as 63 °C, which is only a few degrees lower than for EcoSSB. Copyright © 2013 Elsevier GmbH. All rights reserved.

  19. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  20. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii.

    Science.gov (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten

    2012-01-01

    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  1. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der

    1978-01-01

    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  2. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.

    1982-01-01

    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  3. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

    1982-01-01

    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  4. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.

    2006-01-01

    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  5. RNA isolation from loquat and other recalcitrant woody plants with high quality and yield

    OpenAIRE

    Morante Carriel, Jaime; Sellés Marchart, Susana; Martínez Márquez, Ascensión; Martínez Esteso, María José; Luque Romero, Ignacio; Bru, Roque

    2014-01-01

    RNA isolation is difficult in plants that contain large amounts of polysaccharides and polyphenol compounds. To date, no commercial kit has been developed for the isolation of high-quality RNA from tissues with these characteristics, especially for fruit. The common protocols for RNA isolation are tedious and usually result in poor yields when applied to recalcitrant plant tissues. Here an efficient RNA isolation protocol based on cetyltrimethylammonium bromide (CTAB) and two successive preci...

  6. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.

    Science.gov (United States)

    Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo

    2016-12-01

    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.

  7. Functional analysis of multiple single-stranded DNA-binding proteins from Methanosarcina acetivorans and their effects on DNA synthesis by DNA polymerase BI.

    Science.gov (United States)

    Robbins, Justin B; Murphy, Mary C; White, Bryan A; Mackie, Roderick I; Ha, Taekjip; Cann, Isaac K O

    2004-02-20

    Single-stranded DNA-binding proteins and their functional homologs, replication protein A, are essential components of cellular DNA replication, repair and recombination. We describe here the isolation and characterization of multiple replication protein A homologs, RPA1, RPA2, and RPA3, from the archaeon Methanosarcina acetivorans. RPA1 comprises four single-stranded DNA-binding domains, while RPA2 and RPA3 are each composed of two such domains and a zinc finger domain. Gel filtration analysis suggested that RPA1 exists as homotetramers and homodimers in solution, while RPA2 and RPA3 form only homodimers. Unlike the multiple RPA proteins found in other Archaea and eukaryotes, each of the M. acetivorans RPAs can act as a distinct single-stranded DNA-binding protein. Fluorescence resonance energy transfer and fluorescence polarization anisotropy studies revealed that the M. acetivorans RPAs bind to as few as 10 single-stranded DNA bases. However, more stable binding is achieved with single-stranded DNA of 18-23 bases, and for such substrates the estimated Kd was 3.82 +/- 0.28 nM, 173.6 +/- 105.17 nM, and 5.92 +/- 0.23 nM, for RPA1, RPA2, and RPA3, respectively. The architectures of the M. acetivorans RPAs are different from those of hitherto reported homologs. Thus, these proteins may represent novel forms of replication protein A. Most importantly, our results show that the three RPAs and their combinations highly stimulate the primer extension capacity of M. acetivorans DNA polymerase BI. Although bacterial SSB and eukaryotic RPA have been shown to stimulate DNA synthesis by their cognate DNA polymerases, our findings provide the first in vitro biochemical evidence for the conservation of this property in an archaeon.

  8. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  9. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)

    2012-04-04

    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  10. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.

    1985-01-01

    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  11. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia

    2009-01-01

    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  12. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))

    1993-03-01

    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  13. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA.

    Science.gov (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi

    2008-03-28

    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  14. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  15. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  16. The RNA silencing enzyme RNA polymerase v is required for plant immunity.

    Directory of Open Access Journals (Sweden)

    Ana López

    2011-12-01

    Full Text Available RNA-directed DNA methylation (RdDM is an epigenetic control mechanism driven by small interfering RNAs (siRNAs that influence gene function. In plants, little is known of the involvement of the RdDM pathway in regulating traits related to immune responses. In a genetic screen designed to reveal factors regulating immunity in Arabidopsis thaliana, we identified NRPD2 as the OVEREXPRESSOR OF CATIONIC PEROXIDASE 1 (OCP1. NRPD2 encodes the second largest subunit of the plant-specific RNA Polymerases IV and V (Pol IV and Pol V, which are crucial for the RdDM pathway. The ocp1 and nrpd2 mutants showed increases in disease susceptibility when confronted with the necrotrophic fungal pathogens Botrytis cinerea and Plectosphaerella cucumerina. Studies were extended to other mutants affected in different steps of the RdDM pathway, such as nrpd1, nrpe1, ago4, drd1, rdr2, and drm1drm2 mutants. Our results indicate that all the mutants studied, with the exception of nrpd1, phenocopy the nrpd2 mutants; and they suggest that, while Pol V complex is required for plant immunity, Pol IV appears dispensable. Moreover, Pol V defective mutants, but not Pol IV mutants, show enhanced disease resistance towards the bacterial pathogen Pseudomonas syringae DC3000. Interestingly, salicylic acid (SA-mediated defenses effective against PsDC3000 are enhanced in Pol V defective mutants, whereas jasmonic acid (JA-mediated defenses that protect against fungi are reduced. Chromatin immunoprecipitation analysis revealed that, through differential histone modifications, SA-related defense genes are poised for enhanced activation in Pol V defective mutants and provide clues for understanding the regulation of gene priming during defense. Our results highlight the importance of epigenetic control as an additional layer of complexity in the regulation of plant immunity and point towards multiple components of the RdDM pathway being involved in plant immunity based on genetic evidence

  17. Systemic delivery of siRNA in pumpkin by a plant PHLOEM SMALL RNA-BINDING PROTEIN 1-ribonucleoprotein complex.

    Science.gov (United States)

    Ham, Byung-Kook; Li, Gang; Jia, Weitao; Leary, Julie A; Lucas, William J

    2014-11-01

    In plants, the vascular system, specifically the phloem, functions in delivery of small RNA (sRNA) to exert epigenetic control over developmental and defense-related processes. Although the importance of systemic sRNA delivery has been established, information is currently lacking concerning the nature of the protein machinery involved in this process. Here, we show that a PHLOEM SMALL-RNA BINDING PROTEIN 1 (PSRP1) serves as the basis for formation of an sRNA ribonucleoprotein complex (sRNPC) that delivers sRNA (primarily 24 nt) to sink organs. Assembly of this complex is facilitated through PSRP1 phosphorylation by a phloem-localized protein kinase, PSRPK1. During long-distance transport, PSRP1-sRNPC is stable against phloem phosphatase activity. Within target tissues, phosphatase activity results in disassembly of PSRP1-sRNPC, a process that is probably required for unloading cargo sRNA into surrounding cells. These findings provide an insight into the mechanism involved in delivery of sRNA associated with systemic gene silencing in plants. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  18. Seeing the forest for the trees: annotating small RNA producing genes in plants.

    Science.gov (United States)

    Coruh, Ceyda; Shahid, Saima; Axtell, Michael J

    2014-04-01

    A key goal in genomics is the complete annotation of the expressed regions of the genome. In plants, substantial portions of the genome make regulatory small RNAs produced by Dicer-Like (DCL) proteins and utilized by Argonaute (AGO) proteins. These include miRNAs and various types of endogenous siRNAs. Small RNA-seq, enabled by cheap and fast DNA sequencing, has produced an enormous volume of data on plant miRNA and siRNA expression in recent years. In this review, we discuss recent progress in using small RNA-seq data to produce stable and reliable annotations of miRNA and siRNA genes in plants. In addition, we highlight key goals for the future of small RNA gene annotation in plants. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Pre-mRNA Splicing in Plants: In Vivo Functions of RNA-Binding Proteins Implicated in the Splicing Process

    Directory of Open Access Journals (Sweden)

    Katja Meyer

    2015-07-01

    Full Text Available Alternative pre-messenger RNA splicing in higher plants emerges as an important layer of regulation upon exposure to exogenous and endogenous cues. Accordingly, mutants defective in RNA-binding proteins predicted to function in the splicing process show severe phenotypic alterations. Among those are developmental defects, impaired responses to pathogen threat or abiotic stress factors, and misregulation of the circadian timing system. A suite of splicing factors has been identified in the model plant Arabidopsis thaliana. Here we summarize recent insights on how defects in these splicing factors impair plant performance.

  20. Biosafety research for non-target organism risk assessment of RNAi-based GE plants

    Science.gov (United States)

    Roberts, Andrew F.; Devos, Yann; Lemgo, Godwin N. Y.; Zhou, Xuguo

    2015-01-01

    RNA interference, or RNAi, refers to a set of biological processes that make use of conserved cellular machinery to silence genes. Although there are several variations in the source and mechanism, they are all triggered by double stranded RNA (dsRNA) which is processed by a protein complex into small, single stranded RNA, referred to as small interfering RNAs (siRNA) with complementarity to sequences in genes targeted for silencing. The use of the RNAi mechanism to develop new traits in plants has fueled a discussion about the environmental safety of the technology for these applications, and this was the subject of a symposium session at the 13th ISBGMO in Cape Town, South Africa. This paper continues that discussion by proposing research areas that may be beneficial for future environmental risk assessments of RNAi-based genetically modified plants, with a particular focus on non-target organism assessment. PMID:26594220

  1. Assessing single-stranded oligonucleotide drug-induced effects in vitro reveals key risk factors for thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Sabine Sewing

    Full Text Available Single-stranded oligonucleotides (ON comprise a promising therapeutic platform that enables selective modulation of currently undruggable targets. The development of novel ON drug candidates has demonstrated excellent efficacy, but in certain cases also some safety liabilities were reported. Among them are events of thrombocytopenia, which have recently been evident in late stage trials with ON drugs. The underlying mechanisms are poorly understood and the risk for ON candidates causing such events cannot be sufficiently assessed pre-clinically. We investigated potential thrombocytopenia risk factors of ONs and implemented a set of in vitro assays to assess these risks. Our findings support previous observations that phosphorothioate (PS-ONs can bind to platelet proteins such as platelet collagen receptor glycoprotein VI (GPVI and activate human platelets in vitro to various extents. We also show that these PS-ONs can bind to platelet factor 4 (PF4. Binding to platelet proteins and subsequent activation correlates with ON length and connected to this, the number of PS in the backbone of the molecule. Moreover, we demonstrate that locked nucleic acid (LNA ribosyl modifications in the wings of the PS-ONs strongly suppress binding to GPVI and PF4, paralleled by markedly reduced platelet activation. In addition, we provide evidence that PS-ONs do not directly affect hematopoietic cell differentiation in culture but at higher concentrations show a pro-inflammatory potential, which might contribute to platelet activation. Overall, our data confirm that certain molecular attributes of ONs are associated with a higher risk for thrombocytopenia. We propose that applying the in vitro assays discussed here during the lead optimization phase may aid in deprioritizing ONs with a potential to induce thrombocytopenia.

  2. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA.

    Science.gov (United States)

    Rogers, Cody M; Bochman, Matthew L

    2017-05-13

    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold.

    Science.gov (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G

    2005-05-24

    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  4. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage

    Science.gov (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio

    1998-01-01

    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  5. Slowing single-stranded DNA translocation through a solid-state nanopore by decreasing the nanopore diameter.

    Science.gov (United States)

    Akahori, Rena; Haga, Takanobu; Hatano, Toshiyuki; Yanagi, Itaru; Ohura, Takeshi; Hamamura, Hirotaka; Iwasaki, Tomio; Yokoi, Takahide; Anazawa, Takashi

    2014-07-11

    To slow the translocation of single-stranded DNA (ssDNA) through a solid-state nanopore, a nanopore was narrowed, and the effect of the narrowing on the DNA translocation speed was investigated. In order to accurately measure the speed, long (5.3 kb) ssDNA (namely, ss-poly(dA)) with uniform length (±0.4 kb) was synthesized. The diameters of nanopores fabricated by a transmission electron microscope were controlled by atomic-layer deposition. Reducing the nanopore diameter from 4.5 to 2.3 nm slowed down the translocation of ssDNA by more than 16 times (to 0.18 μs base(-1)) when 300 mV was applied across the nanopore. It is speculated that the interaction between the nanopore and the ssDNA dominates the translocation speed. Unexpectedly, the translocation speed of ssDNA through the 4.5 nm nanopore is more than two orders of magnitude higher than that of double-stranded DNA (dsDNA) through a nanopore of almost the same size. The cause of such a faster translocation of ssDNA can be explained by the weaker drag force inside the nanopore. Moreover, the measured translocation speeds of ssDNA and dsDNA agree well with those calculated by molecular-dynamics (MD) simulation. The MD simulation predicted that reducing the nanopore diameter to almost the same as that of ssDNA (i.e. 1.4 nm) decreases the translocation speed (to 1.4 μs base(-1)). Narrowing the nanopore is thus an effective approach for accomplishing nanopore DNA sequencing.

  6. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler

    2007-12-01

    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  7. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines.

    Science.gov (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao

    2017-07-01

    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  8. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Complementation and recombination between alfalfa mosaic virus RNA3 mutants in tobacco plants

    NARCIS (Netherlands)

    van der Kuyl, A. C.; Neeleman, L.; Bol, J. F.

    1991-01-01

    Deletions were made in an infectious cDNA clone of alfalfa mosaic virus (AIMV) RNA3 and the replication of RNA transcripts of these cDNAs was studied in tobacco plants transformed with AIMV replicase genes (P12 plants). Previously, we found that deletions in the P3 gene did not affect accumulation

  10. A shift in plant proteome profile for a Bromodomain containing RNA binding Protein (BRP1) in plants infected with Cucumber mosaic virus and its satellite RNA.

    Science.gov (United States)

    Chaturvedi, Sonali; Rao, A L N

    2016-01-10

    Host proteins are the integral part of a successful infection caused by a given RNA virus pathogenic to plants. Therefore, identification of crucial host proteins playing an important role in establishing the infection process is likely to help in devising approaches to curbing disease spread. Cucumber mosaic virus (Q-CMV) and its satellite RNA (QsatRNA) are important pathogens of many economically important crop plants worldwide. In a previous study, we demonstrated the biological significance of a Bromodomain containing RNA-binding Protein (BRP1) in the infection cycle of QsatRNA, making BRP1 an important host protein to study. To further shed a light on the mechanistic role of BRP1 in the replication of Q-CMV and QsatRNA, we analyzed the Nicotiana benthamiana host protein interactomes either for BRP1 alone or in the presence of Q-CMV or QsatRNA. Co-immunoprecipitation, followed by LC-MS/MS analysis of BRP1-FLAG on challenging with Q-CMV or QsatRNA has led us to observe a shift in the host protein interactome of BRP1. We discuss the significance of these results in relation to Q-CMV and its QsatRNA infection cycle. Host proteins play an important role in replication and infection of eukaryotic cells by a wide-range of RNA viruses pathogenic to humans, animals and plants. Since a given eukaryotic cell typically contains ~30,000 different proteins, recent advances made in proteomics and bioinformatics approaches allowed the identification of host proteins critical for viral replication and pathogenesis. Although Cucumber mosaic virus (CMV) and its satRNA are well characterized at molecular level, information concerning the network of host factors involved in their replication and pathogenesis is still on its infancy. We have recently observed that a Bromodomain containing host protein (BRP1) is obligatory to transport satRNA to the nucleus. Consequently, it is imperative to apply proteomics and bioinformatics approaches in deciphering how host interactome network

  11. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis.

    Science.gov (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J

    2012-01-01

    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  12. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops

    OpenAIRE

    Guo, Qigao; Liu, Qing; Smith, Neil A.; Liang, Guolu; Wang, Ming-Bo

    2016-01-01

    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing ...

  13. Isolation of high-quality RNA from Platycladus orientalis and other Cupressaceae plants

    Directory of Open Access Journals (Sweden)

    Ermei Chang

    2016-09-01

    Full Text Available Platycladus orientalis has a lifespan of several thousand years in China, making it a good plant in which to study aging at the molecular level, but this requires sufficient quantities of high-quality P. orientalis RNA. However, no appropriate methods have been reported for total RNA isolation from P. orientalis leaves. The TRIzol method did not extract RNA, while cetyltrimethylammonium bromide, sodium dodecyl sulfate-phenol, and plant RNAout kit (Tianz, Inc., China protocols resulted in low yields of poor quality RNA. Isolating total RNA using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, St. Louis, MO, USA resulted in a high-quality product but a low yield. However, the two-step removal of polyphenols and polysaccharides in the improved plant RNAout kit protocol resulted in the isolation of RNA with a 28S:18S rRNA ratio of band intensities that was ~2:1, the A260/A280 absorbance ratio was 2.03, and the total RNA yield from P. orientalis leaves was high. This protocol was tested on different P. orientalis tissues of different ages and on leaves of five other Cupressaceae plants. The total RNAs were successfully used in complementary DNA synthesis for transcriptome sequencing and would be suitable to use in additional experiments. The results of this study will benefit future studies in Cupressaceae plants.

  14. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  15. Synthesis of a gene for the HIV transactivator protein TAT by a novel single stranded approach involving in vivo gap repair.

    OpenAIRE

    Adams, S E; Johnson, I D; Braddock, M; Kingsman, A J; Kingsman, S M; Edwards, R M

    1988-01-01

    The synthesis of a gene for the HIV TAT protein is described using a novel approach that capitalises on the ability to synthesise oligonucleotides of greater than 100 bp in length. It involves the synthesis of large oligomers covering one strand of the desired gene in its entirety and the use of small complementary bridging and adapter oligonucleotides to direct the assembly and cloning of the large oligomers. After ligation to the cloning vector the partially single stranded intermediate is ...

  16. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers

    OpenAIRE

    Antolin, M. F.; Bosio, C. F.; Cotton, J.; Sweeney, W.; Strand, M. R.; Black-IV, W. C.

    1996-01-01

    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  17. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr

    2015-01-01

    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single- strand ed DNA -binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  18. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.

    1979-10-01

    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  19. Escherichia coli Single-Stranded DNA-Binding Protein: NanoESI-MS Studies of Salt-Modulated Subunit Exchange and DNA Binding Transactions

    Science.gov (United States)

    Mason, Claire E.; Jergic, Slobodan; Lo, Allen T. Y.; Wang, Yao; Dixon, Nicholas E.; Beck, Jennifer L.

    2013-02-01

    Single-stranded DNA-binding proteins (SSBs) are ubiquitous oligomeric proteins that bind with very high affinity to single-stranded DNA and have a variety of essential roles in DNA metabolism. Nanoelectrospray ionization mass spectrometry (nanoESI-MS) was used to monitor subunit exchange in full-length and truncated forms of the homotetrameric SSB from Escherichia coli. Subunit exchange in the native protein was found to occur slowly over a period of hours, but was significantly more rapid in a truncated variant of SSB from which the eight C-terminal residues were deleted. This effect is proposed to result from C-terminus mediated stabilization of the SSB tetramer, in which the C-termini interact with the DNA-binding cores of adjacent subunits. NanoESI-MS was also used to examine DNA binding to the SSB tetramer. Binding of single-stranded oligonucleotides [one molecule of (dT)70, one molecule of (dT)35, or two molecules of (dT)35] was found to prevent SSB subunit exchange. Transfer of SSB tetramers between discrete oligonucleotides was also observed and is consistent with predictions from solution-phase studies, suggesting that SSB-DNA complexes can be reliably analyzed by ESI mass spectrometry.

  20. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  1. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.

    1992-01-01

    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  2. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  3. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: simonaclichici@yahoo.com [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)

    2012-03-15

    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  4. Probing of RNA structures in a positive sense RNA virus reveals selection pressures for structural elements

    Science.gov (United States)

    Watters, Kyle E; Choudhary, Krishna; Aviran, Sharon; Perry, Keith L

    2018-01-01

    Abstract In single stranded (+)-sense RNA viruses, RNA structural elements (SEs) play essential roles in the infection process from replication to encapsidation. Using selective 2′-hydroxyl acylation analyzed by primer extension sequencing (SHAPE-Seq) and covariation analysis, we explore the structural features of the third genome segment of cucumber mosaic virus (CMV), RNA3 (2216 nt), both in vitro and in plant cell lysates. Comparing SHAPE-Seq and covariation analysis results revealed multiple SEs in the coat protein open reading frame and 3′ untranslated region. Four of these SEs were mutated and serially passaged in Nicotiana tabacum plants to identify biologically selected changes to the original mutated sequences. After passaging, loop mutants showed partial reversion to their wild-type sequence and SEs that were structurally disrupted by mutations were restored to wild-type-like structures via synonymous mutations in planta. These results support the existence and selection of virus open reading frame SEs in the host organism and provide a framework for further studies on the role of RNA structure in viral infection. Additionally, this work demonstrates the applicability of high-throughput chemical probing in plant cell lysates and presents a new method for calculating SHAPE reactivities from overlapping reverse transcriptase priming sites. PMID:29294088

  5. Plant insects and mites uptake double-stranded RNA upon its exogenous application on tomato leaves.

    Science.gov (United States)

    Gogoi, Anupam; Sarmah, Nomi; Kaldis, Athanasios; Perdikis, Dionysios; Voloudakis, Andreas

    2017-12-01

    Exogenously applied double-stranded RNA (dsRNA) molecules onto tomato leaves, moved rapidly from local to systemic leaves and were uptaken by agricultural pests namely aphids, whiteflies and mites. Four small interfering RNAs, deriving from the applied dsRNA, were molecularly detected in plants, aphids and mites but not in whiteflies. Double-stranded RNA (dsRNA) acts as the elicitor molecule of the RNA silencing (RNA interference, RNAi), the endogenous and evolutionary conserved surveillance system present in all eukaryotes. DsRNAs and their subsequent degradation products, namely the small interfering RNAs (siRNAs), act in a sequence-specific manner to control gene expression. Exogenous application of dsRNAs onto plants elicits resistance against plant viruses. In the present work, exogenously applied dsRNA molecules, derived from Zucchini yellow mosaic virus (ZYMV) HC-Pro region, onto tomato plants were detected in aphids (Myzus persicae), whiteflies (Trialeurodes vaporariorum) and mites (Tetranychus urticae) that were fed on treated as well as systemic tomato leaves. Furthermore, four siRNAs, deriving from the dsRNA applied, were detected in tomato and the agricultural pests fed on treated tomato plants. More specifically, dsRNA was detected in agricultural pests at 3 and 10 dpt (days post treatment) in dsRNA-treated leaves and at 14 dpt in systemic leaves. In addition, using stem-loop RT-PCR, siRNAs were detected in agricultural pests at 3 and 10 dpt in aphids and mites. Surprisingly, in whiteflies carrying the applied dsRNA, siRNAs were not molecularly detected. Our results showed that, upon exogenous application of dsRNAs molecules, these moved rapidly within tomato and were uptaken by agricultural pests fed on treated tomato. As a result, this non-transgenic method has the potential to control important crop pests via RNA silencing of vital genes of the respective pests.

  6. plantDARIO: Web based quantitative and qualitative analysis of small RNA-seq data in plants

    Directory of Open Access Journals (Sweden)

    Deblina ePatra

    2014-12-01

    Full Text Available High-throughput sequencing techniques have made it possible to assay an organism’s entire repertoire of small non-coding RNAs (ncRNAs in an efficient and cost-effective manner. The moderate size of small RNAseq datasets makes it feasible to provide free web services to the research community that provide many basic features of a small RNA-seq analysis including quality control, read normalization, ncRNA quantification, and the prediction of putative novel ncRNAs. DARIO is one such system that so far has been focussed on animals. Here we report on the extension of this system to plant short non-coding RNAs (sncRNAs, which includes modifications to cope with plant-specific ncRNA processing. The current version of plantDARIO covers analyses of mapping files, RNA-seq quality control, expression analyses of annotated ncRNAs, prediction of miRNAs and snoRNAs from unknown expressed loci, and expression analyses of user-defined loci for Arabidopsis thaliana, Beta vulgaris, and Solanum lycopersicum. It links to a visualization browser for custom track display. The easy-to-use platform of plantDARIO quantifies RNA expression based on annotated ncRNAs from different ncRNA databases and also some ncRNA annotations validated by our group. The plantDARIO web site can be accessed at http://plantdario.bioinf.uni-leipzig.de/.

  7. SoMART, a web server for miRNA, tasiRNA and target gene analysis in Solanaceae plants

    Science.gov (United States)

    Plant micro(mi)RNAs and trans-acting small interfering (tasi)RNAs mediate posttranscriptional silencing of genes and play important roles in a variety of biological processes. Although bioinformatics prediction and small (s)RNA cloning are the key approaches used for identification of miRNAs, tasiRN...

  8. Regulation of tRNA biogenesis in plants and its link to plant growth and response to pathogens.

    Science.gov (United States)

    Soprano, Adriana Santos; Smetana, Juliana Helena Costa; Benedetti, Celso Eduardo

    2017-12-06

    The field of tRNA biology, encompassing the functional and structural complexity of tRNAs, has fascinated scientists over the years and is continuously growing. Besides their fundamental role in protein translation, new evidence indicates that tRNA-derived molecules also regulate gene expression and protein synthesis in all domains of life. This review highlights some of the recent findings linking tRNA transcription and modification with plant cell growth and response to pathogens. In fact, mutations in proteins directly involved in tRNA synthesis and modification most often lead to pleiotropic effects on plant growth and immunity. As plants need to optimize and balance their energy and nutrient resources towards growth and defense, regulatory pathways that play a central role in integrating tRNA transcription and protein translation with cell growth control and organ development, such as the auxin-TOR signaling pathway, also influence the plant immune response against pathogens. As a consequence, distinct pathogens employ an array of effector molecules including tRNA fragments to target such regulatory pathways to exploit the plant's translational capacity, gain access to nutrients and evade defenses. An example includes the RNA polymerase III repressor MAF1, a conserved component of the TOR signaling pathway that controls ribosome biogenesis and tRNA synthesis required for plant growth and which is targeted by a pathogen effector molecule to promote disease. This article is part of a Special Issue entitled: SI: Regulation of tRNA synthesis and modification in physiological conditions and disease edited by Dr. Boguta Magdalena. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. RNA interference: A novel tool for plant disease management ...

    African Journals Online (AJOL)

    Plant diseases pose a huge threat to crop production globally. Variations in their genomes cause selection to favor those who can survive pesticides and Bacillus thuringiensis (Bt) crops. Though plant breeding has been the classical means of manipulating the plant genome to develop resistant cultivar for controlling plant ...

  10. Function and anatomy of plant siRNA pools derived from hairpin transgenes

    Directory of Open Access Journals (Sweden)

    Lee Kevin AW

    2007-11-01

    Full Text Available Abstract Background RNA interference results in specific gene silencing by small-interfering RNAs (siRNAs. Synthetic siRNAs provide a powerful tool for manipulating gene expression but high cost suggests that novel siRNA production methods are desirable. Strong evolutionary conservation of siRNA structure suggested that siRNAs will retain cross-species function and that transgenic plants expressing heterologous siRNAs might serve as useful siRNA bioreactors. Here we report a detailed evaluation of the above proposition and present evidence regarding structural features of siRNAs extracted from plants. Results Testing the gene silencing capacity of plant-derived siRNAs in mammalian cells proved to be very challenging and required partial siRNA purification and design of a highly sensitive assay. Using the above assay we found that plant-derived siRNAs are ineffective for gene silencing in mammalian cells. Plant-derived siRNAs are almost exclusively double-stranded and most likely comprise a mixture of bona fide siRNAs and aberrant partially complementary duplexes. We also provide indirect evidence that plant-derived siRNAs may contain a hitherto undetected physiological modification, distinct from 3' terminal 2-O-methylation. Conclusion siRNAs produced from plant hairpin transgenes and extracted from plants are ineffective for gene silencing in mammalian cells. Thus our findings establish that a previous claim that transgenic plants offer a cost-effective, scalable and sustainable source of siRNAs is unwarranted. Our results also indicate that the presence of aberrant siRNA duplexes and possibly a plant-specific siRNA modification, compromises the gene silencing capacity of plant-derived siRNAs in mammalian cells.

  11. RNA-dependent RNA targeting by CRISPR-Cas9

    OpenAIRE

    Strutt, Steven C; Torrez, Rachel M; Kaya, Emine; Negrete, Oscar A; Doudna, Jennifer A

    2018-01-01

    Double-stranded DNA (dsDNA) binding and cleavage by Cas9 is a hallmark of type II CRISPR-Cas bacterial adaptive immunity. All known Cas9 enzymes are thought to recognize DNA exclusively as a natural substrate, providing protection against DNA phage and plasmids. Here, we show that Cas9 enzymes from both subtypes II-A and II-C can recognize and cleave single-stranded RNA (ssRNA) by an RNA-guided mechanism that is independent of a protospacer-adjacent motif (PAM) sequence in the target RNA. RNA...

  12. Quantitative detection for plant virus's RNA-loading by dot-blot

    International Nuclear Information System (INIS)

    Chai Lihong; Xu Bujin; Chen Jishuang

    2003-01-01

    A new method, RNA dot blot combined with direct determination of the radioactivity by BIO-Imaging Analyzer (dRH-dBIA) was used for detecting RNA of plant virus in infected plant tissue. This method was used for the influence of RNA-loading level of tobacco mosaic virus (TMV) in tobacco leave tissues after treatment of a plant hormone relatives (n-Propyl dihydro-jasmonate, PDJ) in the concentration range of 0.001-10 ppm. The results indicate that after PDJ application onto tobacco leaves for 3 days all PDJ treatments cause increase of TMV RNA-loading level except 0.001 ppm treatment, and the higher the concentration, the more obvious increase was observed. This phenomenon was confirmed with semi-leaf lesion spot on Nicotiana glutinosa as a local lesion host. The dRH-dBIA method is applicable in quantitative determination of RNA without obvious artificial influence

  13. Evaluating Methods for Isolating Total RNA and Predicting the Success of Sequencing Phylogenetically Diverse Plant Transcriptomes

    Science.gov (United States)

    Bruskiewich, Richard; Burris, Jason N.; Carrigan, Charlotte T.; Chase, Mark W.; Clarke, Neil D.; Covshoff, Sarah; dePamphilis, Claude W.; Edger, Patrick P.; Goh, Falicia; Graham, Sean; Greiner, Stephan; Hibberd, Julian M.; Jordon-Thaden, Ingrid; Kutchan, Toni M.; Leebens-Mack, James; Melkonian, Michael; Miles, Nicholas; Myburg, Henrietta; Patterson, Jordan; Pires, J. Chris; Ralph, Paula; Rolf, Megan; Sage, Rowan F.; Soltis, Douglas; Soltis, Pamela; Stevenson, Dennis; Stewart, C. Neal; Surek, Barbara; Thomsen, Christina J. M.; Villarreal, Juan Carlos; Wu, Xiaolei; Zhang, Yong; Deyholos, Michael K.; Wong, Gane Ka-Shu

    2012-01-01

    Next-generation sequencing plays a central role in the characterization and quantification of transcriptomes. Although numerous metrics are purported to quantify the quality of RNA, there have been no large-scale empirical evaluations of the major determinants of sequencing success. We used a combination of existing and newly developed methods to isolate total RNA from 1115 samples from 695 plant species in 324 families, which represents >900 million years of phylogenetic diversity from green algae through flowering plants, including many plants of economic importance. We then sequenced 629 of these samples on Illumina GAIIx and HiSeq platforms and performed a large comparative analysis to identify predictors of RNA quality and the diversity of putative genes (scaffolds) expressed within samples. Tissue types (e.g., leaf vs. flower) varied in RNA quality, sequencing depth and the number of scaffolds. Tissue age also influenced RNA quality but not the number of scaffolds ≥1000 bp. Overall, 36% of the variation in the number of scaffolds was explained by metrics of RNA integrity (RIN score), RNA purity (OD 260/230), sequencing platform (GAIIx vs HiSeq) and the amount of total RNA used for sequencing. However, our results show that the most commonly used measures of RNA quality (e.g., RIN) are weak predictors of the number of scaffolds because Illumina sequencing is robust to variation in RNA quality. These results provide novel insight into the methods that are most important in isolating high quality RNA for sequencing and assembling plant transcriptomes. The methods and recommendations provided here could increase the efficiency and decrease the cost of RNA sequencing for individual labs and genome centers. PMID:23185583

  14. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Science.gov (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  15. Tracking fungal community responses to maize plants by DNA- and RNA-based pyrosequencing

    NARCIS (Netherlands)

    Kuramae, E.E.; Verbruggen, E.; Hillekens, R.H.E.; De Hollander, M.; Röling, W.F.M.; Van der Heijden, M.G.A.; Kowalchuk, G.A.

