WorldWideScience

Sample records for single-stranded rna molecules

  1. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  2. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  3. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif

    Science.gov (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  4. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth

    2014-01-01

    . We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices......Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells...

  5. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids.

    Science.gov (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R

    2015-04-08

    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  6. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  7. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol

    2010-05-01

    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  8. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.

    1987-01-01

    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  9. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA

    Science.gov (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana

    2009-04-01

    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  10. Role of electrostatics in the assembly pathway of a single-stranded RNA virus.

    Science.gov (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M

    2014-09-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  11. Selective binding and reverse transcription inhibition of single-strand poly(A) RNA by metal TMPyP complexes.

    Science.gov (United States)

    Zhou, Zhu-Xin; Gao, Feng; Chen, Xing; Tian, Xiang-Jing; Ji, Liang-Nian

    2014-10-06

    Ni-, Cu-, and Zn-TMPyP are capable of binding to single-strand poly(A) RNA with high preference and affinity and inhibiting the reverse transcription of RNA by both M-MuLV and HIV-1 reverse transcriptase. With 10 nM azidothymidine, the IC50 value of M-TMPyP could be lowered to 10(-1) μM order.

  12. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses.

    Science.gov (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn

    2011-06-01

    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  13. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin.

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-13

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecule, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G • U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G • U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  14. Highly stable triple helix formation by homopyrimidine (l)-acyclic threoninol nucleic acids with single stranded DNA and RNA

    DEFF Research Database (Denmark)

    Kumar, Vipin; Kesavan, Venkitasamy; Gothelf, Kurt Vesterager

    2015-01-01

    Acyclic (l)-threoninol nucleic acid (aTNA) containing thymine, cytosine and adenine nucleobases were synthesized and shown to form surprisingly stable triplexes with complementary single stranded homopurine DNA or RNA targets. The triplex structures consist of two (l)-aTNA strands and one DNA...... or RNA, and these triplexes are significantly stronger than the corresponding DNA or RNA duplexes as shown in competition experiments. As a unique property the (l)-aTNAs exclusively form triplex structures with DNA and RNA and no duplex structures are observed by gel electrophoresis. The results were...... compared to the known enantiomer (d)-aTNA, which forms much weaker triplexes depending upon temperature and time. It was demonstrated that (l)-aTNA triplexes are able to stop primer extension on a DNA template, showing the potential of (l)-aTNA for antisense applications....

  15. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples.

    Science.gov (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J

    2006-03-01

    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  16. A single-stranded RNA copy of the Giardia lamblia virus double-stranded RNA genome is present in the infected Giardia lamblia.

    OpenAIRE

    Furfine, E S; White, T C; Wang, A L; Wang, C C

    1989-01-01

    An isolate of Giardia lamblia infected with the double-stranded RNA virus (GLV) has two major species of RNA that are not present in an uninfected isolate. One of these species is the previously characterized double-stranded RNA genome of GLV (1). The second species of RNA appears to be a full length copy of one strand of the double-stranded RNA genome. This full length single-stranded RNA is not present in viral particles isolated from the growth medium. The cellular concentration of the sin...

  17. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-04-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  18. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-02-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  19. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-01

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  20. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)

    2012-04-04

    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  1. Capillary electrophoresis ribosomal RNA single-stranded conformation polymorphism: a new approach for characterization of low-diversity microbial communities.

    Science.gov (United States)

    Nai, Yi H; Zemb, Oliver; Gutierrez-Zamora, Maria-Luisa; Manefield, Mike; Powell, Shane M; Breadmore, Michael C

    2012-10-01

    Capillary electrophoresis (CE) has been the principle system for nucleic acid analysis since the early 1990s due to its inherent advantages such as fast analysis time, high resolution and efficiency, minimal sample requirement, high detection sensitivity, and automation. In the past few decades, microbial community fingerprinting methods such as terminal restriction fragment length polymorphism and single-stranded conformation polymorphism (SSCP) have migrated to CE to utilize its advantages over conventional slab gel electrophoresis. Recently, a gel-based direct rRNA fingerprint method was demonstrated. Different from other existing microbial community characterization approaches, this novel approach is polymerase chain reaction free and capable of providing information on the relative abundance of rRNA from individual phylotypes in low-diversity samples. As a gel-based method, it has a long analysis time and relatively large reagent and sample requirements. Here, we addressed these limitations by transferring the RNA fingerprint approach to the CE platform. Analysis time significantly improved from 24 h to 60 min, and the use of a fluorescently labeled hybridization probe as the detection strategy decreased the sample requirement by ten-fold. The combination of fast analysis time, low sample requirement, and sensitive fluorescence detection makes CE-RNA-SSCP an appealing new approach for characterizing low-diversity microbial communities.

  2. Role of Electrostatics in the assembly pathway of a single-stranded RNA virus

    NARCIS (Netherlands)

    Garmann, R.F.; Comas-Garcia, M.; Koay, M.S.T.; Cornelissen, Jeroen Johannes Lambertus Maria; Knobler, C.M.; Gelbart, W.M.

    2014-01-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318–3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of

  3. Toxin MqsR Cleaves Single-Stranded mRNA with Various 5 Ends

    Science.gov (United States)

    2016-08-24

    decreases persisence about 2400- fold (Harrison et al. 2009). Another type II TA toxin, MazF, induces growth arrest that results in up to a 700- fold...Life Technologies, Waltham, MA). In brief, 25 pmol of RNA was first treated with 0.1 U of calf intestine alkaline phosphatase (CIP, 0.1 U/μL) for 1...MqsR/MqsA regulate toxin CspD. Environ. Microbiol. 12:1105–1121. Kwan, B. W., J. A. Valenta, M. J. Benedik, and T. K. Wood. 2013. Arrested protein

  4. Activation of 2'-5' oligoadenylate synthetase by single-stranded and double-stranded RNA aptamers

    DEFF Research Database (Denmark)

    Hartmann, R; Norby, P L; Martensen, P M

    1998-01-01

    A number of small RNA molecules that are high affinity ligands for the 46-kDa form of human 2'-5' oligoadenylate synthetase have been identified by the SELEX method. Surface plasmon resonance analysis indicates that these RNAs bind to the enzyme with dissociation constants in the nanomolar range....... Competition experiments indicate that the binding site for the small RNAs on the 2'-5' oligoadenylate synthetase molecule at least partially overlaps that for the synthetic double-stranded RNA, poly(I).poly(C). Several of the RNAs function as potent activators of 2'-5' oligoadenylate synthetase in vitro......-stranded RNA, can also be activated by RNA ligands with little secondary structure. Since 2'-5' oligoadenylate synthetase possesses no homology to other known RNA-binding proteins, the development of small specific ligands by SELEX should facilitate studies of RNA-protein interactions and may reveal novel...

  5. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  6. Characterization of a Novel Megabirnavirus from Sclerotinia sclerotiorum Reveals Horizontal Gene Transfer from Single-Stranded RNA Virus to Double-Stranded RNA Virus.

    Science.gov (United States)

    Wang, Minghong; Wang, Yong; Sun, Xiangzhong; Cheng, Jiasen; Fu, Yanping; Liu, Huiquan; Jiang, Daohong; Ghabrial, Said A; Xie, Jiatao

    2015-08-01

    Mycoviruses have been detected in all major groups of filamentous fungi, and their study represents an important branch of virology. Here, we characterized a novel double-stranded RNA (dsRNA) mycovirus, Sclerotinia sclerotiorum megabirnavirus 1 (SsMBV1), in an apparently hypovirulent strain (SX466) of Sclerotinia sclerotiorum. Two similarly sized dsRNA segments (L1- and L2-dsRNA), the genome of SsMBV1, are packaged in rigid spherical particles purified from strain SX466. The full-length cDNA sequence of L1-dsRNA/SsMBV1 comprises two large open reading frames (ORF1 and ORF2), which encode a putative coat protein and an RNA-dependent RNA polymerase (RdRp), respectively. Phylogenetic analysis of the RdRp domain clearly indicates that SsMBV1 is related to Rosellinia necatrix megabirnavirus 1 (RnMBV1). L2-dsRNA/SsMBV1 comprises two nonoverlapping ORFs (ORFA and ORFB) encoding two hypothetical proteins with unknown functions. The 5'-terminal regions of L1- and L2-dsRNA/SsMBV1 share strictly conserved sequences and form stable stem-loop structures. Although L2-dsRNA/SsMBV1 is dispensable for replication, genome packaging, and pathogenicity of SsMBV1, it enhances transcript accumulation of L1-dsRNA/SsMBV1 and stability of virus-like particles (VLPs). Interestingly, a conserved papain-like protease domain similar to a multifunctional protein (p29) of Cryphonectria hypovirus 1 was detected in the ORFA-encoded protein of L2-dsRNA/SsMBV1. Phylogenetic analysis based on the protease domain suggests that horizontal gene transfer may have occurred from a single-stranded RNA (ssRNA) virus (hypovirus) to a dsRNA virus, SsMBV1. Our results reveal that SsMBV1 has a slight impact on the fundamental biological characteristics of its host regardless of the presence or absence of L2-dsRNA/SsMBV1. Mycoviruses are widespread in all major fungal groups, and they possess diverse genomes of mostly ssRNA and dsRNA and, recently, circular ssDNA. Here, we have characterized a novel dsRNA virus

  7. RNA binding to APOBEC3G induces the disassembly of functional deaminase complexes by displacing single-stranded DNA substrates

    Science.gov (United States)

    Polevoda, Bogdan; McDougall, William M.; Tun, Bradley N.; Cheung, Michael; Salter, Jason D.; Friedman, Alan E.; Smith, Harold C.

    2015-01-01

    APOBEC3G (A3G) DNA deaminase activity requires a holoenzyme complex whose assembly on nascent viral reverse transcripts initiates with A3G dimers binding to ssDNA followed by formation of higher-order A3G homo oligomers. Catalytic activity is inhibited when A3G binds to RNA. Our prior studies suggested that RNA inhibited A3G binding to ssDNA. In this report, near equilibrium binding and gel shift analyses showed that A3G assembly and disassembly on ssDNA was an ordered process involving A3G dimers and multimers thereof. Although, fluorescence anisotropy showed that A3G had similar nanomolar affinity for RNA and ssDNA, RNA stochastically dissociated A3G dimers and higher-order oligomers from ssDNA, suggesting a different modality for RNA binding. Mass spectrometry mapping of A3G peptides cross-linked to nucleic acid suggested ssDNA only bound to three peptides, amino acids (aa) 181–194 in the N-terminus and aa 314–320 and 345–374 in the C-terminus that were part of a continuous exposed surface. RNA bound to these peptides and uniquely associated with three additional peptides in the N- terminus, aa 15–29, 41–52 and 83–99, that formed a continuous surface area adjacent to the ssDNA binding surface. The data predict a mechanistic model of RNA inhibition of ssDNA binding to A3G in which competitive and allosteric interactions determine RNA-bound versus ssDNA-bound conformational states. PMID:26424853

  8. Data mining cDNAs reveals three new single stranded RNA viruses in Nasonia (Hymenopetera:Pteromalidae)

    Science.gov (United States)

    Hymenopteran viruses may provide insights into colony collapse disorder in honey bees and other insect species. Three novel small RNA viruses were discovered during the genomics effort for the beneficial parasitoid of flies in the genus Nasonia (Hymenoptera). Genomics provides a great deal of inform...

  9. Cuprolinic Blue: a specific dye for single-stranded RNA in the presence of magnesium chloride. I. Fundamental aspects

    NARCIS (Netherlands)

    Tas, J.; MENDELSON, D.; NOORDEN, C. J. F.

    1983-01-01

    Qualitative and quantitative aspects of the cationic dye Cuprolinic Blue were investigated with model films of polyacrylamide gel in which RNA, DNA and other biological polyanionic compounds had been incorporated. In the presence of 1 M MgCl2, Curpolinic Blue was found to bind specifically to

  10. Characterization of a novel single-stranded RNA virus, closely related to fusariviruses, infecting the plant pathogenic fungus Alternaria brassicicola.

    Science.gov (United States)

    Zhong, Jie; Shang, Hong Hong; Zhu, Chuan Xia; Zhu, Jun Zi; Zhu, Hong Jian; Hu, Yan; Gao, Bi Da

    2016-06-02

    The alternaria blackspot of rapeseed is one of the most prominent diseases of rapeseed. It is caused by three species of the genus Alternaria: Alternaria brassicicola, Alternaria brassicae, and Alternaria raphanin. Here we report a novel positive-sense RNA virus from an A. brassicicola strain 817-14. The virus has a 6639 nucleotide (nt) long genome, excluding a poly (A)-tail, and was predicted to contain three putative open reading frames (ORF1, ORF2, and ORF3). The large ORF1 encoded a 174-kDa polyprotein (composed of 1522 amino acid residues) containing a conserved RNA-dependent RNA polymerase (RdRp) domain and a helicase domain. The other two smaller ORFs encoded polypeptides with unknown function. Homology search and phylogenetic analysis, based on the RdRp and helicase domains, suggest that this virus is related to and grouped with Sclerotinia sclerotiorum fusarivirus 1 (SsFV1), Rosellinia necatrix fusarivirus 1 (RnFV1), Fusarium graminearum virus-DK21 (FgV1), and Penicillium roqueforti RNA mycovirus 1 (PrRV1), all of which belong to a newly proposed family Fusariviridae. For this study, we designed the virus as "Alternaria brassicicola fusarivirus 1" (AbFV1). Virus elimination revealed that AbFV1 has no conspicuous impact on the biological properties of its host. Copyright © 2016. Published by Elsevier B.V.

  11. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.

    1978-01-01

    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  12. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase.

    Science.gov (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias

    2017-06-02

    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  14. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    Science.gov (United States)

    Hong, Ka Lok

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  15. Site-specific binding of viral plus single-stranded RNA to replicase-containing open virus-like particles of yeast.

    OpenAIRE

    Esteban, R; Fujimura, T; Wickner, R B

    1988-01-01

    X double-stranded RNA is a deletion mutant of L-A double-stranded RNA and is encapsidated in viral particles by the L-A-encoded major coat protein. X double-stranded RNA has all the cis sites necessary to be transcribed, encapsidated, and replicated. We have cloned X double-stranded RNA and sequenced it. The complete X double-stranded RNA sequence deduced indicates that the first 25 bases of the X plus-strand 5' end originated from the 5' end of the L-A plus strand and that most, if not all, ...

  16. Ro60-associated single-stranded RNA links inflammation with fetal cardiac fibrosis via ligation of TLRs: a novel pathway to autoimmune-associated heart block.

    Science.gov (United States)

    Clancy, Robert M; Alvarez, David; Komissarova, Elena; Barrat, Franck J; Swartz, Jordan; Buyon, Jill P

    2010-02-15

    Activation of TLR by ssRNA after FcgammaR-mediated phagocytosis of immune complexes (IC) may be relevant in autoimmune-associated congenital heart block (CHB) where the obligate factor is a maternal anti-SSA/Ro Ab and the fetal factors, protein/RNA on an apoptotic cardiocyte and infiltrating macrophages. This study addressed the hypothesis that Ro60-associated ssRNAs link macrophage activation to fibrosis via TLR engagement. Both macrophage transfection with noncoding ssRNA that bind Ro60 and an IC generated by incubation of Ro60-ssRNA with an IgG fraction from a CHB mother or affinity purified anti-Ro60 significantly increased TNF-alpha secretion, an effect not observed using control RNAs or normal IgG. Dependence on TLR was supported by the significant inhibition of TNF-alpha release by IRS661 and chloroquine. The requirement for FcgammaRIIIa-mediated delivery was provided by inhibition with an anti-CD16a Ab. Fibrosis markers were noticeably increased in fetal cardiac fibroblasts after incubation with supernatants generated from macrophages transfected with ssRNA or incubated with the IC. Supernatants generated from macrophages with ssRNA in the presence of IRS661 or chloroquine did not cause fibrosis. In a CHB heart, but not a healthy heart, TLR7 immunostaining was localized to a region near the atrioventricular groove at a site enriched in mononuclear cells and fibrosis. These data support a novel injury model in CHB, whereby endogenous ligand, Ro60-associated ssRNA, forges a nexus between TLR ligation and fibrosis instigated by binding of anti-Ro Abs to the target protein likely accessible via apoptosis.

  17. A G-C-rich palindromic structural motif and a stretch of single-stranded purines are required for optimal packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA.

    Science.gov (United States)

    Jaballah, Soumeya Ali; Aktar, Suriya J; Ali, Jahabar; Phillip, Pretty Susan; Al Dhaheri, Noura Salem; Jabeen, Aayesha; Rizvi, Tahir A

    2010-09-03

    During retroviral RNA packaging, two copies of genomic RNA are preferentially packaged into the budding virus particles whereas the spliced viral RNAs and the cellular RNAs are excluded during this process. Specificity towards retroviral RNA packaging is dependent upon sequences at the 5' end of the viral genome, which at times extend into Gag sequences. It has earlier been suggested that the Mason-Pfizer monkey virus (MPMV) contains packaging sequences within the 5' untranslated region (UTR) and Gag. These studies have also suggested that the packaging determinants of MPMV that lie in the UTR are bipartite and are divided into two regions both upstream and downstream of the major splice donor. However, the precise boundaries of these discontinuous regions within the UTR and the role of the intervening sequences between these dipartite sequences towards MPMV packaging have not been investigated. Employing a combination of genetic and structural prediction analyses, we have shown that region "A", immediately downstream of the primer binding site, is composed of 50 nt, whereas region "B" is composed of the last 23 nt of UTR, and the intervening 55 nt between these two discontinuous regions do not contribute towards MPMV RNA packaging. In addition, we have identified a 14-nt G-C-rich palindromic sequence (with 100% autocomplementarity) within region A that has been predicted to fold into a structural motif and is essential for optimal MPMV RNA packaging. Furthermore, we have also identified a stretch of single-stranded purines (ssPurines) within the UTR and 8 nt of these ssPurines are duplicated in region B. The native ssPurines or its repeat in region B when predicted to refold as ssPurines has been shown to be essential for RNA packaging, possibly functioning as a potential nucleocapsid binding site. Findings from this study should enhance our understanding of the steps involved in MPMV replication including RNA encapsidation process. Copyright (c) 2010 Elsevier Ltd

  18. A novel single-stranded RNA virus isolated from a phytopathogenic filamentous fungus, Rosellinia necatrix, with similarity to hypo-like viruses

    Directory of Open Access Journals (Sweden)

    Rui eZhang

    2014-07-01

    Full Text Available Here we report a biological and molecular characterization of a novel positive-sense RNA virus isolated from a field isolate (NW10 of a filamentous phytopathogenic fungus, the white root rot fungus that is designated as Rosellinia necatrix fusarivirus 1 (RnFV1. A recently developed technology using zinc ions allowed us to transfer RnFV1 to two mycelially incompatible Rosellinia necatrix strains. A biological comparison of the virus-free and -recipient isogenic fungal strains suggested that RnFV1 infects latently and thus has no potential as a virocontrol agent. The virus has an undivided positive-sense RNA genome of 6286 nucleotides excluding a poly (A tail. The genome possesses two non-overlapping open reading frames (ORFs: a large ORF1 that encodes polypeptides with RNA replication functions and a smaller ORF2 that encodes polypeptides of unknown function. A lack of coat protein genes was suggested by the failure of virus particles from infected mycelia. No evidence was obtained by Northern analysis or classical 5'-RACE for the presence of subgenomic RNA for the downstream ORF. Sequence similarities were found in amino-acid sequence between RnFV1 putative proteins and counterparts of a previously reported mycovirus, Fusarium graminearum virus 1 (FgV1. Interestingly, several related sequences were detected by BLAST searches of independent transcriptome assembly databases one of which probably represents an entire virus genome. Phylogenetic analysis based on the conserved RNA-dependent RNA polymerase showed that RnFV1, FgV1, and these similar sequences are grouped in a cluster distinct from distantly related hypoviruses. It is proposed that a new taxonomic family termed Fusariviridae be created to include RnFV1and FgV1.

  19. Design and Assessment of a Real Time Reverse Transcription-PCR Method to Genotype Single-Stranded RNA Male-Specific Coliphages (Family Leviviridae).

    Science.gov (United States)

    A real-time, reverse transcription-PCR (RT-qPCR) assay was developed to differentiate the four genogroups of male-specific ssRNA coliphages (FRNA) (family Leviviridae). As FRNA display a trend of source-specificity (human sewage or animal waste) at the genogroup level, this assa...