    2013-01-01

    We assessed soil fungal diversity and community structure at two sampling times (t1 = 47 days and t2 = 104 days of plant age) in pots associated with four maize cultivars, including two genetically modified (GM) cultivars by high-throughput pyrosequencing of the 18S rRNA gene using DNA and RNA

  16. General enumeration of RNA secondary structures based on new ...

    African Journals Online (AJOL)

    akpobome

    In Biology, the nucleic acids play an important role in coding, transferring and retrieving genetic information, and in directing cell metabolism. The nucleic acid includes DNA and RNA molecule. RNA molecule is a single-stranded nucleic acid of four different kinds of nucleotides. The four nucleotides only differ by one part,.

  17. Terahertz time-domain spectroscopy and imaging of artificial RNA

    DEFF Research Database (Denmark)

    Fischer, Bernd M.; Hoffmann, Matthias; Helm, Hanspeter

    2005-01-01

    We use terahertz time-domain spectroscopy (THz-TDS) to measure the far-infrared dielectric function of two artificial RNA single strands, composed of polyadenylic acid (poly-A) and polycytidylic acid (poly-C). We find a significant difference in the absorption between the two types of RNA strands...

  18. Tracking fungal community responses to maize plants by DNA- and RNA-based pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Eiko E Kuramae

    Full Text Available We assessed soil fungal diversity and community structure at two sampling times (t1 = 47 days and t2 = 104 days of plant age in pots associated with four maize cultivars, including two genetically modified (GM cultivars by high-throughput pyrosequencing of the 18S rRNA gene using DNA and RNA templates. We detected no significant differences in soil fungal diversity and community structure associated with different plant cultivars. However, DNA-based analyses yielded lower fungal OTU richness as compared to RNA-based analyses. Clear differences in fungal community structure were also observed in relation to sampling time and the nucleic acid pool targeted (DNA versus RNA. The most abundant soil fungi, as recovered by DNA-based methods, did not necessary represent the most "active" fungi (as recovered via RNA. Interestingly, RNA-derived community compositions at t1 were highly similar to DNA-derived communities at t2, based on presence/absence measures of OTUs. We recovered large proportions of fungal sequences belonging to arbuscular mycorrhizal fungi and Basidiomycota, especially at the RNA level, suggesting that these important and potentially beneficial fungi are not affected by the plant cultivars nor by GM traits (Bt toxin production. Our results suggest that even though DNA- and RNA-derived soil fungal communities can be very different at a given time, RNA composition may have a predictive power of fungal community development through time.

  19. NOVOMIR: De Novo Prediction of MicroRNA-Coding Regions in a Single Plant-Genome

    Science.gov (United States)

    Teune, Jan-Hendrik; Steger, Gerhard

    2010-01-01

    MicroRNAs (miRNA) are small regulatory, noncoding RNA molecules that are transcribed as primary miRNAs (pri-miRNA) from eukaryotic genomes. At least in plants, their regulatory activity is mediated through base-pairing with protein-coding messenger RNAs (mRNA) followed by mRNA degradation or translation repression. We describe NOVOMIR, a program for the identification of miRNA genes in plant genomes. It uses a series of filter steps and a statistical model to discriminate a pre-miRNA from other RNAs and does rely neither on prior knowledge of a miRNA target nor on comparative genomics. The sensitivity and specificity of NOVOMIR for detection of premiRNAs from Arabidopsis thaliana is ~0.83 and ~0.99, respectively. Plant pre-miRNAs are more heterogeneous with respect to size and structure than animal pre-miRNAs. Despite these difficulties, NOVOMIR is well suited to perform searches for pre-miRNAs on a genomic scale. NOVOMIR is written in Perl and relies on two additional, free programs for prediction of RNA secondary structure (RNALFOLD, RNASHAPES). PMID:20871826

  20. Efficient double-stranded RNA production methods for utilization in plant virus control.

    Science.gov (United States)

    Voloudakis, Andreas E; Holeva, Maria C; Sarin, L Peter; Bamford, Dennis H; Vargas, Marisol; Poranen, Minna M; Tenllado, Francisco

    2015-01-01

    Double-stranded RNA (dsRNA) is an inducer molecule of the RNA silencing (RNA interference, RNAi) pathway that is present in all higher eukaryotes and controls gene expression at the posttranscriptional level. This mechanism allows the cell to recognize aberrant genetic material in a highly sequence specific manner. This ultimately leads to degradation of the homologous target sequence, rendering the plant cell resistant to subcellular pathogens. Consequently, dsRNA-mediated resistance has been exploited in transgenic plants to convey resistance against viruses. In addition, it has been shown that enzymatically synthesized specific dsRNA molecules can be applied directly onto plant tissue to induce resistance against the cognate virus. This strongly implies that dsRNA molecules are applicable as efficacious agents in crop protection, which will fuel the demand for cost-effective dsRNA production methods. In this chapter, the different methods for dsRNA production-both in vitro and in vivo-are described in detail.

  1. Nascent RNA sequencing reveals distinct features in plant transcription

    OpenAIRE

    Hetzel, Jonathan; Duttke, Sascha H.; Benner, Christopher; Chory, Joanne

    2016-01-01

    Transcription is a fundamental and dynamic step in the regulation of gene expression, but the characteristics of plant transcription are poorly understood. We adapted the global nuclear run-on sequencing (GRO-seq) and 5′GRO-seq methods for plants and provide a plant version of the next-generation sequencing software HOMER (homer.ucsd.edu/homer/plants) to facilitate data analysis. Mapping nascent transcripts in Arabidopsis thaliana seedlings enabled identification of known and novel transcript...

  2. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus

    Science.gov (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.

    2016-01-01

    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  3. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy

    OpenAIRE

    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried

    2013-01-01

    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  4. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  5. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.

    1989-01-01

    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  6. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  7. Analysis of plant-derived miRNAs in animal small RNA datasets

    Directory of Open Access Journals (Sweden)

    Zhang Yuanji

    2012-08-01

    Full Text Available Abstract Background Plants contain significant quantities of small RNAs (sRNAs derived from various sRNA biogenesis pathways. Many of these sRNAs play regulatory roles in plants. Previous analysis revealed that numerous sRNAs in corn, rice and soybean seeds have high sequence similarity to animal genes. However, exogenous RNA is considered to be unstable within the gastrointestinal tract of many animals, thus limiting potential for any adverse effects from consumption of dietary RNA. A recent paper reported that putative plant miRNAs were detected in animal plasma and serum, presumably acquired through ingestion, and may have a functional impact in the consuming organisms. Results To address the question of how common this phenomenon could be, we searched for plant miRNAs sequences in public sRNA datasets from various tissues of mammals, chicken and insects. Our analyses revealed that plant miRNAs were present in the animal sRNA datasets, and significantly miR168 was extremely over-represented. Furthermore, all or nearly all (>96% miR168 sequences were monocot derived for most datasets, including datasets for two insects reared on dicot plants in their respective experiments. To investigate if plant-derived miRNAs, including miR168, could accumulate and move systemically in insects, we conducted insect feeding studies for three insects including corn rootworm, which has been shown to be responsive to plant-produced long double-stranded RNAs. Conclusions Our analyses suggest that the observed plant miRNAs in animal sRNA datasets can originate in the process of sequencing, and that accumulation of plant miRNAs via dietary exposure is not universal in animals.

  8. Noncoding RNA mediated traffic of foreign mRNA into chloroplasts reveals a novel signaling mechanism in plants.

    Directory of Open Access Journals (Sweden)

    Gustavo Gómez

    Full Text Available Communication between chloroplasts and the nucleus is one of the milestones of the evolution of plants on earth. Proteins encoded by ancestral chloroplast-endogenous genes were transferred to the nucleus during the endosymbiotic evolution and originated this communication, which is mainly dependent on specific transit-peptides. However, the identification of nuclear-encoded proteins targeted to the chloroplast lacking these canonical signals suggests the existence of an alternative cellular pathway tuning this metabolic crosstalk. Non-coding RNAS (NcRNAs are increasingly recognized as regulators of gene expression as they play roles previously believed to correspond to proteins. Avsunviroidae family viroids are the only noncoding functional RNAs that have been reported to traffic inside the chloroplasts. Elucidating mechanisms used by these pathogens to enter this organelle will unearth novel transport pathways in plant cells. Here we show that a viroid-derived NcRNA acting as a 5'UTR-end mediates the functional import of Green Fluorescent Protein (GFP mRNA into chloroplast. This claim is supported by the observation at confocal microscopy of a selective accumulation of GFP in the chloroplast of the leaves expressing the chimeric vd-5'UTR/GFP and by the detection of the GFP mRNA in chloroplasts isolated from cells expressing this construct. These results support the existence of an alternative signaling mechanism in plants between the host cell and chloroplasts, where an ncRNA functions as a key regulatory molecule to control the accumulation of nuclear-encoded proteins in this organelle. In addition, our findings provide a conceptual framework to develop new biotechnological tools in systems using plant chloroplast as bioreactors. Finally, viroids of the family Avsunviroidae have probably evolved to subvert this signaling mechanism to regulate their differential traffic into the chloroplast of infected cells.

  9. Nucleic acids encoding phloem small RNA-binding proteins and transgenic plants comprising them

    Science.gov (United States)

    Lucas, William J.; Yoo, Byung-Chun; Lough, Tony J.; Varkonyi-Gasic, Erika

    2007-03-13

    The present invention provides a polynucleotide sequence encoding a component of the protein machinery involved in small RNA trafficking, Cucurbita maxima phloem small RNA-binding protein (CmPSRB 1), and the corresponding polypeptide sequence. The invention also provides genetic constructs and transgenic plants comprising the polynucleotide sequence encoding a phloem small RNA-binding protein to alter (e.g., prevent, reduce or elevate) non-cell autonomous signaling events in the plants involving small RNA metabolism. These signaling events are involved in a broad spectrum of plant physiological and biochemical processes, including, for example, systemic resistance to pathogens, responses to environmental stresses, e.g., heat, drought, salinity, and systemic gene silencing (e.g., viral infections).

  10. Phomopsis longicolla RNA virus 1 - Novel virus at the edge of myco- and plant viruses.

    Science.gov (United States)

    Hrabáková, Lenka; Koloniuk, Igor; Petrzik, Karel

    2017-06-01

    The complete nucleotide sequence of a new RNA mycovirus in the KY isolate of Phomopsis longicolla Hobbs 1985 and its protoplasts subcultures p5, p9, and ME711 was discovered. The virus, provisionally named Phomopsis longicolla RNA virus 1 (PlRV1), was localized in mitochondria and was determined to have a genome 2822 nucleotides long. A single open reading frame could be translated in silico by both standard and mitochondrial genetic codes into a product featuring conservative domains for an RNA-dependent RNA polymerase (RdRp). The RdRp of PlRV1 has no counterpart among mycoviruses, but it is about 30% identical with the RdRp of plant ourmiaviruses. Recently, new mycoviruses related to plant ourmiaviruses and forming one clade with PlRV1 have been discovered. This separate clade could represent the crucial link between plant and fungal viruses. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Plant tumour biocontrol agent employs a tRNA-dependent mechanism to inhibit leucyl-tRNA synthetase.

    Science.gov (United States)

    Chopra, Shaileja; Palencia, Andrés; Virus, Cornelia; Tripathy, Ashutosh; Temple, Brenda R; Velazquez-Campoy, Adrian; Cusack, Stephen; Reader, John S

    2013-01-01

    Leucyl-tRNA synthetases (LeuRSs) have an essential role in translation and are promising targets for antibiotic development. Agrocin 84 is a LeuRS inhibitor produced by the biocontrol agent Agrobacterium radiobacter K84 that targets pathogenic strains of A. tumefaciens, the causative agent of plant tumours. Agrocin 84 acts as a molecular Trojan horse and is processed inside the pathogen into a toxic moiety (TM84). Here we show using crystal structure, thermodynamic and kinetic analyses, that this natural antibiotic employs a unique and previously undescribed mechanism to inhibit LeuRS. TM84 requires tRNA(Leu) for tight binding to the LeuRS synthetic active site, unlike any previously reported inhibitors. TM84 traps the enzyme-tRNA complex in a novel 'aminoacylation-like' conformation, forming novel interactions with the KMSKS loop and the tRNA 3'-end. Our findings reveal an intriguing tRNA-dependent inhibition mechanism that may confer a distinct evolutionary advantage in vivo and inform future rational antibiotic design.

  12. Recovery of amiRNA3-PARP1 transgenic maize plants using a ...

    African Journals Online (AJOL)

    Positive plant selectable marker genes are commonly used in plant transformation because they not only enhance the frequency of generation transgenic tissues but are considered biosafe, unlike antibiotic or herbicide resistance genes. In this study, the binary vector pNOV2819-ubiamiRNA3PARP1, harbouring the ...

  13. RECOVERY OF amiRNA3-PARP1 TRANSGENIC MAIZE PLANTS ...

    African Journals Online (AJOL)

    ACSS

    Positive plant selectable marker genes are commonly used in plant transformation because they not only enhance the frequency of generation transgenic tissues but are considered biosafe, unlike antibiotic or herbicide resistance genes. In this study, the binary vector pNOV2819-ubiamiRNA3PARP1, harbouring the ...

  14. De novo reconstruction of plant RNA and DNA virus genomes from viral siRNAs

    Science.gov (United States)

    In antiviral defense, plants produce massive quantities of 21-24 nucleotide siRNAs. Here we demonstrate that the complete genomes of DNA and RNA viruses and viroids can be reconstructed by deep sequencing and de novo assembly of viral/viroid siRNAs from experimentally- and naturally-infected plants....

  15. Plant science. Genomic-scale exchange of mRNA between a parasitic plant and its hosts.

    Science.gov (United States)

    Kim, Gunjune; LeBlanc, Megan L; Wafula, Eric K; dePamphilis, Claude W; Westwood, James H

    2014-08-15

    Movement of RNAs between cells of a single plant is well documented, but cross-species RNA transfer is largely unexplored. Cuscuta pentagona (dodder) is a parasitic plant that forms symplastic connections with its hosts and takes up host messenger RNAs (mRNAs). We sequenced transcriptomes of Cuscuta growing on Arabidopsis and tomato hosts to characterize mRNA transfer between species and found that mRNAs move in high numbers and in a bidirectional manner. The mobile transcripts represented thousands of different genes, and nearly half the expressed transcriptome of Arabidopsis was identified in Cuscuta. These findings demonstrate that parasitic plants can exchange large proportions of their transcriptomes with hosts, providing potential mechanisms for RNA-based interactions between species and horizontal gene transfer. Copyright © 2014, American Association for the Advancement of Science.

  16. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  17. Oxidized base damage and single-strand break repair in mammalian genomes: role of disordered regions and posttranslational modifications in early enzymes.

    Science.gov (United States)

    Hegde, Muralidhar L; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic endonuclease 1 (APE1), form complexes with downstream repair (and other noncanonical) proteins via pairwise interactions. Furthermore, a unique feature of mammalian early BER/SSBR enzymes is the presence of a disordered terminal extension that is absent in their Escherichia coli prototypes. These nonconserved segments usually contain organelle-targeting signals, common interaction interfaces, and sites of posttranslational modifications that may be involved in regulating their repair function including lesion scanning. Finally, the linkage of BER/SSBR deficiency to cancer, aging, and human neurodegenerative diseases, and therapeutic targeting of BER/SSBR are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Isolation and characterization of a single-stranded DNA virus infecting the marine diatom Chaetoceros sp. strain SS628-11 isolated from western Japan.

    Directory of Open Access Journals (Sweden)

    Kei Kimura

    Full Text Available Diatoms are significant organisms for primary production in the earth's aquatic environment. Hence, their dynamics are an important focus area in current studies. Viruses are a great concern as potential factors of diatom mortality, along with other physical, chemical, and biological factors. We isolated and characterized a new diatom virus (Csp07DNAV that lyses the marine planktonic diatom Chaetoceros sp. strain SS628-11. This paper examines the physiological, morphological, and genomic characteristics of Csp07DNAV. The virus was isolated from a surface water sample that was collected at Hiroshima Bay, Japan. It was icosahedral, had a diameter of 34 nm, and accumulated in the nuclei of host cells. Rod-shaped virus particles also coexisted in the host nuclei. The latent period and burst size were estimated to be <12 h and 29 infectious units per host cell, respectively. Csp07DNAV had a closed circular single-stranded DNA genome (5,552 nucleotides, which included a double-stranded region and 3 open reading frames. The monophyly of Csp07DNAV and other Bacilladnavirus group single-stranded DNA viruses was supported by phylogenetic analysis that was based on the amino acid sequence of each virus protein. On the basis of these results, we considered Csp07DNAV to be a new member of the genus Bacilladnavirus.

  19. Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library.

    Directory of Open Access Journals (Sweden)

    Sumate Pengpumkiat

    Full Text Available Chemical synthesis of oligonucleotides is a widely used tool in the field of biochemistry. Several methods for gene synthesis have been introduced in the growing area of genomics. In this paper, a novel method of constructing dsDNA is proposed. Short (28-mer oligo fragments from a library were assembled through successive annealing and ligation processes, followed by PCR. First, two oligo fragments annealed to form a dsDNA molecule. The double-stranded oligo was immobilized onto magnetic beads (solid support via streptavidin-biotin binding. Next, single-stranded oligo fragments were added successively through ligation to form the complete DNA molecule. The synthesized DNA was amplified through PCR and gel electrophoresis was used to characterize the product. Sanger sequencing showed that more than 97% of the nucleotides matched the expected sequence. Extending the length of the DNA molecule by adding single-stranded oligonucleotides from a basis set (library via ligation enables a more convenient and rapid mechanism for the design and synthesis of oligonucleotides on the go. Coupled with an automated dispensing system and libraries of short oligo fragments, this novel DNA synthesis method would offer an efficient and cost-effective method for producing dsDNA.

  20. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  1. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H

    2012-02-22

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  2. On-site detection of Phytophthora spp.—single-stranded target DNA as the limiting factor to improve on-chip hybridization

    International Nuclear Information System (INIS)

    Schwenkbier, Lydia; Pollok, Sibyll; Popp, Jürgen; Weber, Karina; König, Stephan; Wagner, Stefan; Werres, Sabine; Weber, Jörg; Hentschel, Martin

    2014-01-01

    We report on a lab-on-a-chip approach for on-site detection of Phytophthora species that allows visual signal readout. The results demonstrate the significance of single-stranded DNA (ssDNA) generation in terms of improving the intensity of the hybridization signal and to improve the reliability of the method. Conventional PCR with subsequent heat denaturation, sodium hydroxide-based denaturation, lambda exonuclease digestion and two asymmetric PCR methods were investigated for the species P. fragariae, P. kernoviae, and P. ramorum. The positioning of the capture probe within the amplified yeast GTP-binding protein (YPT1) target DNA was also of interest because it significantly influences the intensity of the signal. Statistical tests were used to validate the impact of the ssDNA generation methods and the capture-target probe position. The single-stranded target DNA generated by Linear-After-The-Exponential PCR (LATE-PCR) was found to produce signal intensities comparable to post-PCR exonuclease treatment. The LATE-PCR is the best method for the on-site detection of Phytophthora because the enzymatic digestion after PCR is more laborious and time-consuming. (author)

  3. The influenza A virus NS1 protein binds small interfering RNAs and suppresses RNA silencing in plants

    NARCIS (Netherlands)

    Bucher, E.C.; Hemmes, J.C.; Haan, de P.; Goldbach, R.W.; Prins, M.W.

    2004-01-01

    RNA silencing comprises a set of sequence-specific RNA degradation pathways that occur in a wide range of eukaryotes, including animals, fungi and plants. A hallmark of RNA silencing is the presence of small interfering RNA molecules (siRNAs). The siRNAs are generated by cleavage of larger

  4. Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus.

    Science.gov (United States)

    Le, Dung Tien; Chu, Ha Duc; Sasaya, Takahide

    2015-01-01

    Rice tungro spherical virus (RTSV), also known as Rice waika virus, does not cause visible symptoms in infected rice plants. However, the virus plays a critical role in spreading Rice tungro bacilliform virus (RTBV), which is the major cause of severe symptoms of rice tungro disease. Recent studies showed that RNA interference (RNAi) can be used to develop virus-resistance transgenic rice plants. In this report, we presented simple procedures and protocols needed for the creation of transgenic rice plants capable of producing small interfering RNA specific against RTSV sequences. Notably, our study showed that 60 out of 64 individual hygromycin-resistant lines (putative transgenic lines) obtained through transformation carried transgenes designed for producing hairpin double-stranded RNA. Northern blot analyses revealed the presence of small interfering RNA of 21- to 24-mer in 46 out of 56 confirmed transgenic lines. Taken together, our study indicated that transgenic rice plants carrying an inverted repeat of 500-bp fragments encoding various proteins of RTSV can produce small interfering RNA from the hairpin RNA transcribed from that transgene. In light of recent studies with other viruses, it is possible that some of these transgenic rice lines might be resistant to RTSV.

  5. Combined DECS Analysis and Next-Generation Sequencing Enable Efficient Detection of Novel Plant RNA Viruses.

    Science.gov (United States)

    Yanagisawa, Hironobu; Tomita, Reiko; Katsu, Koji; Uehara, Takuya; Atsumi, Go; Tateda, Chika; Kobayashi, Kappei; Sekine, Ken-Taro

    2016-03-07

    The presence of high molecular weight double-stranded RNA (dsRNA) within plant cells is an indicator of infection with RNA viruses as these possess genomic or replicative dsRNA. DECS (dsRNA isolation, exhaustive amplification, cloning, and sequencing) analysis has been shown to be capable of detecting unknown viruses. We postulated that a combination of DECS analysis and next-generation sequencing (NGS) would improve detection efficiency and usability of the technique. Here, we describe a model case in which we efficiently detected the presumed genome sequence of Blueberry shoestring virus (BSSV), a member of the genus Sobemovirus, which has not so far been reported. dsRNAs were isolated from BSSV-infected blueberry plants using the dsRNA-binding protein, reverse-transcribed, amplified, and sequenced using NGS. A contig of 4,020 nucleotides (nt) that shared similarities with sequences from other Sobemovirus species was obtained as a candidate of the BSSV genomic sequence. Reverse transcription (RT)-PCR primer sets based on sequences from this contig enabled the detection of BSSV in all BSSV-infected plants tested but not in healthy controls. A recombinant protein encoded by the putative coat protein gene was bound by the BSSV-antibody, indicating that the candidate sequence was that of BSSV itself. Our results suggest that a combination of DECS analysis and NGS, designated here as "DECS-C," is a powerful method for detecting novel plant viruses.

  6. MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense.

    Science.gov (United States)

    Liu, Sheng-Rui; Zhou, Jing-Jing; Hu, Chun-Gen; Wei, Chao-Ling; Zhang, Jin-Zhi

    2017-01-01

    MicroRNAs (miRNAs) are non-coding RNAs of approximately 20-24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant-pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.

  7. RNA Isolation from Plant Tissues: A Hands-on Laboratory Experimental Experience for Undergraduates.

    Science.gov (United States)

    Zhang, Nianhui; Yu, Dong; Zhu, Xiaofeng

    2017-12-29

    The practice of RNA isolation in undergraduate experimental courses is rare because of the existence of robust, ubiquitous and stable ribonucleases. We reported here modifications to our original protocol for RNA isolation from plant tissues, including the recovery of nucleic acids by ethanol precipitation at 0 °C for 10 min and the assessment of RNA quality by visualizing the banding profile of the separated RNAs on a standard nondenaturing agarose gel to shorten the duration of the whole procedure and simplify the operation. As a result, the modified procedure, including RNA isolation and quality control analysis could be finished in 4 hr and divided into two sessions. Because endogenous ribonucleases released upon disruption of the organelles and vacuoles were effectively and quickly inactivated, measures were taken to protect RNA integrity throughout the whole procedure so that total RNA with high purity and integrity as well as an appropriate yield could be obtained by students. The RNA isolation protocol described here was simple, efficient, flexible, and low cost. Therefore, it is an ideal approach for undergraduates to learn about RNA techniques. The pedagogical approach of the correlation of experimental work with the rationale for the whole protocol described in this report is an effective way for undergraduates to improve their learning of the techniques of RNA isolation and analysis and the theories behind them, as well as experimental design and data analysis. © 2017 by The International Union of Biochemistry and Molecular Biology, 2017. © 2017 The International Union of Biochemistry and Molecular Biology.

  8. An RNA isolation system for plant tissues rich in secondary metabolites

    Science.gov (United States)

    2011-01-01

    Background Secondary metabolites are reported to interfere with the isolation of RNA particularly with the recipes that use guanidinium-based salt. Such interference was observed in isolation of RNA with medicinal plants rheum (Rheum australe) and arnebia (Arnebia euchroma). A rapid and less cumbersome system for isolation of RNA was essential to facilitate any study related to gene expression. Findings An RNA isolation system free of guanidinium salt was developed that successfully isolated RNA from rheum and arnebia. The method took about 45 min and was successfully evaluated on twenty one tissues with varied secondary metabolites. The A260/280 ratio ranged between 1.8 - 2.0 with distinct 28 S and 18 S rRNA bands visible on a formaldehyde-agarose gel. Conclusions The present manuscript describes a rapid protocol for isolation of RNA, which works well with all the tissues examined so far. The remarkable feature was the success in isolation of RNA with those tissues, wherein the most commonly used methods failed. Isolated RNA was amenable to downstream applications such as reverse transcription-polymerase chain reaction (RT-PCR), differential display (DD), suppression subtractive hybridization (SSH) library construction, and northern hybridization. PMID:21443767

  9. An RNA isolation system for plant tissues rich in secondary metabolites

    Directory of Open Access Journals (Sweden)

    Bhardwaj Pardeep K

    2011-03-01

    Full Text Available Abstract Background Secondary metabolites are reported to interfere with the isolation of RNA particularly with the recipes that use guanidinium-based salt. Such interference was observed in isolation of RNA with medicinal plants rheum (Rheum australe and arnebia (Arnebia euchroma. A rapid and less cumbersome system for isolation of RNA was essential to facilitate any study related to gene expression. Findings An RNA isolation system free of guanidinium salt was developed that successfully isolated RNA from rheum and arnebia. The method took about 45 min and was successfully evaluated on twenty one tissues with varied secondary metabolites. The A260/280 ratio ranged between 1.8 - 2.0 with distinct 28 S and 18 S rRNA bands visible on a formaldehyde-agarose gel. Conclusions The present manuscript describes a rapid protocol for isolation of RNA, which works well with all the tissues examined so far. The remarkable feature was the success in isolation of RNA with those tissues, wherein the most commonly used methods failed. Isolated RNA was amenable to downstream applications such as reverse transcription-polymerase chain reaction (RT-PCR, differential display (DD, suppression subtractive hybridization (SSH library construction, and northern hybridization.

  10. Supervised learning classification models for prediction of plant virus encoded RNA silencing suppressors.

    Directory of Open Access Journals (Sweden)

    Zeenia Jagga

    Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a

  11. Plant micro-RNA identification and transfer– a new dimension to herbal medicine

    Directory of Open Access Journals (Sweden)

    Maria Sala-Cîrtog

    2016-12-01

    Full Text Available INTRODUCTION MicroRNAs (miRNAs are a group of small, noncoding endogenous RNA (21-25 nucleotides long with an important role in gene expression regulation by targeting specific mRNAs in plants, animals and humans. To date, no miRNAs from marigold (Calendula officinalis, one of the best known medicinal plants, have been identified. OBJECTIVES AND BACKGROUND Identification of plant microRNAs that survive the passage through the gastrointestinal tract following digestion in mice MATERIALS AND METHODS - Small plant RNA isolation and extraction -Sequencing data analysis and plant miRNA identification -Animal experiment RESULTS The cDNA libraries of two tissues from Calendula (petals and inflorescence were prepared and small RNAseq were conducted according to Illumina's protocols. A total number of 4 miRNAs, with 0 mismatches, (mir166a, lus-mir166e, ppt-mir894 and ath-mir8175, were identified based on their sequence complementarities. CONCLUSIONS The potentially conserved miRNAs from Calendula were identifiend only in inflorescence, the part that is being used for medicinal purposes. These aspects could lead to a better comprehension of the relationship between exogenous plant genetic material and the changes that occur in mammals following oral ingestion. REFERENCES 1.Wen J-Z, Liao J-Y, Zheng L-L, Xu H, Yang J-H et al. A Contig- Based Strategy for the Genome-Wide Discovery of MicroRNAs without Complete Genome Resources. PLoS ONE. 2014;9: e88179. 2.Liang GF, Zhu YL, Sun B, Shao Y, Jing A, Wang J et al. Assessing the survival of exogenous plant microRNA in mice. Food Sci Nutr. 2014. 3.Zhang L, Hou D, Chen x, et al. Exogenous plant MIR168a specifically targets mammalian LDLRAP1: evidence of cross-kingdom regulation by microRNA. Cell Research. 2012; 22:107-126.

  12. Phylogenetic distribution of plant snoRNA families

    DEFF Research Database (Denmark)

    Patra Bhattacharya, Deblina; Canzler, Sebastian; Kehr, Stephanie

    2016-01-01

    BACKGROUND: Small nucleolar RNAs (snoRNAs) are one of the most ancient families amongst non-protein-coding RNAs. They are ubiquitous in Archaea and Eukarya but absent in bacteria. Their main function is to target chemical modifications of ribosomal RNAs. They fall into two classes, box C/D snoRNA...... snoRNAs are frequently organized in highly conserved spatial clusters. As a resource for further investigations we provide carefully curated and annotated alignments for each snoRNA family under investigation.......BACKGROUND: Small nucleolar RNAs (snoRNAs) are one of the most ancient families amongst non-protein-coding RNAs. They are ubiquitous in Archaea and Eukarya but absent in bacteria. Their main function is to target chemical modifications of ribosomal RNAs. They fall into two classes, box C/D sno......RNAs and box H/ACA snoRNAs, which are clearly distinguished by conserved sequence motifs and the type of chemical modification that they govern. Similarly to microRNAs, snoRNAs appear in distinct families of homologs that affect homologous targets. In animals, snoRNAs and their evolution have been studied...

  13. RNA interference in plant parasitic nematodes | Karakas | African ...

    African Journals Online (AJOL)

    Conserved in most eukaryotic organisms, the RNAi pathway is thought to have evolved as a form of innate immunity against viruses and also plays a major role in regulating development and genome maintenance. RNAi has recently been demonstrated in plant parasitic nematodes. It is a potentially powerful investigative ...

  14. Regulation of mRNA decay in plant responses to salt and osmotic stress.

    Science.gov (United States)

    Kawa, Dorota; Testerink, Christa

    2017-04-01

    Plant acclimation to environmental stresses requires fast signaling to initiate changes in developmental and metabolic responses. Regulation of gene expression by transcription factors and protein kinases acting upstream are important elements of responses to salt and drought. Gene expression can be also controlled at the post-transcriptional level. Recent analyses on mutants in mRNA metabolism factors suggest their contribution to stress signaling. Here we highlight the components of mRNA decay pathways that contribute to responses to osmotic and salt stress. We hypothesize that phosphorylation state of proteins involved in mRNA decapping affect their substrate specificity.

  15. A Role for the F-Box Protein HAWAIIAN SKIRT in Plant microRNA Function.

    Science.gov (United States)

    Lang, Patricia L M; Christie, Michael D; Dogan, Ezgi S; Schwab, Rebecca; Hagmann, Jörg; van de Weyer, Anna-Lena; Scacchi, Emanuele; Weigel, Detlef

    2018-01-01

    As regulators of gene expression in multicellular organisms, microRNAs (miRNAs) are crucial for growth and development. Although a plethora of factors involved in their biogenesis and action in Arabidopsis ( Arabidopsis thaliana ) has been described, these processes and their fine-tuning are not fully understood. Here, we used plants expressing an artificial miRNA target mimic (MIM) to screen for negative regulators of miR156. We identified a new mutant allele of the F-box gene HAWAIIAN SKIRT ( HWS ; At3G61590), hws - 5 , as a suppressor of the MIM156 -induced developmental and molecular phenotypes. In hws plants, levels of some endogenous miRNAs are increased and their mRNA targets decreased. Plants constitutively expressing full-length HWS-but not a truncated version lacking the F-box domain-display morphological and molecular phenotypes resembling those of mutants defective in miRNA biogenesis and activity. In combination with such mutants, hws loses its delayed floral organ abscission ("skirt") phenotype, suggesting epistasis. Also, the hws transcriptome profile partially resembles those of well-known miRNA mutants hyl1 - 2 , se - 3 , and ago1 - 27 , pointing to a role in a common pathway. We thus propose HWS as a novel, F-box dependent factor involved in miRNA function. © 2018 American Society of Plant Biologists. All Rights Reserved.

  16. Phytophthora effector targets a novel component of small RNA pathway in plants to promote infection.

    Science.gov (United States)

    Qiao, Yongli; Shi, Jinxia; Zhai, Yi; Hou, Yingnan; Ma, Wenbo

    2015-05-05

    A broad range of parasites rely on the functions of effector proteins to subvert host immune response and facilitate disease development. The notorious Phytophthora pathogens evolved effectors with RNA silencing suppression activity to promote infection in plant hosts. Here we report that the Phytophthora Suppressor of RNA Silencing 1 (PSR1) can bind to an evolutionarily conserved nuclear protein containing the aspartate-glutamate-alanine-histidine-box RNA helicase domain in plants. This protein, designated PSR1-Interacting Protein 1 (PINP1), regulates the accumulation of both microRNAs and endogenous small interfering RNAs in Arabidopsis. A null mutation of PINP1 causes embryonic lethality, and silencing of PINP1 leads to developmental defects and hypersusceptibility to Phytophthora infection. These phenotypes are reminiscent of transgenic plants expressing PSR1, supporting PINP1 as a direct virulence target of PSR1. We further demonstrate that the localization of the Dicer-like 1 protein complex is impaired in the nucleus of PINP1-silenced or PSR1-expressing cells, indicating that PINP1 may facilitate small RNA processing by affecting the assembly of dicing complexes. A similar function of PINP1 homologous genes in development and immunity was also observed in Nicotiana benthamiana. These findings highlight PINP1 as a previously unidentified component of RNA silencing that regulates distinct classes of small RNAs in plants. Importantly, Phytophthora has evolved effectors to target PINP1 in order to promote infection.

  17. Using single strand conformational polymorphisms (SSCP) to identify Phytophthora species in Oregon forests affected by sudden oak death

    Science.gov (United States)

    E. Hansen; C. Hesse; P. Reeser; W. Sutton; L. Winton

    2006-01-01

    Phytophthora species are abundant in streams, widespread in soils and occasionally found in diseased plants in the tanoak forests of southwestern Oregon. It is time-consuming and expensive to identify hundreds of isolates to species using morphology or internal transribed spacer (ITS) sequencing. We modified a published Phytophthora...

  18. Pre-mRNA splicing repression triggers abiotic stress signaling in plants

    KAUST Repository

    Ling, Yu

    2016-09-24

    Alternative splicing (AS) of precursor RNAs enhances transcriptome plasticity and proteome diversity in response to diverse growth and stress cues. Recent work has shown that AS is pervasive across plant species, with more than 60% of intron-containing genes producing different isoforms. Mammalian cell-based assays have discovered various inhibitors of AS. Here, we show that the macrolide pladienolide B (PB) inhibits constitutive splicing and AS in plants. Also, our RNA sequencing (RNA-seq) data revealed that PB mimics abiotic stress signals including salt, drought and abscisic acid (ABA). PB activates the abiotic stress- and ABA-responsive reporters RD29A

  19. RNA-dependent RNA targeting by CRISPR-Cas9.

    Science.gov (United States)

    Strutt, Steven C; Torrez, Rachel M; Kaya, Emine; Negrete, Oscar A; Doudna, Jennifer A

    2018-01-05

    Double-stranded DNA (dsDNA) binding and cleavage by Cas9 is a hallmark of type II CRISPR-Cas bacterial adaptive immunity. All known Cas9 enzymes are thought to recognize DNA exclusively as a natural substrate, providing protection against DNA phage and plasmids. Here, we show that Cas9 enzymes from both subtypes II-A and II-C can recognize and cleave single-stranded RNA (ssRNA) by an RNA-guided mechanism that is independent of a protospacer-adjacent motif (PAM) sequence in the target RNA. RNA-guided RNA cleavage is programmable and site-specific, and we find that this activity can be exploited to reduce infection by single-stranded RNA phage in vivo. We also demonstrate that Cas9 can direct PAM-independent repression of gene expression in bacteria. These results indicate that a subset of Cas9 enzymes have the ability to act on both DNA and RNA target sequences, and suggest the potential for use in programmable RNA targeting applications. © 2018, Strutt et al.

  20. Synthesis of a wild-type and three mutant Cucurbita maxima trypsin inhibitor-encoding genes by a single-strand approach.

    Science.gov (United States)

    Botes, D P; Qobose, M D; Corfield, V A

    1991-09-15

    A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.

  1. The casein genes in goat breeds from different Continents: analysis by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP

    Directory of Open Access Journals (Sweden)

    A. Caroli

    2010-04-01

    Full Text Available A screening of casein gene variability was carried out by Polymerase Chain Reaction – Single Strand Conformation Polymorphism in 8 goat breeds from Sudan (Nubian goat, Turkey (Angora Goat Lalahan Tiftic, Angora Goat Yerkoy, Hair goat and India (Jammu, Maharashtra, Rajasthan, South Goat. A total of 16 different alleles or groups of alleles were found, showing conspicuous differences among breeds. The allele frequencies were submitted to cluster analysis in order to highlight differences between breeds, also including data from Red Sokoto, West African Dwarf Nigeria, West African Dwarf Cameroon, and Borno Goat. The tree obtained from the cluster analysis showed two main lineages. The West African goat clustered together, the Indian and Turkish breeds were in the other group. Nubian goat was found in an intermediate position.

  2. Investigation of single-strand conformational polymorphism of the TP53 gene in women with a family history of breast cancer

    Directory of Open Access Journals (Sweden)

    R.R. Burbano

    2000-11-01

    Full Text Available Breast cancer in families with germ line mutations in the TP53 gene has been described in the medical literature. Mutation screening for susceptibility genes should allow effective prophylactic and preventive measures. Using single-strand conformational polymorphism, we screened for mutations in exons 5, 6, 7 and 8 of gene TP53 in the peripheral blood of 8 young non-affected members (17 to 36 years old of families with a history of breast cancer. Studies of this type on young patients (mean age, 25 years are very rare in the literature. The identification of these mutations would contribute to genetic counseling of members of families with predisposition to breast cancer. The results obtained did not show any polymorphism indicating mutation. In our sample, the familial tumorigenesis is probably related to other gene etiologies.

  3. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.

    1994-01-01

    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  4. Influence of the single-strand linker composition on the structural/dynamical properties of a truncated octahedral DNA nano-cage family.

    Science.gov (United States)

    Iacovelli, Federico; Alves, Cassio; Falconi, Mattia; Oteri, Francesco; de Oliveira, Cristiano L P; Desideri, Alessandro

    2014-10-01

    The structural/dynamical properties of three truncated octahedral DNA nano-cages composed by identical double helices but single strand linkers with different composition, namely 7 thymidines, 7 adenines, and 7 alternated thymidines and adenines, have been investigated through classical molecular dynamics simulations. Trajectories have been analyzed to investigate the role of the linkers in defining nano-cages stability and flexibility, including possible influence on the internal cages motions. The data indicate that the cages behavior is almost identical and that the structural/dynamical parameters measured along the trajectories are not particularly affected by the presence of different bases. These results demonstrate that the constraints imposed by the nano-structure geometry are the main factor in modulating these properties

  5. Localization of specific sequences and DNA single-strand breaks in individual UV-A-irradiated human lymphocytes by COMET FISH

    Science.gov (United States)

    Bock, Claudia; Rapp, Alexander; Dittmar, Heike; Monajembashi, Shamci; Greulich, Karl-Otto

    1999-01-01

    The COMET assay, a single cell electrophoresis technique which allows to separate electrophoretically fractionated DNA according to size has been combined with fluorescence in situ hybridization (FISH) which allows to localize specific genes or gene regions. This combination (COMET FISH) allows the detection of DNA single strand breaks in specific regions of the genome of human lymphocytes at the single cell level. Various types of DNA probes, e.g. centromere-, (alpha) - satellite-, telomere-, whole chromosome-, single copy- and region specific DNA probes have been used to investigate whether the UV-A induced DNA single strand breaks are distributed randomly all over the human genome or induced at specific sites ('hot spots'). In the investigated human peripheral blood lymphocytes all but one centromere reveal low sensitivity for UV-A irradiation (500 kJ/m2), while telomeres are randomly distributed over COMET heads and tails. The human chromosome 1 is fractionated by irradiation, but remains in the COMET head, indicating an only moderate degree of fractionation. Among three tested single copy probes, c- myc, p53 and p58, the p53 gene located on chromosome 17p13.1 and the p58 gene (1p36) appear to be located in UV-A stable regions of the human genome in 95% of 65 investigated lymphocytes. In contrast, the c-myc proto-oncogene (8q24) is found in the COMET tail in 90% of the 27 investigated lymphocytes and thus appears to be more sensitive to UV-A irradiation.

  6. Evidence that single-stranded DNA breaks are a normal feature of koala sperm chromatin, while double-stranded DNA breaks are indicative of DNA damage.

    Science.gov (United States)

    Zee, Yeng Peng; López-Fernández, Carmen; Arroyo, F; Johnston, Stephen D; Holt, William V; Gosalvez, Jaime

    2009-08-01

    In this study, we have used single and double comet assays to differentiate between single- and double-stranded DNA damage in an effort to refine the interpretation of DNA damage in mature koala spermatozoa. We have also investigated the likelihood that single-stranded DNA breakage is part of the natural spermiogenic process in koalas, where its function would be the generation of structural bends in the DNA molecule so that appropriate packaging and compaction can occur. Koala spermatozoa were examined using the sperm chromatin dispersion test (SCDt) and comet assays to investigate non-orthodox double-stranded DNA. Comet assays were conducted under 1) neutral conditions; and 2) neutral followed by alkaline conditions (double comet assay); the latter technique enabled simultaneous visualisation of both single-stranded and double-stranded DNA breaks. Following the SCDt, there was a continuum of nuclear morphotypes, ranging from no apparent DNA fragmentation to those with highly dispersed and degraded chromatin. Dispersion morphotypes were mirrored by a similar diversity of comet morphologies that could be further differentiated using the double comet assay. The majority of koala spermatozoa had nuclei with DNA abasic-like residues that produced single-tailed comets following the double comet assay. The ubiquity of these residues suggests that constitutive alkali-labile sites are part of the structural configuration of the koala sperm nucleus. Spermatozoa with 'true' DNA fragmentation exhibited a continuum of comet morphologies, ranging from a more severe form of alkaline-susceptible DNA with a diffuse single tail to nuclei that exhibited both single- and double-stranded breaks with two comet tails.

  7. Functional roles of the N- and C-terminal regions of the human mitochondrial single-stranded DNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Marcos T Oliveira

    2010-10-01

    Full Text Available Biochemical studies of the mitochondrial DNA (mtDNA replisome demonstrate that the mtDNA polymerase and the mtDNA helicase are stimulated by the mitochondrial single-stranded DNA-binding protein (mtSSB. Unlike Escherichia coli SSB, bacteriophage T7 gp2.5 and bacteriophage T4 gp32, mtSSBs lack a long, negatively charged C-terminal tail. Furthermore, additional residues at the N-terminus (notwithstanding the mitochondrial presequence are present in the sequence of species across the animal kingdom. We sought to analyze the functional importance of the N- and C-terminal regions of the human mtSSB in the context of mtDNA replication. We produced the mature wild-type human mtSSB and three terminal deletion variants, and examined their physical and biochemical properties. We demonstrate that the recombinant proteins adopt a tetrameric form, and bind single-stranded DNA with similar affinities. They also stimulate similarly the DNA unwinding activity of the human mtDNA helicase (up to 8-fold. Notably, we find that unlike the high level of stimulation that we observed previously in the Drosophila system, stimulation of DNA synthesis catalyzed by human mtDNA polymerase is only moderate, and occurs over a narrow range of salt concentrations. Interestingly, each of the deletion variants of human mtSSB stimulates DNA synthesis at a higher level than the wild-type protein, indicating that the termini modulate negatively functional interactions with the mitochondrial replicase. We discuss our findings in the context of species-specific components of the mtDNA replisome, and in comparison with various prokaryotic DNA replication machineries.

  8. C-mii: a tool for plant miRNA and target identification

    Directory of Open Access Journals (Sweden)

    Numnark Somrak

    2012-12-01

    Full Text Available Abstract Background MicroRNAs (miRNAs have been known to play an important role in several biological processes in both animals and plants. Although several tools for miRNA and target identification are available, the number of tools tailored towards plants is limited, and those that are available have specific functionality, lack graphical user interfaces, and restrict the number of input sequences. Large-scale computational identifications of miRNAs and/or targets of several plants have been also reported. Their methods, however, are only described as flow diagrams, which require programming skills and the understanding of input and output of the connected programs to reproduce. Results To overcome these limitations and programming complexities, we proposed C-mii as a ready-made software package for both plant miRNA and target identification. C-mii was designed and implemented based on established computational steps and criteria derived from previous literature with the following distinguishing features. First, software is easy to install with all-in-one programs and packaged databases. Second, it comes with graphical user interfaces (GUIs for ease of use. Users can identify plant miRNAs and targets via step-by-step execution, explore the detailed results from each step, filter the results according to proposed constraints in plant miRNA and target biogenesis, and export sequences and structures of interest. Third, it supplies bird's eye views of the identification results with infographics and grouping information. Fourth, in terms of functionality, it extends the standard computational steps of miRNA target identification with miRNA-target folding and GO annotation. Fifth, it provides helper functions for the update of pre-installed databases and automatic recovery. Finally, it supports multi-project and multi-thread management. Conclusions C-mii constitutes the first complete software package with graphical user interfaces enabling

  9. The Role of Non-­Coding RNA in Plant Stress

    KAUST Repository

    MacPherson, Cameron R.

    2012-12-01

    Post-transcriptional gene silencing (PTGS) is a powerful mechanism that can be adapted to genetically modify crop plants. PTGS operates in many plant signaling pathways including those mediating stress responses. Given the small number of miRNAs known, research on the characterization of stress-related micro-RNA (miRNA) and their targets could provide the basis for engineering stress tolerant traits in crops. Indeed, several examples of miRNA mediated crop tolerance have been reported. In the research presented here, we aimed to analyze the role of small non-coding RNA (smRNA) pathways involved in plant stress. In particular, we focused on miRNA-mediated PTGS in phosphate (Pi) starvation. The analysis was split into two research projects. First, to identify potential miRNA targets we began by analyzing the response and recovery of coding and long non-coding RNAs (lncRNA) to Pi starvation in shoot and root. The results obtained were the first genome-wide description of the root’s Pi starvation response and recovery. We found that the root\\'s response involved a widely different set of genes than that of the shoot. In the second research project, the results of the first project were correlated with the responses of miRNA and trans-acting small-interfering RNA (tasiRNA) during Pi starvation. Many miRNA circuits have been predicted before, however, tasiRNA circuits are not as well defined. Therefore, we made use of the double-stranded RNA-binding protein 4 (DRB4) smRNA libraries to enhance our prediction of tasiRNAs. Altogether, we provided evidence to support the following miRNA-mRNA pairs that may function in Pi starvation: IPS1:miR399:PHO2; miR399:RS4; miR399:NF-YA10; miR398:CSD1/2; miR2111:TPS11; miR164:NAC6; miR157:TMO7; miR157:PSB28; RPS2:miR169:IPS2; miR397:LAC2; TAS4:PAP1; NR1:PAP1; and Chr3_1967672:TMO7. In general, we found that non-miR399 related circuits were active only during the root’s recovery from Pi starvation. The functional roles of the genes

  10. Small RNA-regulated networks and the evolution of novel structures in plants.

    Science.gov (United States)

    Plavskin, Y; Timmermans, M C P

    2012-01-01

    The evolution of plants on land has produced a great diversity of organs, tissues, and cell types. Many of the genes identified as having a role in the development of such structures in flowering plants are conserved across all land plants, including in clades that diverged before the evolution of the structure in question. This suggests that novel organs commonly evolve via the cooption of existing developmental gene regulatory networks (GRNs). Although numerous examples of such cooptions have been identified, little is known about why those specific GRNs have been coopted. In this review, we discuss the properties of GRNs that may favor their cooption, as well as the mechanisms by which this can occur, in the context of plant developmental evolution. We especially focus on small RNA (sRNA)-regulated and auxin-signaling GRNs as intriguing models of regulatory network recruitment.

  11. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

    2003-01-01

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  12. RNA extraction from plant tissues: the use of calcium to precipitate contaminating pectic sugars.

    Science.gov (United States)

    Dal Cin, Valeriano; Danesin, Marcello; Rizzini, Fabio Massimo; Ramina, Angelo

    2005-10-01

    Several protocols and commercial kits are used for the extraction of nucleic acids from different plant tissues. Although there are several procedures available to remove sugars, which hinder the extraction of clean genomic DNA, there are few to assist with extraction of RNA. Those presently used include precipitations with ethylene glycol monobutyl ether or lithium chloride (LiCl), or centrifugation in cesium chloride (CsCl) gradients, but these generally either do not allow high recovery of RNA, are time consuming, rely on hazardous chemicals or need special equipment. Here we present the use of the simple cation, Ca2+, which has been tested and shown to be very efficient for the precipitation of high molecular weight pectic sugars during RNA extraction. Results are presented for different plant tissues, especially tissues of peach and apple fruits at varying ripening stages.

  13. The application of RNA-seq to the comprehensive analysis of plant mitochondrial transcriptomes

    Czech Academy of Sciences Publication Activity Database

    Stone, James D.; Štorchová, Helena

    2015-01-01

    Roč. 290, č. 1 (2015), s. 1-9 ISSN 1617-4615 R&D Projects: GA ČR(CZ) GAP506/12/1359 Institutional support: RVO:61389030 Keywords : RNA-seq * Plant mitochondria * Transcriptome Subject RIV: EF - Botanics Impact factor: 2.622, year: 2015

  14. MicroRNAs, macrocontrol : Regulation of miRNA processing

    NARCIS (Netherlands)

    Slezak-Prochazka, Izabella; Durmus, Selvi; Kroesen, Bart-Jan; van den Berg, Anke

    MicroRNAs (miRNAs) are a set of small, non-protein-coding RNAs that regulate gene expression at the post-transcriptional level. Maturation of miRNAs comprises several regulated steps resulting in similar to 22-nucleotide single-stranded mature miRNAs. Regulation of miRNA expression can occur both at

  15. Isolation of poly (A)+ mRNA for downstream reactions from some medicinal and aromatic plants.

    Science.gov (United States)

    Shukla, Ashutosh K; Shasany, Ajit K; Khanuja, Suman P S

    2005-02-01

    In the present protocol for extraction of RNA, hexadecyltrimethylammoniumbromide (CTAB) and insoluble polyvinylpyrrolidone were used followed by LiCl precipitation, CsCl ultracentrifugation and finally poly (A)+ mRNA was isolated with the help of oligo(dT)-cellulose columns. The isolated poly (A)+ mRNA was found to be suitable for cDNA-AFLP and suppression subtractive hybridization applications. It is a modified and consolidated protocol based on previously described methods for isolated steps and works better for medicinal and aromatic plants. High yield of poly (A)+ mRNA coupled with its amenability for downstream reactions like RT-PCR, northern blotting and cDNA synthesis for library construction is a key feature of the present protocol.

  16. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.

    1999-01-01

    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  17. Extraction of total RNA from leaves of Eucalyptus and other woody and herbaceous plants using sodium isoascorbate.

    Science.gov (United States)

    Suzuki, Y; Hibino, T; Kawazu, T; Wada, T; Kihara, T; Koyama, H

    2003-05-01

    Rapid extraction of total RNA from Eucalyptus leaves is difficult due to the high content of polyphenolics and polysaccharides. A rapid and simple method was developed by using an extraction buffer containing sodium isoascorbate at a concentration of 500 mM. This method consisted of one or two chloroform extractions, one acid guanidium-phenol-chloroform extraction, and isopropanol precipitation alone. The yields of the RNA fractions were 246-1750 micrograms/g fresh weight when leaves of Eucalyptus, five other woody plants, and four herbaceous plants were used as samples. The contamination of the RNA fractions by proteins and polysaccharides was very limited as judged spectrophotometrically. When the RNA fractions were subjected to agarose gel electrophoresis, intact rRNA bands were detected. The RNA fractions could be used for RT-PCR. These results indicate that our new method achieves a simple and rapid preparation of high-quality RNA from leaves of Eucalyptus and other plant species.

  18. Steady-state electrophoresis of RNA against a gradient of cationic charges in a polyacrylamide matrix.

    Science.gov (United States)

    Zilberstein, Gleb; Shlar, Ilya; Baskin, Emmanuil; Korol, Leonid; Righetti, Pier Giorgio; Bukshpan, Shmuel

    2009-11-01

    A novel method for separation of RNA fragments is reported here, based on migrating the polyanionic RNA fragments in a polycationic polyacrylamide gel, made by incorporating positively charged monomers (the Immobilines used for creating immobilized pH gradients) into the neutral polyacrylamide backbone. Separations are typically performed in a 0-10 mM, pK 10.3 Immobiline gradient under denaturing conditions (6 M urea). In the 100-1000 bp length, it is shown that separations of RNA are optimal and very sharp bands can be obtained, in comparison with conventional electrophoresis, due to the "focusing" effect originated by the charge balancing between the positively charged gel matrix and the negatively charged RNA species. Excellent separations are also obtained from micro-RNAs, single-stranded RNA molecules of 21-23 nucleotides in length, which appear to regulate gene expression in animal and plant tissues. As a third example, 2-D runs in control and polycationic gels are shown. Under native conditions, RNAs are not aligned in a diagonal, suggesting that molecular shape has a strong influence on the interaction between RNA and the charged gel matrix. Thus, 2-D runs in cationic matrices might be exploited for structural studies of RNA molecules.

  19. The Role of Canonical and Noncanonical Pre-mRNA Splicing in Plant Stress Responses

    Directory of Open Access Journals (Sweden)

    A. S. Dubrovina

    2013-01-01

    Full Text Available Plants are sessile organisms capable of adapting to various environmental constraints, such as high or low temperatures, drought, soil salinity, or pathogen attack. To survive the unfavorable conditions, plants actively employ pre-mRNA splicing as a mechanism to regulate expression of stress-responsive genes and reprogram intracellular regulatory networks. There is a growing evidence that various stresses strongly affect the frequency and diversity of alternative splicing events in the stress-responsive genes and lead to an increased accumulation of mRNAs containing premature stop codons, which in turn have an impact on plant stress response. A number of studies revealed that some mRNAs involved in plant stress response are spliced counter to the traditional conception of alternative splicing. Such noncanonical mRNA splicing events include trans-splicing, intraexonic deletions, or variations affecting multiple exons and often require short direct repeats to occur. The noncanonical alternative splicing, along with common splicing events, targets the spliced transcripts to degradation through nonsense-mediated mRNA decay or leads to translation of truncated proteins. Investigation of the diversity, biological consequences, and mechanisms of the canonical and noncanonical alternative splicing events will help one to identify those transcripts which are promising for using in genetic engineering and selection of stress-tolerant plants.

  20. Enhanced whitefly resistance in transgenic tobacco plants expressing double stranded RNA of v-ATPase A gene.

    Directory of Open Access Journals (Sweden)

    Nidhi Thakur

    Full Text Available BACKGROUND: Expression of double strand RNA (dsRNA designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi, thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci upon oral feeding. The v-ATPase subunit A (v-ATPaseA coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. METHODOLOGY/PRINCIPAL FINDINGS: Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. CONCLUSIONS/SIGNIFICANCE: Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.

  1. Enhanced whitefly resistance in transgenic tobacco plants expressing double stranded RNA of v-ATPase A gene.

    Science.gov (United States)

    Thakur, Nidhi; Upadhyay, Santosh Kumar; Verma, Praveen C; Chandrashekar, Krishnappa; Tuli, Rakesh; Singh, Pradhyumna K

    2014-01-01

    Expression of double strand RNA (dsRNA) designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi), thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci) upon oral feeding. The v-ATPase subunit A (v-ATPaseA) coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.

  2. Characterization and subcellular localization of an RNA silencing suppressor encoded by Rice stripe tenuivirus

    International Nuclear Information System (INIS)

    Xiong Ruyi; Wu Jianxiang; Zhou Yijun; Zhou Xueping

    2009-01-01

    Rice stripe virus (RSV) is a single-stranded (ss) RNA virus belonging to the genus Tenuivirus. RSV is present in many East Asian countries and causes severe diseases in rice fields, especially in China. In this study, we analyzed six proteins encoded by the virus for their abilities to suppress RNA silencing in plant using a green fluorescent protein (GFP)-based transient expression assay. Our results indicate that NS3 encoded by RSV RNA3, but not other five RSV encoded proteins, can strongly suppress local GFP silencing in agroinfiltrated Nicotiana benthamiana leaves. NS3 can reverse the GFP silencing, it can also prevent long distance spread of silencing signals which have been reported to be necessary for inducing systemic silencing in host plants. The NS3 protein can significantly reduce the levels of small interfering RNAs (siRNAs) in silencing cells, and was found to bind 21-nucleotide ss-siRNA, siRNA duplex and long ssRNA but not long double-stranded (ds)-RNA. Both N and C terminal of the NS3 protein are critical for silencing suppression, and mutation of the putative nuclear localization signal decreases its local silencing suppression efficiency and blocks its systemic silencing suppression. The NS3-GFP fusion protein and NS3 were shown to accumulate predominantly in nuclei of onion, tobacco and rice cells through transient expression assay or immunocytochemistry and electron microscopy. In addition, transgenic rice and tobacco plants expressing the NS3 did not show any apparent alteration in plant growth and morphology, although NS3 was proven to be a pathogenicity determinant in the PVX heterogenous system. Taken together, our results demonstrate that RSV NS3 is a suppressor of RNA silencing in planta, possibly through sequestering siRNA molecules generated in cells that are undergoing gene silencing.

  3. 3' and 5' microRNA-end post-biogenesis modifications in plant transcriptomes: Evidences from small RNA next generation sequencing data analysis.

    Science.gov (United States)

    Saraf, Shradha; Sanan-Mishra, Neeti; Gursanscky, Nial R; Carroll, Bernard J; Gupta, Dinesh; Mukherjee, Sunil Kumar

    2015-11-27

    The processing of miRNA from its precursors is a precisely regulated process and after biogenesis, the miRNAs are amenable to different kinds of modifications by the addition or deletion of nucleotides at the terminal ends. However, the mechanism and functions of such modifications are not well studied in plants. In this study, we have specifically analysed the terminal end non-templated miRNA modifications, using NGS data of rice, tomato and Arabidopsis small RNA transcriptomes from different tissues and physiological conditions. Our analysis reveals template independent terminal end modifications in the mature as well as passenger strands of the miRNA duplex. Interestingly, it is also observed that miRNA sequences terminating with a cytosine (C) at the 3' end undergo a higher percentage of 5' end modifications. The terminal end modifications did not correlate with the miRNA abundances and are independent of tissue types, physiological conditions and plant species. Our analysis indicates that the addition of nucleotides at miRNA ends is not influenced by the absence of RNA dependent RNA polymerase 6. Moreover the terminal end modified miRNAs are also observed amongst AGO1 bound small RNAs and have potential to alter target, indicating its important functional role in repression of gene expression. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Intragenomic matching reveals a huge potential for miRNA-mediated regulation in plants

    DEFF Research Database (Denmark)

    Lindow, Morten; Jacobsen, Anders; Nygaard, Sanne

    2007-01-01

    microRNAs (miRNAs) are important post-transcriptional regulators, but the extent of this regulation is uncertain, both with regard to the number of miRNA genes and their targets. Using an algorithm based on intragenomic matching of potential miRNAs and their targets coupled with support vector...... machine classification of miRNA precursors, we explore the potential for regulation by miRNAs in three plant genomes: Arabidopsis thaliana, Populus trichocarpa, and Oryza sativa. We find that the intragenomic matching in conjunction with a supervised learning approach contains enough information to allow...

  5. An RNA polymerase II-and AGO4-associated protein acts in RNA-directed DNA methylation

    KAUST Repository

    Gao, Zhihuan

    2010-04-21

    DNA methylation is an important epigenetic mark in many eukaryotes. In plants, 24-nucleotide small interfering RNAs (siRNAs) bound to the effector protein, Argonaute 4 (AGO4), can direct de novo DNA methylation by the methyltransferase DRM2 (refs 2, 4-6). Here we report a new regulator of RNA-directed DNA methylation (RdDM) in Arabidopsis: RDM1. Loss-of-function mutations in the RDM1 gene impair the accumulation of 24-nucleotide siRNAs, reduce DNA methylation, and release transcriptional gene silencing at RdDM target loci. RDM1 encodes a small protein that seems to bind single-stranded methyl DNA, and associates and co-localizes with RNA polymerase II (Pol II, also known as NRPB), AGO4 and DRM2 in the nucleus. Our results indicate that RDM1 is a component of the RdDM effector complex and may have a role in linking siRNA production with pre-existing or de novo cytosine methylation. Our results also indicate that, although RDM1 and Pol V (also known as NRPE) may function together at some RdDM target sites in the peri-nucleolar siRNA processing centre, Pol II rather than Pol V is associated with the RdDM effector complex at target sites in the nucleoplasm. © 2010 Macmillan Publishers Limited. All rights reserved.

  6. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide

    2015-10-01

    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  7. Targeting MicroRNA in Cancer Using Plant-Based Proanthocyanidins

    Directory of Open Access Journals (Sweden)

    Rishipal R. Bansode

    2016-04-01

    Full Text Available Proanthocyanidins are oligomeric flavonoids found in plant sources, most notably in apples, cinnamon, grape skin and cocoa beans. They have been also found in substantial amounts in cranberry, black currant, green tea, black tea and peanut skins. These compounds have been recently investigated for their health benefits. Proanthocyanidins have been demonstrated to have positive effects on various metabolic disorders such as inflammation, obesity, diabetes and insulin resistance. Another upcoming area of research that has gained widespread interest is microRNA (miRNA-based anticancer therapies. MicroRNAs are short non-coding RNA segments, which plays a crucial role in RNA silencing and post-transcriptional regulation of gene expression. Currently, miRNA based anticancer therapies are being investigated either alone or in combination with current treatment methods. In this review, we summarize the current knowledge and investigate the potential of naturally occurring proanthocyanidins in modulating miRNA expression. We will also assess the strategies and challenges of using this approach as potential cancer therapeutics.