  20. Isolation and characterization of Nylanderia fulva virus 1, a positive-sense, single-stranded RNA virus infecting the tawny crazy ant, Nylanderia fulva

    Energy Technology Data Exchange (ETDEWEB)

    Valles, Steven M., E-mail: steven.valles@ars.usda.gov [Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, 1600 SW 23rd Drive, Gainesville, FL 32608 (United States); Oi, David H.; Becnel, James J. [Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, 1600 SW 23rd Drive, Gainesville, FL 32608 (United States); Wetterer, James K. [Wilkes Honors College, Florida Atlantic University, 5353 Parkside Drive, Jupiter, FL 33458 (United States); LaPolla, John S. [Department of Biological Sciences, Towson University, 8000 York Road, Towson, MD 21252 (United States); Firth, Andrew E. [Department of Pathology, University of Cambridge, Cambridge CB2 1QP (United Kingdom)

    2016-09-15

    We report the discovery of Nylanderia fulva virus 1 (NfV-1), the first virus identified and characterized from the ant, Nylanderia fulva. The NfV-1 genome (GenBank accession KX024775) is 10,881 nucleotides in length, encoding one large open reading frame (ORF). Helicase, protease, RNA-dependent RNA polymerase, and jelly-roll capsid protein domains were recognized within the polyprotein. Phylogenetic analysis placed NfV-1 in an unclassified clade of viruses. Electron microscopic examination of negatively stained samples revealed particles with icosahedral symmetry with a diameter of 28.7±1.1 nm. The virus was detected by RT-PCR in larval, pupal, worker and queen developmental stages. However, the replicative strand of NfV-1 was only detected in larvae. Vertical transmission did not appear to occur, but horizontal transmission was facile. The inter-colonial field prevalence of NfV-1 was 52±35% with some local infections reaching 100%. NfV-1 was not detected in limited samples of other Nylanderia species or closely related ant species. - Highlights: • A new positive-strand RNA virus was discovered in the ant, Nylanderia fulva. • The Nylanderia fulva virus 1 genome was comprised of 10,881 nucleotides. • NfV-1 was detected in larval, pupal, queen and worker ants, but not eggs. • Replication of NfV-1 appeared to be limited to the larval stage.

  1. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.

    1976-02-01

    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  2. porphyrin with single strand DNAs

    Indian Academy of Sciences (India)

    for organization of porphyrin molecules into extended assemblies, providing opportunities for construction of supramolecular structures.6–8 Among the porphyrin .... and consequently the mono- and bi-exponential nature of the decays were judged by the reduced chi-square. (χ2) values and distribution of the weighted ...

  3. Programmable autonomous synthesis of single-stranded DNA

    Science.gov (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

    2018-02-01

    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  4. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  5. Three-dimensional model of a selective theophylline-binding RNA molecule

    Energy Technology Data Exchange (ETDEWEB)

    Tung, Chang-Shung; Oprea, T.I.; Hummer, G.; Garcia, A.E.

    1995-07-01

    We propose a three-dimensional (3D) model for an RNA molecule that selectively binds theophylline but not caffeine. This RNA, which was found using SELEX [Jenison, R.D., et al., Science (1994) 263:1425] is 10,000 times more specific for theophylline (Kd=320 nM) than for caffeine (Kd=3.5 mM), although the two ligands are identical except for a methyl group substituted at N7 (present only in caffeine). The binding affinity for ten xanthine-based ligands was used to derive a Comparative Molecular Field Analysis (CoMFA) model (R{sup 2} = 0.93 for 3 components, with cross-validated R{sup 2} of 0.73), using the SYBYL and GOLPE programs. A pharmacophoric map was generated to locate steric and electrostatic interactions between theophylline and the RNA binding site. This information was used to identify putative functional groups of the binding pocket and to generate distance constraints. Based on a model for the secondary structure (Jenison et al., idem), the 3D structure of this RNA was then generated using the following method: each helical region of the RNA molecule was treated as a rigid body; single-stranded loops with specific end-to-end distances were generated. The structures of RNA-xanthine complexes were studied using a modified Monte Carlo algorithm. The detailed structure of an RNA-ligand complex model, as well as possible explanations for the theophylline selectivity will be discussed.

  6. Dynamics of RecA filaments on single-stranded DNA

    NARCIS (Netherlands)

    Van Loenhout, M.T.J.; Van der Heijden, T.; Kanaar, R.; Wyman, C.; Dekker, C.

    2009-01-01

    RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on

  7. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket.

    Science.gov (United States)

    Pham, Hanh T; Bergoin, Max; Tijssen, Peter

    2013-03-14

    The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  8. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket

    OpenAIRE

    Pham, Hanh T.; Bergoin, Max; Tijssen, Peter

    2013-01-01

    International audience; The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  9. RNA as a small molecule druggable target.

    Science.gov (United States)

    Rizvi, Noreen F; Smith, Graham F

    2017-12-01

    Small molecule drugs have readily been developed against many proteins in the human proteome, but RNA has remained an elusive target for drug discovery. Increasingly, we see that RNA, and to a lesser extent DNA elements, show a persistent tertiary structure responsible for many diverse and complex cellular functions. In this digest, we have summarized recent advances in screening approaches for RNA targets and outlined the discovery of novel, drug-like small molecules against RNA targets from various classes and therapeutic areas. The link of structure, function, and small-molecule Druggability validates now for the first time that RNA can be the targets of therapeutic agents. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Isolation and detection of small RNA molecules

    Czech Academy of Sciences Publication Activity Database

    Fulneček, Jaroslav

    2007-01-01

    Roč. 53, - (2007), s. 451-455 ISSN 1214-1178 R&D Projects: GA ČR(CZ) GA204/06/1432 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : small RNA molecules * electrophoresis Subject RIV: BO - Biophysics

  11. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  12. General enumeration of RNA secondary structures based on new ...

    African Journals Online (AJOL)

    akpobome

    In Biology, the nucleic acids play an important role in coding, transferring and retrieving genetic information, and in directing cell metabolism. The nucleic acid includes DNA and RNA molecule. RNA molecule is a single-stranded nucleic acid of four different kinds of nucleotides. The four nucleotides only differ by one part,.

  13. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.

    1985-01-01

    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  14. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)

    student

    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  15. Recent advances in developing small molecules targeting RNA.

    Science.gov (United States)

    Guan, Lirui; Disney, Matthew D

    2012-01-20

    RNAs are underexploited targets for small molecule drugs or chemical probes of function. This may be due, in part, to a fundamental lack of understanding of the types of small molecules that bind RNA specifically and the types of RNA motifs that specifically bind small molecules. In this review, we describe recent advances in the development and design of small molecules that bind to RNA and modulate function that aim to fill this void.

  16. Site-Specific Chemical Labeling of Long RNA Molecules

    DEFF Research Database (Denmark)

    Jahn, Kasper; Olsen, Eva Maria; Nielsen, Morten Muhlig

    2011-01-01

    Site-specific labeling of RNA molecules is a valuable tool for studying their structure and function. Here, we describe a new site-specific RNA labeling method, which utilizes a DNA-templated chemical reaction to attach a label at a specific internal nucleotide in an RNA molecule. The method...

  17. Improved single-strand DNA sizing accuracy in capillary electrophoresis.

    OpenAIRE

    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B

    1997-01-01

    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  18. The Adsorption of Short Single-Stranded DNA Oligomers on Mineral Surfaces

    Science.gov (United States)

    Kopstein, M.; Sverjensky, D. A.; Hazen, R. M.; Cleaves, H. J.

    2009-12-01

    Previous studies have described feasible pathways for the synthesis of simple organic building blocks such as formaldehyde and hydrogen cyanide, and their reaction to form more complex biomolecules such as nucleotide bases, amino acids and sugars (Miller and Orgel 1974, Miller and Cleaves 2006). However, the polymerization of monomers into a useful genetic material remains problematic (Orgel 2004). Organic building blocks were unlikely to polymerize from very dilute aqueous solution in the primitive oceans. Mineral surface adsorption has been suggested as a possible mechanism for concentrating the necessary building blocks (Bernal 1951). This study focused on the adsorption behavior of single-stranded DNA homo-oligomers of adenine and thymine (including the monomers, dimers, tetramers, hexamers, octomers, and decamers) with five different mineral surfaces (pyrite, rutile, hematite, olivine and calcite). Adsorption was studied in 0.1 M pH 8.1 KHCO3 with0.05 M NaCl as background electrolyte. Solutions were mixed for 24 hours at room temperature, centrifuged and the supernatants analyzed by UV/visible spectrophotometry. Equilibrium solution concentrations were measured and used to determine the number of moles adsorbed per square meter. Langmuir isotherms were constructed using the experimental data. It was found that adenine-containing molecules tend to bind much more strongly than thymine-containing molecules. It was also found that the number of moles adsorbed at saturation tends to fall with increasing chain length, while adsorption affinity tends to rise. Oligomer length appears to affect adsorption more than the mineral type. These results may have implications for the primordial organization of the first nucleic acid molecules as the persistence of extra-cellular nucleic acids in the environment. References Bernal, J. D. (1951) The Physical Basis of Life (Routledge, London). Miller S.L. and Cleaves, H.J. (2006) Prebiotic chemistry on the primitive Earth. In

  19. An RNA toolbox for single-molecule force spectroscopy studies

    NARCIS (Netherlands)

    Vilfan, I.D.; Kamping, W.; Van den Hout, M.; Candelli, A.; Hage, S.; Dekker, N.H.

    2007-01-01

    Precise, controllable single-molecule force spectroscopy studies of RNA and RNA-dependent processes have recently shed new light on the dynamics and pathways of RNA folding and RNAenzyme interactions. A crucial component of this research is the design and assembly of an appropriate RNA construct.

  20. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Science.gov (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  1. RNA targeting by small molecules: Binding of protoberberine ...

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... Studies on RNA targeting by small molecules to specifically control certain cellular functions is an area of remarkable current interest. For this purpose, a basic understanding of the molecular aspects of the interaction of small molecules with various RNA structures is essential. Alkaloids are a group of ...

  2. Small Molecule Modifiers of the microRNA and RNA Interference Pathway

    OpenAIRE

    Deiters, Alexander

    2009-01-01

    Recently, the RNA interference (RNAi) pathway has become the target of small molecule inhibitors and activators. RNAi has been well established as a research tool in the sequence-specific silencing of genes in eukaryotic cells and organisms by using exogenous, small, double-stranded RNA molecules of approximately 20 nucleotides. Moreover, a recently discovered post-transcriptional gene regulatory mechanism employs microRNAs (miRNAs), a class of endogenously expressed small RNA molecules, whic...

  3. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    Science.gov (United States)

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  4. Elastic properties of alternative versus single-stranded leveling archwires.

    Science.gov (United States)

    Rucker, Brian K; Kusy, Robert P

    2002-11-01

    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  5. Small molecule alteration of RNA sequence in cells and animals.

    Science.gov (United States)

    Guan, Lirui; Luo, Yiling; Ja, William W; Disney, Matthew D

    2017-10-18

    RNA regulation and maintenance are critical for proper cell function. Small molecules that specifically alter RNA sequence would be exceptionally useful as probes of RNA structure and function or as potential therapeutics. Here, we demonstrate a photochemical approach for altering the trinucleotide expanded repeat causative of myotonic muscular dystrophy type 1 (DM1), r(CUG) exp . The small molecule, 2H-4-Ru, binds to r(CUG) exp and converts guanosine residues to 8-oxo-7,8-dihydroguanosine upon photochemical irradiation. We demonstrate targeted modification upon irradiation in cell culture and in Drosophila larvae provided a diet containing 2H-4-Ru. Our results highlight a general chemical biology approach for altering RNA sequence in vivo by using small molecules and photochemistry. Furthermore, these studies show that addition of 8-oxo-G lesions into RNA 3' untranslated regions does not affect its steady state levels. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. RNA targeting by small molecules: Binding of protoberberine ...

    Indian Academy of Sciences (India)

    For this purpose, a basic understanding of the molecular aspects of the interaction of small molecules with various RNA structures is essential. Alkaloids are a group of natural products with potential therapeutic utility, and very recently, their interaction with many RNA structures have been reported. Especially noteworthy are ...

  7. Defining RNA-Small Molecule Affinity Landscapes Enables Design of a Small Molecule Inhibitor of an Oncogenic Noncoding RNA.

    Science.gov (United States)

    Velagapudi, Sai Pradeep; Luo, Yiling; Tran, Tuan; Haniff, Hafeez S; Nakai, Yoshio; Fallahi, Mohammad; Martinez, Gustavo J; Childs-Disney, Jessica L; Disney, Matthew D

    2017-03-22

    RNA drug targets are pervasive in cells, but methods to design small molecules that target them are sparse. Herein, we report a general approach to score the affinity and selectivity of RNA motif-small molecule interactions identified via selection. Named High Throughput Structure-Activity Relationships Through Sequencing (HiT-StARTS), HiT-StARTS is statistical in nature and compares input nucleic acid sequences to selected library members that bind a ligand via high throughput sequencing. The approach allowed facile definition of the fitness landscape of hundreds of thousands of RNA motif-small molecule binding partners. These results were mined against folded RNAs in the human transcriptome and identified an avid interaction between a small molecule and the Dicer nuclease-processing site in the oncogenic microRNA (miR)-18a hairpin precursor, which is a member of the miR-17-92 cluster. Application of the small molecule, Targapremir-18a, to prostate cancer cells inhibited production of miR-18a from the cluster, de-repressed serine/threonine protein kinase 4 protein (STK4), and triggered apoptosis. Profiling the cellular targets of Targapremir-18a via Chemical Cross-Linking and Isolation by Pull Down (Chem-CLIP), a covalent small molecule-RNA cellular profiling approach, and other studies showed specific binding of the compound to the miR-18a precursor, revealing broadly applicable factors that govern small molecule drugging of noncoding RNAs.

  8. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong

    2011-04-01

    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  9. Origins and Early Evolution of the tRNA Molecule

    Directory of Open Access Journals (Sweden)

    Koji Tamura

    2015-12-01

    Full Text Available Modern transfer RNAs (tRNAs are composed of ~76 nucleotides and play an important role as “adaptor” molecules that mediate the translation of information from messenger RNAs (mRNAs. Many studies suggest that the contemporary full-length tRNA was formed by the ligation of half-sized hairpin-like RNAs. A minihelix (a coaxial stack of the acceptor stem on the T-stem of tRNA can function both in aminoacylation by aminoacyl tRNA synthetases and in peptide bond formation on the ribosome, indicating that it may be a vestige of the ancestral tRNA. The universal CCA-3′ terminus of tRNA is also a typical characteristic of the molecule. “Why CCA?” is the fundamental unanswered question, but several findings give a comprehensive picture of its origin. Here, the origins and early evolution of tRNA are discussed in terms of various perspectives, including nucleotide ligation, chiral selectivity of amino acids, genetic code evolution, and the organization of the ribosomal peptidyl transferase center (PTC. The proto-tRNA molecules may have evolved not only as adaptors but also as contributors to the composition of the ribosome.

  10. Origins and Early Evolution of the tRNA Molecule.

    Science.gov (United States)

    Tamura, Koji

    2015-12-03

    Modern transfer RNAs (tRNAs) are composed of ~76 nucleotides and play an important role as "adaptor" molecules that mediate the translation of information from messenger RNAs (mRNAs). Many studies suggest that the contemporary full-length tRNA was formed by the ligation of half-sized hairpin-like RNAs. A minihelix (a coaxial stack of the acceptor stem on the T-stem of tRNA) can function both in aminoacylation by aminoacyl tRNA synthetases and in peptide bond formation on the ribosome, indicating that it may be a vestige of the ancestral tRNA. The universal CCA-3' terminus of tRNA is also a typical characteristic of the molecule. "Why CCA?" is the fundamental unanswered question, but several findings give a comprehensive picture of its origin. Here, the origins and early evolution of tRNA are discussed in terms of various perspectives, including nucleotide ligation, chiral selectivity of amino acids, genetic code evolution, and the organization of the ribosomal peptidyl transferase center (PTC). The proto-tRNA molecules may have evolved not only as adaptors but also as contributors to the composition of the ribosome.

  11. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.

    1984-01-01

    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  12. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes

    Science.gov (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.

    2015-01-01

    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  13. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-05

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity*

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.

    2015-01-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  15. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  16. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela

    2010-01-01

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  17. RNA secondary structure diagrams for very large molecules: RNAfdl

    DEFF Research Database (Denmark)

    Hecker, Nikolai; Wiegels, Tim; Torda, Andrew E.

    2013-01-01

    There are many programs that can read the secondary structure of an RNA molecule and draw a diagram, but hardly any that can cope with 10 3 bases. RNAfdl is slow but capable of producing intersection-free diagrams for ribosome-sized structures, has a graphical user interface for adjustments...

  18. Single-molecule observations of RNA-RNA kissing interactions in a DNA nanostructure.

    Science.gov (United States)

    Takeuchi, Yosuke; Endo, Masayuki; Suzuki, Yuki; Hidaka, Kumi; Durand, Guillaume; Dausse, Eric; Toulmé, Jean-Jacques; Sugiyama, Hiroshi

    2016-01-01

    RNA molecules uniquely form a complex through specific hairpin loops, called a kissing complex. The kissing complex is widely investigated and used for the construction of RNA nanostructures. Molecular switches have also been created by combining a kissing loop and a ligand-binding aptamer to control the interactions of RNA molecules. In this study, we incorporated two kinds of RNA molecules into a DNA origami structure and used atomic force microscopy to observe their ligand-responsive interactions at the single-molecule level. We used a designed RNA aptamer called GTPswitch, which has a guanosine triphosphate (GTP) responsive domain and can bind to the target RNA hairpin named Aptakiss in the presence of GTP. We observed shape changes of the DNA/RNA strands in the DNA origami, which are induced by the GTPswitch, into two different shapes in the absence and presence of GTP, respectively. We also found that the switching function in the nanospace could be improved by using a cover strand over the kissing loop of the GTPswitch or by deleting one base from this kissing loop. These newly designed ligand-responsive aptamers can be used for the controlled assembly of the various DNA and RNA nanostructures.

  19. Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages.

    Science.gov (United States)

    Kodaira, K; Godson, N G; Taketo, A

    1995-01-25

    The minus origins for complementary strand DNA synthesis (-ori) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, phi K, alpha 3, and St-1 closely resemble each other in DNA structure and contain two potential secondary hairpin loops (I and II) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the -ori regions of phi K and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the phi K mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several phi K and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway.

  20. Single-molecule correlated chemical probing of RNA.

    Science.gov (United States)

    Homan, Philip J; Favorov, Oleg V; Lavender, Christopher A; Kursun, Olcay; Ge, Xiyuan; Busan, Steven; Dokholyan, Nikolay V; Weeks, Kevin M

    2014-09-23

    Complex higher-order RNA structures play critical roles in all facets of gene expression; however, the through-space interaction networks that define tertiary structures and govern sampling of multiple conformations are poorly understood. Here we describe single-molecule RNA structure analysis in which multiple sites of chemical modification are identified in single RNA strands by massively parallel sequencing and then analyzed for correlated and clustered interactions. The strategy thus identifies RNA interaction groups by mutational profiling (RING-MaP) and makes possible two expansive applications. First, we identify through-space interactions, create 3D models for RNAs spanning 80-265 nucleotides, and characterize broad classes of intramolecular interactions that stabilize RNA. Second, we distinguish distinct conformations in solution ensembles and reveal previously undetected hidden states and large-scale structural reconfigurations that occur in unfolded RNAs relative to native states. RING-MaP single-molecule nucleic acid structure interrogation enables concise and facile analysis of the global architectures and multiple conformations that govern function in RNA.

  1. Sub-millimetre wave absorption spectra of artificial RNA molecules

    CERN Document Server

    Globus, T; Woolard, D; Gelmont, B

    2003-01-01

    We demonstrate submillimetre-wave Fourier transform spectroscopy as a novel technique for biological molecule characterization. Transmission measurements are reported at frequencies 10-25 cm sup - sup 1 for single- and double-stranded RNA molecules of known base-pair sequences: homopolymers poly[A], poly[U], poly[C] and poly[G], and double-stranded homopolymers poly[A]-poly[U] and poly[C]-poly[G]. Multiple resonances are observed (i.e. in the microwave through terahertz frequency regime). We also present a computational method to predict the low-frequency absorption spectra of short artificial DNA and RNA. Theoretical conformational analysis of molecules was utilized to derive the low-frequency vibrational modes. Oscillator strengths were calculated for all the vibrational modes in order to evaluate their weight in the absorption spectrum of a molecule. Normal modes and absorption spectra of the double-stranded RNA chain poly[C]-poly[G] were calculated. The absorption spectra extracted from the experiment wer...

  2. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2003-01-01

    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  3. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.

    OpenAIRE

    Barany, F; Boeke, J D

    1983-01-01

    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  4. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks.

    Science.gov (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P

    2012-09-01

    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  5. Examining small molecule: HIV RNA interactions using arrayed imaging reflectometry

    Science.gov (United States)

    Chaimayo, Wanaruk; Miller, Benjamin L.

    2014-03-01

    Human Immunodeficiency Virus (HIV) has been the subject of intense research for more than three decades as it causes an uncurable disease: Acquired Immunodeficiency Syndrome, AIDS. In the pursuit of a medical treatment, RNAtargeted small molecules are emerging as promising targets. In order to understand the binding kinetics of small molecules and HIV RNA, association (ka) and dissociation (kd) kinetic constants must be obtained, ideally for a large number of sequences to assess selectivity. We have developed Aqueous Array Imaged Reflectometry (Aq-AIR) to address this challenge. Using a simple light interference phenomenon, Aq-AIR provides real-time high-throughput multiplex capabilities to detect binding of targets to surface-immobilized probes in a label-free microarray format. The second generation of Aq-AIR consisting of high-sensitivity CCD camera and 12-μL flow cell was fabricated. The system performance was assessed by real-time detection of MBNL1-(CUG)10 and neomycin B - HIV RNA bindings. The results establish this second-generation Aq-AIR to be able to examine small molecules binding to RNA sequences specific to HIV.

  6. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol

    2013-01-01

    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  7. Escherichia coli Single-Stranded DNA-Binding Protein: NanoESI-MS Studies of Salt-Modulated Subunit Exchange and DNA Binding Transactions

    Science.gov (United States)

    Mason, Claire E.; Jergic, Slobodan; Lo, Allen T. Y.; Wang, Yao; Dixon, Nicholas E.; Beck, Jennifer L.

    2013-02-01

    Single-stranded DNA-binding proteins (SSBs) are ubiquitous oligomeric proteins that bind with very high affinity to single-stranded DNA and have a variety of essential roles in DNA metabolism. Nanoelectrospray ionization mass spectrometry (nanoESI-MS) was used to monitor subunit exchange in full-length and truncated forms of the homotetrameric SSB from Escherichia coli. Subunit exchange in the native protein was found to occur slowly over a period of hours, but was significantly more rapid in a truncated variant of SSB from which the eight C-terminal residues were deleted. This effect is proposed to result from C-terminus mediated stabilization of the SSB tetramer, in which the C-termini interact with the DNA-binding cores of adjacent subunits. NanoESI-MS was also used to examine DNA binding to the SSB tetramer. Binding of single-stranded oligonucleotides [one molecule of (dT)70, one molecule of (dT)35, or two molecules of (dT)35] was found to prevent SSB subunit exchange. Transfer of SSB tetramers between discrete oligonucleotides was also observed and is consistent with predictions from solution-phase studies, suggesting that SSB-DNA complexes can be reliably analyzed by ESI mass spectrometry.

  8. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  9. Importance and key events of prokaryotic RNA decay: the ultimate fate of an RNA molecule.

    Science.gov (United States)

    Silva, Inês Jesus; Saramago, Margarida; Dressaire, Clémentine; Domingues, Susana; Viegas, Sandra Cristina; Arraiano, Cecília Maria

    2011-01-01

    RNAs are important effectors in the process of gene expression. In bacteria, constant adaptation to environmental demands is accompanied by a continual adjustment of transcripts' levels. The cellular concentration of a given RNA is the result of the balance between its synthesis and degradation. RNA degradation is a complex process encompassing multiple pathways. Ribonucleases (RNases) are the enzymes that directly process and degrade the transcripts, regulating their amounts. They are also important in quality control of RNAs by detecting and destroying defective molecules. The rate at which RNA decay occurs depends on the availability of ribonucleases and their specificities according to the sequence and/or the structural elements of the RNA molecule. Ribosome loading and the 5'-phosphorylation status can also modulate the stability of transcripts. The wide diversity of RNases present in different microorganisms is another factor that conditions the pathways and mechanisms of RNA degradation. RNases are themselves carefully regulated by distinct mechanisms. Several other factors modulate RNA degradation, namely polyadenylation, which plays a multifunctional role in RNA metabolism. Additionally, small non-coding RNAs are crucial regulators of gene expression, and can directly modulate the stability of their mRNA targets. In many cases this regulation is dependent on Hfq, an RNA binding protein which can act in concert with polyadenylation enzymes and is often necessary for the activity of sRNAs. All of the above-mentioned aspects are discussed in the present review, which also highlights the principal differences between the RNA degradation pathways for the two main Gram-negative and Gram-positive bacterial models. Copyright © 2011 John Wiley & Sons, Ltd.

  10. RNA structure probing : biochemical structure analysis of autoimmune-related RNA molecules

    NARCIS (Netherlands)

    Teunissen, A.W.M.

    1999-01-01

    Next to the well known messenger, ribosomal and transfer RNAs, a large number of small structural RNA molecules exist. These RNAs are bound to proteins, forming ribonucleoprotein particles (RNPs). RNPs are often targets for autoantibodies occurring in an autoimmune disease.Chapter 1 introduces

  11. Secondary structure of 5S RNA: NMR experiments on RNA molecules partially labeled with Nitrogen-15

    International Nuclear Information System (INIS)

    Gewirth, D.T.; Abo, S.R.; Leontis, N.B.; Moore, P.B.

    1987-01-01

    A method has been found for reassembling fragment 1 of Escherichia coli 5S RNA from mixtures containing strand III (bases 69-87) and the complex consisting of strand II (bases 89-120) and strand IV (bases 1-11). The reassembled molecule is identical with unreconstituted fragment 1. With this technique, fragment 1 molecules have been constructed 15 N-labeled either in strand III or in the strand II-strand IV complex. Spectroscopic data obtained with these partially labeled molecules show that the terminal helix of 5S RNA includes the GU and GC base pairs at positions 9 and 10 which the standard model for 5S secondary structure predicts but that these base pairs are unstable both in the fragment and in native 5S RNA. The data also assign three resonances to the helix V region of the molecule (bases 70-77 and 99-106). None of these resonances has a normal chemical shift even though two of them correspond to AU or GU base pairs in the standard model. The implications of these findings for the authors understanding of the structure of 5S RNA and its complex with ribosomal protein L25 are discussed

  12. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail: meicun2006@163.com; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

    2016-12-01

    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  13. Selective small-molecule inhibition of an RNA structural element

    Energy Technology Data Exchange (ETDEWEB)

    Howe, John A.; Wang, Hao; Fischmann, Thierry O.; Balibar, Carl J.; Xiao, Li; Galgoci, Andrew M.; Malinverni, Juliana C.; Mayhood, Todd; Villafania, Artjohn; Nahvi, Ali; Murgolo, Nicholas; Barbieri, Christopher M.; Mann, Paul A.; Carr, Donna; Xia, Ellen; Zuck, Paul; Riley, Dan; Painter, Ronald E.; Walker, Scott S.; Sherborne, Brad; de Jesus, Reynalda; Pan, Weidong; Plotkin, Michael A.; Wu, Jin; Rindgen, Diane; Cummings, John; Garlisi, Charles G.; Zhang, Rumin; Sheth, Payal R.; Gill, Charles J.; Tang, Haifeng; Roemer , Terry (Merck)

    2015-09-30

    Riboswitches are non-coding RNA structures located in messenger RNAs that bind endogenous ligands, such as a specific metabolite or ion, to regulate gene expression. As such, riboswitches serve as a novel, yet largely unexploited, class of emerging drug targets. Demonstrating this potential, however, has proven difficult and is restricted to structurally similar antimetabolites and semi-synthetic analogues of their cognate ligand, thus greatly restricting the chemical space and selectivity sought for such inhibitors. Here we report the discovery and characterization of ribocil, a highly selective chemical modulator of bacterial riboflavin riboswitches, which was identified in a phenotypic screen and acts as a structurally distinct synthetic mimic of the natural ligand, flavin mononucleotide, to repress riboswitch-mediated ribB gene expression and inhibit bacterial cell growth. Our findings indicate that non-coding RNA structural elements may be more broadly targeted by synthetic small molecules than previously expected.

  14. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  15. Phenotypic effect of mutations in evolving populations of RNA molecules

    Directory of Open Access Journals (Sweden)

    Manrubia Susanna C

    2010-02-01

    Full Text Available Abstract Background The secondary structure of folded RNA sequences is a good model to map phenotype onto genotype, as represented by the RNA sequence. Computational studies of the evolution of ensembles of RNA molecules towards target secondary structures yield valuable clues to the mechanisms behind adaptation of complex populations. The relationship between the space of sequences and structures, the organization of RNA ensembles at mutation-selection equilibrium, the time of adaptation as a function of the population parameters, the presence of collective effects in quasispecies, or the optimal mutation rates to promote adaptation all are issues that can be explored within this framework. Results We investigate the effect of microscopic mutations on the phenotype of RNA molecules during their in silico evolution and adaptation. We calculate the distribution of the effects of mutations on fitness, the relative fractions of beneficial and deleterious mutations and the corresponding selection coefficients for populations evolving under different mutation rates. Three different situations are explored: the mutation-selection equilibrium (optimized population in three different fitness landscapes, the dynamics during adaptation towards a goal structure (adapting population, and the behavior under periodic population bottlenecks (perturbed population. Conclusions The ratio between the number of beneficial and deleterious mutations experienced by a population of RNA sequences increases with the value of the mutation rate μ at which evolution proceeds. In contrast, the selective value of mutations remains almost constant, independent of μ, indicating that adaptation occurs through an increase in the amount of beneficial mutations, with little variations in the average effect they have on fitness. Statistical analyses of the distribution of fitness effects reveal that small effects, either beneficial or deleterious, are well described by a Pareto

  16. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi

    1990-01-01

    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  17. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  18. Complex shapes self-assembled from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng

    2012-05-30

    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  19. Designing Efficient Double RNA trans-Splicing Molecules for Targeted RNA Repair

    Science.gov (United States)

    Hüttner, Clemens; Murauer, Eva M.; Hainzl, Stefan; Kocher, Thomas; Neumayer, Anna; Reichelt, Julia; Bauer, Johann W.; Koller, Ulrich

    2016-01-01

    RNA trans-splicing is a promising tool for mRNA modification in a diversity of genetic disorders. In particular, the substitution of internal exons of a gene by combining 3′ and 5′ RNA trans-splicing seems to be an elegant way to modify especially large pre-mRNAs. Here we discuss a robust method for designing double RNA trans-splicing molecules (dRTM). We demonstrate how the technique can be implemented in an endogenous setting, using COL7A1, the gene encoding type VII collagen, as a target. An RTM screening system was developed with the aim of testing the replacement of two internal COL7A1 exons, harbouring a homozygous mutation, with the wild-type version. The most efficient RTMs from a pool of randomly generated variants were selected via our fluorescence-based screening system and adapted for use in an in vitro disease model system. Transduction of type VII collagen-deficient keratinocytes with the selected dRTM led to accurate replacement of two internal COL7A1 exons resulting in a restored wild-type RNA sequence. This is the first study demonstrating specific exon replacement by double RNA trans-splicing within an endogenous transcript in cultured cells, corroborating the utility of this technology for mRNA repair in a variety of genetic disorders. PMID:27669223

  20. Did the Pre-RNA World Rest Upon DNA Molecules?

    Science.gov (United States)

    Lazcano, Antonio; Dworkin, Jason P.; Miller, Stanley L.

    2004-01-01

    The isolation of a DNA sequence that catalyzes the ligation of oligodeoxynucleotides via the formation of 3' - 5' phosphodiester linkage significance in selection experiments has been reported. Ball recently used this to discuss the possibility that natural DNA molecules may have formed in the primitive Earth leading to the origin of life. As noted by Ferris and Usher, if metabolic pathways evolved backwards, it could be argued that the biosynthesis of 2-deoxyribose from ribose suggests that RNA came from DNA. As summarized elsewhere, there are several properties of deoxyribose which could be interpreted to support the possibility that DNA-like molecules arose prior to the RNA world. For example, 2-deoxyribose is slightly more soluble than ribose (which may have been an advantage in a drying pool scenario), may have been more reactive under possible prebiotic conditions (it forms a nucleoside approx. 150 times faster than ribose with the alternative base urazole at 25 C), while it decomposes in solution (approximately 2.6 times more slowly than ribose at 100 C). Other advantages of DNA over RNA are that it has one fewer chiral center, has a greater stability at the 8.2 pH value of the current oceans, and does not has the 2'5' and 3'5' ambiguity in polymerizations. Yet, there is strong molecular biological and biochemical evidence that RNA was featured in the biology well before the last common ancestor. The presence of sugar acids, including both ribo- and deoxysugar acids, in the 4.6 Ga old Murchison meteorite suggest that both may have been available in the primitive Earth, derived from the accretion of extraterrestrial sources and/or from endogenous processes involving formaldehyde and its derivatives. However, the abiotic synthesis of deoxyribose, ribose, and other sugars from glyceraldehyde and acetaldehyde under alkaline conditions is inefficient and unespecific. Although sugars are labile compounds, the role of cyanamide or borate minerals in the

  1. MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing

    DEFF Research Database (Denmark)

    Nielsen, M; Hansen, J H; Hedegaard, J

    2010-01-01

    MicroRNAs (miRNA) are short single-stranded RNA molecules that regulate gene expression post-transcriptionally by binding to complementary sequences in the 3' untranslated region (3' UTR) of target mRNAs. MiRNAs participate in the regulation of myogenesis, and identification of the complete set o...... that highly expressed miRNAs are involved in skeletal muscle development and regeneration, signal transduction, cell-cell and cell-extracellular matrix communication and neural development and function....

  2. RNA secondary structure diagrams for very large molecules: RNAfdl.

    Science.gov (United States)

    Hecker, Nikolai; Wiegels, Tim; Torda, Andrew E

    2013-11-15

    There are many programs that can read the secondary structure of an RNA molecule and draw a diagram, but hardly any that can cope with 10(3) bases. RNAfdl is slow but capable of producing intersection-free diagrams for ribosome-sized structures, has a graphical user interface for adjustments and produces output in common formats. Source code is available under the GNU General Public License v3.0 at http://sourceforge.net/projects/rnafdl for Linux and similar systems or Windows using MinGW. RNAfdl is implemented in C, uses the Cairo 2D graphics library and offers both command line and graphical user interfaces. hecker@rth.dk

  3. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.

    1979-10-01

    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  4. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der

    1988-01-01

    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  5. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.

    2002-01-01

    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit...

  6. Ion assisted structural collapse of a single stranded DNA: A molecular dynamics approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Soumadwip; Dixit, Himanshu; Chakrabarti, Rajarshi, E-mail: rajarshi@chem.iitb.ac.in

    2015-09-28

    Highlights: • The dynamics of a single-stranded DNA in presence of different concentrations of Mg{sup 2+} is investigated. • The initial DNA chain collapse is characterized by the formation of non-sequentially stacked base pairs. • The DNA chain re-swells at high concentrations of Mg{sup 2+} as a consequence of overcharging. - Abstract: The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counterions. It is well known that the structural collapse of DNA is favoured in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl{sub 2}) single stranded DNA with base sequence 5′-CGCGAATTCGCG-3′ (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  7. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2001-01-01

    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  8. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP

    1996-01-01

    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  9. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  10. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.

    1983-01-01

    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  11. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B

    2006-01-01

    by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  12. Experimental Confirmation of a Whole Set of tRNA Molecules in Two Archaeal Species

    Directory of Open Access Journals (Sweden)

    Yoh-ichi Watanabe

    2015-01-01

    Full Text Available Based on the genomic sequences for most archaeal species, only one tRNA gene (isodecoder is predicted for each triplet codon. This observation promotes analysis of a whole set of tRNA molecules and actual splicing patterns of interrupted tRNA in one organism. The entire genomic sequences of two Creanarchaeota, Aeropyrum pernix and Sulfolobus tokodaii, were determined approximately 15 years ago. In these genome datasets, 47 and 46 tRNA genes were detected, respectively. Among them, 14 and 24 genes, respectively, were predicted to be interrupted tRNA genes. To confirm the actual transcription of these predicted tRNA genes and identify the actual splicing patterns of the predicted interrupted tRNA molecules, RNA samples were prepared from each archaeal species and used to synthesize cDNA molecules with tRNA sequence-specific primers. Comparison of the nucleotide sequences of cDNA clones representing unspliced and spliced forms of interrupted tRNA molecules indicated that some introns were located at positions other than one base 3' from anticodon region and that bulge-helix-bulge structures were detected around the actual splicing sites in each interrupted tRNA molecule. Whole-set analyses of tRNA molecules revealed that the archaeal tRNA splicing mechanism may be essential for efficient splicing of all tRNAs produced from interrupted tRNA genes in these archaea.

  13. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud

    2012-06-01

    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  14. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)

    2015-04-22

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  15. Methods to enable the design of bioactive small molecules targeting RNA.

    Science.gov (United States)

    Disney, Matthew D; Yildirim, Ilyas; Childs-Disney, Jessica L

    2014-02-21

    RNA is an immensely important target for small molecule therapeutics or chemical probes of function. However, methods that identify, annotate, and optimize RNA-small molecule interactions that could enable the design of compounds that modulate RNA function are in their infancies. This review describes recent approaches that have been developed to understand and optimize RNA motif-small molecule interactions, including structure-activity relationships through sequencing (StARTS), quantitative structure-activity relationships (QSAR), chemical similarity searching, structure-based design and docking, and molecular dynamics (MD) simulations. Case studies described include the design of small molecules targeting RNA expansions, the bacterial A-site, viral RNAs, and telomerase RNA. These approaches can be combined to afford a synergistic method to exploit the myriad of RNA targets in the transcriptome.

  16. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.

    1985-01-01

    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  17. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    Science.gov (United States)

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  18. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.

    1982-01-01

    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  19. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification

    OpenAIRE

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-01-01

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen...

  20. In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides

    International Nuclear Information System (INIS)

    Oppenheim, Amos B.; Rattray, Alison J.; Bubunenko, Mikhail; Thomason, Lynn C.; Court, Donald L.

    2004-01-01

    We demonstrate that the bacteriophage λ Red functions efficiently recombine linear DNA or single-strand oligonucleotides (ss-oligos) into bacteriophage λ to create specific changes in the viral genome. Point mutations, deletions, and gene replacements have been created. While recombineering with oligonucleotides, we encountered other mutations accompanying the desired point mutational change. DNA sequence analysis suggests that these unwanted mutations are mainly frameshift deletions introduced during oligonucleotide synthesis

  1. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis.

    Science.gov (United States)

    Olszewski, Marcin; Mickiewicz, Małgorzata; Kur, Józef

    2008-07-01

    The thermophilic bacterium Thermoanaerobacter tengcongensis has two single-stranded DNA-binding (SSB) proteins, designated TteSSB2 and TteSSB3. In a SSB complementation assay in Escherichia coli, only TteSSB3 took over the in vivo function of EcoSSB. We have cloned the ssb genes obtained by PCR and have developed E. coli overexpression systems. The TteSSB2 and TteSSB3 consist of 153 and 150 amino acids with a calculated molecular mass of 17.29 and 16.96 kDa, respectively. They are the smallest known bacterial SSB proteins. The homology between amino acid sequences of these proteins is 40% identity and 53% similarity. They are functional as homotetramers, with each monomer encoding one single-stranded DNA binding domain (OB-fold). In fluorescence titrations with poly(dT), both proteins bind single-stranded DNA with a binding site size of about 40 nt per homotetramer. Thermostability with half-life of about 30 s at 95 degrees C makes TteSSB3 similar to the known SSB of Thermus aquaticus (TaqSSB). The TteSSB2 was fully active even after 6 h incubation at 100 degrees C. Here, we show for the first time paralogous thermostable homotetrameric SSBs, which could be an attractive alternative for known homodimeric thermostable SSB proteins in their applications for molecular biology methods and analytical purposes.

  2. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana.

    Science.gov (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L

    2005-04-01

    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  3. Intercalation of single-strand oligonucleotides between nucleolipid anionic membranes: a neutron diffraction study.

    Science.gov (United States)

    Milani, Silvia; Berti, Debora; Dante, Silvia; Hauss, Thomas; Baglioni, Piero

    2009-04-07

    This contribution presents a neutron diffraction investigation of anionic lamellar phases composed of mixtures of 1-palmitoyl, 2-oleoyl phosphatidyl-nucleosides (POPN, where N is either adenosine or uridine), and POPC (1-palmitoyl,2-oleoyl-phosphatidyl-choline). Their behavior is studied for two different mole ratios and in the presence of nucleic acids. The samples are formed by the evaporation of liposomal dispersions prepared in water or in solutions containing single-strand oligonucleotides. Previous small angle X-ray scattering (SAXS) experiments on the system POPA/polyU (polyuridylic acid, high degree of polymerization, synthetic ribonucleic acid) proved that the insertion and ordering of the biopolymer in the phospholipid lamellae were driven by molecular recognition. In the present study, we extend the previous investigation to single-strand monodisperse oligonucleotides (50-mers). Structural details of the membranes were obtained from the analysis of the neutron diffraction scattering length density profiles. The evidence of direct and specific interactions, driven by molecular recognition between the nucleic polar heads of the nucleolipid and the single-strand nucleic acid, is strengthened by the comparison with identically charged bilayers formed by POPG/POPC. These results contribute to the understanding of the parameters governing the interactions between nucleolipid membranes and oligonucleotides, providing a novel strategy for the design of lipid-based vehicles for nucleic acids.

  4. Stretching and controlled motion of single-stranded DNA in locally heated solid-state nanopores.

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B; Aksimentiev, Aleksei

    2013-08-27

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4-8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA.

  5. Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library.