  8. RNA Interference: A Novel Source of Resistance to Combat Plant Parasitic Nematodes

    Directory of Open Access Journals (Sweden)

    Sagar Banerjee

    2017-05-01

    Full Text Available Plant parasitic nematodes cause severe damage and yield loss in major crops all over the world. Available control strategies include use of insecticides/nematicides but these have proved detrimental to the environment, while other strategies like crop rotation and resistant cultivars have serious limitations. This scenario provides an opportunity for the utilization of technological advances like RNA interference (RNAi to engineer resistance against these devastating parasites. First demonstrated in the model free living nematode, Caenorhabtidis elegans; the phenomenon of RNAi has been successfully used to suppress essential genes of plant parasitic nematodes involved in parasitism, nematode development and mRNA metabolism. Synthetic neurotransmitants mixed with dsRNA solutions are used for in vitro RNAi in plant parasitic nematodes with significant success. However, host delivered in planta RNAi has proved to be a pioneering phenomenon to deliver dsRNAs to feeding nematodes and silence the target genes to achieve resistance. Highly enriched genomic databases are exploited to limit off target effects and ensure sequence specific silencing. Technological advances like gene stacking and use of nematode inducible and tissue specific promoters can further enhance the utility of RNAi based transgenics against plant parasitic nematodes.

  9. Structure-function relationship of viral cis-acting RNA elements : the role of the OriI and OriR in enterovirus replication

    NARCIS (Netherlands)

    Ooij, Martinus Johannes Maria van

    2007-01-01

    The genus Enterovirus belongs to Picornaviridae, a family of small, non-enveloped, lytic RNA viruses. They contain a single-stranded RNA genome of positive polarity of approximately 7,500 nucleotides. A viral protein VPg is specifically linked to the 5'terminus of the viral RNA. IRES-mediated

  10. Analysis of small RNA production patterns among the two potato spindle tuber viroid variants in tomato plants

    Directory of Open Access Journals (Sweden)

    Charith Raj Adkar-Purushothama

    2015-12-01

    Full Text Available In order to analyze the production of small RNA (sRNA by viroids upon infecting the plants, the tomato plants (Solanum lycopersicum cultivar Rutgers were inoculated with the variants of Potato spindle tuber viroid (PSTVd. After 21-days of postinoculation, total RNA was extracted and subjected for deep-sequencing using Illumina HiSeq platform. The primers were trimmed and only 21- to 24-nt long sRNAs were filtered after quality check of the raw data. The filtered sRNA population was then mapped against both the genomic (+ and antigenomic (− strands of the respective PSTVd variants using standard pattern-matching algorithm. The profiling of viroid derived sRNA (vd-sRNA revealed that the viroids are susceptible to host RNA silencing mechanism. High-throughput sequence data linked to this project have been deposited in the Gene Expression Omnibus (GEO database under accession number GSE69225.

  11. Integrated RNA-Seq and sRNA-Seq Analysis Identifies Chilling and Freezing Responsive Key Molecular Players and Pathways in Tea Plant (Camellia sinensis)

    Science.gov (United States)

    Zheng, Chao; Zhao, Lei; Wang, Yu; Shen, Jiazhi; Zhang, Yinfei; Jia, Sisi; Li, Yusheng; Ding, Zhaotang

    2015-01-01

    Tea [Camellia sinensis (L) O. Kuntze, Theaceae] is one of the most popular non-alcoholic beverages worldwide. Cold stress is one of the most severe abiotic stresses that limit tea plants’ growth, survival and geographical distribution. However, the genetic regulatory network and signaling pathways involved in cold stress responses in tea plants remain unearthed. Using RNA-Seq, DGE and sRNA-Seq technologies, we performed an integrative analysis of miRNA and mRNA expression profiling and their regulatory network of tea plants under chilling (4℃) and freezing (-5℃) stress. Differentially expressed (DE) miRNA and mRNA profiles were obtained based on fold change analysis, miRNAs and target mRNAs were found to show both coherent and incoherent relationships in the regulatory network. Furthermore, we compared several key pathways (e.g., ‘Photosynthesis’), GO terms (e.g., ‘response to karrikin’) and transcriptional factors (TFs, e.g., DREB1b/CBF1) which were identified as involved in the early chilling and/or freezing response of tea plants. Intriguingly, we found that karrikins, a new group of plant growth regulators, and β-primeverosidase (BPR), a key enzyme functionally relevant with the formation of tea aroma might play an important role in both early chilling and freezing response of tea plants. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis further confirmed the results from RNA-Seq and sRNA-Seq analysis. This is the first study to simultaneously profile the expression patterns of both miRNAs and mRNAs on a genome-wide scale to elucidate the molecular mechanisms of early responses of tea plants to cold stress. In addition to gaining a deeper insight into the cold resistant characteristics of tea plants, we provide a good case study to analyse mRNA/miRNA expression and profiling of non-model plant species using next-generation sequencing technology. PMID:25901577

  12. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2016-05-28

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  13. A biomarker model of sublethal genotoxicity (DNA single-strand breaks and adducts) using the sentinel organism Aporrectodea longa in spiked soil

    International Nuclear Information System (INIS)

    Martin, Francis L.; Piearce, Trevor G.; Hewer, Alan; Phillips, David H.; Semple, Kirk T.

    2005-01-01

    There is a need to develop risk biomarkers during the remediation of contaminated land. We employed the earthworm, Aporrectodea longa (Ude), to determine whether genotoxicity measures could be applied to this organism's intestinal tissues. Earthworms were added, for 24 h or 7 days, to soil samples spiked with benzo[a]pyrene (B[a]P) and/or lindane. After exposure, intestinal tissues (crop/gizzard or intestine) were removed prior to the measurement in disaggregated cells of DNA single-strand breaks (SSBs) by the alkaline comet assay. Damage was quantified by comet tail length (CTL, μm). B[a]P 24-h exposure induced dose-related increases (P 32 P-postlabelling, showed a two-adduct-spot pattern. This preliminary investigation suggests that earthworm tissues may be incorporated into genotoxicity assays to facilitate hazard identification within terrestrial ecosystems. - Sublethal genotoxicity in the sentinel organism A. longa can be used to monitor the effects of contaminants in soil

  14. Conformation effects of CpG methylation on single-stranded DNA oligonucleotides: analysis of the opioid peptide dynorphin-coding sequences.

    Directory of Open Access Journals (Sweden)

    Malik Mumtaz Taqi

    Full Text Available Single-stranded DNA (ssDNA is characterized by high conformational flexibility that allows these molecules to adopt a variety of conformations. Here we used native polyacrylamide gel electrophoresis (PAGE, circular dichroism (CD spectroscopy and nuclear magnetic resonance (NMR spectroscopy to show that cytosine methylation at CpG sites affects the conformational flexibility of short ssDNA molecules. The CpG containing 37-nucleotide PDYN (prodynorphin fragments were used as model molecules. The presence of secondary DNA structures was evident from differences in oligonucleotide mobilities on PAGE, from CD spectra, and from formation of A-T, G-C, and non-canonical G-T base pairs observed by NMR spectroscopy. The oligonucleotides displayed secondary structures at 4°C, and some also at 37°C. Methylation at CpG sites prompted sequence-dependent formation of novel conformations, or shifted the equilibrium between different existing ssDNA conformations. The effects of methylation on gel mobility and base pairing were comparable in strength to the effects induced by point mutations in the DNA sequences. The conformational effects of methylation may be relevant for epigenetic regulatory events in a chromatin context, including DNA-protein or DNA-DNA recognition in the course of gene transcription, and DNA replication and recombination when double-stranded DNA is unwinded to ssDNA.

  15. Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Krzysztof Lepek

    2015-01-01

    Full Text Available Monitoring and control of infections are key parts of surveillance systems and epidemiological risk prevention. In the case of influenza A viruses (IAVs, which show high variability, a wide range of hosts, and a potential of reassortment between different strains, it is essential to study not only people, but also animals living in the immediate surroundings. If understated, the animals might become a source of newly formed infectious strains with a pandemic potential. Special attention should be focused on pigs, because of the receptors specific for virus strains originating from different species, localized in their respiratory tract. Pigs are prone to mixed infections and may constitute a reservoir of potentially dangerous IAV strains resulting from genetic reassortment. It has been reported that a quadruple reassortant, A(H1N1pdm09, can be easily transmitted from humans to pigs and serve as a donor of genetic segments for new strains capable of infecting humans. Therefore, it is highly desirable to develop a simple, cost-effective, and rapid method for evaluation of IAV genetic variability. We describe a method based on multitemperature single-strand conformational polymorphism (MSSCP, using a fragment of the hemagglutinin (HA gene, for detection of coinfections and differentiation of genetic variants of the virus, difficult to identify by conventional diagnostic.

  16. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS.

    Science.gov (United States)

    Pachkowski, Brian F; Tano, Keizo; Afonin, Valeriy; Elder, Rhoderick H; Takeda, Shunichi; Watanabe, Masami; Swenberg, James A; Nakamura, Jun

    2009-12-01

    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase beta.

  17. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against the Pesticide Fipronil and Sensitive Detection in River Water

    Directory of Open Access Journals (Sweden)

    Ka L. Hong

    2017-12-01

    Full Text Available Fipronil is a commonly used insecticide that has been shown to have environmental and human health risks. The current standard methods of detection for fipronil and its metabolites, such as GC-MS, are time consuming and labor intensive. In this study, a variant of systematic evolution of ligands by exponential enrichment (SELEX, was utilized to identify the first single-stranded DNA (ssDNA molecular recognition element (MRE that binds to fipronil with high affinity (Kd = 48 ± 8 nM. The selected MRE displayed low cross binding activity on various environmentally relevant, structurally unrelated herbicides and pesticides, in addition to broad-spectrum binding activity on major metabolites of fipronil and a structurally similar pesticide in prepared river samples. Additionally, a proof-of-principle fluorescent detection assay was developed by using the selected ssDNA MRE as a signal-reporting element, with a limit of detection of 105 nM in a prepared river water sample.

  18. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Boye, E.; Johansen, I.; Brustad, T.

    1976-01-01

    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 2 0 C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 2 0 C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  19. Clonal origin of multiple lung cancers: K-ras and p53 mutations determined by nonradioisotopic single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Lau, D H; Yang, B; Hu, R; Benfield, J R

    1997-08-01

    Disease stage is the most important factor in determining prognosis and treatment of lung cancer. Staging of lung cancer is complicated by presentation of multiple pulmonary malignant lesions with a similar histology. It is a dilemma to decide if these lesions are synchronous primaries arising from different malignant clones or metastases from a single clone. Lung cancer is associated with multiple genetic abnormalities including mutations of K-ras and p53, which are believed to occur prior to onset of metastasis. To determine the clonal origin of multiple pulmonary malginant nodules, we analyzed point-mutations of K-ras and p53 by microdissection, polymerase chain reactions (PCR), nonradioisotopic single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. Each pulmonary lesion was microdissected from paraffin slides. Genomic DNA was amplified by two sequential PCRs followed by electrophoresis in a minigel and silver staining. Deoxyribonucleic acid sequencing was performed if necessary to confirm a mutation found upon SSCP analysis. Applying this molecular approach, we were able to differentiate the clonal origins of multiple malignant nodules of the lung as exemplified by the two cases presented.

  20. Selection and Characterization of Single-Stranded DNA Aptamers Binding Human B-Cell Surface Protein CD20 by Cell-SELEX

    Directory of Open Access Journals (Sweden)

    Mansoureh Haghighi

    2018-03-01

    Full Text Available The B-lymphocyte antigen (CD20 is a suitable target for single-stranded (ss nucleic acid oligomer (aptamers. The aim of study was selection and characterization of a ssDNA aptamer against CD20 using Cell-Systematic Evolution of Ligands by Exponential Enrichment (Cell-SELEX. The cDNA clone of CD20 (pcDNA-CD20 was transfected to human embryonic kidney (HEK293T cells. Ten rounds of Cell-SELEX was performed on recombinant HEK-CD20 cells. The final eluted ssDNA pool was amplified and ligated in T/A vector for cloning. The plasmids of positive clones were extracted, sequenced and the secondary structures of the aptamers predicted using DNAMAN® software. The sequencing results revealed 10 different types; three of them had the highest thermodynamic stability, named AP-1, AP-2 and AP-3. The AP-1 aptamer was the most thermodynamically stable one (ΔGAP-1 = −10.87 kcal/mol with the highest binding affinity to CD20 (96.91 ± 4.5 nM. Since, the CD20 is a suitable target for recognition of B-Cell. The selected aptamers could be comparable to antibodies with many advantages. The AP-1, AP-2 and AP-3 could be candidate instead of antibodies for diagnostic and therapeutic applications in immune deficiency, autoimmune diseases, leukemia and lymphoma.

  1. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    Science.gov (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Integrative modelling coupled with ion mobility mass spectrometry reveals structural features of the clamp loader in complex with single-stranded DNA binding protein.

    Science.gov (United States)

    Politis, Argyris; Park, Ah Young; Hall, Zoe; Ruotolo, Brandon T; Robinson, Carol V

    2013-11-29

    DNA polymerase III, a decameric 420-kDa assembly, simultaneously replicates both strands of the chromosome in Escherichia coli. A subassembly of this holoenzyme, the seven-subunit clamp loader complex, is responsible for loading the sliding clamp (β2) onto DNA. Here, we use structural information derived from ion mobility mass spectrometry (IM-MS) to build three-dimensional models of one form of the full clamp loader complex, γ3δδ'ψχ (254 kDa). By probing the interaction between the clamp loader and a single-stranded DNA (ssDNA) binding protein (SSB4) and by identifying two distinct conformational states, with and without ssDNA, we assemble models of ψχ-SSB4 (108 kDa) and the clamp loader-SSB4 (340 kDa) consistent with IM data. A significant increase in measured collision cross-section (~10%) of the clamp loader-SSB4 complex upon DNA binding suggests large conformational rearrangements. This DNA bound conformation represents the active state and, along with the presence of ψχ, stabilises the clamp loader-SSB4 complex. Overall, this study of a large heteromeric complex analysed by IM-MS, coupled with integrative modelling, highlights the potential of such an approach to reveal structural features of previously unknown complexes of high biological importance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Direct detection of RNA in vitro and in situ by target-primed RCA: The impact of E. coli RNase III on the detection efficiency of RNA sequences distanced far from the 3'-end.

    Science.gov (United States)

    Merkiene, Egle; Gaidamaviciute, Edita; Riauba, Laurynas; Janulaitis, Arvydas; Lagunavicius, Arunas

    2010-08-01

    We improved the target RNA-primed RCA technique for direct detection and analysis of RNA in vitro and in situ. Previously we showed that the 3' --> 5' single-stranded RNA exonucleolytic activity of Phi29 DNA polymerase converts the target RNA into a primer and uses it for RCA initiation. However, in some cases, the single-stranded RNA exoribonucleolytic activity of the polymerase is hindered by strong double-stranded structures at the 3'-end of target RNAs. We demonstrate that in such hampered cases, the double-stranded RNA-specific Escherichia coli RNase III efficiently assists Phi29 DNA polymerase in converting the target RNA into a primer. These observations extend the target RNA-primed RCA possibilities to test RNA sequences distanced far from the 3'-end and customize this technique for the inner RNA sequence analysis.

  4. A novel RNA-binding peptide regulates the establishment of the Medicago truncatula-Sinorhizobium meliloti nitrogen-fixing symbiosis.

    Science.gov (United States)

    Laporte, Philippe; Satiat-Jeunemaître, Béatrice; Velasco, Isabel; Csorba, Tibor; Van de Velde, Willem; Campalans, Anna; Burgyan, Joszef; Arevalo-Rodriguez, Miguel; Crespi, Martin

    2010-04-01

    Plants use a variety of small peptides for cell to cell communication during growth and development. Leguminous plants are characterized by their ability to develop nitrogen-fixing nodules via an interaction with symbiotic bacteria. During nodule organogenesis, several so-called nodulin genes are induced, including large families that encode small peptides. Using a three-hybrid approach in yeast cells, we identified two new small nodulins, MtSNARP1 and MtSNARP2 (for small nodulin acidic RNA-binding protein), which interact with the RNA of MtENOD40, an early induced nodulin gene showing conserved RNA secondary structures. The SNARPs are acidic peptides showing single-stranded RNA-binding activity in vitro and are encoded by a small gene family in Medicago truncatula. These peptides exhibit two new conserved motifs and a putative signal peptide that redirects a GFP fusion to the endoplasmic reticulum both in protoplasts and during symbiosis, suggesting they are secreted. MtSNARP2 is expressed in the differentiating region of the nodule together with several early nodulin genes. MtSNARP2 RNA interference (RNAi) transgenic roots showed aberrant early senescent nodules where differentiated bacteroids degenerate rapidly. Hence, a functional symbiotic interaction may be regulated by secreted RNA-binding peptides.

  5. Two Negative-Strand RNA Viruses Identified in Watermelon Represent a Novel Clade in the Order Bunyavirales

    Directory of Open Access Journals (Sweden)

    Min Xin

    2017-08-01

    Full Text Available Two novel negative-sense, single-stranded (ss RNA viruses were identified in watermelon plants and named watermelon crinkle leaf-associated virus 1 and 2 (WCLaV-1 and -2, respectively. The multipartite genomes consist of three RNA molecules of ~6.8, 1.4, and 1.3 kb. The genomes and the deduced proteins of RNA1 and RNA3 show features resembling those of members in the genus Phlebovirus and Tenuivirus; however, the predicted proteins encoded by RNA2 are related to the movement protein (MP in the genus Ophiovirus and Emaravirus. Furthermore, these two viruses define a novel clade in the family Phenuiviridae, order Bunyavirales, which is phylogenetically related to the viruses in the above four genera. Moreover, after mechanical inoculation with WCLaV-1 seedlings of the natural host watermelon plants develop crinkling similar to those observed in the field. These findings enhance our understanding of the evolution and the classification of ssRNA viruses.

  6. MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense

    OpenAIRE

    Liu, Sheng-Rui; Zhou, Jing-Jing; Hu, Chun-Gen; Wei, Chao-Ling; Zhang, Jin-Zhi

    2017-01-01

    MicroRNAs (miRNAs) are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense ...

  7. Programmed self-assembly of DNA/RNA for biomedical applications

    Science.gov (United States)

    Wang, Pengfei

    Three self-assembly strategies were utilized for assembly of novel functional DNA/RNA nanostructures. RNA-DNA hybrid origami method was developed to fabricate nano-objects (ribbon, rectangle, and triangle) with precisely controlled geometry. Unlike conventional DNA origami which use long DNA single strand as scaffold, a long RNA single strand was used instead, which was folded by short DNA single strands (staples) into prescribed objects through sequence specific hybridization between RNA and DNA. Single stranded tiles (SST) and RNA-DNA hybrid origami were utilized to fabricate a variety of barcode-like nanostructures with unique patterns by expanding a plain rectangle via introducing spacers (10-bp dsDNA segment) between parallel duplexes. Finally, complex 2D array and 3D polyhedrons with multiple patterns within one structure were assembled from simple DNA motifs. Two demonstrations of biomedical applications of DNA nanotechnology were presented. Firstly, lambda-DNA was used as template to direct the fabrication of multi-component magnetic nanoparticle chains. Nuclear magnetic relaxation (NMR) characterization showed superb magnetic relaxativity of the nanoparticle chains which have large potential to be utilized as MRI contrast agents. Secondly, DNA nanotechnology was introduced into the conformational study of a routinely used catalytic DNAzyme, the RNA-cleaving 10-23 DNAzyme. The relative angle between two flanking duplexes of the catalytic core was determined (94.8°), which shall be able to provide a clue to further understanding of the cleaving mechanism of this DNAzyme from a conformational perspective.

  8. On RNA-RNA interaction structures of fixed topological genus.

    Science.gov (United States)

    Fu, Benjamin M M; Han, Hillary S W; Reidys, Christian M

    2015-04-01

    Interacting RNA complexes are studied via bicellular maps using a filtration via their topological genus. Our main result is a new bijection for RNA-RNA interaction structures and a linear time uniform sampling algorithm for RNA complexes of fixed topological genus. The bijection allows to either reduce the topological genus of a bicellular map directly, or to lose connectivity by decomposing the complex into a pair of single stranded RNA structures. Our main result is proved bijectively. It provides an explicit algorithm of how to rewire the corresponding complexes and an unambiguous decomposition grammar. Using the concept of genus induction, we construct bicellular maps of fixed topological genus g uniformly in linear time. We present various statistics on these topological RNA complexes and compare our findings with biological complexes. Furthermore we show how to construct loop-energy based complexes using our decomposition grammar. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. porphyrin with single strand DNAs

    Indian Academy of Sciences (India)

    for organization of porphyrin molecules into extended assemblies, providing opportunities for construction of supramolecular structures.6–8 Among the porphyrin .... and consequently the mono- and bi-exponential nature of the decays were judged by the reduced chi-square. (χ2) values and distribution of the weighted ...

  10. AN INSIGHT OF COTTON LEAF CURL VIRUS: A DEVASTATING PLANT PATHOGENIC BEGOMOVIRUS

    Directory of Open Access Journals (Sweden)

    Mahmood-ur-Rahman

    2012-12-01

    Full Text Available Genome of plant viruses consists of either RNA or DNA. DNA viruses can be categorized into two types, (1 circular double-stranded DNA (dsDNA, these viruses are able to replicate through the process of reverse transcription from RNA (the caulimoviruses and badnaviruses, (2 viruses that have circular single-stranded DNA (ssDNA, which replicate through a dsDNA intermediate (the Geminivirus and nanoviruses. Begomoviruses are whiteflies transmitted geminiviruses and infect many economically important dicotyledonous crops including cotton, potato, tomato, cassava and chili. Begomoviruses cause leaf curl disease in cotton. In this review article, the Cotton Leaf Curl Virus (CLCuV has been introduced systematically.

  11. Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth

    Directory of Open Access Journals (Sweden)

    Stern David B

    2010-09-01

    Full Text Available Abstract Background The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. Results AS5-overexpressing (AS5ox plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Conclusions Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

  12. MicroRNA expression profiles in conventional and micropropagated strawberry (Fragaria x ananassa Duch.) plants.

    Science.gov (United States)

    Li, He; Zhang, Zhihong; Huang, Feifei; Chang, Linlin; Ma, Yue

    2009-06-01

    MicroRNAs (miRNAs) are a class of small non-coding RNAs which play a critical role in plant growth and development. To detect strawberry miRNAs and discover the expression difference between conventional and micropropagated strawberry plants, we carried out the detection and quantification of strawberry miRNAs by microarray. The main findings were that 74 miRNAs were checked in strawberry plants and four miRNA genes displayed clear expression difference between conventional and micropropagated strawberry plants, including two up-regulated genes (miR535 and miR390) and two down-regulated genes (miR169a and miR169d). The ratios of conventionally propagated strawberry plant/micropropagated strawberry plant for miR535, miR390, miR169a and miR169d were 2.6884, 2.2673, 0.2496 and 0.3814, respectively. Quantitative reverse transcription polymerase chain reaction applied to the two up-regulated genes (miR535 and miR390) validated the microarray result. This is the first report on differential expression of miRNAs in conventional and micropropagated plants.

  13. RNA

    African Journals Online (AJOL)

    SARAH

    30 nov. 2013 ... RÉSUMÉ. Objectif : La présente étude est conduite dans les régions de Maradi et Zinder situées dans le Centre-Sud du. Niger où la pratique de la régénération naturelle assistée des ligneux dans les champs (RNA) a permis de reverdir plus de 5 millions d'hectares. Le but de ce travail est d'évaluer ...

  14. Convergence of Domain Architecture, Structure, and Ligand Affinity in Animal and Plant RNA-Binding Proteins.

    Science.gov (United States)

    Dias, Raquel; Manny, Austin; Kolaczkowski, Oralia; Kolaczkowski, Bryan

    2017-06-01

    Reconstruction of ancestral protein sequences using phylogenetic methods is a powerful technique for directly examining the evolution of molecular function. Although ancestral sequence reconstruction (ASR) is itself very efficient, downstream functional, and structural studies necessary to characterize when and how changes in molecular function occurred are often costly and time-consuming, currently limiting ASR studies to examining a relatively small number of discrete functional shifts. As a result, we have very little direct information about how molecular function evolves across large protein families. Here we develop an approach combining ASR with structure and function prediction to efficiently examine the evolution of ligand affinity across a large family of double-stranded RNA binding proteins (DRBs) spanning animals and plants. We find that the characteristic domain architecture of DRBs-consisting of 2-3 tandem double-stranded RNA binding motifs (dsrms)-arose independently in early animal and plant lineages. The affinity with which individual dsrms bind double-stranded RNA appears to have increased and decreased often across both animal and plant phylogenies, primarily through convergent structural mechanisms involving RNA-contact residues within the β1-β2 loop and a small region of α2. These studies provide some of the first direct information about how protein function evolves across large gene families and suggest that changes in molecular function may occur often and unassociated with major phylogenetic events, such as gene or domain duplications. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. Suppressors of RNA silencing encoded by tomato leaf curl ...

    Indian Academy of Sciences (India)

    2013-01-06

    Jan 6, 2013 ... satellite DNA β which are predicted to function as silencing suppressors. In the present study suppressor function ... of plant viruses with circular single-stranded DNA genomes that are composed of one or two components of ..... 1 2 3 4 5 6 7 8 9 10 11 12 13 14 M. Figure 4. Southern blot analysis of DNA ...

  16. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA.

    Science.gov (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S

    2000-09-20

    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  17. Flow cytometry analysis of single-strand DNA damage in neuroblastoma cell lines using the F7-26 monoclonal antibody.

    Science.gov (United States)

    Grigoryan, Rita S; Yang, Bo; Keshelava, Nino; Barnhart, Jerry R; Reynolds, C Patrick

    2007-11-01

    The F7-26 monoclonal antibody (Mab) has been reported to be specific for single-strand DNA damage (ssDNA) and to also identify cells in apoptosis. We carriedout studies to determine if F7-26 binding measured by flow cytometry was able to specifically identify exogenous ssDNA as opposed to DNA damage from apoptosis. Neuroblastoma cells were treated with melphalan (L-PAM), fenretinide, 4-hydroperoxycyclophosphamide (4-HC)+/-pan-caspase inhibitor BOC-d-fmk, topotecan or with 10Gy gamma radiation+/-hydrogen peroxide (H2O2) and fixed immediately postradiation. Cytotoxicity was measured by DIMSCAN digital imaging fluorescence assay. The degree of ssDNA damage was analyzed by flow cytometry using Mab F7-26, with DNA visualized by propidium iodide counterstaining. Flow cytometry was used to measure apoptosis detected by terminal deoxynucleotidyltransferase (TUNEL) assay and reactive oxygen species (ROS) by carboxy-dichlorofluorescein diacetate. Irradiated and immediately fixed neuroblastoma cells showed increased ssDNA, but not apoptosis by TUNEL (TUNEL-negative). 4-HC or L-PAM+/-BOC-d-fmk increased ssDNA (F7-26-positive), but BOC-d-fmk prevented TUNEL staining. Fenretinide increased apoptosis by TUNEL but not ssDNA damage detected with F7-26. Enhanced ssDNA in neuroblastoma cells treated with radiation+H2O2 was associated with increased ROS. Topotecan increased both ssDNA and cytotoxicity in 4-HC-treated cells. These data demonstrate that Mab F7-26 recognized ssDNA due to exogenous DNA damage, rather than apoptosis. This assay should be useful to characterize the mechanism of action of antineoplastic drugs. Copyright (c) 2007 International Society for Analytical Cytology.

  18. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani

    2006-09-01

    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  19. Detection of p53 mutations by single-strand conformation polymorphisms (SSCP) gel electrophoresis. A comparative study of radioactive and nonradioactive silver-stained SSCP analysis.

    Science.gov (United States)

    Bosari, S; Marchetti, A; Buttitta, F; Graziani, D; Borsani, G; Loda, M; Bevilacqua, G; Coggi, G

    1995-12-01

    p53 mutations are the most common genetic abnormality in humans tumors, but their clinical significance remains to be precisely elucidated. Conventional single-strand conformation polymorphism (SSCP) analysis, a well-established technique for detecting p53 mutations, uses radioactively labeled polymerase chain reaction (PCR) products, which migrate abnormally in the presence of mutations. We performed radioactive PCR-SSCP analysis in a series of 30 formalin-fixed, paraffin-embedded ovarian carcinomas and two cell lines (SW480 and Caov4) harboring known homozygous p53 mutations and compared the results with nonradioactive silver-stained SSCP. The purpose was to assess whether nonradioactive SSCP is suitable for detecting p53 mutations in a rapid, sensitive, cost-effective fashion, without the need of radioactive isotopes. We accomplished PCR amplification of p53 exons 5 through 8 in 26 carcinomas, and radioactive SSCP detected p53 mutations in 13 tumors; three mutations were localized in exon 5, six in exon 6, two in exon 7, and two in exon 8. All mutations were correctly identified with nonradioactive SSCP, except for one exon 8 mutation. To establish the sensitivity of nonradioactive SSCP, DNA samples of SW480 and Caov4 were mixed with increasing amounts (0-90%) of normal DNA and subjected to PCR-SSCP analysis. Mutations were detected until the concentration of SW480 and Caov4 was 15% and 10%, respectively, of the total sample. The results of our investigation demonstrate that nonradioactive silver-stained SSCP is a sensitive, rapid, and simple technique to detect p53 mutations, even in formalin-fixed tissues, and could be easily used to investigate large series of patients to assess the clinical significance of p53 mutations in human tumors.

  20. Ampelomyces mycoparasites from apple powdery mildew identified as a distinct group based on single-stranded conformation polymorphism analysis of the rDNA ITS region.

    Science.gov (United States)

    Szentiványi, Orsolya; Kiss, Levente; Russell, John C; Kovács, Gábor M; Varga, Krisztina; Jankovics, Tünde; Lesemann, Silke; Xu, Xiang-Ming; Jeffries, Peter

    2005-04-01

    Pycnidial fungi belonging to the genus Ampelomyces are the most common natural antagonists of powdery mildews worldwide. During a study of the interactions between apple powdery mildew (Podosphaera leucotricha) and Ampelomyces mycoparasites, 52 new Ampelomyces isolates were obtained from P. leucotricha and, in addition, 13 new isolates from other species of the Erysiphaceae in four European countries. Their genetic diversity was screened using single-stranded conformation polymorphism (SSCP) analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). For comparison, 24 isolates obtained from genetic resource collections or other sources were included in this study. Based on the ITS-SSCP patterns, the isolates were placed in eight groups. The isolates belonged to two types based on their growth in culture. The faster-growing and the slower-growing isolates were included in different SSCP groups. A phylogenetic analysis of the ITS sequences of representatives of these groups confirmed the results obtained with the SSCP method, and showed that the faster-growing isolates do not belong to Ampelomyces as suggested by earlier studies. All the isolates from P. leucotricha fell into a distinct SSCP group of genetically homogeneous isolates. This suggests that Ampelomyces mycoparasites which occur in apple powdery mildew are slightly different from the other Ampelomyces groups which contain mycoparasites from various powdery mildew species. This may be because the main growth period of Ampelomyces mycoparasites in apple powdery mildew is isolated in time from that of Ampelomyces isolates that occur in other species of the Erysiphaceae. P. leucotricha starts its life-cycle early in the season, usually in March-April, while most powdery mildews are active in the same environments only late in the year.