    Directory of Open Access Journals (Sweden)

    Sumate Pengpumkiat

    Full Text Available Chemical synthesis of oligonucleotides is a widely used tool in the field of biochemistry. Several methods for gene synthesis have been introduced in the growing area of genomics. In this paper, a novel method of constructing dsDNA is proposed. Short (28-mer oligo fragments from a library were assembled through successive annealing and ligation processes, followed by PCR. First, two oligo fragments annealed to form a dsDNA molecule. The double-stranded oligo was immobilized onto magnetic beads (solid support via streptavidin-biotin binding. Next, single-stranded oligo fragments were added successively through ligation to form the complete DNA molecule. The synthesized DNA was amplified through PCR and gel electrophoresis was used to characterize the product. Sanger sequencing showed that more than 97% of the nucleotides matched the expected sequence. Extending the length of the DNA molecule by adding single-stranded oligonucleotides from a basis set (library via ligation enables a more convenient and rapid mechanism for the design and synthesis of oligonucleotides on the go. Coupled with an automated dispensing system and libraries of short oligo fragments, this novel DNA synthesis method would offer an efficient and cost-effective method for producing dsDNA.

  6. Repair of ultraviolet light damage in Saccharomyces cerevisiae as studied with double- and single-stranded incoming DNAs

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, D.; Hieda, K.

    1992-01-01

    Purified double- and single-stranded DNAs of the autonomously replicating vector M13RK9-T were irradiated with ultraviolet light (UV) in vitro and introduced into competent whole cells of Saccharomyces cerevisiae. Incoming double-stranded DNA was more sensitive to UV in excision repair-deficient rad2-1 cells than in proficient repair RAD + cells, while single-stranded DNA exhibited high sensitivity in both host cells. The results indicate that in yeast there is no effective rescue of UV-incoming single-stranded DNA by excision repair or other constitutive dark repair processes

  7. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks.

    Science.gov (United States)

    Pachkowski, Brian; Nakamura, Jun

    2013-01-01

    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  8. Telomeric noncoding RNA TERRA is induced by telomere shortening to nucleate telomerase molecules at short telomeres.

    Science.gov (United States)

    Cusanelli, Emilio; Romero, Carmina Angelica Perez; Chartrand, Pascal

    2013-09-26

    Elongation of a short telomere depends on the action of multiple telomerase molecules, which are visible as telomerase RNA foci or clusters associated with telomeres in yeast and mammalian cells. How several telomerase molecules act on a single short telomere is unknown. Herein, we report that the telomeric noncoding RNA TERRA is involved in the nucleation of telomerase molecules into clusters prior to their recruitment at a short telomere. We find that telomere shortening induces TERRA expression, leading to the accumulation of TERRA molecules into a nuclear focus. Simultaneous time-lapse imaging of telomerase RNA and TERRA reveals spontaneous events of telomerase nucleation on TERRA foci in early S phase, generating TERRA-telomerase clusters. This cluster is subsequently recruited to the short telomere from which TERRA transcripts originate during S phase. We propose that telomere shortening induces noncoding RNA expression to coordinate the recruitment and activity of telomerase molecules at short telomeres. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Simultaneous detection of mRNA and protein in single cells using immunofluorescence-combined single-molecule RNA FISH.

    Science.gov (United States)

    Kochan, Jakub; Wawro, Mateusz; Kasza, Aneta

    2015-10-01

    Although the concept of combining immunofluorescence (IF) with single-molecule RNA fluorescence in situ hybridization (smRNA FISH) seems obvious, the specific materials used during IF and smRNA FISH make it difficult to perform these procedures simultaneously on the same specimen. Even though there are reports where IF and smRNA FISH were combined with success, these were insufficient in terms of signal intensities, staining patterns, and GFP-compatibility, and a detailed exploration of the various factors that influence IF and smRNA FISH outcome has not been published yet. Here, we report a detailed study of conditions and reagents used in classic IF and smRNA FISH that allowed us to establish an easy, robust, and GFP-compatible procedure. Our protocol enables simultaneous detection of mRNA and protein quantity as well as the subcellular distribution of these molecules in single cells by combining an RNase-free modification of the IF technique and the more recent smRNA FISH method. Using this procedure, we have shown the direct interaction of RNase MCPIP1 with IL-6 mRNA. We also demonstrate the use of our protocol in heterogeneous cell population analysis, revealing cell-to-cell differences in mRNA and protein content.

  10. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.

    1980-01-01

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  11. A Capture-SELEX Strategy for Multiplexed Selection of RNA Aptamers Against Small Molecules

    DEFF Research Database (Denmark)

    Lauridsen, Lasse Holm; Doessing, Holger B.; Long, Katherine S.

    2018-01-01

    In vitro selection of aptamers that recognize small organic molecules has proven difficult, in part due to the challenge of immobilizing small molecules on solid supports for SELEX (Systematic Evolution of Ligands by Exponential Enrichment). This study describes the implementation of RNA Capture......-SELEX, a selection strategy that uses an RNA library to yield ligand-responsive RNA aptamers targeting small organic molecules in solution. To demonstrate the power of this method we selected several aptamers with specificity towards either the natural sweetener rebaudioside A or the food-coloring agent carminic...

  12. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  13. Computer-Aided Design of RNA Origami Structures.

    Science.gov (United States)

    Sparvath, Steffen L; Geary, Cody W; Andersen, Ebbe S

    2017-01-01

    RNA nanostructures can be used as scaffolds to organize, combine, and control molecular functionalities, with great potential for applications in nanomedicine and synthetic biology. The single-stranded RNA origami method allows RNA nanostructures to be folded as they are transcribed by the RNA polymerase. RNA origami structures provide a stable framework that can be decorated with functional RNA elements such as riboswitches, ribozymes, interaction sites, and aptamers for binding small molecules or protein targets. The rich library of RNA structural and functional elements combined with the possibility to attach proteins through aptamer-based binding creates virtually limitless possibilities for constructing advanced RNA-based nanodevices.In this chapter we provide a detailed protocol for the single-stranded RNA origami design method using a simple 2-helix tall structure as an example. The first step involves 3D modeling of a double-crossover between two RNA double helices, followed by decoration with tertiary motifs. The second step deals with the construction of a 2D blueprint describing the secondary structure and sequence constraints that serves as the input for computer programs. In the third step, computer programs are used to design RNA sequences that are compatible with the structure, and the resulting outputs are evaluated and converted into DNA sequences to order.

  14. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela

    2015-01-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  15. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted

    2014-01-01

    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  16. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams

    2014-01-01

    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  17. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia

    2009-01-01

    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  18. Single-Molecule Analysis of Pre-mRNA Splicing with Colocalization Single-Molecule Spectroscopy (CoSMoS).

    Science.gov (United States)

    Braun, Joerg E; Serebrov, Victor

    2017-01-01

    Recent development of single-molecule techniques to study pre-mRNA splicing has provided insights into the dynamic nature of the spliceosome. Colocalization single-molecule spectroscopy (CoSMoS) allows following spliceosome assembly in real time at single-molecule resolution in the full complexity of cellular extracts. A detailed protocol of CoSMoS has been published previously (Anderson and Hoskins, Methods Mol Biol 1126:217-241, 2014). Here, we provide an update on the technical advances since the first CoSMoS studies including slide surface treatment, data processing, and representation. We describe various labeling strategies to generate RNA reporters with multiple dyes (or other moieties) at specific locations.

  19. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng

    2015-05-08

    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  20. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    Science.gov (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora.

    Science.gov (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E

    2003-08-01

    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  2. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification.

    Science.gov (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-10-07

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  3. Capture, unfolding, and detection of individual tRNA molecules using a nanopore device

    Directory of Open Access Journals (Sweden)

    Andrew M Smith

    2015-06-01

    Full Text Available Transfer RNAs (tRNA are the most common RNA molecules in cells and have critical roles as both translators of the genetic code and regulators of protein synthesis. As such, numerous methods have focused on studying tRNA abundance and regulation, with the most widely used methods being RNA-seq and microarrays. Though revolutionary to transcriptomics, these assays are limited by an inability to encode tRNA modifications in the requisite cDNA. These modifications are abundant in tRNA and critical to their function. Here we describe proof-of-concept experiments where individual tRNA molecules are examined as linear strands using a biological nanopore. This method utilizes an enzymatically ligated synthetic DNA adapter to concentrate tRNA at the lipid bilayer of the nanopore device and efficiently denature individual tRNA molecules as they are pulled through the α-hemolysin (α-HL nanopore. Additionally, the DNA adapter provides a loading site for ϕ29 DNA polymerase (ϕ29 DNAP, which acts as a brake on the translocating tRNA. This increases the dwell time of adapted tRNA in the nanopore, allowing us to identify the region of the nanopore signal that is produced by the translocating tRNA itself. Using adapter-modified E. coli tRNAfMet and tRNALys, we show that the nanopore signal during controlled translocation is dependent on the identity of the tRNA. This confirms that adapter-modified tRNA can translocate end-to-end through nanopores and provides the foundation for future work in direct sequencing of individual transfer RNA with a nanopore-based device.

  4. Capture, Unfolding, and Detection of Individual tRNA Molecules Using a Nanopore Device

    Science.gov (United States)

    Smith, Andrew M.; Abu-Shumays, Robin; Akeson, Mark; Bernick, David L.

    2015-01-01

    Transfer RNAs (tRNA) are the most common RNA molecules in cells and have critical roles as both translators of the genetic code and regulators of protein synthesis. As such, numerous methods have focused on studying tRNA abundance and regulation, with the most widely used methods being RNA-seq and microarrays. Though revolutionary to transcriptomics, these assays are limited by an inability to encode tRNA modifications in the requisite cDNA. These modifications are abundant in tRNA and critical to their function. Here, we describe proof-of-concept experiments where individual tRNA molecules are examined as linear strands using a biological nanopore. This method utilizes an enzymatically ligated synthetic DNA adapter to concentrate tRNA at the lipid bilayer of the nanopore device and efficiently denature individual tRNA molecules, as they are pulled through the α-hemolysin (α-HL) nanopore. Additionally, the DNA adapter provides a loading site for ϕ29 DNA polymerase (ϕ29 DNAP), which acts as a brake on the translocating tRNA. This increases the dwell time of adapted tRNA in the nanopore, allowing us to identify the region of the nanopore signal that is produced by the translocating tRNA itself. Using adapter-modified Escherichia coli tRNAfMet and tRNALys, we show that the nanopore signal during controlled translocation is dependent on the identity of the tRNA. This confirms that adapter-modified tRNA can translocate end-to-end through nanopores and provide the foundation for future work in direct sequencing of individual transfer RNA with a nanopore-based device. PMID:26157798

  5. Covalent stabilization of a small molecule-RNA complex.

    Science.gov (United States)

    Peacock, Hayden; Bachu, Radhika; Beal, Peter A

    2011-09-01

    We demonstrate covalent bond formation between an RNA aptamer containing a cysteamine-tethered nucleobase and helix-threading peptides (HTPs) containing α-bromoacetamide N-termini. The reaction is high yielding and inhibited by a DNA strand Watson-Crick complementary to the aptamer sequence indicating covalent reaction is dependent on the high affinity HTP-binding site present in the folded aptamer. These results are important for future structural studies of HTP-RNA complexes and methods for the discovery of new high affinity analogs via covalent tethering strategies. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast.

    Science.gov (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A

    2010-08-05

    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  7. Intrinsic Properties of tRNA Molecules as Deciphered via Bayesian Network and Distribution Divergence Analysis

    Directory of Open Access Journals (Sweden)

    Sergio Branciamore

    2018-02-01

    Full Text Available The identity/recognition of tRNAs, in the context of aminoacyl tRNA synthetases (and other molecules, is a complex phenomenon that has major implications ranging from the origins and evolution of translation machinery and genetic code to the evolution and speciation of tRNAs themselves to human mitochondrial diseases to artificial genetic code engineering. Deciphering it via laboratory experiments, however, is difficult and necessarily time- and resource-consuming. In this study, we propose a mathematically rigorous two-pronged in silico approach to identifying and classifying tRNA positions important for tRNA identity/recognition, rooted in machine learning and information-theoretic methodology. We apply Bayesian Network modeling to elucidate the structure of intra-tRNA-molecule relationships, and distribution divergence analysis to identify meaningful inter-molecule differences between various tRNA subclasses. We illustrate the complementary application of these two approaches using tRNA examples across the three domains of life, and identify and discuss important (informative positions therein. In summary, we deliver to the tRNA research community a novel, comprehensive methodology for identifying the specific elements of interest in various tRNA molecules, which can be followed up by the corresponding experimental work and/or high-resolution position-specific statistical analyses.

  8. RNA targeting by small molecules: Binding of protoberberine ...

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... diseases particularly in viral infections like HIV, AIDS and hepatitis C has led to growing interest in RNA as a potential target for therapeutic intervention (Gallego and Varani 2001;. Foloppe et al. 2006; Liu et al. 2008; Fulle and Gohlke 2010). Furthermore, the recent discovery of a number of micro-.

  9. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold.

    Science.gov (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G

    2005-05-24

    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  10. Empirical model for matching spectrophotometric reflectance of yarn windings and multispectral imaging reflectance of single strands of yarns.

    Science.gov (United States)

    Luo, Lin; Shen, Hui-Liang; Shao, Si-Jie; Xin, John

    2015-08-01

    The state-of-the-art multispectral imaging system can directly acquire the reflectance of a single strand of yarn that is impossible for traditional spectrophotometers. Instead, the spectrophotometric reflectance of a yarn winding, which is constituted by yarns wound on a background card, is regarded as the yarn reflectance in textile. While multispectral imaging systems and spectrophotometers can be separately used to acquire the reflectance of a single strand of yarn and corresponding yarn winding, the quantitative relationship between them is not yet known. In this paper, the relationship is established based on models that describe the spectral response of a spectrophotometer to a yarn winding and that of a multispectral imaging system to a single strand of yarn. The reflectance matching function from a single strand of yarn to corresponding yarn winding is derived to be a second degree polynomial function, which coefficients are the solutions of a constrained nonlinear optimization problem. Experiments on 100 pairs of samples show that the proposed approach can reduce the color difference between yarn windings and single strands of yarns from 2.449 to 1.082 CIEDE2000 units. The coefficients of the optimal reflection matching function imply that the reflectance of a yarn winding measured by a spectrophotometer consists of not only the intrinsic reflectance of yarn but also the nonignorable interreflection component between yarns.

  11. Physics of Complex Polymeric Molecules

    Science.gov (United States)

    Kelly, Joshua Walter

    The statistical physics of complex polymers with branches and circuits is the topic of this dissertation. An important motivation are large, single-stranded (ss) RNA molecules. Such molecules form complex ``secondary" and ``tertiary" structures that can be represented as branched polymers with circuits. Such structures are in part directly determined by the nucleotide sequence and in part subject to thermal fluctuations. The polymer physics literature on molecules in this class has mostly focused on randomly branched polymers without circuits while there has been minimal research on polymers with specific structures and on polymers that contain circuits. The dissertation is composed of three parts: Part I studies branched polymers with thermally fluctuating structure confined to a potential well as a simple model for the encapsidation of viral RNA. Excluded volume interactions were ignored. In Part II, I apply Flory theory to the study of the encapsidation of viral ss RNA molecules with specific branched structures, but without circuits, in the presence of excluded volume interaction. In Part III, I expand on Part II and consider complex polymers with specific structure including both branching and circuits. I introduce a method based on the mathematics of Laplacian matrices that allows me to calculate density profiles for such molecules, which was not possible within Flory theory.

  12. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan

    2015-01-01

    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  13. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik

    1992-04-01

    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  14. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.

    1987-01-01

    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  15. Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Gust, I.D.; Feinstone, S.M.; Purcell, R.H.; Alter, H.J.

    1980-01-01

    A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

  16. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata).

    Science.gov (United States)

    Jackson, Elliot W; Bistolas, Kalia S I; Button, Jason B; Hewson, Ian

    2016-01-01

    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates.

  17. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.

    1980-01-01

    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  18. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux

    2016-12-01

    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  19. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  20. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA.

    Science.gov (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee

    2011-03-24

    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  1. Small Interfering RNA Efficiently Suppresses Adhesion Molecule Expression on Pulmonary Microvascular Endothelium

    Directory of Open Access Journals (Sweden)

    Tobias Walker

    2011-01-01

    Full Text Available Background. Adhesion molecules are known to influence postoperative organ function, they are hardly involved in the inflammatory response following the ischemia-reperfusion injury. We sought to investigate the potency of small interfering RNAs to suppress adhesion molecule expression in human pulmonary microvascular endothelial cells. Methods. Human lung microvascular endothelial cells were transfected with specific siRNA followed by a stimulation of the cells with an inflammatory cytokine. Adhesion molecule expression was determined by FACS-analysis, and reduction of intracellular mRNA was determined by qRT-PCR. Furthermore, the attachment of isolated neutrophils on the endothelial layer was determined after siRNA transfection. Results. In summary, siRNA transfection significantly decreased the percentage positive cells in a single cocktail transfection of each adhesion molecule investigated. Adhering neutrophils were diminished as well. Conclusion. siRNA might be a promising tool for the effective suppression of adhesion molecule expression on pulmonary microvascular cells, potentially minimizing leukocyte-endothelial depending interactions of a pulmonary allograft.

  2. Assessing single-stranded oligonucleotide drug-induced effects in vitro reveals key risk factors for thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Sabine Sewing

    Full Text Available Single-stranded oligonucleotides (ON comprise a promising therapeutic platform that enables selective modulation of currently undruggable targets. The development of novel ON drug candidates has demonstrated excellent efficacy, but in certain cases also some safety liabilities were reported. Among them are events of thrombocytopenia, which have recently been evident in late stage trials with ON drugs. The underlying mechanisms are poorly understood and the risk for ON candidates causing such events cannot be sufficiently assessed pre-clinically. We investigated potential thrombocytopenia risk factors of ONs and implemented a set of in vitro assays to assess these risks. Our findings support previous observations that phosphorothioate (PS-ONs can bind to platelet proteins such as platelet collagen receptor glycoprotein VI (GPVI and activate human platelets in vitro to various extents. We also show that these PS-ONs can bind to platelet factor 4 (PF4. Binding to platelet proteins and subsequent activation correlates with ON length and connected to this, the number of PS in the backbone of the molecule. Moreover, we demonstrate that locked nucleic acid (LNA ribosyl modifications in the wings of the PS-ONs strongly suppress binding to GPVI and PF4, paralleled by markedly reduced platelet activation. In addition, we provide evidence that PS-ONs do not directly affect hematopoietic cell differentiation in culture but at higher concentrations show a pro-inflammatory potential, which might contribute to platelet activation. Overall, our data confirm that certain molecular attributes of ONs are associated with a higher risk for thrombocytopenia. We propose that applying the in vitro assays discussed here during the lead optimization phase may aid in deprioritizing ONs with a potential to induce thrombocytopenia.

  3. Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1

    DEFF Research Database (Denmark)

    Yang, Jay; Bachrati, Csanad Z; Ou, Jiongwen

    2010-01-01

    -passage mechanism. We generated single-stranded catenanes that resemble the proposed dissolution intermediate recognized by human topoisomerase IIIalpha. We demonstrate that human topoisomerase IIIalpha is a single-stranded DNA decatenase that is specifically stimulated by the BLM-RMI1 pair. In addition, RMI1......Human topoisomerase IIIalpha is a type IA DNA topoisomerase that functions with BLM and RMI1 to resolve DNA replication and recombination intermediates. BLM, human topoisomerase IIIalpha, and RMI1 catalyze the dissolution of double Holliday junctions into noncrossover products via a strand...

  4. Enhanced NMR signal detection of imino protons in RNA molecules containing 3' dangling nucleotides

    International Nuclear Information System (INIS)

    Amborski, Andrew N.; Johnson, Philip E.

    2008-01-01

    We present a method for improving the quality of nuclear magnetic resonance (NMR) spectra involving exchangeable protons near the base of the stem of RNA hairpin molecules. NMR spectra of five different RNA hairpins were compared. These hairpins consisted of a native RNA structure and four molecules each having different unpaired, or dangling, nucleotides at the 3' end. NMR experiments were acquired in water for each construct and the quality of the imino proton spectral regions were examined. The imino resonances near the base of the stem of the wild type RNA structure were not observed due to breathing motions. However, a significant increase in spectral quality for molecules with dangling 3' adenosine or guanosine nucleotides was observed, with imino protons detected in these constructs that were not observed in the wild type construct. A modest improvement in spectral quality was seen for the construct with a 3' unpaired uridine, whereas no significant improvement was observed for a 3' unpaired cytidine. This improvement in NMR spectral quality mirrors the increased thermodynamic stability observed for 3' unpaired nucleotides which is dependant on the stacking interactions of these nucleotides against the base of the stem. The use of a dangling 3' adenosine nucleotide represents an easy method to significantly improve the quality of NMR spectra of RNA molecules

  5. Post-transcriptional bursting in genes regulated by small RNA molecules

    Science.gov (United States)

    Rodrigo, Guillermo

    2018-03-01

    Gene expression programs in living cells are highly dynamic due to spatiotemporal molecular signaling and inherent biochemical stochasticity. Here we study a mechanism based on molecule-to-molecule variability at the RNA level for the generation of bursts of protein production, which can lead to heterogeneity in a cell population. We develop a mathematical framework to show numerically and analytically that genes regulated post transcriptionally by small RNA molecules can exhibit such bursts due to different states of translation activity (on or off), mostly revealed in a regime of few molecules. We exploit this framework to compare transcriptional and post-transcriptional bursting and also to illustrate how to tune the resulting protein distribution with additional post-transcriptional regulations. Moreover, because RNA-RNA interactions are predictable with an energy model, we define the kinetic constants of on-off switching as functions of the two characteristic free-energy differences of the system, activation and formation, with a nonequilibrium scheme. Overall, post-transcriptional bursting represents a distinctive principle linking gene regulation to gene expression noise, which highlights the importance of the RNA layer beyond the simple information transfer paradigm and significantly contributes to the understanding of the intracellular processes from a first-principles perspective.

  6. NMR-study of dynamic structural transtions in RNA-molecules

    OpenAIRE

    Fürtig, Boris

    2007-01-01

    The following thesis is concerned with the elucidation of structural changes of RNA molecules during the time course of dynamic processes that are commonly denoted as folding reactions. In contrast to the field of protein folding, the concept of RNA folding comprises not only folding reactions itself but also refolding- or conformational switching- and assembly processes (see chapter III). The method in this thesis to monitor these diverse processes is high resolution liquid-state NMR spectro...

  7. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.

    1988-01-01

    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  8. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.

    2012-01-01

    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  9. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues

    Science.gov (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak

    2006-01-01

    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  10. The LncRNA Connectivity Map: Using LncRNA Signatures to Connect Small Molecules, LncRNAs, and Diseases.

    Science.gov (United States)

    Yang, Haixiu; Shang, Desi; Xu, Yanjun; Zhang, Chunlong; Feng, Li; Sun, Zeguo; Shi, Xinrui; Zhang, Yunpeng; Han, Junwei; Su, Fei; Li, Chunquan; Li, Xia

    2017-07-27

    Well characterized the connections among diseases, long non-coding RNAs (lncRNAs) and drugs are important for elucidating the key roles of lncRNAs in biological mechanisms in various biological states. In this study, we constructed a database called LNCmap (LncRNA Connectivity Map), available at http://www.bio-bigdata.com/LNCmap/ , to establish the correlations among diseases, physiological processes, and the action of small molecule therapeutics by attempting to describe all biological states in terms of lncRNA signatures. By reannotating the microarray data from the Connectivity Map database, the LNCmap obtained 237 lncRNA signatures of 5916 instances corresponding to 1262 small molecular drugs. We provided a user-friendly interface for the convenient browsing, retrieval and download of the database, including detailed information and the associations of drugs and corresponding affected lncRNAs. Additionally, we developed two enrichment analysis methods for users to identify candidate drugs for a particular disease by inputting the corresponding lncRNA expression profiles or an associated lncRNA list and then comparing them to the lncRNA signatures in our database. Overall, LNCmap could significantly improve our understanding of the biological roles of lncRNAs and provide a unique resource to reveal the connections among drugs, lncRNAs and diseases.

  11. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos

    2015-09-01

    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  12. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair

    Science.gov (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.

    2009-01-01

    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  13. Substrate-assisted 2D DNA lattices and algorithmic lattices from single-stranded tiles.

    Science.gov (United States)

    Kim, Junghoon; Ha, Tai Hwan; Park, Sung Ha

    2015-08-07

    We present a simple route to circumvent kinetic traps which affect many types of DNA nanostructures in their self-assembly process. Using this method, a new 2D DNA lattice made up of short, single-stranded tile (SST) motifs was created. Previously, the growth of SST DNA assemblies was restricted to 1D (tubes and ribbons) or finite-sized 2D (molecular canvases). By utilizing the substrate-assisted growth method, sets of SSTs were designed as unit cells to self-assemble into periodic and aperiodic 2D lattices which continuously grow both along and orthogonal to the helical axis. Notably, large-scale (∼1 μm(2)) fully periodic 2D lattices were fabricated using a minimum of just 2 strand species. Furthermore, the ability to create 2D lattices from a few motifs enables certain rules to be encoded into these SSTs to carry out algorithmic self-assembly. A set of these motifs was designed to execute simple 1-input 1-output COPY and NOT algorithms, the space-time manifestations which were aperiodic 2D algorithmic SST lattices. The methodology presented here can be straightforwardly applied to other motifs which fall into this type of kinetic trap to create novel DNA crystals.

  14. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.

    2007-01-01

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  15. Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems.

    Science.gov (United States)

    Musumeci, Domenica; Rozza, Lucia; Merlino, Antonello; Paduano, Luigi; Marzo, Tiziano; Massai, Lara; Messori, Luigi; Montesarchio, Daniela

    2015-08-21

    The interaction of the anticancer Ru(iii) complex AziRu - in comparison with its analogue NAMI-A, currently in advanced clinical trials as an antimetastatic agent - with DNA model systems, both single stranded and duplex oligonucleotides, was investigated using a combined approach, including absorption UV-vis spectroscopy, circular dichroism (CD) and electrospray mass spectrometry (ESI-MS) techniques. UV-vis absorption spectra of the Ru complexes were recorded at different times in a pseudo-physiological solution, to monitor the ligand exchange processes in the absence and in the presence of the examined oligonucleotides. CD experiments provided information on the overall conformational changes of the DNA model systems induced by these metal complexes. UV- and CD-monitored thermal denaturation studies were performed to analyse the effects of AziRu and NAMI-A on the stability of the duplex structures. ESI-MS experiments, carried out on the oligonucleotide/metal complex mixtures under investigation, allowed us to detect the formation of stable adducts between the guanine-containing oligomers and the ruthenium complexes. These data unambiguously demonstrate that both AziRu and NAMI-A can interact with the DNA model systems. Although very similar in their structures, the two metal compounds manifest a markedly different reactivity with the examined sequences, respectively, with either a naked Ru(3+) ion or a Ru(Im)(3+) (Im = imidazole) fragment being incorporated into the oligonucleotide structure via stable linkages.

  16. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop.

    Science.gov (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S

    2009-05-01

    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  17. Biophysical characterization of the association of histones with single-stranded DNA.

    Science.gov (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier

    2017-11-01

    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong

    2008-01-01

    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  19. Effect of Conformational Entropy on the Nanomechanics of Microcantilever-Based Single-Stranded DNA Sensors

    Directory of Open Access Journals (Sweden)

    Zou-Qing Tan

    2014-09-01

    Full Text Available An entropy-controlled bending mechanism is presented to study the nanomechanics of microcantilever-based single-stranded DNA (ssDNA sensors. First; the conformational free energy of the ssDNA layer is given with an improved scaling theory of thermal blobs considering the curvature effect; and the mechanical energy of the non-biological layer is described by Zhang’s two-variable method for laminated beams. Then; an analytical model for static deflections of ssDNA microcantilevers is formulated by the principle of minimum energy. The comparisons of deflections predicted by the proposed model; Utz–Begley’s model and Hagan’s model are also examined. Numerical results show that the conformational entropy effect on microcantilever deflections cannot be ignored; especially at the conditions of high packing density or long chain systems; and the variation of deflection predicted by the proposed analytical model not only accords with that observed in the related experiments qualitatively; but also appears quantitatively closer to the experimental values than that by the preexisting models. In order to improve the sensitivity of static-mode biosensors; it should be as small as possible to reduce the substrate stiffness.

  20. In vitro selection and characterization of single stranded DNA aptamers for luteolin: A possible recognition tool.

    Science.gov (United States)

    Tuma Sabah, Jinan; Zulkifli, Razauden Mohamed; Shahir, Shafinaz; Ahmed, Farediah; Abdul Kadir, Mohammed Rafiq; Zakaria, Zarita

    2018-03-06

    Distinctive bioactivities possessed by luteolin (3', 4', 5, 7-tetrahydroxy-flavone) are advantageous for sundry practical applications. This paper reports the in vitro selection and characterization of single stranded-DNA (ssDNA) aptamers, specific for luteolin (LUT). 76-mer library containing 1015 randomized ssDNA were screened via systematic evolution of ligands by exponential enrichment (SELEX). The recovered ssDNA pool from the 8th round was amplified with unlabeled primers and cloned into PSTBlue-1 vector prior to sequencing. 22 of LUT-binding aptamer variants were further classified into one of the seven groups based on their N40 random sequence regions, wherein one representative from each group was characterized. The dissociation constant of aptamers designated as LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively with high binding affinity towards LUT. Prediction analysis of the secondary structure suggested discrete features with typical loop and stem motifs. Furthermore, LUT#3 displayed higher specificity with insignificant binding toward kaempferol and quercetin despite its structural and functional similarity compared to LUT#28 and LUT#20. Further LUT#3 can detect free luteolin within 0.2-1 mM in solution. It was suggested that LUT#3 aptamer were the most suitable for LUT recognition tool at laboratory scale based on the condition tested. Copyright © 2018. Published by Elsevier Inc.

  1. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska

    2017-12-01

    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  2. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.

    1985-01-01

    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  3. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  4. RNA three-way junctions can act as flexible RNA structural elements in large RNA molecules: a molecular simulation analysis

    Czech Academy of Sciences Publication Activity Database

    Beššeová, Ivana; Réblová, Kamila; Leontis, N.B.; Šponer, Jiří

    2009-01-01

    Roč. 26, č. 6 (2009), s. 830-831 ISSN 0739-1102. [The 17th Conversation. 16.06.2009-20.06.2009, Albany] Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : RNA three-way junctions * RNA Subject RIV: BO - Biophysics

  5. Evidence that single-stranded DNA breaks are a normal feature of koala sperm chromatin, while double-stranded DNA breaks are indicative of DNA damage.

    Science.gov (United States)

    Zee, Yeng Peng; López-Fernández, Carmen; Arroyo, F; Johnston, Stephen D; Holt, William V; Gosalvez, Jaime

    2009-08-01

    In this study, we have used single and double comet assays to differentiate between single- and double-stranded DNA damage in an effort to refine the interpretation of DNA damage in mature koala spermatozoa. We have also investigated the likelihood that single-stranded DNA breakage is part of the natural spermiogenic process in koalas, where its function would be the generation of structural bends in the DNA molecule so that appropriate packaging and compaction can occur. Koala spermatozoa were examined using the sperm chromatin dispersion test (SCDt) and comet assays to investigate non-orthodox double-stranded DNA. Comet assays were conducted under 1) neutral conditions; and 2) neutral followed by alkaline conditions (double comet assay); the latter technique enabled simultaneous visualisation of both single-stranded and double-stranded DNA breaks. Following the SCDt, there was a continuum of nuclear morphotypes, ranging from no apparent DNA fragmentation to those with highly dispersed and degraded chromatin. Dispersion morphotypes were mirrored by a similar diversity of comet morphologies that could be further differentiated using the double comet assay. The majority of koala spermatozoa had nuclei with DNA abasic-like residues that produced single-tailed comets following the double comet assay. The ubiquity of these residues suggests that constitutive alkali-labile sites are part of the structural configuration of the koala sperm nucleus. Spermatozoa with 'true' DNA fragmentation exhibited a continuum of comet morphologies, ranging from a more severe form of alkaline-susceptible DNA with a diffuse single tail to nuclei that exhibited both single- and double-stranded breaks with two comet tails.

  6. Approaches to Validate and Manipulate RNA Targets with Small Molecules in Cells.

    Science.gov (United States)

    Childs-Disney, Jessica L; Disney, Matthew D

    2016-01-01

    RNA has become an increasingly important target for therapeutic interventions and for chemical probes that dissect and manipulate its cellular function. Emerging targets include human RNAs that have been shown to directly cause cancer, metabolic disorders, and genetic disease. In this review, we describe various routes to obtain bioactive compounds that target RNA, with a particular emphasis on the development of small molecules. We use these cases to describe approaches that are being developed for target validation, which include target-directed cleavage, classic pull-down experiments, and covalent cross-linking. Thus, tools are available to design small molecules to target RNA and to identify the cellular RNAs that are their targets.

  7. Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules

    NARCIS (Netherlands)

    Schnettler, E.; Hemmes, J.C.; Huisman, R.; Goldbach, R.W.; Prins, M.W.; Kormelink, R.J.M.

    2010-01-01

    The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs

  8. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy

    2008-01-01

    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  9. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray.

    Science.gov (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino

    2008-08-25

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  10. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Science.gov (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino

    2008-01-01

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  11. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system.

    Science.gov (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus

    2011-04-06

    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  12. Finding Order in Randomness: Single-Molecule Studies Reveal Stochastic RNA Processing | Center for Cancer Research

    Science.gov (United States)

    Producing a functional eukaryotic messenger RNA (mRNA) requires the coordinated activity of several large protein complexes to initiate transcription, elongate nascent transcripts, splice together exons, and cleave and polyadenylate the 3’ end. Kinetic competition between these various processes has been proposed to regulate mRNA maturation, but this model could lead to multiple, randomly determined, or stochastic, pathways or outcomes. Regulatory checkpoints have been suggested as a means of ensuring quality control. However, current methods have been unable to tease apart the contributions of these processes at a single gene or on a time scale that could provide mechanistic insight. To begin to investigate the kinetic relationship between transcription and splicing, Daniel Larson, Ph.D., of CCR’s Laboratory of Receptor Biology and Gene Expression, and his colleagues employed a single-molecule RNA imaging approach to monitor production and processing of a human β-globin reporter gene in living cells.

  13. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.

    1995-01-01

    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  14. Distinct circular single-stranded DNA viruses exist in different soil types.

    Science.gov (United States)

    Reavy, Brian; Swanson, Maud M; Cock, Peter J A; Dawson, Lorna; Freitag, Thomas E; Singh, Brajesh K; Torrance, Lesley; Mushegian, Arcady R; Taliansky, Michael

    2015-06-15

    The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  15. A high throughput system for the preparation of single stranded templates grown in microculture.

    Science.gov (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M

    1994-01-01

    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  16. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)

    1994-09-01

    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  17. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  18. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

    Science.gov (United States)

    Richardson, Tomas T; Harran, Omar; Murray, Heath

    2016-06-16

    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

  19. Conformation effects of CpG methylation on single-stranded DNA oligonucleotides: analysis of the opioid peptide dynorphin-coding sequences.

    Directory of Open Access Journals (Sweden)

    Malik Mumtaz Taqi

    Full Text Available Single-stranded DNA (ssDNA is characterized by high conformational flexibility that allows these molecules to adopt a variety of conformations. Here we used native polyacrylamide gel electrophoresis (PAGE, circular dichroism (CD spectroscopy and nuclear magnetic resonance (NMR spectroscopy to show that cytosine methylation at CpG sites affects the conformational flexibility of short ssDNA molecules. The CpG containing 37-nucleotide PDYN (prodynorphin fragments were used as model molecules. The presence of secondary DNA structures was evident from differences in oligonucleotide mobilities on PAGE, from CD spectra, and from formation of A-T, G-C, and non-canonical G-T base pairs observed by NMR spectroscopy. The oligonucleotides displayed secondary structures at 4°C, and some also at 37°C. Methylation at CpG sites prompted sequence-dependent formation of novel conformations, or shifted the equilibrium between different existing ssDNA conformations. The effects of methylation on gel mobility and base pairing were comparable in strength to the effects induced by point mutations in the DNA sequences. The conformational effects of methylation may be relevant for epigenetic regulatory events in a chromatin context, including DNA-protein or DNA-DNA recognition in the course of gene transcription, and DNA replication and recombination when double-stranded DNA is unwinded to ssDNA.

  20. Prediction of RNA secondary structures: from theory to models and real molecules

    International Nuclear Information System (INIS)

    Schuster, Peter

    2006-01-01

    RNA secondary structures are derived from RNA sequences, which are strings built form the natural four letter nucleotide alphabet, {AUGC}. These coarse-grained structures, in turn, are tantamount to constrained strings over a three letter alphabet. Hence, the secondary structures are discrete objects and the number of sequences always exceeds the number of structures. The sequences built from two letter alphabets form perfect structures when the nucleotides can form a base pair, as is the case with {GC} or {AU}, but the relation between the sequences and structures differs strongly from the four letter alphabet. A comprehensive theory of RNA structure is presented, which is based on the concepts of sequence space and shape space, being a space of structures. It sets the stage for modelling processes in ensembles of RNA molecules like evolutionary optimization or kinetic folding as dynamical phenomena guided by mappings between the two spaces. The number of minimum free energy (mfe) structures is always smaller than the number of sequences, even for two letter alphabets. Folding of RNA molecules into mfe energy structures constitutes a non-invertible mapping from sequence space onto shape space. The preimage of a structure in sequence space is defined as its neutral network. Similarly the set of suboptimal structures is the preimage of a sequence in shape space. This set represents the conformation space of a given sequence. The evolutionary optimization of structures in populations is a process taking place in sequence space, whereas kinetic folding occurs in molecular ensembles that optimize free energy in conformation space. Efficient folding algorithms based on dynamic programming are available for the prediction of secondary structures for given sequences. The inverse problem, the computation of sequences for predefined structures, is an important tool for the design of RNA molecules with tailored properties. Simultaneous folding or cofolding of two or more RNA

  1. The nucleotide sequence of threonine transfer RNA coded by bacteriophage T4

    International Nuclear Information System (INIS)

    Guthrie, C.; Scholla, C.A.; Yesian, H.; Abelson, J.

    1978-01-01

    The nucleotide sequence of a low molecular weight RNA coded by bacteriophage T4 (and previously identified as species α) has been determined. The molecule is of particular biological interest for its associated biosynthetic properties. This RNA is 76 nucleotides in length, contains eight modified bases, and can be arranged in a cloverleaf configuration common to tRNAs. The anticodon sequence is UGU, which corresponds to the threonine-specific codons ACsub(G)sup(A). The nucleotide sequence was determined primarily by nearest-neighbour analysis of RNA synthesized in vitro using [α- 32 P] nucleoside triphosphates. Using the single-strand specific nuclease S1, two in vivo labelled half-molecules were generated and analysed. This information together with restrictions imposed by nearest-neighbour data, provided a unique linear sequence of nucleotides with the features of secondary structure common to tRNA molecules. (author)

  2. A large collapsed-state RNA can exhibit simple exponential single-molecule dynamics.

    Science.gov (United States)

    Smith, Glenna J; Lee, Kang Taek; Qu, Xiaohui; Xie, Zheng; Pesic, Jelena; Sosnick, Tobin R; Pan, Tao; Scherer, Norbert F

    2008-05-09

    The process of large RNA folding is believed to proceed from many collapsed structures to a unique functional structure requiring precise organization of nucleotides. The diversity of possible structures and stabilities of large RNAs could result in non-exponential folding kinetics (e.g. stretched exponential) under conditions where the molecules have not achieved their native state. We describe a single-molecule fluorescence resonance energy transfer (FRET) study of the collapsed-state region of the free energy landscape of the catalytic domain of RNase P RNA from Bacillus stearothermophilus (C(thermo)). Ensemble measurements have shown that this 260 residue RNA folds cooperatively to its native state at >or=1 mM Mg(2+), but little is known about the conformational dynamics at lower ionic strength. Our measurements of equilibrium conformational fluctuations reveal simple exponential kinetics that reflect a small number of discrete states instead of the expected inhomogeneous dynamics. The distribution of discrete dwell times, collected from an "ensemble" of 300 single molecules at each of a series of Mg(2+) concentrations, fit well to a double exponential, which indicates that the RNA conformational changes can be described as a four-state system. This finding is somewhat unexpected under [Mg(2+)] conditions in which this RNA does not achieve its native state. Observation of discrete well-defined conformations in this large RNA that are stable on the seconds timescale at low [Mg(2+)] (<0.1 mM) suggests that even at low ionic strength, with a tremendous number of possible (weak) interactions, a few critical interactions may produce deep energy wells that allow for rapid averaging of motions within each well, and yield kinetics that are relatively simple.

  3. Structural Analysis of ‘key’ Interactions in Functional RNA Molecules

    KAUST Repository

    Chawla, Mohit

    2018-04-01

    The main objective of the thesis is to carry out structural bioinformatics study along with usage of advanced quantum chemical methods to look at the structural stability and energetics of RNA building blocks. The main focus of the work described here lies on understanding the reasons behind the intrinsic stability of key interactions in nucleic acids. Crystal structures of RNA molecules exhibit fascinating variety of non-covalent interactions, which play an important role in maintaining the three dimensional structures. An accurate atomic level description of these interactions in the structural building blocks of RNA is a key to understand the structure-function relationship in these molecules. An effort has been made to link the conclusions drawn from quantum chemical computations on RNA base pairs in wide biochemical context of their occurrence in RNA structures. The initial attention was on the impact of natural and non-natural modifications of the nucleic acid bases on the structure and stability of base pairs that they are involved in. In the remaining sections we cover other molecular interactions shaping nucleic acids, as the interaction between ribose and the bases, and the fluoride sensing riboswitch system in order to investigate structure and dynamics of nucleic acids at the atomic level and to gain insight into the physical chemistry behind.