  1. Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody: a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody.

    Science.gov (United States)

    Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua

    2018-02-01

    Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.

  2. Variabilidad genética de Aedes aegypti en algunas áreas del Perú usando Single Stranded Conformational Polymorphism (SSCP

    Directory of Open Access Journals (Sweden)

    Nélida Leiva G

    2004-07-01

    Full Text Available Aedes aegypti es el vector responsable de la transmisión del virus del dengue, su distribución geográfica se ha ampliado rápidamente debido principalmente a la intervención de los seres humanos. Objetivo: Analizar la variabilidad genética de este mosquito mediante la comparación del Segundo Espaciador Transcrito Interno (ITS 2 perteneciente al ADN ribosomal (rADN. Materiales y Métodos: Se analizaron muestras de ocho localidades (Jaén, Tingo María, Iquitos, Lambayeque, el distrito de El Rimac, Sullana y Zarumilla y uno de la provincia de Huaquillas (Ecuador. El análisis de la variabilidad se determinó usando la técnica conocida como SSCP (Single Stranded Conformation Polymorphism. Resultados: El estudio muestra que existe variabilidad genética entre las poblaciones analizadas, principalmente entre las muestras localizadas en la costa del Perú (Zarumilla, El Rímac, Sullana y Huaquillas y las muestras del nororiente (Tingo María, Iquitos, Jaén y Lambayeque Conclusión: Se determinaron dos variantes genéticas entre las poblaciones de Aedes aegypti: Costeña y Nororiental, que probablemente provienen de dos ancestros diferentes y cuyo ancestro común sufrió de aislamiento por distancia. Se observó que no existe relación entre las distancias genéticas y las distancias geográficas indicando que la migración de estas poblaciones es el resultado de la intervención de los seres humanos que diseminan al vector y no por la migración activa del mosquito. Se plantea el papel de la Cordillera de los Andes en la migración y separación de las poblaciones de Aedes.

  3. Detection of hybridization of single-strand DNA PCR products in temperature change process by a novel metal-clamping piezoelectric sensor.

    Science.gov (United States)

    Chen, Qinghai; Bian, Zhiheng; Hua, Xing; Yao, Chunyan; Wu, Wei; Zhang, Xue; Zhang, Bo; Huang, Junfu; Tang, Wanli; Fu, Weiling

    2010-05-15

    Oligonucleotide probes on the sensor surface can be hybridized with single-strand DNA (ssDNA) that is formed from PCR products in ice bath after degeneration. Thus, detection of PCR products by piezoelectric sensors requires the participation of ssDNA PCR products in ice bath. When PCR products in ice bath are added into the buffer of the sensor well at room temperature, there will be a temperature change process during mixing. However, it still remains unclear whether the temperature change affects the frequency baseline stability of the sensor and the result judgment, which is the basic condition for detecting hybridization of nucleic acid. In this study, we detected the hybridization of HPV PCR products during temperature change process by a self-designed adjustable metal-clamping piezoelectric sensor. The study mainly involves sensor adjustment, probe immobilization and ice bath sample addition (at different concentrations and different volumes). The response curve of basic frequency in temperature change process showed three stages, i.e., increase, decrease to baseline, and continuous decrease to stability. The early increase of frequency and duration of the time can reach 55+/-7.4 Hz and 39 min when 40 microL sample (0-1 degrees C) was added into 110 microL buffer (25 degrees C). The frequency increase effect caused by temperature difference at early stage depends on the volume ratio of two liquids and on the temperature difference. The results indicate that we should pay more attention to possibly small volume of PCR products in ice bath and minor temperature difference of two liquids in operation. 2010 Elsevier B.V. All rights reserved.

  4. Gauging the Nanotoxicity of h2D-C2N toward Single-Stranded DNA: An in Silico Molecular Simulation Approach.

    Science.gov (United States)

    Mukhopadhyay, Titas Kumar; Bhattacharyya, Kalishankar; Datta, Ayan

    2018-04-12

    Recent toxicological assessments of graphene, graphene oxides, and some other two-dimensional (2D) materials have shown them to be substantially toxic at the nanoscale, where they inhibit and eventually disrupt biological processes. These shortfalls of graphene and analogs have resulted in a quest for novel biocompatible 2D materials with minimum cytotoxicity. In this article, we demonstrate C 2 N (h2D-C 2 N), a newly synthesized 2D porous graphene analog, to be non-nanotoxic toward genetic materials from an "in-silico" point of view through sequence-dependent binding of different polynucleotide single-stranded DNA (ssDNA) onto it. The calculated binding energy of nucleobases and the free energy of binding of polynucleotides follow the common trait, cytosine > guanine > adenine > thymine, and are well within the limits of physisorption. Ab-initio simulations completely exclude the possibility of any chemical reaction, demonstrating purely noncovalent binding of nucleobases with C 2 N through a crucial interplay between hydrogen bonding and π-stacking interactions with the surface. Further, we show that the extent of distortion inflicted upon ssDNA by C 2 N is negligible. Analysis of the density of states of the nucleobase-C 2 N hybrids confirms minimum electronic perturbation of the bases after adsorption. Most importantly, we demonstrate the potency of C 2 N in nucleic acid transportation via reversible binding of ssDNA. The plausible use of C 2 N as a template for DNA repair is illustrated through an example of C 2 N-assisted complementary ssDNA winding.

  5. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Novel hypovirulence-associated RNA mycovirus in the plant pathogenic fungus botrytis cinerea: molecular and biological characterization

    Science.gov (United States)

    Botrytis cinerea is a pathogenic fungus causing gray mold disease on numerous economically important crops and ornamental plants. This study was conducted to characterize the biological and molecular features of a novel RNA mycovirus, Botrytis cinerea RNA virus 1 (BcRV1), in the hypovirulent strain ...

  7. Multiple RNA processing defects and impaired chloroplast function in plants deficient in the organellar protein-only RNase P enzyme.

    Directory of Open Access Journals (Sweden)

    Wenbin Zhou

    Full Text Available Transfer RNA (tRNA precursors undergo endoribonucleolytic processing of their 5' and 3' ends. 5' cleavage of the precursor transcript is performed by ribonuclease P (RNase P. While in most organisms RNase P is a ribonucleoprotein that harbors a catalytically active RNA component, human mitochondria and the chloroplasts (plastids and mitochondria of seed plants possess protein-only RNase P enzymes (PRORPs. The plant organellar PRORP (PRORP1 has been characterized to some extent in vitro and by transient gene silencing, but the molecular, phenotypic and physiological consequences of its down-regulation in stable transgenic plants have not been assessed. Here we have addressed the function of the dually targeted organellar PRORP enzyme in vivo by generating stably transformed Arabidopsis plants in which expression of the PRORP1 gene was suppressed by RNA interference (RNAi. PRORP1 knock-down lines show defects in photosynthesis, while mitochondrial respiration is not appreciably affected. In both plastids and mitochondria, the effects of PRORP1 knock-down on the processing of individual tRNA species are highly variable. The drastic reduction in the levels of mature plastid tRNA-Phe(GAA and tRNA-Arg(ACG suggests that these two tRNA species limit plastid gene expression in the PRORP1 mutants and, hence, are causally responsible for the mutant phenotype.

  8. Evolution of green plants as deduced from 5S rRNA sequences.

    Science.gov (United States)

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

  9. Structural characterization of antibiotic self-immunity tRNA synthetase in plant tumour biocontrol agent.

    Science.gov (United States)

    Chopra, Shaileja; Palencia, Andrés; Virus, Cornelia; Schulwitz, Sarah; Temple, Brenda R; Cusack, Stephen; Reader, John

    2016-10-07

    Antibiotic-producing microbes evolved self-resistance mechanisms to avoid suicide. The biocontrol Agrobacterium radiobacter K84 secretes the Trojan Horse antibiotic agrocin 84 that is selectively transported into the plant pathogen A. tumefaciens and processed into the toxin TM84. We previously showed that TM84 employs a unique tRNA-dependent mechanism to inhibit leucyl-tRNA synthetase (LeuRS), while the TM84-producer prevents self-poisoning by expressing a resistant LeuRS AgnB2. We now identify a mechanism by which the antibiotic-producing microbe resists its own toxin. Using a combination of structural, biochemical and biophysical approaches, we show that AgnB2 evolved structural changes so as to resist the antibiotic by eliminating the tRNA-dependence of TM84 binding. Mutagenesis of key resistance determinants results in mutants adopting an antibiotic-sensitive phenotype. This study illuminates the evolution of resistance in self-immunity genes and provides mechanistic insights into a fascinating tRNA-dependent antibiotic with applications for the development of anti-infectives and the prevention of biocontrol emasculation.

  10. Effect of temperature on the pathogenesis, accumulation of viral and satellite RNAs and on plant proteome in peanut stunt virus and satellite RNA-infected plants

    Directory of Open Access Journals (Sweden)

    Aleksandra eObrępalska-Stęplowska

    2015-10-01

    Full Text Available Temperature is an important environmental factor influencing plant development in natural and diseased conditions. The growth rate of plants grown at 27°C is more rapid than for plants grown at 21°C. Thus, temperature affects the rate of pathogenesis progression in individual plants. We have analyzed the effect of temperature conditions (either 21°C or 27°C during the day on the accumulation rate of the virus and satellite RNA (satRNA in Nicotiana benthamiana plants infected by peanut stunt virus (PSV with and without its satRNA, at four time points. In addition, we extracted proteins from PSV and PSV+satRNA-infected plants harvested at 21 dpi, when disease symptoms began to appear on plants grown at 21°C and were well developed on those grown at 27°C, to assess the proteome profile in infected plants compared to mock-inoculated plants grown at these two temperatures, using 2D-gel electrophoresis and mass spectrometry approaches. The accumulation rate of the viral RNAs and satRNA was more rapid at 27°C at the beginning of the infection and then rapidly decreased in PSV-infected plants. At 21 dpi, PSV and satRNA accumulation was higher at 21°C and had a tendency to increase further. In all studied plants grown at 27°C, we observed a significant drop in the identified proteins participating in photosynthesis and carbohydrate metabolism at the proteome level, in comparison to plants maintained at 21°C. On the other hand, the proteins involved in protein metabolic processes were all more abundant in plants grown at 27°C. This was especially evident when PSV-infected plants were analyzed, where increase in abundance of proteins involved in protein synthesis, degradation, and folding was revealed. In mock-inoculated and PSV-infected plants we found an increase in abundance of the majority of stress-related differently-regulated proteins and those associated with protein metabolism. In contrast, in PSV+satRNA-infected plants the shift in the

  11. Biotechnological approaches for plant viruses resistance: from general to the modern RNA silencing pathway

    Directory of Open Access Journals (Sweden)

    Silas Pessini Rodrigues

    2009-08-01

    Full Text Available Virus diseases are significant threats to modern agriculture and their control remains a challenge to the management of cultivation. The main virus resistance strategies are based on either natural resistance or engineered virus-resistant plants. Recent progress in understanding the molecular mechanisms underlying the roles of resistance genes has promoted the development of new anti-virus strategies. Engineered plants, in particular plants expressing RNA-silencing nucleotides, are becoming increasingly important and are likely to provide more effective strategies in future. A general discussion on the biotechnology of plant responses to virus infection is followed by recent advances in engineered plant resistance.As viroses são problemas importantes para a agricultura moderna e o seu controle representa um desafio para o manejo de áreas cultivadas. As principais estratégias de resistência a vírus se baseiam em mecanismos naturais ou em engenharia genética. Recentemente, a maior compreensão dos mecanismos moleculares envolvidos na função de genes de resistência da planta facilitou o desenvolvimento de novas estratégias antivirais. Plantas modificadas geneticamente, em particular aquelas expressando a via de silenciamento de RNA, são alvo de interesse crescente e representam a possibilidade de estratégias futuras mais efetivas. Neste trabalho são discutidos diferentes aspectos relacionados à resistência a viroses em plantas. Adicionalmente, a perspectiva de aplicação biotecnológica das diferentes vias de resistência é apresentada.

  12. Post-translational regulation of miRNA pathway components, AGO1 and HYL1, in plants

    DEFF Research Database (Denmark)

    Cho, Seok Keun; Ryu, Moon Young; Shah, Pratik

    2016-01-01

    , the complexity of the proteome increases, and this then influences most biological processes. Although small RNAs are crucial regulatory elements for gene expression in most eukaryotes, PTMs of small RNA microprocessor and RNA silencing components have not been extensively investigated in plants. To date......, several studies have shown that the proteolytic regulation of AGOs is important for host-pathogen interactions. DRB4 is regulated by the ubiquitin-proteasome system, and the degradation of HYL1 is modulated by a de-etiolation repressor, COP1, and an unknown cytoplasmic protease. Here, we discuss current...... findings on the PTMs of microprocessor and RNA silencing components in plants....

  13. Mutagenesis of the Agrobacterium VirE2 single-stranded DNA-binding protein identifies regions required for self-association and interaction with VirE1 and a permissive site for hybrid protein construction.

    Science.gov (United States)

    Zhou, X R; Christie, P J

    1999-07-01

    The VirE2 single-stranded DNA-binding protein (SSB) of Agrobacterium tumefaciens is required for delivery of T-DNA to the nuclei of susceptible plant cells. By yeast two-hybrid and immunoprecipitation analyses, VirE2 was shown to self-associate and to interact with VirE1. VirE2 mutants with small deletions or insertions of a 31-residue oligopeptide (i31) at the N or C terminus or with an i31 peptide insertion at Leu236 retained the capacity to form homomultimers. By contrast, VirE2 mutants with modifications outside a central region located between residues 320 and 390 retained the capacity to interact with VirE1. These findings suggest the tertiary structure of VirE2 is important for homomultimer formation whereas a central domain mediates formation of a complex with VirE1. The capacity of VirE2 mutants to interact with full-length VirE2 in the yeast Saccharomyces cerevisiae correlated with the abundance of the mutant proteins in A. tumefaciens, suggesting that VirE2 is stabilized by homomultimerization in the bacterium. We further characterized the promoter and N- and C-terminal sequence requirements for synthesis of functional VirE2. A PvirB::virE2 construct yielded functional VirE2 protein as defined by complementation of a virE2 null mutation. By contrast, PvirE or Plac promoter constructs yielded functional VirE2 only if virE1 was coexpressed with virE2. Deletion of 10 or 9 residues from the N or C terminus of VirE2, respectively, or addition of heterologous peptides or proteins to either terminus resulted in a loss of protein function. However, an i31 peptide insertion at Tyr39 had no effect on protein function as defined by the capacity of the mutant protein to (i) interact with native VirE2, (ii) interact with VirE1, (iii) accumulate at abundant levels in A. tumefaciens, and (iv) restore wild-type virulence to a virE2 null mutant. We propose that Tyr39 of VirE2 corresponds to a permissive site for insertion of heterologous peptides or proteins of interest

  14. Phosphate-methylated DNA aimed at HIV-1 RNA loops and integrated DNA inhibits viral infectivity

    NARCIS (Netherlands)

    Buck, H. M.; Koole, L. H.; van Genderen, M. H.; Smit, L.; Geelen, J. L.; Jurriaans, S.; Goudsmit, J.

    1990-01-01

    Phosphate-methylated DNA hybridizes strongly and specifically to natural DNA and RNA. Hybridization to single-stranded and double-stranded DNA leads to site-selective blocking of replication and transcription. Phosphate-methylated DNA was used to interrupt the life cycle of the human

  15. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    In this study, shRNA vectors having different stem length were constructed and their silencing effect was tested in mouse embryonic fibroblast and in vivo. Interfering RNAs were designed with stems of 21, 27, and 29 bp. The enhanced green fluorescent protein gene was used as target gene. The synthesized single strands ...

  16. Locked nucleic acid (LNA): High affinity targeting of RNA for diagnostics and therapeutics

    DEFF Research Database (Denmark)

    Kauppinen, S.; Vester, Birte; Wengel, Jesper

    2005-01-01

    Locked nucleic acid (LNA) is a nucleic acid analogue containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA mimicking sugar conformation. This conformational restriction results in unprecedented hybridization affinity towards complementary single stranded RN...

  17. PlantRNA_Sniffer: A SVM-Based Workflow to Predict Long Intergenic Non-Coding RNAs in Plants

    Directory of Open Access Journals (Sweden)

    Lucas Maciel Vieira

    2017-03-01

    Full Text Available Non-coding RNAs (ncRNAs constitute an important set of transcripts produced in the cells of organisms. Among them, there is a large amount of a particular class of long ncRNAs that are difficult to predict, the so-called long intergenic ncRNAs (lincRNAs, which might play essential roles in gene regulation and other cellular processes. Despite the importance of these lincRNAs, there is still a lack of biological knowledge and, currently, the few computational methods considered are so specific that they cannot be successfully applied to other species different from those that they have been originally designed to. Prediction of lncRNAs have been performed with machine learning techniques. Particularly, for lincRNA prediction, supervised learning methods have been explored in recent literature. As far as we know, there are no methods nor workflows specially designed to predict lincRNAs in plants. In this context, this work proposes a workflow to predict lincRNAs on plants, considering a workflow that includes known bioinformatics tools together with machine learning techniques, here a support vector machine (SVM. We discuss two case studies that allowed to identify novel lincRNAs, in sugarcane (Saccharum spp. and in maize (Zea mays. From the results, we also could identify differentially-expressed lincRNAs in sugarcane and maize plants submitted to pathogenic and beneficial microorganisms.

  18. De novo reconstruction of consensus master genomes of plant RNA and DNA viruses from siRNAs

    Science.gov (United States)

    In antiviral defense, plants produce massive quantities of 21-24 nucleotide siRNAs. Here we demonstrate that the complete genomes of DNA and RNA viruses and viroids can be reconstructed by deep sequencing and de novo assembly of viral/viroid siRNAs from experimentally- and naturally-infected plants....

  19. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W

    2009-12-23

    Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation

  20. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  1. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  2. rgs-CaM Detects and Counteracts Viral RNA Silencing Suppressors in Plant Immune Priming.

    Science.gov (United States)

    Jeon, Eun Jin; Tadamura, Kazuki; Murakami, Taiki; Inaba, Jun-Ichi; Kim, Bo Min; Sato, Masako; Atsumi, Go; Kuchitsu, Kazuyuki; Masuta, Chikara; Nakahara, Kenji S

    2017-10-01

    Primary infection of a plant with a pathogen that causes high accumulation of salicylic acid in the plant typically via a hypersensitive response confers enhanced resistance against secondary infection with a broad spectrum of pathogens, including viruses. This phenomenon is called systemic acquired resistance (SAR), which is a plant priming for adaption to repeated biotic stress. However, the molecular mechanisms of SAR-mediated enhanced inhibition, especially of virus infection, remain unclear. Here, we show that SAR against cucumber mosaic virus (CMV) in tobacco plants ( Nicotiana tabacum ) involves a calmodulin-like protein, rgs-CaM. We previously reported the antiviral function of rgs-CaM, which binds to and directs degradation of viral RNA silencing suppressors (RSSs), including CMV 2b, via autophagy. We found that rgs-CaM-mediated immunity is ineffective against CMV infection in normally growing tobacco plants but is activated as a result of SAR induction via salicylic acid signaling. We then analyzed the effect of overexpression of rgs-CaM on salicylic acid signaling. Overexpressed and ectopically expressed rgs-CaM induced defense reactions, including cell death, generation of reactive oxygen species, and salicylic acid signaling. Further analysis using a combination of the salicylic acid analogue benzo-(1,2,3)-thiadiazole-7-carbothioic acid S -methyl ester (BTH) and the Ca 2+ ionophore A23187 revealed that rgs-CaM functions as an immune receptor that induces salicylic acid signaling by simultaneously perceiving both viral RSS and Ca 2+ influx as infection cues, implying its autoactivation. Thus, secondary infection of SAR-induced tobacco plants with CMV seems to be effectively inhibited through 2b recognition and degradation by rgs-CaM, leading to reinforcement of antiviral RNA silencing and other salicylic acid-mediated antiviral responses. IMPORTANCE Even without an acquired immune system like that in vertebrates, plants show enhanced whole-plant

  3. The nucleolar RNA-binding protein B-36 is highly conserved among plants.

    Science.gov (United States)

    Guiltinan, M J; Schelling, M E; Ehtesham, N Z; Thomas, J C; Christensen, M E

    1988-08-01

    The nucleolar protein B-36 is an RNA-associated protein which has a number of properties in common with pre-mRNA-binding proteins (hnRNP proteins). Like the hnRNP proteins, B-36 appears to be evolutionarily conserved among various eukaryotes (protists and several animal species). The conservation of B-36 throughout the plant kingdom has been investigated using a panel of nine monoclonal antibodies previously shown to recognize a minimum of four different epitopes in Physarum B-36, the protein used to generate the monoclonal antibodies. Two of the epitopes (I and III) are widely conserved in 34 kDa proteins (presumably B-36 homologues) from the various species tested (Chlamydomonas, moss, fern, oat, onion, carrot, and bean). Using immunofluorescence localization in moss and carrot protoplasts, the cross-reacting proteins were shown to be restricted to the nucleolus, further confirming their probable homology to B-36. Epitopes I and III are also unique to the B-36 homologues as demonstrated by the failure of any other bands to cross-react. Another epitope (IV) was specifically recognized in the plant B-36 homologues but exhibited greatly reduced affinity for the monoclonal antibody relative to Physarum B-36. The remaining epitope (II), unlike the others, exhibited variable conservation in the plant B-36 homologues and, in addition, was present in several other seemingly unrelated proteins. Finally, several of the plant species exhibited two cross-reacting variants at roughly the 34 kDa position and in at least one of these cases a single monoclonal antibody was able to distinguish between the two variants, a result indicating that the variants do have bona fide structural differences.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. A geminivirus-based guide RNA delivery system for CRISPR/Cas9 mediated plant genome editing

    OpenAIRE

    Yin, Kangquan; Han, Ting; Liu, Guang; Chen, Tianyuan; Wang, Ying; Yu, Alice Yunzi L.; Liu, Yule

    2015-01-01

    CRISPR/Cas has emerged as potent genome editing technology and has successfully been applied in many organisms, including several plant species. However, delivery of genome editing reagents remains a challenge in plants. Here, we report a virus-based guide RNA (gRNA) delivery system for CRISPR/Cas9 mediated plant genome editing (VIGE) that can be used to precisely target genome locations and cause mutations. VIGE is performed by using a modified Cabbage Leaf Curl virus (CaLCuV) vector to expr...

  5. Contribution of single-strand breaks and alkali-labile bonds to the loss of infectivity of γ-irradiated phiX174 RF-DNA in E. coli cells mutant in various repair functions

    International Nuclear Information System (INIS)

    McKee, R.H.

    1975-01-01

    Twenty-one radiation sensitive mutants have been examined for their capacity to support gamma-irradiated phiX174 RF-DNA. The survival of phiX174 RF-DNA was reduced in essentially all of the sensitive mutants. The irradiated phiX174 RF-DNA was then separated into populations containing either single-strand breaks or alkali-labile bonds to examine the capacity of the mutants to repair each of the classes of lesions. It was found that all E. coli strains are unable to repair 22 percent of the single-strand breaks and all sensitive mutants are unable to repair an additional 10 percent of the breaks. All the repair functions examined are involved in single-strand break repair and none are more or less necessary than any of the others. PhiX174 RF-DNA is also inactivated by alkali-labile bonds. In the normal strains the inactivation efficiency is 0.16 lethal events per lesion with a threshold dose of 15 to 20 krads. The mutants are divided into two classes by their sensitivity to alkali-labile bonds. Both classes of mutants are also inactivated by alkali-labile bonds with efficiencies of about 0.17 and 0.29 lethal events per lesion, respectively. It is proposed that the differences seen in survival curves of phiX174 measured in the sensitive mutants is due to this difference. Although in normal cells the efficiency of inactivation of phiX174 by single-strand breaks is 50 percent greater than by alkali-labile bonds, alkali-labile bonds are produced at approximately twice the rate of single-strand breaks so alkali-labile bonds account for about 61 percent of the overall inactivation. In the mutants of least sensitivity alkali-labile bonds account for about 54 percent of the inactivating events and in the most sensitive about 67 percent

  6. Engineering host-derived resistance against plant parasites through RNA interference: challenges and opportunities.

    Science.gov (United States)

    Runo, Steven

    2011-01-01

    RNA interference (RNAi) has rapidly advanced to become a powerful genetic tool and holds promise to revolutionizing agriculture by providing a strategy for controlling a wide array of crop pests. Numerous studies document RNAi efficacy in achieving silencing in viruses, insects, nematodes and weeds parasitizing crops. In general, host derived pest resistance through RNAi is achieved by genetically transforming host plants with double stranded RNA constructs targeted at essential parasite genes leading to generation of small interfering RNAs (siRNAs). Small interfering RNAs formed in the host are then delivered to the parasite and transported to target cells. Delivery can be oral - worms and insects, viral infections, viruses - or through a vascular connections - parasitic plants, while delivery to target cells is by cell to cell systemic movement of the silencing signal. Despite the overall optimism in generating pest resistant crops through RNAi-mediated silencing, some hurdles have recently begun to emerge. Presently, the main challenge is delivery of sufficient siRNAs, in the right cells, and at the right time to mount; a strong, durable, and broad-spectrum posttranscriptional gene silencing (PTGS) signal. This review highlights the novel strategies available for improving host derived RNAi resistance in downstream applied agriculture.

  7. High sensitive method detection of plant RNA viruses by electrochemiluminescence reverse transcription PCR

    Science.gov (United States)

    Tang, Ya-bing; Xing, Da; Zhu, De-bin; Zhou, Xiao-ming

    2007-05-01

    It is well known that plant and animal viruses had widely spread the whole of world, and made a big loss in farming and husbandry. It is necessary that a highly efficient and accurate virus's detection method was developed. This research combines reverse transcription polymerase chain reaction (RT-PCR) technique with electrochemiluminescence method, to detect plant RNA viruses for the first time. Biotin-probe hybridizes with PCR product to specific select the target for detection, thus can avoid pseudo-positive result. TBR-probe hybridizes with PCR product to emit light for ECL detection. Specific nucleic acid sequences (20bp) were added to 5' terminal all of the primers, which can improve the chance of hybridization between TBR-probe and PCR product. At the same time, one of the PCR product chain can hybridize two Ru-probes, the ECL signal is intensified. The method was used to detect Odntoglossum ringspot virus ORSV, Sugarcane mosaic virus ScMV, Sorghum mosaic virus SrMV, and Maize dwarf mosaic virus MDMV, the experiment results show that this method could reliably identity virus infected plant samples. In a word, this method has higher sensitivity and lower cost than others. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity.

  8. Genetic Structure and Molecular Variability Analysis of Citrus sudden death-associated virus Isolates from Infected Plants Grown in Brazil

    Directory of Open Access Journals (Sweden)

    Emilyn Emy Matsumura

    2016-12-01

    Full Text Available Citrus sudden death-associated virus (CSDaV is a monopartite positive-sense single-stranded RNA virus that was suggested to be associated with citrus sudden death (CSD disease in Brazil. Here, we report the first study of the genetic structure and molecular variability among 31 CSDaV isolates collected from both symptomatic and asymptomatic trees in CSD-affected areas. Analyses of partial nucleotide sequences of five domains of the CSDaV genomic RNA, including those encoding for the methyltransferase, the multi-domain region (MDR, the helicase, the RNA-dependent RNA polymerase and the coat protein, showed that the MDR coding region was the most diverse region assessed here, and a possible association between this region and virus adaption to different host or plant tissues is considered. Overall, the nucleotide diversity (π was low for CSDaV isolates, but the phylogenetic analyses revealed the predominance of two main groups, one of which showed a higher association with CSD-symptomatic plants. Isolates obtained from CSD-symptomatic plants, compared to those obtained from asymptomatic plants, showed higher nucleotide diversity, nonsynonymous and synonymous substitution rates and number of amino acid changes on the coding regions located closer to the 5’ end region of the genomic RNA. This work provides new insights into the genetic diversity of the CSDaV, giving support for further epidemiological studies.

  9. RNA Interference towards the Potato Psyllid, Bactericera cockerelli, Is Induced in Plants Infected with Recombinant Tobacco mosaic virus (TMV.

    Directory of Open Access Journals (Sweden)

    Hada Wuriyanghan

    Full Text Available The potato/tomato psyllid, Bactericera cockerelli (B. cockerelli, is an important plant pest and the vector of the phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum, which is associated with the zebra chip disease of potatoes. Previously, we reported induction of RNA interference effects in B. cockerelli via in vitro-prepared dsRNA/siRNAs after intrathoracic injection, and after feeding of artificial diets containing these effector RNAs. In order to deliver RNAi effectors via plant hosts and to rapidly identify effective target sequences in plant-feeding B. cockerelli, here we developed a plant virus vector-based in planta system for evaluating candidate sequences. We show that recombinant Tobacco mosaic virus (TMV containing B. cockerelli sequences can efficiently infect and generate small interfering RNAs in tomato (Solanum lycopersicum, tomatillo (Physalis philadelphica and tobacco (Nicotiana tabacum plants, and more importantly delivery of interfering sequences via TMV induces RNAi effects, as measured by actin and V-ATPase mRNA reductions, in B. cockerelli feeding on these plants. RNAi effects were primarily detected in the B. cockerelli guts. In contrast to our results with TMV, recombinant Potato virus X (PVX and Tobacco rattle virus (TRV did not give robust infections in all plants and did not induce detectable RNAi effects in B. cockerelli. The greatest RNA interference effects were observed when B. cockerelli nymphs were allowed to feed on leaf discs collected from inoculated or lower expanded leaves from corresponding TMV-infected plants. Tomatillo plants infected with recombinant TMV containing B. cockerelli actin or V-ATPase sequences also showed phenotypic effects resulting in decreased B. cockerelli progeny production as compared to plants infected by recombinant TMV containing GFP. These results showed that RNAi effects can be achieved in plants against the phloem feeder, B. cockerelli, and the TMV-plant

  10. Progress in Genome Editing Technology and Its Application in Plants.

    Science.gov (United States)

    Zhang, Kai; Raboanatahiry, Nadia; Zhu, Bin; Li, Maoteng

    2017-01-01

    Genome editing technology (GET) is a versatile approach that has progressed rapidly as a mechanism to alter the genotype and phenotype of organisms. However, conventional genome modification using GET cannot satisfy current demand for high-efficiency and site-directed mutagenesis, retrofitting of artificial nucleases has developed into a new avenue within this field. Based on mechanisms to recognize target genes, newly-developed GETs can generally be subdivided into three cleavage systems, protein-dependent DNA cleavage systems (i.e., zinc-finger nucleases, ZFN, and transcription activator-like effector nucleases, TALEN), RNA-dependent DNA cleavage systems (i.e., clustered regularly interspaced short palindromic repeats-CRISPR associated proteins, CRISPR-Cas9, CRISPR-Cpf1, and CRISPR-C2c1), and RNA-dependent RNA cleavage systems (i.e., RNA interference, RNAi, and CRISPR-C2c2). All these techniques can lead to double-stranded (DSB) or single-stranded breaks (SSB), and result in either random mutations via non-homologous end-joining (NHEJ) or targeted mutation via homologous recombination (HR). Thus, site-directed mutagenesis can be induced via targeted gene knock-out, knock-in, or replacement to modify specific characteristics including morphology-modification, resistance-enhancement, and physiological mechanism-improvement along with plant growth and development. In this paper, an non-comprehensive review on the development of different GETs as applied to plants is presented.