  4. Detection of tmRNA molecules on microarrays at low temperatures using helper oligonucleotides.

    Science.gov (United States)

    Kaplinski, Lauris; Scheler, Ott; Parkel, Sven; Palta, Priit; Toome, Kadri; Kurg, Ants; Remm, Maido

    2010-04-28

    The hybridization of synthetic Streptococcus pneumoniae tmRNA on a detection microarray is slow at 34 degrees C resulting in low signal intensities. We demonstrate that adding specific DNA helper oligonucleotides (chaperones) to the hybridization buffer increases the signal strength at a given temperature and thus makes the specific detection of Streptococcus pneumoniae tmRNA more sensitive. No loss of specificity was observed at low temperatures compared to hybridization at 46 degrees C. The effect of the chaperones can be explained by disruption of the strong secondary and tertiary structure of the target RNA by the selective hybridization of helper molecules. The amplification of the hybridization signal strength by chaperones is not necessarily local; we observed increased signal intensities in both local and distant regions of the target molecule. The sensitivity of the detection of tmRNA at low temperature can be increased by chaperone oligonucleotides. Due to the complexity of RNA secondary and tertiary structures the effect of any individual chaperone is currently not predictable.

  5. Detection of tmRNA molecules on microarrays at low temperatures using helper oligonucleotides

    Directory of Open Access Journals (Sweden)

    Palta Priit

    2010-04-01

    Full Text Available Abstract Background The hybridization of synthetic Streptococcus pneumoniae tmRNA on a detection microarray is slow at 34°C resulting in low signal intensities. Results We demonstrate that adding specific DNA helper oligonucleotides (chaperones to the hybridization buffer increases the signal strength at a given temperature and thus makes the specific detection of Streptococcus pneumoniae tmRNA more sensitive. No loss of specificity was observed at low temperatures compared to hybridization at 46°C. The effect of the chaperones can be explained by disruption of the strong secondary and tertiary structure of the target RNA by the selective hybridization of helper molecules. The amplification of the hybridization signal strength by chaperones is not necessarily local; we observed increased signal intensities in both local and distant regions of the target molecule. Conclusions The sensitivity of the detection of tmRNA at low temperature can be increased by chaperone oligonucleotides. Due to the complexity of RNA secondary and tertiary structures the effect of any individual chaperone is currently not predictable.

  6. Electrical conduction and photoresponses of gamma-ray-irradiated single-stranded DNA/single-walled carbon nanotube composite systems

    Energy Technology Data Exchange (ETDEWEB)

    Hong, W.; Lee, E.M.; Kim, D.W.; Lee, Cheol Eui, E-mail: rscel@korea.ac.kr

    2015-04-15

    Highlights: •Effects of gamma-ray irradiation on single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. •Barrier for thermally activated conduction in the composite systems modified by the gamma-ray irradiation. •Photoresponses reveal photoexcitation and oxygen photodesorption modified by gamma-ray irradiation. -- Abstract: Effects of gamma-ray irradiation on the electrical conductivity and photoresponse have been studied for single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. The temperature-dependent electrical conductivity of the ssDNA/SWNT composite films, well described by a fluctuation-induced tunneling model, indicated modification of the barrier for thermally activated conduction by the gamma-ray irradiation. Besides, the photoresponse measurements indicated modified photoexcited charge carrier generation and oxygen photodesorption in the composite systems due to the gamma-ray irradiation.

  7. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.

    2006-01-01

    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  8. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    Science.gov (United States)

    2014-09-30

    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  9. Quantitative affinity electrophoresis of RNA-small molecule interactions by cross-linking the ligand to acrylamide.

    Science.gov (United States)

    Boodram, Sherry N; McCann, Lucas C; Organ, Michael G; Johnson, Philip E

    2013-11-15

    We show that the affinity electrophoresis analysis of RNA-small molecule interactions can be made quantifiable by cross-linking the ligand to the gel matrix. Using an RNA-aminoglycoside model system to verify our method, we attached an acryloyl chloride molecule to the aminoglycosides paromomycin and neomycin B to synthesize an acrylamide-aminoglycoside monomer. This molecule was then used as a component in gel polymerization for affinity electrophoresis, covalently attaching an aminoglycoside molecule to the gel matrix. To test RNA binding to the cross-linked aminoglycosides, we used the aminoglycoside binding RNA molecule derived from thymidylate synthase messenger RNA (mRNA) that contains a C-C mismatch. Binding is indicated by the difference in RNA mobility between gels with cross-linked ligand, with ligand embedded during polymerization, and with no ligand present. Critically, the predicted straight line relationship between the reciprocal of the relative migration of the RNA and the ligand concentration is obtained when using cross-linked aminoglycosides, whereas a straight line is not obtained using embedded aminoglycosides. Average apparent dissociation constants are determined from the slope of the line from these plots. This method allows an easy quantitative comparison between different nucleic acid molecules for a small molecule ligand. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.

    2013-01-01

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  11. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.

    1977-01-01

    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  12. Molecular-crowding effects on single-molecule RNA folding/unfolding thermodynamics and kinetics

    Science.gov (United States)

    Dupuis, Nicholas F.; Holmstrom, Erik D.; Nesbitt, David J.

    2014-01-01

    The effects of “molecular crowding” on elementary biochemical processes due to high solute concentrations are poorly understood and yet clearly essential to the folding of nucleic acids and proteins into correct, native structures. The present work presents, to our knowledge, first results on the single-molecule kinetics of solute molecular crowding, specifically focusing on GAAA tetraloop–receptor folding to isolate a single RNA tertiary interaction using time-correlated single-photon counting and confocal single-molecule FRET microscopy. The impact of crowding by high–molecular-weight polyethylene glycol on the RNA folding thermodynamics is dramatic, with up to ΔΔG° ∼ −2.5 kcal/mol changes in free energy and thus >60-fold increase in the folding equilibrium constant (Keq) for excluded volume fractions of 15%. Most importantly, time-correlated single-molecule methods permit crowding effects on the kinetics of RNA folding/unfolding to be explored for the first time (to our knowledge), which reveal that this large jump in Keq is dominated by a 35-fold increase in tetraloop–receptor folding rate, with only a modest decrease in the corresponding unfolding rate. This is further explored with temperature-dependent single-molecule RNA folding measurements, which identify that crowding effects are dominated by entropic rather than enthalpic contributions to the overall free energy change. Finally, a simple “hard-sphere” treatment of the solute excluded volume is invoked to model the observed kinetic trends, and which predict ΔΔG° ∼ −5 kcal/mol free-energy stabilization at excluded volume fractions of 30%. PMID:24850865

  13. Three-dimensional Nanowire Structures for Ultra-Fast Separation of DNA, Protein and RNA Molecules

    Science.gov (United States)

    Rahong, Sakon; Yasui, Takao; Yanagida, Takeshi; Nagashima, Kazuki; Kanai, Masaki; Meng, Gang; He, Yong; Zhuge, Fuwei; Kaji, Noritada; Kawai, Tomoji; Baba, Yoshinobu

    2015-01-01

    Separation and analysis of biomolecules represent crucial processes for biological and biomedical engineering development; however, separation resolution and speed for biomolecules analysis still require improvements. To achieve separation and analysis of biomolecules in a short time, the use of highly-ordered nanostructures fabricated by top-down or bottom-up approaches have been proposed. Here, we reported on the use of three-dimensional (3D) nanowire structures embedded in microchannels fabricated by a bottom-up approach for ultrafast separation of small biomolecules, such as DNA, protein, and RNA molecules. The 3D nanowire structures could analyze a mixture of DNA molecules (50–1000 bp) within 50 s, a mixture of protein molecules (20–340 kDa) within 5 s, and a mixture of RNA molecules (100–1000 bases) within 25 s. And, we could observe the electrophoretic mobility difference of biomolecules as a function of molecular size in the 3D nanowire structures. Since the present methodology allows users to control the pore size of sieving materials by varying the number of cycles for nanowire growth, the 3D nanowire structures have a good potential for use as alternatives for other sieving materials. PMID:26073192

  14. Small Molecule, Big Prospects: MicroRNA in Pregnancy and Its Complications

    Directory of Open Access Journals (Sweden)

    Meng Cai

    2017-01-01

    Full Text Available MicroRNAs are small, noncoding RNA molecules that regulate target gene expression in the posttranscriptional level. Unlike siRNA, microRNAs are “fine-tuners” rather than “switches” in the regulation of gene expression; thus they play key roles in maintaining tissue homeostasis. The aberrant microRNA expression is implicated in the disease process. To date, numerous studies have demonstrated the regulatory roles of microRNAs in various pathophysiological conditions. In contrast, the study of microRNA in pregnancy and its associated complications, such as preeclampsia (PE, fetal growth restriction (FGR, and preterm labor, is a young field. Over the last decade, the knowledge of pregnancy-related microRNAs has increased and the molecular mechanisms by which microRNAs regulate pregnancy or its associated complications are emerging. In this review, we focus on the recent advances in the research of pregnancy-related microRNAs, especially their function in pregnancy-associated complications and the potential clinical applications. Here microRNAs that associate with pregnancy are classified as placenta-specific, placenta-associated, placenta-derived circulating, and uterine microRNA according to their localization and origin. MicroRNAs offer a great potential for developing diagnostic and therapeutic targets in pregnancy-related disorders.

  15. Detection of NASBA amplified bacterial tmRNA molecules on SLICSel designed microarray probes.

    Science.gov (United States)

    Scheler, Ott; Kaplinski, Lauris; Glynn, Barry; Palta, Priit; Parkel, Sven; Toome, Kadri; Maher, Majella; Barry, Thomas; Remm, Maido; Kurg, Ants

    2011-02-28

    We present a comprehensive technological solution for bacterial diagnostics using tmRNA as a marker molecule. A robust probe design algorithm for microbial detection microarray is implemented. The probes were evaluated for specificity and, combined with NASBA (Nucleic Acid Sequence Based Amplification) amplification, for sensitivity. We developed a new web-based program SLICSel for the design of hybridization probes, based on nearest-neighbor thermodynamic modeling. A SLICSel minimum binding energy difference criterion of 4 kcal/mol was sufficient to design of Streptococcus pneumoniae tmRNA specific microarray probes. With lower binding energy difference criteria, additional hybridization specificity tests on the microarray were needed to eliminate non-specific probes. Using SLICSel designed microarray probes and NASBA we were able to detect S. pneumoniae tmRNA from a series of total RNA dilutions equivalent to the RNA content of 0.1-10 CFU. The described technological solution and both its separate components SLICSel and NASBA-microarray technology independently are applicative for many different areas of microbial diagnostics.

  16. Detection of NASBA amplified bacterial tmRNA molecules on SLICSel designed microarray probes

    Directory of Open Access Journals (Sweden)

    Toome Kadri

    2011-02-01

    Full Text Available Abstract Background We present a comprehensive technological solution for bacterial diagnostics using tmRNA as a marker molecule. A robust probe design algorithm for microbial detection microarray is implemented. The probes were evaluated for specificity and, combined with NASBA (Nucleic Acid Sequence Based Amplification amplification, for sensitivity. Results We developed a new web-based program SLICSel for the design of hybridization probes, based on nearest-neighbor thermodynamic modeling. A SLICSel minimum binding energy difference criterion of 4 kcal/mol was sufficient to design of Streptococcus pneumoniae tmRNA specific microarray probes. With lower binding energy difference criteria, additional hybridization specificity tests on the microarray were needed to eliminate non-specific probes. Using SLICSel designed microarray probes and NASBA we were able to detect S. pneumoniae tmRNA from a series of total RNA dilutions equivalent to the RNA content of 0.1-10 CFU. Conclusions The described technological solution and both its separate components SLICSel and NASBA-microarray technology independently are applicative for many different areas of microbial diagnostics.

  17. Detection of NASBA amplified bacterial tmRNA molecules on SLICSel designed microarray probes

    LENUS (Irish Health Repository)

    Scheler, Ott

    2011-02-28

    Abstract Background We present a comprehensive technological solution for bacterial diagnostics using tmRNA as a marker molecule. A robust probe design algorithm for microbial detection microarray is implemented. The probes were evaluated for specificity and, combined with NASBA (Nucleic Acid Sequence Based Amplification) amplification, for sensitivity. Results We developed a new web-based program SLICSel for the design of hybridization probes, based on nearest-neighbor thermodynamic modeling. A SLICSel minimum binding energy difference criterion of 4 kcal\\/mol was sufficient to design of Streptococcus pneumoniae tmRNA specific microarray probes. With lower binding energy difference criteria, additional hybridization specificity tests on the microarray were needed to eliminate non-specific probes. Using SLICSel designed microarray probes and NASBA we were able to detect S. pneumoniae tmRNA from a series of total RNA dilutions equivalent to the RNA content of 0.1-10 CFU. Conclusions The described technological solution and both its separate components SLICSel and NASBA-microarray technology independently are applicative for many different areas of microbial diagnostics.

  18. Efficient CRISPR/Cas9-Mediated Genome Editing Using a Chimeric Single-Guide RNA Molecule

    KAUST Repository

    Butt, Haroon

    2017-08-24

    The CRISPR/Cas9 system has been applied in diverse eukaryotic organisms for targeted mutagenesis. However, targeted gene editing is inefficient and requires the simultaneous delivery of a DNA template for homology-directed repair (HDR). Here, we used CRISPR/Cas9 to generate targeted double-strand breaks and to deliver an RNA repair template for HDR in rice (Oryza sativa). We used chimeric single-guide RNA (cgRNA) molecules carrying both sequences for target site specificity (to generate the double-strand breaks) and repair template sequences (to direct HDR), flanked by regions of homology to the target. Gene editing was more efficient in rice protoplasts using repair templates complementary to the non-target DNA strand, rather than the target strand. We applied this cgRNA repair method to generate herbicide resistance in rice, which showed that this cgRNA repair method can be used for targeted gene editing in plants. Our findings will facilitate applications in functional genomics and targeted improvement of crop traits.

  19. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms.

    Science.gov (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A

    2012-05-01

    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. The RNA synthesis machinery of negative-stranded RNA viruses

    Energy Technology Data Exchange (ETDEWEB)

    Ortín, Juan, E-mail: jortin@cnb.csic.es [Department of Molecular and Cellular Biology, Centro Nacional de Biotecnología (CSIC) and CIBER de Enfermedades Respiratorias (ISCIII), Madrid (Spain); Martín-Benito, Jaime, E-mail: jmartinb@cnb.csic.es [Department of Macromolecular Structures, Centro Nacional de Biotecnología (CSIC), Madrid (Spain)

    2015-05-15

    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure of their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes.

  1. The RNA synthesis machinery of negative-stranded RNA viruses

    International Nuclear Information System (INIS)

    Ortín, Juan; Martín-Benito, Jaime

    2015-01-01

    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure of their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes

  2. Small Molecule Targeting of a MicroRNA Associated with Hepatocellular Carcinoma.

    Science.gov (United States)

    Childs-Disney, Jessica L; Disney, Matthew D

    2016-02-19

    Development of precision therapeutics is of immense interest, particularly as applied to the treatment of cancer. By analyzing the preferred cellular RNA targets of small molecules, we discovered that 5"-azido neomycin B binds the Drosha processing site in the microRNA (miR)-525 precursor. MiR-525 confers invasive properties to hepatocellular carcinoma (HCC) cells. Although HCC is one of the most common cancers, treatment options are limited, making the disease often fatal. Herein, we find that addition of 5"-azido neomycin B and its FDA-approved precursor, neomycin B, to an HCC cell line selectively inhibits production of the mature miRNA, boosts a downstream protein, and inhibits invasion. Interestingly, neomycin B is a second-line agent for hepatic encephalopathy (HE) and bacterial infections due to cirrhosis. Our results provocatively suggest that neomycin B, or second-generation derivatives, may be dual functioning molecules to treat both HE and HCC. Collectively, these studies show that rational design approaches can be tailored to disease-associated RNAs to afford potential lead therapeutics.

  3. Fluorescent labeling of NASBA amplified tmRNA molecules for microarray applications.

    Science.gov (United States)

    Scheler, Ott; Glynn, Barry; Parkel, Sven; Palta, Priit; Toome, Kadri; Kaplinski, Lauris; Remm, Maido; Maher, Majella; Kurg, Ants

    2009-05-15

    Here we present a novel promising microbial diagnostic method that combines the sensitivity of Nucleic Acid Sequence Based Amplification (NASBA) with the high information content of microarray technology for the detection of bacterial tmRNA molecules. The NASBA protocol was modified to include aminoallyl-UTP (aaUTP) molecules that were incorporated into nascent RNA during the NASBA reaction. Post-amplification labeling with fluorescent dye was carried out subsequently and tmRNA hybridization signal intensities were measured using microarray technology. Significant optimization of the labeled NASBA protocol was required to maintain the required sensitivity of the reactions. Two different aaUTP salts were evaluated and optimum final concentrations were identified for both. The final 2 mM concentration of aaUTP Li-salt in NASBA reaction resulted in highest microarray signals overall, being twice as high as the strongest signals with 1 mM aaUTP Na-salt. We have successfully demonstrated efficient combination of NASBA amplification technology with microarray based hybridization detection. The method is applicative for many different areas of microbial diagnostics including environmental monitoring, bio threat detection, industrial process monitoring and clinical microbiology.

  4. Fluorescent labeling of NASBA amplified tmRNA molecules for microarray applications

    Directory of Open Access Journals (Sweden)

    Kaplinski Lauris

    2009-05-01

    Full Text Available Abstract Background Here we present a novel promising microbial diagnostic method that combines the sensitivity of Nucleic Acid Sequence Based Amplification (NASBA with the high information content of microarray technology for the detection of bacterial tmRNA molecules. The NASBA protocol was modified to include aminoallyl-UTP (aaUTP molecules that were incorporated into nascent RNA during the NASBA reaction. Post-amplification labeling with fluorescent dye was carried out subsequently and tmRNA hybridization signal intensities were measured using microarray technology. Significant optimization of the labeled NASBA protocol was required to maintain the required sensitivity of the reactions. Results Two different aaUTP salts were evaluated and optimum final concentrations were identified for both. The final 2 mM concentration of aaUTP Li-salt in NASBA reaction resulted in highest microarray signals overall, being twice as high as the strongest signals with 1 mM aaUTP Na-salt. Conclusion We have successfully demonstrated efficient combination of NASBA amplification technology with microarray based hybridization detection. The method is applicative for many different areas of microbial diagnostics including environmental monitoring, bio threat detection, industrial process monitoring and clinical microbiology.

  5. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes

    OpenAIRE

    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  6. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family.

    Science.gov (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław

    2017-05-01

    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  7. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity.

    Science.gov (United States)

    Monnet, Jordan; Kozelka, Jiří

    2012-10-01

    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris

    2016-01-01

    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA-binding pro......Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...... leads to enhanced cooperative binding to DNA.Conclusions: Our findings contribute to the emerging picture that bacterial proteins, exemplified here by SsbA, undergo phosphorylation at multiple residues. This results in a complex regulation of cellular functions, and suggests that the complexity...

  9. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  10. Development of an Interaction Assay between Single-Stranded Nucleic Acids Trapped with Silica Particles and Fluorescent Compounds

    Directory of Open Access Journals (Sweden)

    R. Maeda

    2012-09-01

    Full Text Available Biopolymers are easily denatured by heating, a change in pH or chemical substances when they are immobilized on a substrate. To prevent denaturation of biopolymers, we developed a method to trap a polynucleotide on a substrate by hydrogen bonding using silica particles with surfaces modified by aminoalkyl chains ([A-AM silane]/SiO2. [A-AM silane]/SiO2 was synthesized by silane coupling reaction of N-2-(aminoethyl-3-aminopropyltrimethoxysilane (A-AM silane with SiO2 particles with a diameter of 5 μm at 100 °C for 20 min. The surface chemical structure of [A-AM silane]/SiO2 was characterized by Fourier transform infrared spectroscopy and molecular orbital calculations. The surface of the silica particles was modified with A-AM silane and primary amine groups were formed. [A-AM silane]/SiO2 was trapped with single-stranded nucleic acids [(Poly-X; X = A (adenine, G (guanine and C (cytosine] in PBS solution at 37 °C for 1 h. The single-stranded nucleic acids were trapped on the surface of the [A-AM silane]/SiO2 by hydrogen bonding to form conjugated materials. The resulting complexes were further conjugated by derivatives of acridine orange (AO as fluorescent labels under the same conditions to form [AO:Poly-X:A-AM silane]/SiO2 complexes. Changes in the fluorescence intensity of these complexes originating from interactions between the single-stranded nucleic acid and aromatic compounds were also evaluated. The change in intensity displayed the order [AO: Poly-G: A-AM silane]/SiO2 > [AO:Poly-A:A-AM silane]/SiO2 >> [AO:Poly-C:A-AM silane]/SiO2. This suggests that the single-stranded nucleic acids conjugated with aminoalkyl chains on the surfaces of SiO2 particles and the change in fluorescence intensity reflected the molecular interaction between AO and the nucleic-acid base in a polynucleotide.