  11. Progress in Genome Editing Technology and Its Application in Plants

    Science.gov (United States)

    Zhang, Kai; Raboanatahiry, Nadia; Zhu, Bin; Li, Maoteng

    2017-01-01

    Genome editing technology (GET) is a versatile approach that has progressed rapidly as a mechanism to alter the genotype and phenotype of organisms. However, conventional genome modification using GET cannot satisfy current demand for high-efficiency and site-directed mutagenesis, retrofitting of artificial nucleases has developed into a new avenue within this field. Based on mechanisms to recognize target genes, newly-developed GETs can generally be subdivided into three cleavage systems, protein-dependent DNA cleavage systems (i.e., zinc-finger nucleases, ZFN, and transcription activator-like effector nucleases, TALEN), RNA-dependent DNA cleavage systems (i.e., clustered regularly interspaced short palindromic repeats-CRISPR associated proteins, CRISPR-Cas9, CRISPR-Cpf1, and CRISPR-C2c1), and RNA-dependent RNA cleavage systems (i.e., RNA interference, RNAi, and CRISPR-C2c2). All these techniques can lead to double-stranded (DSB) or single-stranded breaks (SSB), and result in either random mutations via non-homologous end-joining (NHEJ) or targeted mutation via homologous recombination (HR). Thus, site-directed mutagenesis can be induced via targeted gene knock-out, knock-in, or replacement to modify specific characteristics including morphology-modification, resistance-enhancement, and physiological mechanism-improvement along with plant growth and development. In this paper, an non-comprehensive review on the development of different GETs as applied to plants is presented. PMID:28261237

  12. MicroRNA-mediated interactions between host and hepatitis C virus.

    Science.gov (United States)

    Li, Hu; Jiang, Jian-Dong; Peng, Zong-Gen

    2016-01-28

    MicroRNAs (miRNAs) are small noncoding RNAs. More than 2500 mature miRNAs are detected in plants, animals and several types of viruses. Hepatitis C virus (HCV), which is a positive-sense, single-stranded RNA virus, does not encode viral miRNA. However, HCV infection alters the expression of host miRNAs, either in cell culture or in patients with liver disease progression, such as liver fibrosis, cirrhosis, and hepatocellular carcinoma. In turn, host miRNAs regulate HCV life cycle through directly binding to HCV RNAs or indirectly targeting cellular mRNAs. Increasing evidence demonstrates that miRNAs are one of the centered factors in the interaction network between virus and host. The competitive viral and host RNA hypothesis proposes a latent cross-regulation pattern between host mRNAs and HCV RNAs. High loads of HCV RNA sequester and de-repress host miRNAs from their normal host targets and thus disturb host gene expression, indicating a means of adaptation for HCV to establish a persistent infection. Some special miRNAs are closely correlated with liver-specific disease progression and the changed levels of miRNAs are even higher sensitivity and specificity than those of traditional proteins. Therefore, some of them can serve as novel diagnostic/prognostic biomarkers in HCV-infected patients with liver diseases. They are also attractive therapeutic targets for development of new anti-HCV agents.

  13. Method for RNA extraction and cDNA library construction from microbes in crop rhizosphere soil.

    Science.gov (United States)

    Fang, Changxun; Xu, Tiecheng; Ye, Changliang; Huang, Likun; Wang, Qingshui; Lin, Wenxiong

    2014-02-01

    Techniques to analyze the transcriptome of the soil rhizosphere are essential to reveal the interactions and communications between plants and microorganisms in the soil ecosystem. In this study, different volumes of Al₂(SO₄)₃ were added to rhizosphere soil samples to precipitate humic substances, which interfere with most procedures of RNA and DNA analyses. After humic substances were precipitated, cells of soil microorganisms were broken by vortexing with glass beads, and then DNA and RNA were recovered using Tris-HCl buffer with LiCl, SDS, and EDTA. The crude extract was precipitated and dissolved in RNAse-free water, and then separated by agarose gel electrophoresis. We determined the optimum volume of Al₂(SO₄)₃ for treating rhizosphere soil of rice, tobacco, sugarcane, Rehmannia glutinosa, and Pseudostellaria heterophylla. The crude nucleic acids extract from rice soil was treated with DNase I and then RNA was purified using a gel filtration column. The purified RNA was reverse-transcribed into single-strand cDNA and then ligated with an adaptor at each end before amplifying ds cDNA. The ds cDNA was sub-cloned for subsequent gene sequence analysis. We conducted qPCR to amplify 16S ribosomal DNA and observed highly efficient amplification. These results show that the extraction method can be optimized to isolate and obtain high-quality nucleic acids from microbes in different rhizosphere soils, suitable for genomic and post-genomic analyses.

  14. A Cold-Inducible DEAD-Box RNA Helicase from Arabidopsis thaliana Regulates Plant Growth and Development under Low Temperature.

    Science.gov (United States)

    Liu, Yuelin; Tabata, Daisuke; Imai, Ryozo

    2016-01-01

    DEAD-box RNA helicases comprise a large family and are involved in a range of RNA processing events. Here, we identified one of the Arabidopsis thaliana DEAD-box RNA helicases, AtRH7, as an interactor of Arabidopsis COLD SHOCK DOMAIN PROTEIN 3 (AtCSP3), which is an RNA chaperone involved in cold adaptation. Promoter:GUS transgenic plants revealed that AtRH7 is expressed ubiquitously and that its levels of the expression are higher in rapidly growing tissues. Knockout mutant lines displayed several morphological alterations such as disturbed vein pattern, pointed first true leaves, and short roots, which resemble ribosome-related mutants of Arabidopsis. In addition, aberrant floral development was also observed in rh7 mutants. When the mutants were germinated at low temperature (12°C), both radicle and first leaf emergence were severely delayed; after exposure of seedlings to a long period of cold, the mutants developed aberrant, fewer, and smaller leaves. RNA blots and circular RT-PCR revealed that 35S and 18S rRNA precursors accumulated to higher levels in the mutants than in WT under both normal and cold conditions, suggesting the mutants are partially impaired in pre-rRNA processing. Taken together, the results suggest that AtRH7 affects rRNA biogenesis and plays an important role in plant growth under cold.

  15. Plant-Specific Preprotein and Amino Acid Transporter Proteins Are Required for tRNA Import into Mitochondria1[OPEN

    Science.gov (United States)

    Kubiszewski-Jakubiak, Szymon; Teixeira, Pedro F.; Narsai, Reena; Ivanova, Aneta; Megel, Cyrille; Schock, Annette; Kraus, Sabrina; Glaser, Elzbieta; Philippar, Katrin; Maréchal-Drouard, Laurence; Soll, Jürgen

    2016-01-01

    A variety of eukaryotes, in particular plants, do not contain the required number of tRNAs to support the translation of mitochondria-encoded genes and thus need to import tRNAs from the cytosol. This study identified two Arabidopsis (Arabidopsis thaliana) proteins, Tric1 and Tric2 (for tRNA import component), which on simultaneous inactivation by T-DNA insertion lines displayed a severely delayed and chlorotic growth phenotype and significantly reduced tRNA import capacity into isolated mitochondria. The predicted tRNA-binding domain of Tric1 and Tric2, a sterile-α-motif at the C-terminal end of the protein, was required to restore tRNA uptake ability in mitochondria of complemented plants. The purified predicted tRNA-binding domain binds the T-arm of the tRNA for alanine with conserved lysine residues required for binding. T-DNA inactivation of both Tric proteins further resulted in an increase in the in vitro rate of in organello protein synthesis, which was mediated by a reorganization of the nuclear transcriptome, in particular of genes encoding a variety of proteins required for mitochondrial gene expression at both the transcriptional and translational levels. The characterization of Tric1/2 provides mechanistic insight into the process of tRNA import into mitochondria and supports the theory that the tRNA import pathway resulted from the repurposing of a preexisting protein import apparatus. PMID:27789739

  16. A Cold-Inducible DEAD-Box RNA Helicase from Arabidopsis thaliana Regulates Plant Growth and Development under Low Temperature.

    Directory of Open Access Journals (Sweden)

    Yuelin Liu

    Full Text Available DEAD-box RNA helicases comprise a large family and are involved in a range of RNA processing events. Here, we identified one of the Arabidopsis thaliana DEAD-box RNA helicases, AtRH7, as an interactor of Arabidopsis COLD SHOCK DOMAIN PROTEIN 3 (AtCSP3, which is an RNA chaperone involved in cold adaptation. Promoter:GUS transgenic plants revealed that AtRH7 is expressed ubiquitously and that its levels of the expression are higher in rapidly growing tissues. Knockout mutant lines displayed several morphological alterations such as disturbed vein pattern, pointed first true leaves, and short roots, which resemble ribosome-related mutants of Arabidopsis. In addition, aberrant floral development was also observed in rh7 mutants. When the mutants were germinated at low temperature (12°C, both radicle and first leaf emergence were severely delayed; after exposure of seedlings to a long period of cold, the mutants developed aberrant, fewer, and smaller leaves. RNA blots and circular RT-PCR revealed that 35S and 18S rRNA precursors accumulated to higher levels in the mutants than in WT under both normal and cold conditions, suggesting the mutants are partially impaired in pre-rRNA processing. Taken together, the results suggest that AtRH7 affects rRNA biogenesis and plays an important role in plant growth under cold.

  17. Role of plant MicroRNA in cross-species regulatory networks of humans.

    Science.gov (United States)

    Zhang, Hao; Li, Yanpu; Liu, Yuanning; Liu, Haiming; Wang, Hongyu; Jin, Wen; Zhang, Yanmei; Zhang, Chao; Xu, Dong

    2016-08-08

    It has been found that microRNAs (miRNAs) can function as a regulatory factor across species. For example, food-derived plant miRNAs may pass through the gastrointestinal (GI) tract, enter into the plasma and serum of mammals, and interact with endogenous RNAs to regulate their expression. Although this new type of regulatory mechanism is not well understood, it provides a fresh look at the relationship between food consumption and physiology. To investigate this new type of mechanism, we conducted a systematic computational study to analyze the potential functions of these dietary miRNAs in the human body. In this paper, we predicted human and plant target genes using RNAhybrid and set some criteria to further filter them. Then we built the cross-species regulatory network according to the filtered targets, extracted central nodes by PageRank algorithm and built core modules. We summarized the functions of these modules to three major categories: ion transport, metabolic process and stress response, and especially some target genes are highly related to ion transport, polysaccharides and the lipid metabolic process. Through functional analysis, we found that human and plants have similar functions such as ion transport and stress response, so our study also indicates the existence of a close link between exogenous plant miRNA targets and digestive/urinary organs. According to our analysis results, we suggest that the ingestion of these plant miRNAs may have a functional impact on consuming organisms in a cross-kingdom way, and the dietary habit may affect the physiological condition at a genetic level. Our findings may be useful for discovering cross-species regulatory mechanism in further study.

  18. Evolutionary rate variation and RNA secondary structure prediction

    DEFF Research Database (Denmark)

    Knudsen, B.; Andersen, E.S.; Damgaard, C.

    2004-01-01

    Predicting RNA secondary structure using evolutionary history can be carried out by using an alignment of related RNA sequences with conserved structure. Accurately determining evolutionary substitution rates for base pairs and single stranded nucleotides is a concern for methods based on this type...... by applying rates derived from tRNA and rRNA to the prediction of the much more rapidly evolving 5'-region of HIV-1. We find that the HIV-1 prediction is in agreement with experimental data, even though the relative evolutionary rate between A and G is significantly increased, both in stem and loop regions...

  19. MicroRNA from Moringa oleifera: Identification by High Throughput Sequencing and Their Potential Contribution to Plant Medicinal Value.

    Science.gov (United States)

    Pirrò, Stefano; Zanella, Letizia; Kenzo, Maurice; Montesano, Carla; Minutolo, Antonella; Potestà, Marina; Sobze, Martin Sanou; Canini, Antonella; Cirilli, Marco; Muleo, Rosario; Colizzi, Vittorio; Galgani, Andrea

    2016-01-01

    Moringa oleifera is a widespread plant with substantial nutritional and medicinal value. We postulated that microRNAs (miRNAs), which are endogenous, noncoding small RNAs regulating gene expression at the post-transcriptional level, might contribute to the medicinal properties of plants of this species after ingestion into human body, regulating human gene expression. However, the knowledge is scarce about miRNA in Moringa. Furthermore, in order to test the hypothesis on the pharmacological potential properties of miRNA, we conducted a high-throughput sequencing analysis using the Illumina platform. A total of 31,290,964 raw reads were produced from a library of small RNA isolated from M. oleifera seeds. We identified 94 conserved and two novel miRNAs that were validated by qRT-PCR assays. Results from qRT-PCR trials conducted on the expression of 20 Moringa miRNA showed that are conserved across multiple plant species as determined by their detection in tissue of other common crop plants. In silico analyses predicted target genes for the conserved miRNA that in turn allowed to relate the miRNAs to the regulation of physiological processes. Some of the predicted plant miRNAs have functional homology to their mammalian counterparts and regulated human genes when they were transfected into cell lines. To our knowledge, this is the first report of discovering M. oleifera miRNAs based on high-throughput sequencing and bioinformatics analysis and we provided new insight into a potential cross-species control of human gene expression. The widespread cultivation and consumption of M. oleifera, for nutritional and medicinal purposes, brings humans into close contact with products and extracts of this plant species. The potential for miRNA transfer should be evaluated as one possible mechanism of action to account for beneficial properties of this valuable species.

  20. RNase MRP RNA and RNase P activity in plants are associated with a Pop1p containing complex.

    Science.gov (United States)

    Krehan, Mario; Heubeck, Christian; Menzel, Nicolas; Seibel, Peter; Schön, Astrid

    2012-09-01

    RNase P processes the 5'-end of tRNAs. An essential catalytic RNA has been demonstrated in Bacteria, Archaea and the nuclei of most eukaryotes; an organism-specific number of proteins complement the holoenzyme. Nuclear RNase P from yeast and humans is well understood and contains an RNA, similar to the sister enzyme RNase MRP. In contrast, no protein subunits have yet been identified in the plant enzymes, and the presence of a nucleic acid in RNase P is still enigmatic. We have thus set out to identify and characterize the subunits of these enzymes in two plant model systems. Expression of the two known Arabidopsis MRP RNA genes in vivo was verified. The first wheat MRP RNA sequences are presented, leading to improved structure models for plant MRP RNAs. A novel mRNA encoding the central RNase P/MRP protein Pop1p was identified in Arabidopsis, suggesting the expression of distinct protein variants from this gene in vivo. Pop1p-specific antibodies precipitate RNase P activity and MRP RNAs from wheat extracts. Our results provide evidence that in plants, Pop1p is associated with MRP RNAs and with the catalytic subunit of RNase P, either separately or in a single large complex.

  1. Genetic recombination in plant-infecting messenger-sense RNA viruses: overview and research perspectives

    Directory of Open Access Journals (Sweden)

    Jozef Julian Bujarski

    2013-03-01

    Full Text Available RNA recombination is one of the driving forces of genetic variability in (+-strand RNA viruses. Various types of RNA-RNA crossovers were described including crosses between the same or different viral RNAs or between viral and cellular RNAs. Likewise, a variety of molecular mechanisms are known to support RNA recombination, such as replicative events (based on internal or end-to-end replicase switchings along with nonreplicative joining among RNA fragments of viral and/or cellular origin. Such mechanisms as RNA decay or RNA interference are responsible for RNA fragmentation and trans-esterification reactions which are likely accountable for ligation of RNA fragments. Numerous host factors were found to affect the profiles of viral RNA recombinants and significant differences in recombination frequency were observed among various RNA viruses. Comparative analyses of viral sequences allowed for the development of evolutionary models in order to explain adaptive phenotypic changes and co-evolving sites. Many questions remain to be answered by forthcoming RNA recombination research. (i How various factors modulate the ability of viral replicase to switch templates, (ii What is the intracellular location of RNA-RNA template switchings, (iii Mechanisms and factors responsible for non-replicative RNA recombination, (iv Mechanisms of integration of RNA viral sequences with cellular genomic DNA, and (v What is the role of RNA splicing and ribozyme activity. From an evolutionary stand point, it is not known how RNA viruses parasitize new host species via recombination, nor is it obvious what the contribution of RNA recombination is among other RNA modification pathways. We do not understand why the frequency of RNA recombination varies so much among RNA viruses and the status of RNA recombination as a form of sex is not well documented.

  2. Conformationally locked aryl C-nucleosides: synthesis of phosphoramidite monomers and incorporation into single-stranded DNA and LNA (locked nucleic acid)

    DEFF Research Database (Denmark)

    Babu, B. Ravindra; Prasad, Ashok K.; Trikha, Smriti

    2002-01-01

    . The phosphoramidite approach was used for automated incorporation of the LNA-type beta-configured C-aryl monomers 17a-17e into short DNA and 2'-OMe-RNA/LNA strands. It is shown that universal hybridization can be obtained with a conformationally restricted monomer as demonstrated most convincingly for the pyrene LNA...... monomer 17d, both in a DNA context and in an RNA-like context. Increased binding affinity of oligonucleotide probes for universal hybridization can be induced by combining the pyrene LNA monomer 17d with affinity-enhancing 2'-OMe-RNA/LNA monomers....

  3. Computer-Aided Design of RNA Origami Structures.

    Science.gov (United States)

    Sparvath, Steffen L; Geary, Cody W; Andersen, Ebbe S

    2017-01-01

    RNA nanostructures can be used as scaffolds to organize, combine, and control molecular functionalities, with great potential for applications in nanomedicine and synthetic biology. The single-stranded RNA origami method allows RNA nanostructures to be folded as they are transcribed by the RNA polymerase. RNA origami structures provide a stable framework that can be decorated with functional RNA elements such as riboswitches, ribozymes, interaction sites, and aptamers for binding small molecules or protein targets. The rich library of RNA structural and functional elements combined with the possibility to attach proteins through aptamer-based binding creates virtually limitless possibilities for constructing advanced RNA-based nanodevices.In this chapter we provide a detailed protocol for the single-stranded RNA origami design method using a simple 2-helix tall structure as an example. The first step involves 3D modeling of a double-crossover between two RNA double helices, followed by decoration with tertiary motifs. The second step deals with the construction of a 2D blueprint describing the secondary structure and sequence constraints that serves as the input for computer programs. In the third step, computer programs are used to design RNA sequences that are compatible with the structure, and the resulting outputs are evaluated and converted into DNA sequences to order.

  4. Comparative study on the evolution of chloroplast ribosomal 5S RNA of a living fossil plant, Cycas revoluta Thumb.

    Science.gov (United States)

    Zhou, X Q; Liu, W Y; Wang, M Q

    1988-08-01

    The complete nucleotide sequence of Cycas revoluta Thunb chloroplast 5 S rRNA was determined. It consists of 122 nucleotides. This is the only known 5 S rRNA sequence in Gymnospermae. It is highly homologous with chloroplast 5 S rRNA of higher plants (92-97%), but less homologous (about 54%) with those of lower plants. There is however 67% homology between Cycas and a procaryote a. nidulans. The chloroplast 5 S rRNAs of Angiospermae are nearly identical with each other (95-97%). S. oligorhize and L. minor have 100% homology among themselves. We have constructed a phylogenic tree of 5 S rRNA sequences from fifteen plant chloroplasts. The result suggests that the emergence of algae occurred at an early stage of plant chloroplast evolution and that green plants originated from green algae. This is in agreement with the classical view and other theories of molecular evolution. However there is no common ancestor in the case of Bryophyta and ferns. Among the Angiospermae, a precise evolutionary process cannot be deduced because the Knuc values among the species are very close to each other.

  5. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family.

    Science.gov (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław

    2017-05-01

    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  6. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D

    2010-01-01

    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  7. Increased type I collagen content and DNA binding activity of a single-stranded, cytosine-rich sequence in the high-salt buffer protein extract of the copper-deficient rat heart.

    Science.gov (United States)

    Zeng, Huawei; Saari, Jack T

    2004-11-01

    Dietary copper (Cu) deficiency not only causes a hypertrophic cardiomyopathy but also increases cancer risk in rodent models. However, a possible alteration in gene expression has not been fully examined. The present study was undertaken to determine the effect of Cu deficiency on protein profiles in rat heart tissue. Male Sprague-Dawley rats were fed diets that were either a Cu-adequate diet (6.0 microg Cu/g diet, n = 6) or a Cu-deficient diet (0.3 microg Cu/g diet, n = 6) for 5 weeks. The high-salt buffer (HSB) protein extract from heart tissue of Cu-deficient, but not Cu-adequate rats showed a 132 kDa protein band by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. This protein band stained pink with Coomassie Blue, suggesting the presence of collagens or other proline-rich proteins. Dot immunoblotting demonstrated that total type I collagen was increased by 110% in HSB protein extract from Cu-deficient, relative to Cu-adequate, rats. Liquid chromatography with mass spectrometry analysis indicated that the 132 kDa protein band contained a collagen alpha (I) chain precursor as well as a leucine-rich protein 130 (LRP130) in HSB protein extract from Cu-deficient but not Cu-adequate rats. A gel shift assay showed that HSB protein extract from Cu-deficient rats bound to a single-stranded cytosine-rich DNA with higher affinity than the extract of Cu-adequate rats, similar to reports of an increase in LRP130 single-stranded DNA binding activity in several types of tumor cells. Collectively, these results not only suggest an additional feature of altered collagen metabolism with Cu deficiency but also demonstrate for the first time an increase in single-stranded cytosine-rich DNA binding in Cu-deficient rat heart.

  8. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: tcheng@ntu.edu.tw [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)

    2013-02-01

    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ► To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ► ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ► PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ► The findings

  9. Expression of the double-stranded RNA of the soybean pod borer Leguminivora glycinivorella (Lepidoptera: Tortricidae) ribosomal protein P0 gene enhances the resistance of transgenic soybean plants.

    Science.gov (United States)

    Meng, Fanli; Li, Yang; Zang, Zhenyuan; Li, Na; Ran, Ruixue; Cao, Yingxue; Li, Tianyu; Zhou, Quan; Li, Wenbin

    2017-12-01

    The soybean pod borer [SPB; Leguminivora glycinivorella (Matsumura) (Lepidoptera: Tortricidae)] is the most important soybean pest in northeastern Asia. Silencing genes using plant-mediated RNA-interference is a promising strategy for controlling SPB infestations. The ribosomal protein P0 is important for protein translation and DNA repair in the SPB. Thus, transferring P0 double-stranded RNA (dsRNA) into plants may help prevent SPB-induced damage. We investigated the effects of SpbP0 dsRNA injections and SpbP0 dsRNA-expressing transgenic soybean plants on the SPB. Larval mortality rates were greater for SpbP0 dsRNA-injected larvae (96%) than for the control larvae (31%) at 14 days after injections. Transgenic T 2 soybean plants expressing SpbP0 dsRNA sustained less damage from SPB larvae than control plants. In addition, the expression level of the SpbP0 gene decreased and the mortality rate increased when SPB larvae were fed on T 3 transgenic soybean pods. Moreover, the surviving larvae were deformed and exhibited inhibited growth. Silencing SpbP0 expression is lethal to the SPB. Transgenic soybean plants expressing SpbP0 dsRNA are more resistant to the SPB than wild-type plants. Thus, SpbP0 dsRNA-expressing transgenic plants may be useful for controlling insect pests. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  10. A modular toolbox for gRNA?Cas9 genome engineering in plants based on the GoldenBraid standard

    OpenAIRE

    Vazquez-Vilar, Marta; Bernab?-Orts, Joan Miquel; Fernandez-del-Carmen, Asun; Ziarsolo, Pello; Blanca, Jose; Granell, Antonio; Orzaez, Diego

    2016-01-01

    [EN] Background: The efficiency, versatility and multiplexing capacity of RNA-guided genome engineering using the CRISPR/Cas9 technology enables a variety of applications in plants, ranging from gene editing to the construction of transcriptional gene circuits, many of which depend on the technical ability to compose and transfer complex synthetic instructions into the plant cell. The engineering principles of standardization and modularity applied to DNA cloning are impacting pla...

  11. Plant rhabdoviruses: new insights and research needs in the interplay of negative-strand RNA viruses with plant and insect hosts.

    Science.gov (United States)

    Mann, Krin S; Dietzgen, Ralf G

    2014-08-01

    Rhabdoviruses are taxonomically classified in the family Rhabdoviridae, order Mononegavirales. As a group, rhabdoviruses can infect plants, invertebrates and vertebrates. Plant cyto- and nucleorhabdoviruses infect a wide variety of species across both monocot and dicot families, including agriculturally important crops such as lettuce, wheat, barley, rice, maize, potato and tomato. Plant rhabdoviruses are transmitted by and replicate in hemipteran insects such as aphids (Aphididae), leafhoppers (Cicadellidae), or planthoppers (Delphacidae). These specific interactions between plants, viruses and insects offer new insights into host adaptation and molecular virus evolution. This review explores recent advances as well as knowledge gaps in understanding of replication, RNA silencing suppression and movement of plant rhabdoviruses with respect to both plant and insect hosts.

  12. Elongator and SPT4/SPT5 complexes as proxy to study RNA polymerase II transcript elongation control of plant development.

    Science.gov (United States)

    Van Lijsebettens, Mieke; Dürr, Julius; Woloszynska, Magdalena; Grasser, Klaus D

    2014-10-01

    The elongation phase of the RNA polymerase II (RNAPII) transcription process is dynamic and regulated. Elongator and SUPPRESSOR OF Ty4 (SPT4)/SPT5 are transcript elongation factors that contribute to the regulation of mRNA synthesis by RNA polymerase II in the chromatin context. Recently, the Elongator complex consisting of six subunits and the SPT4/SPT5 heterodimer were isolated from Arabidopsis. Mutant plants affected in the expression of Elongator or SPT4/SPT5 share various auxin-signaling phenotypes. In line with that observation, auxin-related genes are prominent among the genes differentially expressed in these mutants. Exemplified by Elongator and SPT4/SPT5, we discuss here the role that transcript elongation factors may play in the control of plant growth and development. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. A Method for Extracting High-Quality RNA from Diverse Plants for Next-Generation Sequencing and Gene Expression Analyses

    Directory of Open Access Journals (Sweden)

    Roxana Yockteng

    2013-12-01

    Full Text Available Premise of the study: To study gene expression in plants, high-quality RNA must be extracted in quantities sufficient for subsequent cDNA library construction. Field-based collections are often limited in quantity and quality of tissue and are typically preserved in RNAlater. Obtaining sufficient and high-quality yield from variously preserved samples is essential to studies of comparative biology. We present a protocol for the extraction of high-quality RNA from even the most recalcitrant plant tissues. Methods and Results: Tissues from mosses, cycads, and angiosperm floral organs and leaves were preserved in RNAlater or frozen fresh at −80°C. Extractions were performed and quality was measured for yield and purity. Conclusions: This protocol results in the extraction of high-quality RNA from a variety of plant tissues representing vascular and nonvascular plants. RNA was used for cDNA synthesis to generate libraries for next-generation sequencing and for expression studies using quantitative PCR (qPCR and semiquantitative reverse transcription PCR (RT-PCR.

  14. High Variety of Known and New RNA and DNA Viruses of Diverse Origins in Untreated Sewage

    Science.gov (United States)

    Ng, Terry Fei Fan; Marine, Rachel; Wang, Chunlin; Simmonds, Peter; Kapusinszky, Beatrix; Bodhidatta, Ladaporn; Oderinde, Bamidele Soji; Wommack, K. Eric

    2012-01-01

    Deep sequencing of untreated sewage provides an opportunity to monitor enteric infections in large populations and for high-throughput viral discovery. A metagenomics analysis of purified viral particles in untreated sewage from the United States (San Francisco, CA), Nigeria (Maiduguri), Thailand (Bangkok), and Nepal (Kathmandu) revealed sequences related to 29 eukaryotic viral families infecting vertebrates, invertebrates, and plants (BLASTx E score, 90% protein identities) in numerous viral families infecting humans (Adenoviridae, Astroviridae, Caliciviridae, Hepeviridae, Parvoviridae, Picornaviridae, Picobirnaviridae, and Reoviridae), plants (Alphaflexiviridae, Betaflexiviridae, Partitiviridae, Sobemovirus, Secoviridae, Tombusviridae, Tymoviridae, Virgaviridae), and insects (Dicistroviridae, Nodaviridae, and Parvoviridae). The full and partial genomes of a novel kobuvirus, salivirus, and sapovirus are described. A novel astrovirus (casa astrovirus) basal to those infecting mammals and birds, potentially representing a third astrovirus genus, was partially characterized. Potential new genera and families of viruses distantly related to members of the single-stranded RNA picorna-like virus superfamily were genetically characterized and named Picalivirus, Secalivirus, Hepelivirus, Nedicistrovirus, Cadicistrovirus, and Niflavirus. Phylogenetic analysis placed these highly divergent genomes near the root of the picorna-like virus superfamily, with possible vertebrate, plant, or arthropod hosts inferred from nucleotide composition analysis. Circular DNA genomes distantly related to the plant-infecting Geminiviridae family were named Baminivirus, Nimivirus, and Niminivirus. These results highlight the utility of analyzing sewage to monitor shedding of viral pathogens and the high viral diversity found in this common pollutant and provide genetic information to facilitate future studies of these newly characterized viruses. PMID:22933275

  15. MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing

    DEFF Research Database (Denmark)

    Nielsen, M; Hansen, J H; Hedegaard, J

    2010-01-01

    MicroRNAs (miRNA) are short single-stranded RNA molecules that regulate gene expression post-transcriptionally by binding to complementary sequences in the 3' untranslated region (3' UTR) of target mRNAs. MiRNAs participate in the regulation of myogenesis, and identification of the complete set o...... that highly expressed miRNAs are involved in skeletal muscle development and regeneration, signal transduction, cell-cell and cell-extracellular matrix communication and neural development and function....

  16. De novo reconstruction of consensus master genomes of plant RNA and DNA viruses from siRNAs.

    Science.gov (United States)

    Seguin, Jonathan; Rajeswaran, Rajendran; Malpica-López, Nachelli; Martin, Robert R; Kasschau, Kristin; Dolja, Valerian V; Otten, Patricia; Farinelli, Laurent; Pooggin, Mikhail M

    2014-01-01

    Virus-infected plants accumulate abundant, 21-24 nucleotide viral siRNAs which are generated by the evolutionary conserved RNA interference (RNAi) machinery that regulates gene expression and defends against invasive nucleic acids. Here we show that, similar to RNA viruses, the entire genome sequences of DNA viruses are densely covered with siRNAs in both sense and antisense orientations. This implies pervasive transcription of both coding and non-coding viral DNA in the nucleus, which generates double-stranded RNA precursors of viral siRNAs. Consistent with our finding and hypothesis, we demonstrate that the complete genomes of DNA viruses from Caulimoviridae and Geminiviridae families can be reconstructed by deep sequencing and de novo assembly of viral siRNAs using bioinformatics tools. Furthermore, we prove that this 'siRNA omics' approach can be used for reliable identification of the consensus master genome and its microvariants in viral quasispecies. Finally, we utilized this approach to reconstruct an emerging DNA virus and two viroids associated with economically-important red blotch disease of grapevine, and to rapidly generate a biologically-active clone representing the wild type master genome of Oilseed rape mosaic virus. Our findings show that deep siRNA sequencing allows for de novo reconstruction of any DNA or RNA virus genome and its microvariants, making it suitable for universal characterization of evolving viral quasispecies as well as for studying the mechanisms of siRNA biogenesis and RNAi-based antiviral defense.

  17. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  18. RNAi-mediated mortality of the whitefly through transgenic expression of double-stranded RNA homologous to acetylcholinesterase and ecdysone receptor in tobacco plants

    Science.gov (United States)

    The whitefly Bemisia tabaci (Genn.) is a pest and vector of plant viruses affecting plants worldwide. Using RNA interference (RNAi) to downregulate whitefly genes by expressing their homologous double stranded RNAs in plants has great potential for management of whiteflies to reduce plant virus dise...

  19. dRNA-Seq Reveals Genomewide TSSs and Noncoding RNAs of Plant Beneficial Rhizobacterium Bacillus amyloliquefaciens FZB42

    Science.gov (United States)

    Fan, Ben; Förstner, Konrad; Vogel, Jörg; Borriss, Rainer; Wu, Xiao-Qin

    2015-01-01

    Bacillus amyloliquefaciens subsp. plantarum FZB42 is a representative of Gram-positive plant-growth-promoting rhizobacteria (PGPR) that inhabit plant root environments. In order to better understand the molecular mechanisms of bacteria-plant symbiosis, we have systematically analyzed the primary transcriptome of strain FZB42 grown under rhizosphere-mimicking conditions using differential RNA sequencing (dRNA-seq). Our analysis revealed 4,877 transcription start sites for protein-coding genes, identified genes differentially expressed under different growth conditions, and corrected many previously mis-annotated genes. We also identified a large number of riboswitches and cis-encoded antisense RNAs, as well as trans-encoded small noncoding RNAs that may play important roles in the gene regulation of Bacillus. Overall, our analyses provided a landscape of Bacillus primary transcriptome and improved the knowledge of rhizobacteria-host interactions. PMID:26540162

  20. dRNA-Seq Reveals Genomewide TSSs and Noncoding RNAs of Plant Beneficial Rhizobacterium Bacillus amyloliquefaciens FZB42.

    Directory of Open Access Journals (Sweden)

    Ben Fan

    Full Text Available Bacillus amyloliquefaciens subsp. plantarum FZB42 is a representative of Gram-positive plant-growth-promoting rhizobacteria (PGPR that inhabit plant root environments. In order to better understand the molecular mechanisms of bacteria-plant symbiosis, we have systematically analyzed the primary transcriptome of strain FZB42 grown under rhizosphere-mimicking conditions using differential RNA sequencing (dRNA-seq. Our analysis revealed 4,877 transcription start sites for protein-coding genes, identified genes differentially expressed under different growth conditions, and corrected many previously mis-annotated genes. We also identified a large number of riboswitches and cis-encoded antisense RNAs, as well as trans-encoded small noncoding RNAs that may play important roles in the gene regulation of Bacillus. Overall, our analyses provided a landscape of Bacillus primary transcriptome and improved the knowledge of rhizobacteria-host interactions.

  1. Use of recombinant tobacco mosaic virus to achieve RNA interference in plants against the citrus mealybug, Planococcus citri (Hemiptera: Pseudococcidae.

    Directory of Open Access Journals (Sweden)

    Arif Muhammad Khan

    Full Text Available The citrus mealybug, Planococcus citri, is an important plant pest with a very broad plant host range. P. citri is a phloem feeder and loss of plant vigor and stunting are characteristic symptoms induced on a range of host plants, but P. citri also reduces fruit quality and causes fruit drop leading to significant yield reductions. Better strategies for managing this pest are greatly needed. RNA interference (RNAi is an emerging tool for functional genomics studies and is being investigated as a practical tool for highly targeted insect control. Here we investigated whether RNAi effects can be induced in P. citri and whether candidate mRNAs could be identified as possible targets for RNAi-based P. citri control. RNAi effects were induced in P. citri, as demonstrated by specific target reductions of P. citri actin, chitin synthase 1 and V-ATPase mRNAs after injection of the corresponding specific double-stranded RNA inducers. We also used recombinant Tobacco mosaic virus (TMV to express these RNAi effectors in Nicotiana benthamiana plants. We found that P. citri showed lower fecundity and pronounced death of crawlers after feeding on recombinant TMV-infected plants. Taken together, our data show that actin, chitin synthase 1 and V-ATPase mRNAs are potential targets for RNAi against P. citri, and that recombinant TMV is an effective tool for evaluating candidate RNAi effectors in plants.

  2. The Conserved RNA Exonuclease Rexo5 Is Required for 3′ End Maturation of 28S rRNA, 5S rRNA, and snoRNAs

    Directory of Open Access Journals (Sweden)

    Stefanie Gerstberger

    2017-10-01

    Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.

  3. Regulation of poly(A) RNA retention in the nucleus as a survival strategy of plants during hypoxia.

    Science.gov (United States)

    Niedojadło, Janusz; Dełeńko, Konrad; Niedojadło, Katarzyna

    2016-05-03

    Last finding indicates that post-transcriptional processes are significant in low-oxygen conditions, but their nature is poorly understood. Here, we localized poly(A) RNA and mRNA coding proteins involved and not involved with resistance to hypoxia in Lupinus luteus and Arabidopsis thaliana during submergence and after recovery of aerobic conditions. We showed a strong nuclear accumulation of poly(A) RNA and 6 of 7 studied mRNAs with a concurrent strong reduction in RNA polymerase II transcription during hypoxia. In this study, the nucleus did not accumulate mRNA of the ADH1 (alcohol dehydrogenase 1) gene, which is a core hypoxia gene. The RNA accumulation in the nucleus is among the mechanisms of post-transcriptional gene regulation that prevents translation. However re-aeration was accompanied by a strong increase in the amount of the mRNAs in the cytoplasm and a simultaneous decrease in nuclear mRNAs. This finding indicates that the nucleus is a storage site for those of mRNAs which are not involved in the response to hypoxia for use by the plants after the hypoxic stress. In this study, the highest intensity of RNA accumulation occurred in Cajal bodies (CBs); the intensity of accumulation was inversely correlated with transcription. Under hypoxia, ncb-1 mutants of Arabidopsis thaliana with a complete absence of CBs died sooner than wild type (WT), accompanied by a strong reduction in the level of poly(A) RNA in the nucleus. These results suggest that the CBs not only participate in the storage of the nuclear RNA, but they also could take part in its stabilization under low-oxygen conditions.

  4. Traffic jam on the cellular secretory pathway generated by a replication protein from a plant RNA virus.

    Science.gov (United States)

    Hyodo, Kiwamu; Kaido, Masanori; Okuno, Tetsuro

    2014-01-01

    Although positive-strand RNA [(+)RNA] viruses have a limited coding capacity, they can replicate efficiently in host cells because of their ability to use host-derived proteins, membranes, lipids, and metabolites, and to rewire cellular trafficking pathways. Previously, we showed that a plant RNA virus, the Red clover necrotic mosaic virus (RCNMV), hijacked Arf1 and Sar1, which are small GTPases that regulate the biogenesis of COPI and COPII vesicles, respectively, for viral RNA replication. These small GTPases are relocated from appropriate subcellular compartments to the viral RNA replication sites by p27 replication protein, which raises the possibility that RCNMV interferes with the cellular secretory pathway. Here, we examined this possibility by using green fluorescent protein-fused rice SCAMP1 and Arabidopsis LRR84A as secretory pathway marker proteins and showed that p27 inhibited the trafficking of these proteins. RCNMV-mediated inhibition of the host secretion pathway and its possible impact on plant-virus interaction are discussed.

  5. Mimicry of molecular pretenders: the terminal structures of satellites associated with plant RNA viruses.

    Science.gov (United States)

    Huang, Ying-Wen; Hu, Chung-Chi; Lin, Na-Sheng; Hsu, Yau-Heiu

    2010-01-01

    Satellite RNAs (satRNAs) and satellite viruses depend on the replicase complexes provided by their cognate helper viruses and host plants for replication, pretending that they are part of the viral genomes. Although satRNAs and satellite viruses do not share significant nucleotide sequence similarity with the helper viruses, the essential cis-acting elements recognized by the replicase complexes must reside on their genomes, acting as the mimicry for the molecular pretenders. By understanding how this molecular mimicry deceives the helper viruses into supporting the satellites, a significant amount of knowledge of the basic requirements and mechanisms for replication of viruses and satellites has been obtained. Here we review the recent advances in understanding the effects of the cis elements at the termini of satRNAs and satellite viruses on their accumulation. Several well-characterized satellite/helper virus systems, representing the non-coding short satRNAs, mRNA-type long satRNAs, circular satRNAs and satellite viruses, are compared and contrasted. It is concluded that different satellites may adopt different strategies to exploit the replication/transcription/translation machineries of their helper viruses, and different mimicries may be implemented by the same molecular pretender for different biological functions.

  6. Identification of Appropriate Reference Genes for Normalization of miRNA Expression in Grafted Watermelon Plants under Different Nutrient Stresses.

    Science.gov (United States)

    Wu, Weifang; Deng, Qin; Shi, Pibiao; Yang, Jinghua; Hu, Zhongyuan; Zhang, Mingfang

    2016-01-01

    Watermelon (Citrullus lanatus) is a globally important crop belonging to the family Cucurbitaceae. The grafting technique is commonly used to improve its tolerance to stress, as well as to enhance its nutrient uptake and utilization. It is believed that miRNA is most likely involved in its nutrient-starvation response as a graft-transportable signal. The quantitative real-time reverse transcriptase polymerase chain reaction is the preferred method for miRNA functional analysis, in which reliable reference genes for normalization are crucial to ensure the accuracy. The purpose of this study was to select appropriate reference genes in scion (watermelon) and rootstocks (squash and bottle gourd) of grafted watermelon plants under normal growth conditions and nutrient stresses (nitrogen and phosphorus starvation). Under nutrient starvation, geNorm identified miR167c and miR167f as two most stable genes in both watermelon leaves and squash roots. miR166b was recommended by both geNorm and NormFinder as the best reference in bottle gourd roots under nutrient limitation. Expression of a new Cucurbitaceae miRNA, miR85, was used to validate the reliability of candidate reference genes under nutrient starvation. Moreover, by comparing several target genes expression in qRT-PCR analysis with those in RNA-seq data, miR166b and miR167c were proved to be the most suitable reference genes to normalize miRNA expression under normal growth condition in scion and rootstock tissues, respectively. This study represents the first comprehensive survey of the stability of miRNA reference genes in Cucurbitaceae and provides valuable information for investigating more accurate miRNA expression involving grafted watermelon plants.

  7. Influenza virus RNA polymerase: insights into the mechanisms of viral RNA synthesis

    Science.gov (United States)

    te Velthuis, Aartjan J.W.; Fodor, Ervin

    2016-01-01

    The genome of influenza viruses consists of multiple segments of single stranded negative-sense RNA. Each of these segments is bound by the heterotrimeric viral RNA-dependent RNA polymerase and multiple copies of nucleoprotein, forming viral ribonucleoprotein (vRNP) complexes. It is in the context of these vRNPs that the viral RNA polymerase carries out transcription of viral genes and replication of the viral RNA genome. In this Review, we discuss our current knowledge of the structure of the influenza virus RNA polymerase, how it carries out transcription and replication, and how its activities are modulated by viral and host factors. Furthermore, we discuss how advances in our understanding of polymerase function could help identifying new antiviral targets. PMID:27396566

  8. tRNA Derived smallRNAs: smallRNAs Repertoire Has Yet to Be Decoded in Plants

    Directory of Open Access Journals (Sweden)

    Gaurav Sablok

    2017-07-01

    Full Text Available Among several smallRNAs classes, microRNAs play an important role in controlling the post-transcriptional events. Next generation sequencing has played a major role in extending the landscape of miRNAs and revealing their spatio-temporal roles in development and abiotic stress. Lateral evolution of these smallRNAs classes have widely been seen with the recently emerging knowledge on tRNA derived smallRNAs. In the present perspective, we discussed classification, identification and roles of tRNA derived smallRNAs across plants and their potential involvement in abiotic and biotic stresses.

  9. Plant MPSS databases: signature-based transcriptional resources for analyses of mRNA and small RNA.

    Science.gov (United States)

    Nakano, Mayumi; Nobuta, Kan; Vemaraju, Kalyan; Tej, Shivakundan Singh; Skogen, Jeremy W; Meyers, Blake C

    2006-01-01

    MPSS (massively parallel signature sequencing) is a sequencing-based technology that uses a unique method to quantify gene expression level, generating millions of short sequence tags per library. We have created a series of databases for four species (Arabidopsis, rice, grape and Magnaporthe grisea, the rice blast fungus). Our MPSS databases measure the expression level of most genes under defined conditions and provide information about potentially novel transcripts (antisense transcripts, alternative splice isoforms and regulatory intergenic transcripts). A modified version of MPSS has been used to perform deep profiling of small RNAs from Arabidopsis, and we have recently adapted our database to display these data. Interpretation of the small RNA MPSS data is facilitated by the inclusion of extensive repeat data in our genome viewer. All the data and the tools introduced in this article are available at http://mpss.udel.edu.

  10. Evolution of endogenous non-retroviral genes integrated into plant genomes

    Directory of Open Access Journals (Sweden)

    Hyosub Chu

    2014-08-01

    Full Text Available Numerous comparative genome analyses have revealed the wide extent of horizontal gene transfer (HGT in living organisms, which contributes to their evolution and genetic diversity. Viruses play important roles in HGT. Endogenous viral elements (EVEs are defined as viral DNA sequences present within the genomes of non-viral organisms. In eukaryotic cells, the majority of EVEs are derived from RNA viruses using reverse transcription. In contrast, endogenous non-retroviral elements (ENREs are poorly studied. However, the increasing availability of genomic data and the rapid development of bioinformatics tools have enabled the identification of several ENREs in various eukaryotic organisms. To date, a small number of ENREs integrated into plant genomes have been identified. Of the known non-retroviruses, most identified ENREs are derived from double-strand (ds RNA viruses, followed by single-strand (ss DNA and ssRNA viruses. At least eight virus families have been identified. Of these, viruses in the family Partitiviridae are dominant, followed by viruses of the families Chrysoviridae and Geminiviridae. The identified ENREs have been primarily identified in eudicots, followed by monocots. In this review, we briefly discuss the current view on non-retroviral sequences integrated into plant genomes that are associated with plant-virus evolution and their possible roles in antiviral resistance.

  11. An optimised method for the extraction of bacterial mRNA from plant roots infected with Escherichia coli O157:H7

    Directory of Open Access Journals (Sweden)

    Ashleigh eHolmes

    2014-06-01

    Full Text Available Analysis of microbial gene expression during host colonisation provides valuable information on the nature of interaction, beneficial or pathogenic, and the adaptive processes involved. Isolation of bacterial mRNA for in planta analysis can be challenging where host nucleic acid may dominate the preparation, or inhibitory compounds affect downstream analysis, e.g. qPCR, microarray or RNA-seq. The goal of this work was to optimise the isolation of bacterial mRNA of food-borne pathogens from living plants. Reported methods for recovery of phytopathogen-infected plant material, using hot phenol extraction and high concentration of bacterial inoculation or large amounts of infected tissues, were found to be inappropriate for plant roots inoculated with Escherichia coli O157:H7. The bacterial RNA yields were too low and increased plant material resulted in a dominance of plant RNA in the sample. To improve the yield of bacterial RNA and reduce the number of plants required, an optimised method was developed which combines bead beating with directed bacterial lysis using SDS and lysozyme. Inhibitory plant compounds, such as phenolics and polysaccharides, were counteracted with the addition of HMW-PEG and CTAB. The new method increased the total yield of bacterial mRNA substantially and allowed assessment of gene expression by qPCR. This method can be applied to other bacterial species associated with plant roots, and also in the wider context of food safety.

  12. Brassica RNA binding protein ERD4 is involved in conferring salt, drought tolerance and enhancing plant growth in Arabidopsis.

    Science.gov (United States)

    Rai, Archana N; Tamirisa, Srinath; Rao, K V; Kumar, Vinay; Suprasanna, P

    2016-03-01

    'Early responsive to dehydration' (ERD) genes are a group of plant genes having functional roles in plant stress tolerance and development. In this study, we have isolated and characterized a Brassica juncea 'ERD' gene (BjERD4) which encodes a novel RNA binding protein. The expression pattern of ERD4 analyzed under different stress conditions showed that transcript levels were increased with dehydration, sodium chloride, low temperature, heat, abscisic acid and salicylic acid treatments. The BjERD4 was found to be localized in the chloroplasts as revealed by Confocal microscopy studies. To study the function, transgenic Arabidopsis plants were generated and analyzed for various morphological and physiological parameters. The overexpressing transgenic lines showed significant increase in number of leaves with more leaf area and larger siliques as compared to wild type plants, whereas RNAi:ERD4 transgenic lines showed reduced leaf number, leaf area, dwarf phenotype and delayed seed germination. Transgenic Arabidopsis plants overexpressing BjERD4 gene also exhibited enhanced tolerance to dehydration and salt stresses, while the knockdown lines were susceptible as compared to wild type plants under similar stress conditions. It was observed that BjERD4 protein could bind RNA as evidenced by the gel-shift assay. The overall results of transcript analysis, RNA gel-shift assay, and transgenic expression, for the first time, show that the BjERD4 is involved in abiotic stress tolerance besides offering new clues about the possible roles of BjERD4 in plant growth and development.

  13. The Transcription Bubble of the RNA Polymerase-Promoter Open Complex Exhibits Conformational Heterogeneity and Millisecond-Scale Dynamics : Implications for Transcription Start-Site Selection

    NARCIS (Netherlands)

    Robb, Nicole C.; Cordes, Thorben; Hwang, Ling Chin; Gryte, Kristofer; Duchi, Diego; Craggs, Timothy D.; Santoso, Yusdi; Weiss, Shimon; Ebright, Richard H.; Kapanidis, Achillefs N.

    2013-01-01

    Bacterial transcription is initiated after RNA polymerase (RNAP) binds to promoter DNA, melts similar to 14 bp around the transcription start site and forms a single-stranded "transcription bubble" within a catalytically active RNAP-DNA open complex (RPo). There is significant flexibility in the

  14. A geminivirus-based guide RNA delivery system for CRISPR/Cas9 mediated plant genome editing.

    Science.gov (United States)

    Yin, Kangquan; Han, Ting; Liu, Guang; Chen, Tianyuan; Wang, Ying; Yu, Alice Yunzi L; Liu, Yule

    2015-10-09

    CRISPR/Cas has emerged as potent genome editing technology and has successfully been applied in many organisms, including several plant species. However, delivery of genome editing reagents remains a challenge in plants. Here, we report a virus-based guide RNA (gRNA) delivery system for CRISPR/Cas9 mediated plant genome editing (VIGE) that can be used to precisely target genome locations and cause mutations. VIGE is performed by using a modified Cabbage Leaf Curl virus (CaLCuV) vector to express gRNAs in stable transgenic plants expressing Cas9. DNA sequencing confirmed VIGE of endogenous NbPDS3 and NbIspH genes in non-inoculated leaves because CaLCuV can infect plants systemically. Moreover, VIGE of NbPDS3 and NbIspH in newly developed leaves caused photo-bleached phenotype. These results demonstrate that geminivirus-based VIGE could be a powerful tool in plant genome editing.

  15. Advances in RNA interference technology and its impact on nutritional improvement, disease and insect control in plants.

    Science.gov (United States)

    Katoch, Rajan; Thakur, Neelam

    2013-03-01

    This review highlights the advances in the knowledge of RNA interference (RNAi) and discusses recent progress on the functionality of different components RNAi machinery operating in the organisms. The silencing of genes by RNA interference has become the technology of choice for investigation of gene functions in different organisms. The refinement in the knowledge of the endogenous RNAi pathways in plants along with the development of new strategies and applications for the improvement of nutritional value of important agricultural crops through suppression of genes in different plants have opened new vistas for nutritional security. The improvement in the nutritional status of the plants and reduction in the level of toxins or antinutrients was desired for long, but the available technology was not completely successful in achieving the tissue specific regulation of some genes. In the recent years, a number of economically important crop plants have been tested successfully for improving plant nutritional value through metabolic engineering using RNAi. The implications of this technology for crop improvement programs, including nutritional enrichment, reduction of antinutrients, disease, and insect control have been successfully tested in variety of crops with commercial considerations. The enhancement of the nutraceutical traits for the desired health benefits in common crop plants through manipulation of gene expression has been elaborated in this article. The tremendous potential with RNAi technology is expected to revolutionize the modern agriculture for meeting the growing challenges is discussed.

  16. An Internal Ribosome Entry Site Directs Translation of the 39-Gene from Pelargonium Flower Break Virus Genomic RNA: Implications for Infectivity

    OpenAIRE

    Fernandez Miragall, Olga; HERNANDEZ FORT, CARMEN

    2011-01-01

    [EN] Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 59-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 39-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 59-proximal from subgenomic RNAs. However, in one...

  17. Characterization and evolution of microRNA genes derived from repetitive elements and duplication events in plants.

    Directory of Open Access Journals (Sweden)

    Jie Sun

    Full Text Available MicroRNAs (miRNAs are a major class of small non-coding RNAs that act as negative regulators at the post-transcriptional level in animals and plants. In this study, all known miRNAs in four plant species (Arabidopsis thaliana, Populus trichocarpa, Oryza sativa and Sorghum bicolor have been analyzed, using a combination of computational and comparative genomic approaches, to systematically identify and characterize the miRNAs that were derived from repetitive elements and duplication events. The study provides a complete mapping, at the genome scale, of all the miRNAs found on repetitive elements in the four test plant species. Significant differences between repetitive element-related miRNAs and non-repeat-derived miRNAs were observed for many characteristics, including their location in protein-coding and intergenic regions in genomes, their conservation in plant species, sequence length of their hairpin precursors, base composition of their hairpin precursors and the minimum free energy of their hairpin structures. Further analysis showed that a considerable number of miRNA families in the four test plant species arose from either tandem duplication events, segmental duplication events or a combination of the two. However, comparative analysis suggested that the contribution made by these two duplication events differed greatly between the perennial tree species tested and the other three annual species. The expansion of miRNA families in A. thaliana, O. sativa and S. bicolor are more likely to occur as a result of tandem duplication events than from segmental duplications. In contrast, genomic segmental duplications contributed significantly more to the expansion of miRNA families in P. trichocarpa than did tandem duplication events. Taken together, this study has successfully characterized miRNAs derived from repetitive elements and duplication events at the genome scale and provides comprehensive knowledge and deeper insight into the

  18. Tudor staphylococcal nuclease is a structure-specific ribonuclease that degrades RNA at unstructured regions during microRNA decay.

    Science.gov (United States)

    Li, Chia-Lung; Yang, Wei-Zen; Shi, Zhonghao; Yuan, Hanna S

    2018-02-13

    Tudor staphylococcal nuclease (TSN) is an evolutionarily conserved ribonuclease in eukaryotes that is composed of five staphylococcal nuclease-like domains (SN1 to SN5) and a Tudor domain. TSN degrades hyper-edited double-stranded RNA, including primary miRNA precursors containing multiple I-U and U-I pairs, and mature miRNA during miRNA decay. However, how TSN binds and degrades its RNA substrates remains unclear. Here, we show that the C. elegans TSN (cTSN) is a monomeric Ca 2+ -dependent ribonuclease, cleaving RNA chains at the 5'-side of the phosphodiester linkage to produce degraded fragments with 5'-hydroxyl and 3'-phosphate ends. cTSN degrades single-stranded RNA and double-stranded RNA containing mismatched base pairs, but is not restricted to those containing multiple I-U and U-I pairs. cTSN has at least two catalytic active sites located in the SN1 and SN3 domains, since mutations of the putative Ca 2+ -binding residues in these two domains strongly impaired its ribonuclease activity. We further show by small-angle X-ray scattering that rice osTSN has a flexible two-lobed structure with open to closed conformations, indicating that TSN may change its conformation upon RNA binding. We conclude that TSN is a structure-specific ribonuclease targeting not only single-stranded RNA, but also unstructured regions of double-stranded RNA. This study provides the molecular basis for how TSN cooperates with RNA editing to eliminate duplex RNA in cell defense, and how TSN selects and degrades RNA during microRNA decay. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  19. Molecular phylogenetics and comparative modeling of HEN1, a methyltransferase involved in plant microRNA biogenesis

    Directory of Open Access Journals (Sweden)

    Obarska Agnieszka

    2006-01-01

    Full Text Available Abstract Background Recently, HEN1 protein from Arabidopsis thaliana was discovered as an essential enzyme in plant microRNA (miRNA biogenesis. HEN1 transfers a methyl group from S-adenosylmethionine to the 2'-OH or 3'-OH group of the last nucleotide of miRNA/miRNA* duplexes produced by the nuclease Dicer. Previously it was found that HEN1 possesses a Rossmann-fold methyltransferase (RFM domain and a long N-terminal extension including a putative double-stranded RNA-binding motif (DSRM. However, little is known about the details of the structure and the mechanism of action of this enzyme, and about its phylogenetic origin. Results Extensive database searches were carried out to identify orthologs and close paralogs of HEN1. Based on the multiple sequence alignment a phylogenetic tree of the HEN1 family was constructed. The fold-recognition approach was used to identify related methyltransferases with experimentally solved structures and to guide the homology modeling of the HEN1 catalytic domain. Additionally, we identified a La-like predicted RNA binding domain located C-terminally to the DSRM domain and a domain with a peptide prolyl cis/trans isomerase (PPIase fold, but without the conserved PPIase active site, located N-terminally to the catalytic domain. Conclusion The bioinformatics analysis revealed that the catalytic domain of HEN1 is not closely related to any known RNA:2'-OH methyltransferases (e.g. to the RrmJ/fibrillarin superfamily, but rather to small-molecule methyltransferases. The structural model was used as a platform to identify the putative active site and substrate-binding residues of HEN and to propose its mechanism of action.

  20. In silico identification and characterization of microRNAs and their putative target genes in Solanaceae plants.

    Science.gov (United States)

    Kim, Hyun-Jin; Baek, Kwang-Hyun; Lee, Bong-Woo; Choi, Doil; Hur, Cheol-Goo

    2011-02-01

    MicroRNAs (miRNAs) are a class of small, single-stranded, noncoding RNAs ranging from 19 to 25 nucleotides. The miRNA control various cellular functions by negatively regulating gene expression at the post-transcriptional level. The miRNA regulation over their target genes has a central role in regulating plant growth and development; however, only a few reports have been published on the function of miRNAs in the family Solanaceae. We identified Solanaceae miRNAs and their target genes by analyzing expressed sequence tag (EST) data from five different Solanaceae species. A comprehensive bioinformatic analysis of EST data of Solanaceae species revealed the presence of at least 11 miRNAs and 54 target genes in pepper (Capsicum annuum L.), 22 miRNAs and 221 target genes in potato (Solanum tuberosum L.), 12 miRNAs and 417 target genes in tomato (Solanum lycopersicum L.), 46 miRNAs and 60 target genes in tobacco (Nicotiana tabacum L.), and 7 miRNAs and 28 target genes in Nicotiana benthamiana. The identified Solanaceae miRNAs and their target genes were deposited in the SolmiRNA database, which is freely available for academic research only at http://genepool.kribb.re.kr/SolmiRNA. Our data indicate that the Solanaceae family has both conserved and specific miRNAs and that their target genes may play important roles in growth and development of Solanaceae plants.

  1. High-throughput sequencing as an effective approach in profiling small RNAs derived from a hairpin RNA expression vector in woody plants.

    Science.gov (United States)

    Zhao, Dongyan; Song, Guo-Qing

    2014-11-01

    Hairpin RNA (hpRNA)-mediated gene silencing has proved to be an efficient approach to develop virus-resistant transgenic plants. To characterize small RNA molecules (sRNAs) derived from an hpRNA expression vector in transgenic cherry rootstock plants, we conducted small RNA sequencing of (1) a transgenic rootstock containing an inverted repeat of the partial coat protein of Prunus necrotic ring spot virus (PNRSV-hpRNA); (2) a nontransgenic rootstock; and (3) a PNRSV-infected sweet cherry plant. Analysis of the PNRSV sRNA pools indicated that 24-nt (nucleotide) small interfering RNAs (siRNAs) were the most prevalent sRNAs in the transgenic rootstock whereas the most abundant sRNAs in the PNRSV-infected nontransgenic rootstock were 21-nt siRNAs. In addition, the 24-nt siRNAs of the PNRSV-hpRNA were more abundant on the sense strand than those on the antisense strand in the transgenic rootstock. In contrast, preference in generating PNRSV sRNAs, ranging from 19-nt to 30-nt for sense and antisense strands, was not distinct in the PNRSV-infected nontransgenic sweet cherry. Taken together, this is the first report on profiling hpRNA-derived sRNAs in woody plants using high-throughput sequencing technology, which is an efficient way to verify the presence/absence, the abundance, and the sequence features of certain sRNAs. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  2. The RNA synthesis machinery of negative-stranded RNA viruses

    Energy Technology Data Exchange (ETDEWEB)

    Ortín, Juan, E-mail: jortin@cnb.csic.es [Department of Molecular and Cellular Biology, Centro Nacional de Biotecnología (CSIC) and CIBER de Enfermedades Respiratorias (ISCIII), Madrid (Spain); Martín-Benito, Jaime, E-mail: jmartinb@cnb.csic.es [Department of Macromolecular Structures, Centro Nacional de Biotecnología (CSIC), Madrid (Spain)

    2015-05-15

    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure of their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes.

  3. The RNA synthesis machinery of negative-stranded RNA viruses

    International Nuclear Information System (INIS)

    Ortín, Juan; Martín-Benito, Jaime

    2015-01-01

    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure of their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes

  4. Deep sequencing-based transcriptome profiling reveals comprehensive insights into the responses of Nicotiana benthamiana to beet necrotic yellow vein virus infections containing or lacking RNA4.

    Directory of Open Access Journals (Sweden)

    Huiyan Fan

    Full Text Available BACKGROUND: Beet necrotic yellow vein virus (BNYVV, encodes either four or five plus-sense single stranded RNAs and is the causal agent of sugar beet rhizomania disease, which is widely distributed in most regions of the world. BNYVV can also infect Nicotiana benthamiana systemically, and causes severe curling and stunting symptoms in the presence of RNA4 or mild symptoms in the absence of RNA4. RESULTS: Confocal laser scanning microscopy (CLSM analyses showed that the RNA4-encoded p31 protein fused to the red fluorescent protein (RFP accumulated mainly in the nuclei of N. benthamiana epidermal cells. This suggested that severe RNA4-induced symptoms might result from p31-dependent modifications of the transcriptome. Therefore, we used next-generation sequencing technologies to analyze the transcriptome profile of N. benthamiana in response to infection with different isolates of BNYVV. Comparisons of the transcriptomes of mock, BN3 (RNAs 1+2+3, and BN34 (RNAs 1+2+3+4 infected plants identified 3,016 differentially expressed transcripts, which provided a list of candidate genes that potentially are elicited in response to virus infection. Our data indicate that modifications in the expression of genes involved in RNA silencing, ubiquitin-proteasome pathway, cellulose synthesis, and metabolism of the plant hormone gibberellin may contribute to the severe symptoms induced by RNA4 from BNYVV. CONCLUSIONS: These results expand our understanding of the genetic architecture of N. benthamiana as well as provide valuable clues to identify genes potentially involved in resistance to BNYVV infection. Our global survey of gene expression changes in infected plants reveals new insights into the complicated molecular mechanisms underlying symptom development, and aids research into new strategies to protect crops against viruses.