  11. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide

    Science.gov (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio

    1998-01-01

    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  12. Simultaneous identification of seven foodborne pathogens and Escherichia coli (pathogenic and nonpathogenic) using capillary electrophoresis-based single-strand conformation polymorphism coupled with multiplex PCR.

    Science.gov (United States)

    Oh, Mi-Hwa; Paek, Se-Hee; Shin, Gi Won; Kim, Hae-Yeong; Jung, Gyoo Yeol; Oh, Sangsuk

    2009-06-01

    The objective of this study was to develop a novel technique for parallel analysis of eight important foodborne microbes using capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) coupled with multiplex PCR. Specific primers for multiplex PCR amplification of the 16S rRNA gene were designed, corresponding to eight species of bacteria, including Escherichia coli, Clostridium perfringens, Campylobacter jejuni, Salmonella enterica, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Bacillus cereus, for the species-specific identification and optimal separation of their PCR products in subsequent analysis by CE-SSCP. Multiplex PCR conditions including annealing temperature, extension time, the number of PCR cycles, and primer concentrations were then optimized for simultaneous detection of all target foodborne bacteria. The diagnostic system using CE-SSCP combined with multiplex PCR developed here can be used for rapid investigation of causative agents of foodborne illness. The simplicity and high sensitivity of the method may lead to improved management of safety and illness related to food.

  13. Live-Cell Visualization of Pre-mRNA Splicing with Single-Molecule Sensitivity

    Directory of Open Access Journals (Sweden)

    Robert M. Martin

    2013-09-01

    Full Text Available Removal of introns from pre-messenger RNAs (pre-mRNAs via splicing provides a versatile means of genetic regulation that is often disrupted in human diseases. To decipher how splicing occurs in real time, we directly examined with single-molecule sensitivity the kinetics of intron excision from pre-mRNA in the nucleus of living human cells. By using two different RNA labeling methods, MS2 and λN, we show that β-globin introns are transcribed and excised in 20–30 s. Furthermore, we show that replacing the weak polypyrimidine (Py tract in mouse immunoglobulin μ (IgM pre-mRNA by a U-rich Py decreases the intron lifetime, thus providing direct evidence that splice-site strength influences splicing kinetics. We also found that RNA polymerase II transcribes at elongation rates ranging between 3 and 6 kb min−1 and that transcription can be rate limiting for splicing. These results have important implications for a mechanistic understanding of cotranscriptional splicing regulation in the live-cell context.

  14. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2016-05-28

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  15. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

    2015-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA)...

  16. Ion Density Analysis of Single-Stranded DNA in Liquid Crystal

    Science.gov (United States)

    Iwabata, Kazuki; Seki, Yasutaka; Toizumi, Ryota; Shimada, Yuki; Furue, Hirokazu; Sakaguchi, Kengo

    2013-09-01

    With the widespread use of liquid crystals (LCs) in liquid crystal displays, we have looked into the application of liquid crystals in biotechnology. The purpose of the study described here is to investigate the physical properties of DNA using LCs. Synthetic oligonucleotide molecules were dispersed in MLC6884, the sample injected into antiparallel cells, and the amount of mobile ions was measured. The LC cell doped with oligonucleotide molecules showed a sequence-dependent, specific correlation between oligonucleotide concentration and the amount of mobile ions in the LC cells. In the framework of the Stokes model and polyacrylamide gel electrophoresis (PAGE) analysis, we speculate that this result arises from the difference in ion mobility, which is caused by the shape of the oligonucleotide molecule in the LC.

  17. Permuted tRNA genes of Cyanidioschyzon merolae, the origin of the tRNA molecule and the root of the Eukarya domain.

    Science.gov (United States)

    Di Giulio, Massimo

    2008-08-07

    An evolutionary analysis is conducted on the permuted tRNA genes of Cyanidioschyzon merolae, in which the 5' half of the tRNA molecule is codified at the 3' end of the gene and its 3' half is codified at the 5' end. This analysis has shown that permuted genes cannot be considered as derived traits but seem to possess characteristics that suggest they are ancestral traits, i.e. they originated when tRNA molecule genes originated for the first time. In particular, if the hypothesis that permuted genes are a derived trait were true, then we should not have been able to observe that the most frequent class of permuted genes is that of the anticodon loop type, for the simple reason that this class would derive by random permutation from a class of non-permuted tRNA genes, which instead is the rarest. This would not explain the high frequency with which permuted tRNA genes with perfectly separate 5' and 3' halves were observed. Clearly the mechanism that produced this class of permuted genes would envisage the existence, in an advanced stage of evolution, of minigenes codifying for the 5' and 3' halves of tRNAs which were assembled in a permuted way at the origin of the tRNA molecule, thus producing a high frequency of permuted genes of the class here referred. Therefore, this evidence supports the hypothesis that the genes of the tRNA molecule were assembled by minigenes codifying for hairpin-like RNA molecules, as suggested by one model for the origin of tRNA [Di Giulio, M., 1992. On the origin of the transfer RNA molecule. J. Theor. Biol. 159, 199-214; Di Giulio, M., 1999. The non-monophyletic origin of tRNA molecule. J. Theor. Biol. 197, 403-414]. Moreover, the late assembly of the permuted genes of C. merolae, as well as their ancestrality, strengthens the hypothesis of the polyphyletic origins of these genes. Finally, on the basis of the uniqueness and the ancestrality of these permuted genes, I suggest that the root of the Eukarya domain is in the super

  18. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism.

    Science.gov (United States)

    Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong

    2016-07-01

    A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.

  19. Characterization of the single-stranded DNA binding protein pV(VGJΦ) of VGJΦ phage from Vibrio cholerae.

    Science.gov (United States)

    Falero, Alina; Caballero, Andy; Trigueros, Sonia; Pérez, Celso; Campos, Javier; Marrero, Karen; Fando, Rafael

    2011-09-01

    pV(VGJΦ), a single-stranded DNA binding protein of the vibriophage VGJΦ was subject to biochemical analysis. Here, we show that this protein has a general affinity for single-stranded DNA (ssDNA) as documented by Electrophoretic Mobility Shift Assay (EMSA). The apparent molecular weight of the monomer is about 12.7kDa as measured by HPLC-SEC. Moreover, isoelectrofocusing showed an isoelectric point for pV(VGJΦ) of 6.82 pH units. Size exclusion chromatography in 150mM NaCl, 50mM sodium phosphate buffer, pH 7.0 revealed a major protein species of 27.0kDa, suggesting homodimeric protein architecture. Furthermore, pV(VGJΦ) binds ssDNA at extreme temperatures and the complex was stable after extended incubation times. Upon frozen storage at -20°C for a year the protein retained its integrity, biological activity and oligomericity. On the other hand, bioinformatics analysis predicted that pV(VGJΦ) protein has a disordered C-terminal, which might be involved in its functional activity. All the aforementioned features make pV(VGJΦ) interesting for biotechnological applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles.

    Science.gov (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng

    2015-11-21

    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  1. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.

    1978-01-01

    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  2. Size, Shape, and Sequence-Dependent Immunogenicity of RNA Nanoparticles

    Directory of Open Access Journals (Sweden)

    Sijin Guo

    2017-12-01

    Full Text Available RNA molecules have emerged as promising therapeutics. Like all other drugs, the safety profile and immune response are important criteria for drug evaluation. However, the literature on RNA immunogenicity has been controversial. Here, we used the approach of RNA nanotechnology to demonstrate that the immune response of RNA nanoparticles is size, shape, and sequence dependent. RNA triangle, square, pentagon, and tetrahedron with same shape but different sizes, or same size but different shapes were used as models to investigate the immune response. The levels of pro-inflammatory cytokines induced by these RNA nanoarchitectures were assessed in macrophage-like cells and animals. It was found that RNA polygons without extension at the vertexes were immune inert. However, when single-stranded RNA with a specific sequence was extended from the vertexes of RNA polygons, strong immune responses were detected. These immunostimulations are sequence specific, because some other extended sequences induced little or no immune response. Additionally, larger-size RNA square induced stronger cytokine secretion. 3D RNA tetrahedron showed stronger immunostimulation than planar RNA triangle. These results suggest that the immunogenicity of RNA nanoparticles is tunable to produce either a minimal immune response that can serve as safe therapeutic vectors, or a strong immune response for cancer immunotherapy or vaccine adjuvants.

  3. Absorption by DNA single strands of adenine isolated in vacuo: The role of multiple chromophores

    DEFF Research Database (Denmark)

    Nielsen, L.M.; Pedersen, S.O.; Kirketerp, M.-B.S.

    2012-01-01

    to that for the adenine molecule and the dAMP mononucleotide. Desolvation has little effect on the bandwidth, which implies that inhomogenous broadening of the absorption bands in aqueous solution is of minor importance compared to, e.g., conformational disorder. Finally, at high photon energies, internal conversion...

  4. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: skim1@lsuhsc.edu [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  5. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee

    2012-01-01

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  6. Genomic sequences of two novel Levivirus single-stranded RNA coliphages (family Leviviridae): Evidence for recombination in environmental strains

    Science.gov (United States)

    Bacteriophages are likely the most abundant entities in the aquatic environment, yet knowledge of their ecology is limited. During a fecal source-tracking study, two genetically novel Leviviridae strains were discovered. Although the novel strains were isolated from coastal wat...

  7. Infectious Bursal disease virus: ribonucleoprotein complexes of a double-stranded RNA virus.

    Science.gov (United States)

    Luque, Daniel; Saugar, Irene; Rejas, María Teresa; Carrascosa, José L; Rodríguez, José F; Castón, José R

    2009-02-27

    Genome-binding proteins with scaffolding and/or regulatory functions are common in living organisms and include histones in eukaryotic cells, histone-like proteins in some double-stranded DNA (dsDNA) viruses, and the nucleocapsid proteins of single-stranded RNA viruses. dsRNA viruses nevertheless lack these ribonucleoprotein (RNP) complexes and are characterized by sharing an icosahedral T=2 core involved in the metabolism and insulation of the dsRNA genome. The birnaviruses, with a bipartite dsRNA genome, constitute a well-established exception and have a single-shelled T=13 capsid only. Moreover, as in many negative single-stranded RNA viruses, the genomic dsRNA is bound to a nucleocapsid protein (VP3) and the RNA-dependent RNA polymerase (VPg). We used electron microscopy and functional analysis to characterize these RNP complexes of infectious bursal disease virus, the best characterized member of the Birnaviridae family. Mild disruption of viral particles revealed that VP3, the most abundant core protein, present at approximately 450 copies per virion, is found in filamentous material tightly associated with the dsRNA. We developed a method to purify RNP and VPg-dsRNA complexes. Analysis of these complexes showed that they are linear molecules containing a constant amount of protein. Sensitivity assays to nucleases indicated that VP3 renders the genomic dsRNA less accessible for RNase III without introducing genome compaction. Additionally, we found that these RNP complexes are functionally competent for RNA synthesis in a capsid-independent manner, in contrast to most dsRNA viruses.

  8. Differentiation of Short Single-Stranded DNA Homopolymers in Solid-State Nanopores

    Science.gov (United States)

    Venta, Kimberly; Shemer, Gabriel; Puster, Matthew; Rodríguez-Manzo, Julio A.; Balan, Adrian; Rosenstein, Jacob K.; Shepard, Ken; Drndić, Marija

    2013-01-01

    In the last two decades, new techniques that monitor ionic current modulations as single molecules pass through a nanoscale pore have enabled numerous single-molecule studies. While biological nanopores have recently shown the ability to resolve single nucleotides within individual DNA molecules, similar developments with solid-state nanopores have lagged, due to challenges both in fabricating stable nanopores of similar dimensions as biological nanopores and in achieving sufficiently low-noise and high-bandwidth recordings. Here we show that small silicon nitride nanopores (0.8 to 2-nm-diameter in 5 to 8-nm-thick membranes) can resolve differences between ionic current signals produced by short (30 base) ssDNA homopolymers (poly(dA), poly(dC), poly(dT)), when combined with measurement electronics that allow a signal-to-noise ratio of better than 10 to be achieved at 1 MHz bandwidth. While identifying intramolecular DNA sequences with silicon nitride nanopores will require further improvements in nanopore sensitivity and noise levels, homopolymer differentiation represents an important milestone in the development of solid-state nanopores. PMID:23621759

  9. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  10. Suppression of mRNA Nanoparticle Transfection in Human Fibroblasts by Selected Interferon Inhibiting Small Molecule Compounds.

    Science.gov (United States)

    Liu, Yang; Krishnan, Manoj N; Phua, Kyle K L

    2017-07-31

    In vitro transcribed (IVT) mRNA is increasingly applied in lieu of DNA to deliver reprogramming genes to fibroblasts for stem cell derivation. However, IVT mRNA induces interferon (IFN) responses from mammalian cells that reduces transfection efficiency. It has been previously suggested that small molecule inhibitors of IFN are a viable strategy to enhance mRNA transfection efficiency. Herein, we screen a list of commercially available small molecules, including published IFN inhibitors, for their potential to enhance mRNA transfection in BJ fibroblasts. Transfection enhancement is quantified by relative mean fluorescence intensity of translated green fluorescent protein (GFP) in treated cells compared to dimethyl sulfoxide treated controls. Within toxicological constrains, all tested small molecules did not enhance mRNA transfection in BJ fibroblasts while a third of the tested compounds unexpectedly inhibited GFP expression even though IFN-β production is inhibited. Based on the results of our study, we conclude that small molecule inhibitors, including IFN inhibitors, tested in this study do not enhance in vitro mRNA transfection efficiency in human fibroblasts.

  11. Mismatched single stranded antisense oligonucleotides can induce efficient dystrophin splice switching

    Directory of Open Access Journals (Sweden)

    Kole Ryszard

    2011-10-01

    Full Text Available Abstract Background Antisense oligomer induced exon skipping aims to reduce the severity of Duchenne muscular dystrophy by redirecting splicing during pre-RNA processing such that the causative mutation is by-passed and a shorter but partially functional Becker muscular dystrophy-like dystrophin isoform is produced. Normal exons are generally targeted to restore the dystrophin reading frame however, an appreciable subset of dystrophin mutations are intra-exonic and therefore have the potential to compromise oligomer efficiency, necessitating personalised oligomer design for some patients. Although antisense oligomers are easily personalised, it remains unclear whether all patient polymorphisms within antisense oligomer target sequences will require the costly process of producing and validating patient specific compounds. Methods Here we report preclinical testing of a panel of splice switching antisense oligomers, designed to excise exon 25 from the dystrophin transcript, in normal and dystrophic patient cells. These patient cells harbour a single base insertion in exon 25 that lies within the target sequence of an oligomer shown to be effective at removing exon 25. Results It was anticipated that such a mutation would compromise oligomer binding and efficiency. However, we show that, despite the mismatch an oligomer, designed and optimised to excise exon 25 from the normal dystrophin mRNA, removes the mutated exon 25 more efficiently than the mutation-specific oligomer. Conclusion This raises the possibility that mismatched AOs could still be therapeutically applicable in some cases, negating the necessity to produce patient-specific compounds.

  12. Theoretical Study of the Transpore Velocity Control of Single-Stranded DNA

    Directory of Open Access Journals (Sweden)

    Weixin Qian

    2014-08-01

    Full Text Available The electrokinetic transport dynamics of deoxyribonucleic acid (DNA molecules have recently attracted significant attention in various fields of research. Our group is interested in the detailed examination of the behavior of DNA when confined in micro/nanofluidic channels. In the present study, the translocation mechanism of a DNA-like polymer chain in a nanofluidic channel was investigated using Langevin dynamics simulations. A coarse-grained bead-spring model was developed to simulate the dynamics of a long polymer chain passing through a rectangular cross-section nanopore embedded in a nanochannel, under the influence of a nonuniform electric field. Varying the cross-sectional area of the nanopore was found to allow optimization of the translocation process through modification of the electric field in the flow channel, since a drastic drop in the electric potential at the nanopore was induced by changing the cross-section. Furthermore, the configuration of the polymer chain in the nanopore was observed to determine its translocation velocity. The competition between the strength of the electric field and confinement in the small pore produces various transport mechanisms and the results of this study thus represent a means of optimizing the design of nanofluidic devices for single molecule detection.

  13. Analyzing abundance of mRNA molecules with a near-infrared fluorescence technique.

    Science.gov (United States)

    Chen, Ying; Pan, Yan; Zhang, Beibei; Wang, Jinke

    2014-01-01

    This study describes a simple method for analyzing the abundance of mRNA molecules in a total DNA sample. Due to the dependence on the near-infrared fluorescence technique, this method is named near-infrared fluorescence gene expression detection (NIRF-GED). The procedure has three steps: (1) isolating total RNA from detected samples and reverse-transcription into cDNA with a biotin-labeled oligo dT; (2) hybridizing cDNA to oligonucleotide probes coupled to a 96-well microplate; and (3) detecting biotins with NIRF-labeled streptavidin. The method was evaluated by performing proof-in-concept detections of absolute and relative expressions of housekeeping and NF-κB target genes in HeLa cells. As a result, the absolute expression of three genes, Ccl20, Cxcl2, and Gapdh, in TNF-α-uninduced HeLa cells was determined with a standard curve constructed on the same microplate, and the relative expression of five genes, Ccl20, Cxcl2, Il-6, STAT5A, and Gapdh, in TNF-α-induced and -uninduced HeLa cells was measured by using NIRF-GED. The results were verified by quantitative PCR (qPCR) and DNA microarray detections. The biggest advantage of NIRF-GED over the current techniques lies in its independence of exponential or linear amplification of nucleic acids. Moreover, NIRF-GED also has several other benefits, including high sensitivity as low as several fmols, absolute quantification in the range of 9 to 147 fmols, low cDNA consumption similar to qPCR template, and the current medium throughput in 96-well microplate format and future high throughput in DNA microarray format. NIRF-GED thus provides a new tool for analyzing gene transcripts and other nucleic acid molecules.

  14. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample.

    Science.gov (United States)

    Cui, Lunbiao; Wu, Binyao; Zhu, Xiaojuan; Guo, Xiling; Ge, Yiyue; Zhao, Kangchen; Qi, Xian; Shi, Zhiyang; Zhu, Fengcai; Sun, Lixin; Zhou, Minghao

    2017-11-01

    Metagenomic analysis through high-throughput sequencing is a tool for detecting both known and novel viruses. Using this technique, a novel circular single-stranded DNA (ssDNA) virus genome was discovered in respiratory secretions from a febrile traveler. The virus, named human respiratory-associated PSCV-5-like virus (HRAPLV), has a genome comprising 3,018 bases, with two major putative ORFs inversely encoding capsid (Cap) and replicase (Rep) protein and separated by two intergenic regions. One stem-loop structure was predicted in the larger intergenic region (LIR). The predicted amino acid sequences of the Cap and Rep proteins of HRAPLV showed highest identity to those of porcine stool-associated circular virus 5 isolate CP3 (PoSCV 5) (53.0% and 48.9%, respectively). The host tropism of the virus is unknown, and further study is warranted to determine whether this novel virus is associated with human disease.

  15. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Vrushali S. [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Gokhale, Suresh P.; Patil, Kashinath R. [Physical and Material Chemistry Division, National Chemical Laboratory, Pune (India); Haram, Santosh K., E-mail: haram@chem.unipune.ernet.i [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)

    2010-02-15

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 +- 2 mum and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, alpha-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k{sup 0}) and electron transfer coefficient (alpha) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  16. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    International Nuclear Information System (INIS)

    Joshi, Vrushali S.; Gokhale, Suresh P.; Patil, Kashinath R.; Haram, Santosh K.

    2010-01-01

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 ± 2 μm and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, α-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k 0 ) and electron transfer coefficient (α) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  17. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  18. Quenching of Single-Walled Carbon Nanotube Fluorescence by Dissolved Oxygen Reveals Selective Single-Stranded DNA Affinities.

    Science.gov (United States)

    Zheng, Yu; Bachilo, Sergei M; Weisman, R Bruce

    2017-05-04

    The selective interactions between short oligomers of single-stranded DNA (ssDNA) and specific structures of single-walled carbon nanotubes have been exploited in powerful methods for nanotube sorting. We report here that nanotubes coated with ssDNA also display selective interactions through the selective quenching of nanotube fluorescence by dissolved oxygen. In aqueous solutions equilibrated under 1 atm of O 2 , emission intensity from semiconducting nanotubes is reduced by between 9 and 40%, varying with the combination of ssDNA sequence and nanotube structure. This quenching reverses promptly and completely on the removal of dissolved O 2 and may be due to physisorption on nanotube surfaces. Fluorescence quenching offers a simple, nondestructive approach for studying the structure-selective interactions of ssDNA with single-walled carbon nanotubes and identifying recognition sequences.

  19. Surface treatment on amorphous InGaZnO4 thin film for single-stranded DNA biosensing

    Science.gov (United States)

    Sun, Dali; Matsui, Hiroaki; Wu, Chun-Nan; Tabata, Hitoshi

    2015-01-01

    Amorphous InGaZnO4 (aIGZO) has been widely used as a transparent semiconductor. However, no research has been found yet applying aIGZO to biosensing. This paper examined the single strand DNA (ssDNA) immobilization on aIGZO by absorption with a comparison to ITO, which is the first step for many biosensing schemas. The DNA quantification by florescence intensity shows that the absorption capacity of aIGZO film to ssDNA is 6.7 times greater than that of ITO. XPS and contact angle analysis proved the high DNA absorption affinity on aIGZO film is related to its high effectiveness to OH- attachment. A feasible method to immobilized ssDNA on aIGZO thin film is evaluated in this paper, and consequently, enables a possible approach to apply aIGZO in biosensing.