  5. N. meningitidis 1681 is a member of the FinO family of RNA chaperones.

    Energy Technology Data Exchange (ETDEWEB)

    Chaulk, S.; Lu, J.; Tan, K.; Arthur, D.; Edwards, R.; Frost, L.; Joachimiak, A.; Glover, J. (Biosciences Division); (Univ. of Alberta)

    2010-11-01

    The conjugative transfer of F-like plasmids between bacteria is regulated by the plasmid-encoded RNA chaperone, FinO, which facilitates sense - antisense RNA interactions to regulate plasmid gene expression. FinO was thought to adopt a unique structure, however many putative homologs have been identified in microbial genomes and are considered members of the FinO-conjugation-repressor superfamily. We were interested in determining whether other members were also able to bind RNA and promote duplex formation, suggesting that this motif does indeed identify a putative RNA chaperone. We determined the crystal structure of the N. meningitidis MC58 protein NMB1681. It revealed striking similarity to FinO, with a conserved fold and a large, positively charged surface that could function in RNA interactions. Using assays developed to study FinO-FinP sRNA interactions, NMB1681, like FinO, bound tightly to FinP RNA stem-loops with short 5-foot and 3-foot single-stranded tails but not to ssRNA. It also was able to catalyze strand exchange between an RNA duplex and a complementary single-strand, and facilitated duplexing between complementary RNA hairpins. Finally, NMB1681 was able to rescue a finO deficiency and repress F plasmid conjugation. This study strongly suggests that NMB1681 is a FinO-like RNA chaperone that likely regulates gene expression through RNA-based mechanisms in N. meningitidis.

  6. RNA-binding protein regulates plant DNA methylation by controlling mRNA processing at the intronic heterochromatin-containing gene IBM1.

    Science.gov (United States)

    Wang, Xingang; Duan, Cheng-Guo; Tang, Kai; Wang, Bangshing; Zhang, Huiming; Lei, Mingguang; Lu, Kun; Mangrauthia, Satendra K; Wang, Pengcheng; Zhu, Guohui; Zhao, Yang; Zhu, Jian-Kang

    2013-09-17

    DNA methylation-dependent heterochromatin formation is a conserved mechanism of epigenetic silencing of transposons and other repeat elements in many higher eukaryotes. Genes adjacent to repetitive elements are often also subjected to this epigenetic silencing. Consequently, plants have evolved antisilencing mechanisms such as active DNA demethylation mediated by the REPRESSOR OF SILENCING 1 (ROS1) family of 5-methylcytosine DNA glycosylases to protect these genes from silencing. Some transposons and other repeat elements have found residence in the introns of genes. It is unclear how these intronic repeat elements-containing genes are regulated. We report here the identification of ANTI-SILENCING 1 (ASI1), a bromo-adjacent homology domain and RNA recognition motif-containing protein, from a forward genetic screen for cellular antisilencing factors in Arabidopsis thaliana. ASI1 is required to prevent promoter DNA hypermethylation and transcriptional silencing of some transgenes. Genome-wide DNA methylation analysis reveals that ASI1 has a similar role to that of the histone H3K9 demethylase INCREASE IN BONSAI METHYLATION 1 (IBM1) in preventing CHG methylation in the bodies of thousands of genes. We found that ASI1 is an RNA-binding protein and ensures the proper expression of IBM1 full-length transcript by associating with an intronic heterochromatic repeat element of IBM1. Through mRNA sequencing, we identified many genes containing intronic transposon elements that require ASI1 for proper expression. Our results suggest that ASI1 associates with intronic heterochromatin and binds the gene transcripts to promote their 3' distal polyadenylation. The study thus reveals a unique mechanism by which higher eukaryotes deal with the collateral effect of silencing intronic repeat elements.

  7. Processing of nuclear viroids in vivo: an interplay between RNA conformations.

    Directory of Open Access Journals (Sweden)

    María-Eugenia Gas

    2007-11-01

    Full Text Available Replication of viroids, small non-protein-coding plant pathogenic RNAs, entails reiterative transcription of their incoming single-stranded circular genomes, to which the (+ polarity is arbitrarily assigned, cleavage of the oligomeric strands of one or both polarities to unit-length, and ligation to circular RNAs. While cleavage in chloroplastic viroids (family Avsunviroidae is mediated by hammerhead ribozymes, where and how cleavage of oligomeric (+ RNAs of nuclear viroids (family Pospiviroidae occurs in vivo remains controversial. Previous in vitro data indicated that a hairpin capped by a GAAA tetraloop is the RNA motif directing cleavage and a loop E motif ligation. Here we have re-examined this question in vivo, taking advantage of earlier findings showing that dimeric viroid (+ RNAs of the family Pospiviroidae transgenically expressed in Arabidopsis thaliana are processed correctly. Using this methodology, we have mapped the processing site of three members of this family at equivalent positions of the hairpin I/double-stranded structure that the upper strand and flanking nucleotides of the central conserved region (CCR can form. More specifically, from the effects of 16 mutations on Citrus exocortis viroid expressed transgenically in A. thaliana, we conclude that the substrate for in vivo cleavage is the conserved double-stranded structure, with hairpin I potentially facilitating the adoption of this structure, whereas ligation is determined by loop E and flanking nucleotides of the two CCR strands. These results have deep implications on the underlying mechanism of both processing reactions, which are most likely catalyzed by enzymes different from those generally assumed: cleavage by a member of the RNase III family, and ligation by an RNA ligase distinct from the only one characterized so far in plants, thus predicting the existence of at least a second plant RNA ligase.

  8. Comparative structural analysis of cytoplasmic and chloroplastic 5S rRNA from spinach.

    Science.gov (United States)

    Pieler, T; Digweed, M; Bartsch, M; Erdmann, V A

    1983-01-01

    5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2). Images PMID:6340063

  9. Comparative structural analysis of cytoplasmic and chloroplastic 5S rRNA from spinach.

    OpenAIRE

    Pieler, T; Digweed, M; Bartsch, M; Erdmann, V A

    1983-01-01

    5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2).

  10. In vivo visualization of RNA in plants cells using the λN₂₂ system and a GATEWAY-compatible vector series for candidate RNAs.

    Science.gov (United States)

    Schönberger, Johannes; Hammes, Ulrich Z; Dresselhaus, Thomas

    2012-07-01

    The past decade has seen a tremendous increase in RNA research, which has demonstrated that RNAs are involved in many more processes than were previously thought. The dynamics of RNA synthesis towards their regulated activity requires the interplay of RNAs with numerous RNA binding proteins (RBPs). The localization of RNA, a mechanism for controlling translation in a spatial and temporal fashion, requires processing and assembly of RNA into transport granules in the nucleus, transport towards cytoplasmic destinations and regulation of its activity. Compared with animal model systems little is known about RNA dynamics and motility in plants. Commonly used methods to study RNA transport and localization are time-consuming, and require expensive equipment and a high level of experimental skill. Here, we introduce the λN₂₂ RNA stem-loop binding system for the in vivo visualization of RNA in plant cells. The λN₂₂ system consists of two components: the λN₂₂ RNA binding peptide and the corresponding box-B stem loops. We generated fusions of λN₂₂ to different fluorophores and a GATEWAY vector series for the simple fusion of any target RNA 5' or 3' to box-B stem loops. We show that the λN₂₂ system can be used to detect RNAs in transient expression assays, and that it offers advantages compared with the previously described MS2 system. Furthermore, the λN₂₂ system can be used in combination with the MS2 system to visualize different RNAs simultaneously in the same cell. The toolbox of vectors generated for both systems is easy to use and promises significant progress in our understanding of RNA transport and localization in plant cells. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  11. Transcription of potato spindle tuber viroid by RNA polymerase II starts in the left terminal loop

    International Nuclear Information System (INIS)

    Kolonko, Nadine; Bannach, Oliver; Aschermann, Katja; Hu, Kang-Hong; Moors, Michaela; Schmitz, Michael; Steger, Gerhard; Riesner, Detlev

    2006-01-01

    Viroids are single-stranded, circular RNAs of 250 to 400 bases, that replicate autonomously in their host plants but do not code for a protein. Viroids of the family Pospiviroidae, of which potato spindle tuber viroid (PSTVd) is the type strain, are replicated by the host's DNA-dependent RNA polymerase II in the nucleus. To analyze the initiation site of transcription from the (+)-stranded circles into (-)-stranded replication intermediates, we used a nuclear extract from a non-infected cell culture of the host plant S. tuberosum. The (-)-strands, which were de novo-synthesized in the extract upon addition of circular (+)-PSTVd, were purified by affinity chromatography. This purification avoided contamination by host nucleic acids that had resulted in a misassignment of the start site in an earlier study. Primer-extension analysis of the de novo-synthesized (-)-strands revealed a single start site located in the hairpin loop of the left terminal region in circular PSTVd's secondary structure. This start site is supported further by analysis of the infectivity and replication behavior of site-directed mutants in planta

  12. Novel Hypovirulence-Associated RNA Mycovirus in the Plant-Pathogenic Fungus Botrytis cinerea: Molecular and Biological Characterization

    Science.gov (United States)

    Yu, Lin; Sang, Wen; Wu, Ming-De; Zhang, Jing; Yang, Long; Zhou, Ying-Jun; Chen, Wei-Dong

    2015-01-01

    Botrytis cinerea is a pathogenic fungus causing gray mold on numerous economically important crops and ornamental plants. This study was conducted to characterize the biological and molecular features of a novel RNA mycovirus, Botrytis cinerea RNA virus 1 (BcRV1), in the hypovirulent strain BerBc-1 of B. cinerea. The genome of BcRV1 is 8,952 bp long with two putative overlapped open reading frames (ORFs), ORF1 and ORF2, coding for a hypothetical polypeptide (P1) and RNA-dependent RNA polymerase (RdRp), respectively. A −1 frameshifting region (designated the KNOT element) containing a shifty heptamer, a heptanucleotide spacer, and an H-type pseudoknot was predicted in the junction region of ORF1 and ORF2. The −1 frameshifting role of the KNOT element was experimentally confirmed through determination of the production of the fusion protein red fluorescent protein (RFP)-green fluorescent protein (GFP) by the plasmid containing the construct dsRed-KNOT-eGFP in Escherichia coli. BcRV1 belongs to a taxonomically unassigned double-stranded RNA (dsRNA) mycovirus group. It is closely related to grapevine-associated totivirus 2 and Sclerotinia sclerotiorum nonsegmented virus L. BcRV1 in strain BerBc-1 was found capable of being transmitted vertically through macroconidia and horizontally to other B. cinerea strains through hyphal contact. The presence of BcRV1 was found to be positively correlated with hypovirulence in B. cinerea, with the attenuation effects of BcRV1 on mycelial growth and pathogenicity being greatly affected by the accumulation level of BcRV1. PMID:25595766

  13. Expression of SANT/HTH Myb mRNA, a plant morphogenesis-regulating transcription factor, changes due to viroid infection

    Czech Academy of Sciences Publication Activity Database

    Matoušek, Jaroslav; Piernikarczyk, R.J.J.; Týcová, Anna; Duraisamy, Ganesh Selvaraj; Kocábek, Tomáš; Steger, G.

    2015-01-01

    Roč. 183, JUL (2015), s. 85-94 ISSN 0176-1617 R&D Projects: GA ČR GCP501/10/J018 Institutional support: RVO:60077344 Keywords : mRNA target * RNA decay * Biolistic plant inoculation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.971, year: 2015

  14. FLDS: A Comprehensive dsRNA Sequencing Method for Intracellular RNA Virus Surveillance.

    Science.gov (United States)

    Urayama, Syun-Ichi; Takaki, Yoshihiro; Nunoura, Takuro

    2016-01-01

    Knowledge of the distribution and diversity of RNA viruses is still limited in spite of their possible environmental and epidemiological impacts because RNA virus-specific metagenomic methods have not yet been developed. We herein constructed an effective metagenomic method for RNA viruses by targeting long double-stranded (ds)RNA in cellular organisms, which is a hallmark of infection, or the replication of dsRNA and single-stranded (ss)RNA viruses, except for retroviruses. This novel dsRNA targeting metagenomic method is characterized by an extremely high recovery rate of viral RNA sequences, the retrieval of terminal sequences, and uniform read coverage, which has not previously been reported in other metagenomic methods targeting RNA viruses. This method revealed a previously unidentified viral RNA diversity of more than 20 complete RNA viral genomes including dsRNA and ssRNA viruses associated with an environmental diatom colony. Our approach will be a powerful tool for cataloging RNA viruses associated with organisms of interest.

  15. Is plant mitochondrial RNA editing a source of phylogenetic incongruence? An answer from in silico and in vivo data sets

    Directory of Open Access Journals (Sweden)

    Quagliariello Carla

    2008-03-01

    Full Text Available Abstract Background In plant mitochondria, the post-transcriptional RNA editing process converts C to U at a number of specific sites of the mRNA sequence and usually restores phylogenetically conserved codons and the encoded amino acid residues. Sites undergoing RNA editing evolve at a higher rate than sites not modified by the process. As a result, editing sites strongly affect the evolution of plant mitochondrial genomes, representing an important source of sequence variability and potentially informative characters. To date no clear and convincing evidence has established whether or not editing sites really affect the topology of reconstructed phylogenetic trees. For this reason, we investigated here the effect of RNA editing on the tree building process of twenty different plant mitochondrial gene sequences and by means of computer simulations. Results Based on our simulation study we suggest that the editing ‘noise’ in tree topology inference is mainly manifested at the cDNA level. In particular, editing sites tend to confuse tree topologies when artificial genomic and cDNA sequences are generated shorter than 500 bp and with an editing percentage higher than 5.0%. Similar results have been also obtained with genuine plant mitochondrial genes. In this latter instance, indeed, the topology incongruence increases when the editing percentage goes up from about 3.0 to 14.0%. However, when the average gene length is higher than 1,000 bp (rps3, matR and atp1 no differences in the comparison between inferred genomic and cDNA topologies could be detected. Conclusions Our findings by the here reported in silico and in vivo computer simulation system seem to strongly suggest that editing sites contribute in the generation of misleading phylogenetic trees if the analyzed mitochondrial gene sequence is highly edited (higher than 3.0% and reduced in length (shorter than 500 bp. In the current lack of direct experimental evidence the results

  16. Analysis of 3D gene expression patterns in plants using whole-mount RNA in situ hybridization.

    Science.gov (United States)

    Rozier, Frédérique; Mirabet, Vincent; Vernoux, Teva; Das, Pradeep

    2014-10-01

    In situ mRNA hybridization is one of the most powerful techniques for analyzing patterns of gene expression. However, its usefulness is limited in complex plant tissues by the need to fix, embed and section samples before localizing the desired mRNA. Here we present a robust whole-mount in situ hybridization method that allows easy access to patterns of gene expression in intact, complex tissues, such as the inflorescence apex of Arabidopsis thaliana. The tissue is first fixed and then permeabilized by treatment with a cocktail of cell wall-digesting enzymes that has been optimized to preserve the integrity of tissue structures, while also permitting the detection of expression patterns in deep tissues. In addition to colorimetric staining, fluorimetric staining that can be imaged by confocal microscopy can also be used with this protocol, thus providing full 3D resolution. The entire procedure can take <3 d from tissue preparation to image acquisition.

  17. Frequent chloroplast RNA editing in early-branching flowering plants: pilot studies on angiosperm-wide coexistence of editing sites and their nuclear specificity factors.

    Science.gov (United States)

    Hein, Anke; Polsakiewicz, Monika; Knoop, Volker

    2016-01-25

    RNA editing by cytidine-to-uridine conversions is an essential step of RNA maturation in plant organelles. Some 30-50 sites of C-to-U RNA editing exist in chloroplasts of flowering plant models like Arabidopsis, rice or tobacco. We now predicted significantly more RNA editing in chloroplasts of early-branching angiosperm genera like Amborella, Calycanthus, Ceratophyllum, Chloranthus, Illicium, Liriodendron, Magnolia, Nuphar and Zingiber. Nuclear-encoded RNA-binding pentatricopeptide repeat (PPR) proteins are key editing factors expected to coevolve with their cognate RNA editing sites in the organelles. With an extensive chloroplast transcriptome study we identified 138 sites of RNA editing in Amborella trichopoda, approximately the 3- to 4-fold of cp editing in Arabidopsis thaliana or Oryza sativa. Selected cDNA studies in the other early-branching flowering plant taxa furthermore reveal a high diversity of early angiosperm RNA editomes. Many of the now identified editing sites in Amborella have orthologues in ferns, lycophytes or hornworts. We investigated the evolution of CRR28 and RARE1, two known Arabidopsis RNA editing factors responsible for cp editing events ndhBeU467PL, ndhDeU878SL and accDeU794SL, respectively, all of which we now found conserved in Amborella. In a phylogenetically wide sampling of 65 angiosperm genomes we find evidence for only one single loss of CRR28 in chickpea but several independent losses of RARE1, perfectly congruent with the presence of their cognate editing sites in the respective cpDNAs. Chloroplast RNA editing is much more abundant in early-branching than in widely investigated model flowering plants. RNA editing specificity factors can be traced back for more than 120 million years of angiosperm evolution and show highly divergent patterns of evolutionary losses, matching the presence of their target editing events.

  18. Activated charcoal-mediated RNA extraction method for Azadirachta indica and plants highly rich in polyphenolics, polysaccharides and other complex secondary compounds

    Science.gov (United States)

    2013-01-01

    Background High quality RNA is a primary requisite for numerous molecular biological applications but is difficult to isolate from several plants rich in polysaccharides, polyphenolics and other secondary metabolites. These compounds either bind with nucleic acids or often co-precipitate at the final step and many times cannot be removed by conventional methods and kits. Addition of vinyl-pyrollidone polymers in extraction buffer efficiently removes polyphenolics to some extent, but, it failed in case of Azadirachta indica and several other medicinal and aromatic plants. Findings Here we report the use of adsorption property of activated charcoal (0.03%–0.1%) in RNA isolation procedures to remove complex secondary metabolites and polyphenolics to yield good quality RNA from Azadirachta indica. We tested and validated our modified RNA isolation method across 21 different plants including Andrographis paniculata, Aloe vera, Rosa damascena, Pelargonium graveolens, Phyllanthus amarus etc. from 13 other different families, many of which are considered as tough system for isolating RNA. The A260/280 ratio of the extracted RNA ranged between 1.8-2.0 and distinct 28S and 18S ribosomal RNA bands were observed in denaturing agarose gel electrophoresis. Analysis using Agilent 2100 Bioanalyzer revealed intact total RNA yield with very good RNA Integrity Number. Conclusions The RNA isolated by our modified method was found to be of high quality and amenable for sensitive downstream molecular applications like subtractive library construction and RT-PCR. This modified RNA isolation procedure would aid and accelerate the biotechnological studies in complex medicinal and aromatic plants which are extremely rich in secondary metabolic compounds. PMID:23537338

  19. Activated charcoal-mediated RNA extraction method for Azadirachta indica and plants highly rich in polyphenolics, polysaccharides and other complex secondary compounds.

    Science.gov (United States)

    Rajakani, Raja; Narnoliya, Lokesh; Sangwan, Neelam Singh; Sangwan, Rajender Singh; Gupta, Vikrant

    2013-03-28

    High quality RNA is a primary requisite for numerous molecular biological applications but is difficult to isolate from several plants rich in polysaccharides, polyphenolics and other secondary metabolites. These compounds either bind with nucleic acids or often co-precipitate at the final step and many times cannot be removed by conventional methods and kits. Addition of vinyl-pyrollidone polymers in extraction buffer efficiently removes polyphenolics to some extent, but, it failed in case of Azadirachta indica and several other medicinal and aromatic plants. Here we report the use of adsorption property of activated charcoal (0.03%-0.1%) in RNA isolation procedures to remove complex secondary metabolites and polyphenolics to yield good quality RNA from Azadirachta indica. We tested and validated our modified RNA isolation method across 21 different plants including Andrographis paniculata, Aloe vera, Rosa damascena, Pelargonium graveolens, Phyllanthus amarus etc. from 13 other different families, many of which are considered as tough system for isolating RNA. The A260/280 ratio of the extracted RNA ranged between 1.8-2.0 and distinct 28S and 18S ribosomal RNA bands were observed in denaturing agarose gel electrophoresis. Analysis using Agilent 2100 Bioanalyzer revealed intact total RNA yield with very good RNA Integrity Number. The RNA isolated by our modified method was found to be of high quality and amenable for sensitive downstream molecular applications like subtractive library construction and RT-PCR. This modified RNA isolation procedure would aid and accelerate the biotechnological studies in complex medicinal and aromatic plants which are extremely rich in secondary metabolic compounds.

  20. Structure of an Rrp6-RNA exosome complex bound to poly(A) RNA

    Energy Technology Data Exchange (ETDEWEB)

    Wasmuth, Elizabeth V.; Januszyk, Kurt; Lima, Christopher D. [MSKCC

    2014-08-20

    The eukaryotic RNA exosome processes and degrades RNA by directing substrates to the distributive or processive 3' to 5' exoribonuclease activities of Rrp6 or Rrp44, respectively. The non-catalytic nine-subunit exosome core (Exo9) features a prominent central channel. Although RNA can pass through the channel to engage Rrp44, it is not clear how RNA is directed to Rrp6 or whether Rrp6 uses the central channel. Here we report a 3.3 Å crystal structure of a ten-subunit RNA exosome complex from Saccharomyces cerevisiae composed of the Exo9 core and Rrp6 bound to single-stranded poly(A) RNA. The Rrp6 catalytic domain rests on top of the Exo9 S1/KH ring above the central channel, the RNA 3' end is anchored in the Rrp6 active site, and the remaining RNA traverses the S1/KH ring in an opposite orientation to that observed in a structure of a Rrp44-containing exosome complex. Solution studies with human and yeast RNA exosome complexes suggest that the RNA path to Rrp6 is conserved and dependent on the integrity of the S1/KH ring. Although path selection to Rrp6 or Rrp44 is stochastic in vitro, the fate of a particular RNA may be determined in vivo by the manner in which cofactors present RNA to the RNA exosome.

  1. Towards annotating the plant epigenome: the Arabidopsis thaliana small RNA locus map.

    Science.gov (United States)

    Hardcastle, Thomas J; Müller, Sebastian Y; Baulcombe, David C

    2018-04-20

    Based on 98 public and internal small RNA high throughput sequencing libraries, we mapped small RNAs to the genome of the model organism Arabidopsis thaliana and defined loci based on their expression using an empirical Bayesian approach. The resulting loci were subsequently classified based on their genetic and epigenetic context as well as their expression properties. We present the results of this classification, which broadly conforms to previously reported divisions between transcriptional and post-transcriptional gene silencing small RNAs, and to PolIV and PolV dependencies. However, we are able to demonstrate the existence of further subdivisions in the small RNA population of functional significance. Moreover, we present a framework for similar analyses of small RNA populations in all species.

  2. Analysis of DNA strand break induction and repair in plants from the vicinity of Chernobyl

    International Nuclear Information System (INIS)

    Syomov, A.B.; Ptitsyna, S.N.; Sergeeva, S.A.

    1992-01-01

    For 3 years following the Chernobyl accident DNA repair efficiency was studied in irradiated and control populations of various plan species. Compared with the control populations, some irradiated populations exhibited increases in the yield of DNA single-strand breaks per unit dose of challenge radiation. The effect was registered in low-dose-rate alpha-irradiated populations, but was absent in plant populations growing in conditions of low-dose-rate beta-irradiation. The efficiency of single-strand DNA repair was identical in control and irradiated populations and approximated 100%. (author). 12 refs.; 1 fig.; 2 tabs

  3. EdiPy: a resource to simulate the evolution of plant mitochondrial genes under the RNA editing.

    Science.gov (United States)

    Picardi, Ernesto; Quagliariello, Carla

    2006-02-01

    EdiPy is an online resource appropriately designed to simulate the evolution of plant mitochondrial genes in a biologically realistic fashion. EdiPy takes into account the presence of sites subjected to RNA editing and provides multiple artificial alignments corresponding to both genomic and cDNA sequences. Each artificial data set can successively be submitted to main and widespread evolutionary and phylogenetic software packages such as PAUP, Phyml, PAML and Phylip. As an online bioinformatic resource, EdiPy is available at the following web page: http://biologia.unical.it/py_script/index.html.

  4. Intracellular RNA during microsporogenesis in plants: Texus baccata as a model system

    Directory of Open Access Journals (Sweden)

    Roger I. Pennell

    2014-01-01

    Full Text Available The fluorescent proble Acridine Orange has provided valuable information about changes in levels of insoluble RNA during meiosis in pollen mother cells of Taxus baccata, in which prophase is unusually prolonged. By combining the data offered by fluorescence microscopy with microdensitometry it has been possible to measure changes in the amounts of RNA within cytoplasm. nucleus and nucleolus individually. The data are generally in line with those arising from other techniques, but lend themselves to a wholly original interpretation of the controlling events in meiosis.

  5. Sequence organization and putative regulatory elements in the 5S rRNA genes of two higher plants (Vigna radiata and Matthiola incana).

    Science.gov (United States)

    Hemleben, V; Werts, D

    1988-01-01

    The tandemly arranged and clustered highly repeated 5S rRNA genes are investigated for two plants belonging to different higher plant families: Matthiola incana (Brassicaceae, Dilleniidae, Rosidae; 3600 5S rRNA genes/n) shows a homogeneous repeat size of 510 bp, whereas Vigna radiata (mung bean, former Phaseolus aureus, Fabaceae, Rosidae; approx. 4300 5S rRNA genes) has a repeat size of 215 bp. The mung-bean 5S rRNA coding region starts 5' with AGG and ends with CCT; Matthiola starts with GGG and ends with CCC. Striking is the strict occurrence of a 'TATA' box starting at nucleotide-28 similar to Neurospora crassa 5S rRNA genes. The 3' end is followed by CTTTT or GTTT stretches present in different numbers in the non-transcribed spacer suggesting a function in termination.

  6. Structural Analyses of Avocado sunblotch viroid Reveal Differences in the Folding of Plus and Minus RNA Strands

    Directory of Open Access Journals (Sweden)

    Clémentine Delan-Forino

    2014-01-01

    Full Text Available Viroids are small pathogenic circular single-stranded RNAs, present in two complementary sequences, named plus and minus, in infected plant cells. A high degree of complementarities between different regions of the RNAs allows them to adopt complex structures. Since viroids are naked non-coding RNAs, interactions with host factors appear to be closely related to their structural and catalytic characteristics. Avocado sunblotch viroid (ASBVd, a member of the family Avsunviroidae, replicates via a symmetric RNA-dependant rolling-circle process, involving self-cleavage via hammerhead ribozymes. Consequently, it is assumed that ASBVd plus and minus strands adopt similar structures. Moreover, by computer analyses, a quasi-rod-like secondary structure has been predicted. Nevertheless, secondary and tertiary structures of both polarities of ASBVd remain unsolved. In this study, we analyzed the characteristic of each strand of ASBVd through biophysical analyses. We report that ASBVd transcripts of plus and minus polarities exhibit differences in electrophoretic mobility under native conditions and in thermal denaturation profiles. Subsequently, the secondary structures of plus and minus polarities of ASBVd were probed using the RNA-selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE method. The models obtained show that both polarities fold into different structures. Moreover, our results suggest the existence of a kissing-loop interaction within the minus strand that may play a role in in vivo viroid life cycle.

  7. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    Science.gov (United States)

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Tomato chlorotic mottle virus is a target of RNA silencing but the presence of specific short interfering RNAs does not guarantee resistance in transgenic plants

    NARCIS (Netherlands)

    Ribeiro, S.G.; Lohuis, H.; Goldbach, R.W.; Prins, M.

    2007-01-01

    Tomato chlorotic mottle virus (ToCMoV) is a begomovirus found widespread in tomato fields in Brazil. ToCMoV isolate BA-Se1 (ToCMoV-[BA-Se1]) was shown to trigger the plant RNA silencing surveillance in different host plants and, coinciding with a decrease in viral DNA levels, small interfering RNAs

  9. Dual RNA-seq of the plant pathogen phytophthora ramorum and its tanoak host

    Science.gov (United States)

    Katherine J. Hayden; Matteo Garbelotto; Brian J. Knaus; Richard C. Cronn; Hardeep Rai; Jessica W. Wright

    2014-01-01

    Emergent diseases are an ever-increasing threat to forests and forest ecosystems and necessitate the development of research tools for species that often may have few preexisting resources. We sequenced the mRNA expressed by the sudden oak death pathogen Phytophthora ramorum and its most susceptible forest host, tanoak, within the same tissue at two time points after...

  10. Cytogenetic features of rRNA genes across land plants: analysis of the Plant rDNA database

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Kovařík, Aleš; Leitch, A. R.; Garnatje, T.

    2017-01-01

    Roč. 89, č. 5 (2017), s. 1020-1030 ISSN 0960-7412 R&D Projects: GA ČR(CZ) GC16-02149J Institutional support: RVO:68081707 Keywords : in-situ hybridization * 5s rdna * 45s rdna * concerted evolution Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 5.901, year: 2016

  11. Different roles of glycine-rich RNA-binding protein7 in plant defense against Pectobacterium carotovorum, Botrytis cinerea, and tobacco mosaic viruses.

    Science.gov (United States)

    Lee, Hwa Jung; Kim, Jin Seo; Yoo, Seung Jin; Kang, Eun Young; Han, Song Hee; Yang, Kwang-Yeol; Kim, Young Cheol; McSpadden Gardener, Brian; Kang, Hunseung

    2012-11-01

    Glycine-rich RNA-binding protein7 (AtGRP7) has previously been demonstrated to confer plant defense against Pseudomonas syringae DC3000. Here, we show that AtGRP7 can play different roles in plant defense against diverse pathogens. AtGRP7 enhances resistance against a necrotrophic bacterium Pectobacterium carotovorum SCC1 or a biotrophic virus tobacco mosaic virus. By contrast, AtGRP7 plays a negative role in defense against a necrotrophic fungus Botrytis cinerea. These results provide evidence that AtGRP7 is a potent regulator in plant defense response to diverse pathogens, and suggest that the regulation of RNA metabolism by RNA-binding proteins is important for plant innate immunity. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  12. The Rev1 interacting region (RIR) motif in the scaffold protein XRCC1 mediates a low-affinity interaction with polynucleotide kinase/phosphatase (PNKP) during DNA single-strand break repair.

    Science.gov (United States)

    Breslin, Claire; Mani, Rajam S; Fanta, Mesfin; Hoch, Nicolas; Weinfeld, Michael; Caldecott, Keith W

    2017-09-29

    The scaffold protein X-ray repair cross-complementing 1 (XRCC1) interacts with multiple enzymes involved in DNA base excision repair and single-strand break repair (SSBR) and is important for genetic integrity and normal neurological function. One of the most important interactions of XRCC1 is that with polynucleotide kinase/phosphatase (PNKP), a dual-function DNA kinase/phosphatase that processes damaged DNA termini and that, if mutated, results in ataxia with oculomotor apraxia 4 (AOA4) and microcephaly with early-onset seizures and developmental delay (MCSZ). XRCC1 and PNKP interact via a high-affinity phosphorylation-dependent interaction site in XRCC1 and a forkhead-associated domain in PNKP. Here, we identified using biochemical and biophysical approaches a second PNKP interaction site in XRCC1 that binds PNKP with lower affinity and independently of XRCC1 phosphorylation. However, this interaction nevertheless stimulated PNKP activity and promoted SSBR and cell survival. The low-affinity interaction site required the highly conserved Rev1-interacting region (RIR) motif in XRCC1 and included three critical and evolutionarily invariant phenylalanine residues. We propose a bipartite interaction model in which the previously identified high-affinity interaction acts as a molecular tether, holding XRCC1 and PNKP together and thereby promoting the low-affinity interaction identified here, which then stimulates PNKP directly. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  14. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  15. OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS to guide the autonomous self-assembly of long DNA constructs from multiple DNA single <