  20. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana.

    Science.gov (United States)

    Olszewski, Marcin; Grot, Anna; Wojciechowski, Marek; Nowak, Marta; Mickiewicz, Małgorzata; Kur, Józef

    2010-10-15

    In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. We report the characterization of single-stranded DNA binding proteins (SSBs) from the thermophilic bacteria Thermotoga maritima (TmaSSB) and Thermotoga neapolitana (TneSSB). They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively). They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold) in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC) the melting temperature (Tm) was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR).

  1. Charge enhancement of single-stranded DNA in negative electrospray ionization using the supercharging reagent meta-nitrobenzyl alcohol.

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1% m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1% m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  2. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  3. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB).

    Science.gov (United States)

    van Loon, Barbara; Samson, Leona D

    2013-03-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  4. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata

    2010-10-01

    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  5. Aptamer based voltammetric determination of ampicillin using a single-stranded DNA binding protein and DNA functionalized gold nanoparticles.

    Science.gov (United States)

    Wang, Jun; Ma, Kui; Yin, Huanshun; Zhou, Yunlei; Ai, Shiyun

    2017-12-20

    An aptamer based method is described for the electrochemical determination of ampicillin. It is based on the use of DNA aptamer, DNA functionalized gold nanoparticles (DNA-AuNPs), and single-stranded DNA binding protein (ssDNA-BP). When the aptamer hybridizes with the target DNA on the AuNPs, the ssDNA-BP is captured on the electrode surface via its specific interaction with ss-DNA. This results in a decreased electrochemical signal of the redox probe Fe(CN) 6 3- which is measured best at a voltage of 0.188 mV (vs. reference electrode). In the presence of ampicillin, the formation of aptamer-ampicillin conjugate blocks the further immobilization of DNA-AuNPs and ssDNA-BP, and this leads to an increased response. The method has a linear reposne that convers the 1 pM to 5 nM ampicillin concentration range, with a 0.38 pM detection limit (at an S/N ratio of 3). The assay is selective, stable and reproducible. It was applied to the determination of ampicillin in spiked milk samples where it gave recoveries ranging from 95.5 to 105.5%. Graphical abstract Schematic of a simple and sensitive electrochemical apta-biosensor for ampicillin detection. It is based on the use of gold nanoparticles (AuNPs), DNA aptamer, DNA functionalized AuNPs (DNA-AuNPs), and single-strand DNA binding protein (SSBP).

  6. Heterochromatin Reorganization during Early Mouse Development Requires a Single-Stranded Noncoding Transcript

    Directory of Open Access Journals (Sweden)

    Miguel Casanova

    2013-09-01

    Full Text Available The equalization of pericentric heterochromatin from distinct parental origins following fertilization is essential for genome function and development. The recent implication of noncoding transcripts in this process raises questions regarding the connection between RNA and the nuclear organization of distinct chromatin environments. Our study addresses the interrelationship between replication and transcription of the two parental pericentric heterochromatin (PHC domains and their reorganization during early embryonic development. We demonstrate that the replication of PHC is dispensable for its clustering at the late two-cell stage. In contrast, using parthenogenetic embryos, we show that pericentric transcripts are essential for this reorganization independent of the chromatin marks associated with the PHC domains. Finally, our discovery that only reverse pericentric transcripts are required for both the nuclear reorganization of PHC and development beyond the two-cell stage challenges current views on heterochromatin organization.

  7. Genome-wide Single-Molecule Footprinting Reveals High RNA Polymerase II Turnover at Paused Promoters.

    Science.gov (United States)

    Krebs, Arnaud R; Imanci, Dilek; Hoerner, Leslie; Gaidatzis, Dimos; Burger, Lukas; Schübeler, Dirk

    2017-08-03

    Transcription initiation entails chromatin opening followed by pre-initiation complex formation and RNA polymerase II recruitment. Subsequent polymerase elongation requires additional signals, resulting in increased residence time downstream of the start site, a phenomenon referred to as pausing. Here, we harnessed single-molecule footprinting to quantify distinct steps of initiation in vivo throughout the Drosophila genome. This identifies the impact of promoter structure on initiation dynamics in relation to nucleosomal occupancy. Additionally, perturbation of transcriptional initiation reveals an unexpectedly high turnover of polymerases at paused promoters-an observation confirmed at the level of nascent RNAs. These observations argue that absence of elongation is largely caused by premature termination rather than by stable polymerase stalling. In support of this non-processive model, we observe that induction of the paused heat shock promoter depends on continuous initiation. Our study provides a framework to quantify protein binding at single-molecule resolution and refines concepts of transcriptional pausing. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  8. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.

    1994-01-01

    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  9. Novel AgoshRNA molecules for silencing of the CCR5 co-receptor for HIV-1 infection.

    Science.gov (United States)

    Herrera-Carrillo, Elena; Berkhout, Ben

    2017-01-01

    Allogeneic transplantation of blood stem cells from a CCR5-Δ32 homozygous donor to an HIV-infected individual, the "Berlin patient", led to a cure. Since then there has been a search for approaches that mimic this intervention in a gene therapy setting. RNA interference (RNAi) has evolved as a powerful tool to regulate gene expression in a sequence-specific manner and can be used to inactivate the CCR5 mRNA. Short hairpin RNA (shRNA) molecules can impair CCR5 expression, but these molecules may cause unintended side effects and they will not be processed in cells that lack Dicer, such as monocytes. Dicer-independent RNAi pathways have opened opportunities for new AgoshRNA designs that rely exclusively on Ago2 for maturation. Furthermore, AgoshRNA processing yields a single active guide RNA, thus reducing off-target effects. In this study, we tested different AgoshRNA designs against CCR5. We selected AgoshRNAs that potently downregulated CCR5 expression on human T cells and peripheral blood mononuclear cells (PBMC) and that had no apparent adverse effect on T cell development as assessed in a competitive cell growth assay. CCR5 knockdown significantly protected T cells from CCR5 tropic HIV-1 infection.

  10. RNA force field with accuracy comparable to state-of-the-art protein force fields.

    Science.gov (United States)

    Tan, Dazhi; Piana, Stefano; Dirks, Robert M; Shaw, David E

    2018-02-13

    Molecular dynamics (MD) simulation has become a powerful tool for characterizing at an atomic level of detail the conformational changes undergone by proteins. The application of such simulations to RNA structures, however, has proven more challenging, due in large part to the fact that the physical models ("force fields") available for MD simulations of RNA molecules are substantially less accurate in many respects than those currently available for proteins. Here, we introduce an extensive revision of a widely used RNA force field in which the parameters have been modified, based on quantum mechanical calculations and existing experimental information, to more accurately reflect the fundamental forces that stabilize RNA structures. We evaluate these revised parameters through long-timescale MD simulations of a set of RNA molecules that covers a wide range of structural complexity, including single-stranded RNAs, RNA duplexes, RNA hairpins, and riboswitches. The structural and thermodynamic properties measured in these simulations exhibited dramatically improved agreement with experimentally determined values. Based on the comparisons we performed, this RNA force field appears to achieve a level of accuracy comparable to that of state-of-the-art protein force fields, thus significantly advancing the utility of MD simulation as a tool for elucidating the structural dynamics and function of RNA molecules and RNA-containing biological assemblies. Copyright © 2018 the Author(s). Published by PNAS.

  11. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    Science.gov (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Insects' RNA Profiling Reveals Absence of "Hidden Break" in 28S Ribosomal RNA Molecule of Onion Thrips, Thrips tabaci.

    Science.gov (United States)

    Macharia, Rosaline Wanjiru; Ombura, Fidelis Levi; Aroko, Erick Onyango

    2015-01-01

    With an exception of aphids, insects' 28S rRNA is thought to harbor a "hidden break" which cleaves under denaturing conditions to comigrate with 18S rRNA band to exhibit a degraded appearance on native agarose gels. The degraded appearance confounds determination of RNA integrity in laboratories that rely on gel electrophoresis. To provide guidelines for RNA profiles, RNA from five major insect orders, namely, Diptera, Hemiptera, Thysanoptera, Hymenoptera, and Lepidoptera, was compared under denaturing and nondenaturing conditions. This study confirmed that although present in most of insect's RNA, the "hidden break" is absent in the 28S rRNA of onion thrips, Thrips tabaci. On the other hand, presence of "hidden break" was depicted in whiteflies' 28S rRNA despite their evolutionary grouping under same order with aphids. Divergence of 28S rRNA sequences confirms variation of both size and composition of gap region among insect species. However, phylogeny reconstruction does not support speciation as a possible source of the hidden break in insect's 28S rRNA. In conclusion, we show that RNA from a given insect order does not conform to a particular banding profile and therefore this approach cannot be reliably used to characterize newly discovered species.

  13. Therapeutic Effect of Novel Single-Stranded RNAi Agent Targeting Periostin in Eyes with Retinal Neovascularization

    Directory of Open Access Journals (Sweden)

    Takahito Nakama

    2017-03-01

    Full Text Available Retinal neovascularization (NV due to retinal ischemia remains one of the principal causes of vision impairment in patients with ischemic retinal diseases. We recently reported that periostin (POSTN may play a role in the development of preretinal fibrovascular membranes, but its role in retinal NV has not been determined. The purpose of this study was to examine the expression of POSTN in the ischemic retinas of a mouse model of oxygen-induced retinal NV. We also studied the function of POSTN on retinal NV using Postn KO mice and human retinal endothelial cells (HRECs in culture. In addition, we used a novel RNAi agent, NK0144, which targets POSTN to determine its effect on the development of retinal NV. Our results showed that the expression of POSTN was increased in the vascular endothelial cells, pericytes, and M2 macrophages in ischemic retinas. POSTN promoted the ischemia-induced retinal NV by Akt phosphorylation through integrin αvβ3. NK0144 had a greater inhibitory effect than canonical double-stranded siRNA on preretinal pathological NV in vivo and in vitro. These findings suggest a causal relationship between POSTN and retinal NV, and indicate a potential therapeutic role of intravitreal injection of NK0144 for retinal neovascular diseases.

  14. Genetic evidence for single-strand lesions initiating Nbs1-dependent homologous recombination in diversification of Ig v in chicken B lymphocytes.

    Directory of Open Access Journals (Sweden)

    Makoto Nakahara

    2009-01-01

    Full Text Available Homologous recombination (HR is initiated by DNA double-strand breaks (DSB. However, it remains unclear whether single-strand lesions also initiate HR in genomic DNA. Chicken B lymphocytes diversify their Immunoglobulin (Ig V genes through HR (Ig gene conversion and non-templated hypermutation. Both types of Ig V diversification are initiated by AID-dependent abasic-site formation. Abasic sites stall replication, resulting in the formation of single-stranded gaps. These gaps can be filled by error-prone DNA polymerases, resulting in hypermutation. However, it is unclear whether these single-strand gaps can also initiate Ig gene conversion without being first converted to DSBs. The Mre11-Rad50-Nbs1 (MRN complex, which produces 3' single-strand overhangs, promotes the initiation of DSB-induced HR in yeast. We show that a DT40 line expressing only a truncated form of Nbs1 (Nbs1(p70 exhibits defective HR-dependent DSB repair, and a significant reduction in the rate--though not the fidelity--of Ig gene conversion. Interestingly, this defective gene conversion was restored to wild type levels by overproduction of Escherichia coli SbcB, a 3' to 5' single-strand-specific exonuclease, without affecting DSB repair. Conversely, overexpression of chicken Exo1 increased the efficiency of DSB-induced gene-targeting more than 10-fold, with no effect on Ig gene conversion. These results suggest that Ig gene conversion may be initiated by single-strand gaps rather than by DSBs, and, like SbcB, the MRN complex in DT40 may convert AID-induced lesions into single-strand gaps suitable for triggering HR. In summary, Ig gene conversion and hypermutation may share a common substrate-single-stranded gaps. Genetic analysis of the two types of Ig V diversification in DT40 provides a unique opportunity to gain insight into the molecular mechanisms underlying the filling of gaps that arise as a consequence of replication blocks at abasic sites, by HR and error

  15. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian

    2012-07-06

    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  16. Ambient pollutants, polymorphisms associated with microRNA processing and adhesion molecules: the Normative Aging Study

    Directory of Open Access Journals (Sweden)

    Vokonas Pantel S

    2011-05-01

    Full Text Available Abstract Background Particulate air pollution has been associated with cardiovascular morbidity and mortality, but it remains unclear which time windows and pollutant sources are most critical. MicroRNA (miRNA is thought to be involved in cardiovascular regulation. However, little is known about whether polymorphisms in genes that process microRNAs influence response to pollutant exposure. We hypothesized that averaging times longer than routinely measured one or two day moving averages are associated with higher soluble intercellular adhesion molecule-1 (sICAM-1 and vascular cell adhesion molecule-1 (sVCAM-1 levels, and that stationary and mobile sources contribute differently to these effects. We also investigated whether single nucleotide polymorphisms (SNPs in miRNA-processing genes modify these associations. Methods sICAM-1 and sVCAM-1 were measured from 1999-2008 and matched to air pollution monitoring for fine particulate matter (PM2.5 black carbon, and sulfates (SO42-. We selected 17 SNPs in five miRNA-processing genes. Mixed-effects models were used to assess effects of pollutants, SNPs, and interactions under recessive inheritance models using repeated measures. Results 723 participants with 1652 observations and 1-5 visits were included in our analyses for black carbon and PM2.5. Sulfate data was available for 672 participants with 1390 observations. An interquartile range change in seven day moving average of PM2.5 (4.27 μg/m3 was associated with 3.1% (95%CI: 1.6, 4.6 and 2.5% (95%CI: 0.6, 4.5 higher sICAM-1 and sVCAM-1. Interquartile range changes in sulfates (1.39 μg/m3 were associated with 1.4% higher (95%CI: 0.04, 2.7 and 1.6% (95%CI: -0.4, 3.7 higher sICAM-1 and sVCAM-1 respectively. No significant associations were observed for black carbon. In interaction models with PM2.5, both sICAM-1 and sVCAM-1 levels were lower in rs1062923 homozygous carriers. These interactions remained significant after multiple comparisons

  17. Double-stranded DNA dissociates into single strands when dragged into a poor solvent.

    Science.gov (United States)

    Cui, Shuxun; Yu, Jin; Kühner, Ferdinand; Schulten, Klaus; Gaub, Hermann E

    2007-11-28

    DNA displays a richness of biologically relevant supramolecular structures, which depend on both sequence and ambient conditions. The effect of dragging double-stranded DNA (dsDNA) from water into poor solvent on the double-stranded structure is still unclear because of condensation. Here, we employed single molecule techniques based on atomic force microscopy and molecular dynamics (MD) simulations to investigate the change in structure and mechanics of DNA during the ambient change. We found that the two strands are split apart when the dsDNA is pulled at one strand from water into a poor solvent. The findings were corroborated by MD simulations where dsDNA was dragged from water into poor solvent, revealing details of the strand separation at the water/poor solvent interface. Because the structure of DNA is of high polarity, all poor solvents show a relatively low polarity. We speculate that the principle of spontaneous unwinding/splitting of dsDNA by providing a low-polarity (in other word, hydrophobic) micro-environment is exploited as one of the catalysis mechanisms of helicases.

  18. Sequence variation of the human immunodeficiency virus primer-binding site suggests the use of an alternative tRNA(Lys) molecule in reverse transcription

    NARCIS (Netherlands)

    Das, A. T.; Klaver, B.; Berkhout, B.

    1997-01-01

    Retroviruses use a cellular tRNA molecule as primer for reverse transcription. The complementarity between the 3' end of this tRNA and a sequence near the 5' end of the viral RNA, the primer-binding site (PBS), allows the primer to anneal onto the viral RNA. During reverse transcription 18

  19. Enthalpy-Driven RNA Folding: Single-Molecule Thermodynamics of Tetraloop–Receptor Tertiary Interaction†

    Science.gov (United States)

    Fiore, Julie L.; Kraemer, Benedikt; Koberling, Felix; Edmann, Rainer; Nesbitt, David J.

    2010-01-01

    RNA folding thermodynamics are crucial for structure prediction, which requires characterization of both enthalpic and entropic contributions of tertiary motifs to conformational stability. We explore the temperature dependence of RNA folding due to the ubiquitous GAAA tetraloop–receptor docking interaction, exploiting immobilized and freely diffusing single-molecule fluorescence resonance energy transfer (smFRET) methods. The equilibrium constant for intramolecular docking is obtained as a function of temperature (T = 21–47 °C), from which a van’t Hoff analysis yields the enthalpy (ΔH°) and entropy (ΔS°) of docking. Tetraloop–receptor docking is significantly exothermic and entropically unfavorable in 1 mM MgCl2 and 100 mM NaCl, with excellent agreement between immobilized (ΔH° = −17.4 ± 1.6 kcal/mol, and ΔS° = −56.2 ± 5.4 cal mol−1 K−1) and freely diffusing (ΔH° = −17.2 ± 1.6 kcal/mol, and ΔS° = −55.9 ± 5.2 cal mol−1 K−1) species. Kinetic heterogeneity in the tetraloop–receptor construct is unaffected over the temperature range investigated, indicating a large energy barrier for interconversion between the actively docking and nondocking subpopulations. Formation of the tetraloop–receptor interaction can account for ~60% of the ΔH° and ΔS° of P4–P6 domain folding in the Tetrahymena ribozyme, suggesting that it may act as a thermodynamic clamp for the domain. Comparison of the isolated tetraloop–receptor and other tertiary folding thermodynamics supports a theme that enthalpy- versus entropy-driven folding is determined by the number of hydrogen bonding and base stacking interactions. PMID:19186984

  20. Identification and characterization of single-stranded DNA-binding protein from the facultative psychrophilic bacteria Pseudoalteromonas haloplanktis.

    Science.gov (United States)

    Olszewski, Marcin; Nowak, Marta; Cyranka-Czaja, Anna; Kur, Józef

    2014-01-01

    Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism such as DNA replication, repair, and recombination, and is essential for cell survival. This study reports on the ssb-like gene cloning, gene expression and characterization of a single-stranded DNA-binding protein of Pseudoalteromonas haloplanktis (PhaSSB) and is the first report of such a protein from psychrophilic microorganism. PhaSSB possesses a high sequence similarity to Escherichia coli SSB (48% identity and 57% similarity) and has the longest amino acid sequence (244 amino acid residues) of all the known bacterial SSBs with one OB-fold per monomer. An analysis of purified PhaSSB by means of chemical cross-linking experiments, sedimentation analysis and size exclusion chromatography revealed a stable tetramer in solution. Using EMSA, we characterized the stoichiometry of PhaSSB complexed with a series of ssDNA homopolymers, and the size of the binding site was determined as being approximately 35 nucleotides long. In fluorescence titrations, the occluded site size of PhaSSB on poly(dT) is 34 nucleotides per tetramer under low-salt conditions (2mM NaCl), but increases to 54-64 nucleotides at higher-salt conditions (100-300mM NaCl). This suggests that PhaSSB undergoes a transition between ssDNA binding modes, which is observed for EcoSSB. The binding properties of PhaSSB investigated using SPR technology revealed that the affinity of PhaSSB to ssDNA is typical of SSB proteins. The only difference in the binding mode of PhaSSB to ssDNA is a faster association phase, when compared to EcoSSB, though compensated by faster dissociation rate. When analyzed by differential scanning calorimetry (DSC), the melting temperature (Tm) was determined as 63 °C, which is only a few degrees lower than for EcoSSB. Copyright © 2013 Elsevier GmbH. All rights reserved.

  1. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii.

    Science.gov (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten

    2012-01-01

    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  2. Towards 3D structure prediction of large RNA molecules: an integer programming framework to insert local 3D motifs in RNA secondary structure.

    Science.gov (United States)

    Reinharz, Vladimir; Major, François; Waldispühl, Jérôme

    2012-06-15

    The prediction of RNA 3D structures from its sequence only is a milestone to RNA function analysis and prediction. In recent years, many methods addressed this challenge, ranging from cycle decomposition and fragment assembly to molecular dynamics simulations. However, their predictions remain fragile and limited to small RNAs. To expand the range and accuracy of these techniques, we need to develop algorithms that will enable to use all the structural information available. In particular, the energetic contribution of secondary structure interactions is now well documented, but the quantification of non-canonical interactions-those shaping the tertiary structure-is poorly understood. Nonetheless, even if a complete RNA tertiary structure energy model is currently unavailable, we now have catalogues of local 3D structural motifs including non-canonical base pairings. A practical objective is thus to develop techniques enabling us to use this knowledge for robust RNA tertiary structure predictors. In this work, we introduce RNA-MoIP, a program that benefits from the progresses made over the last 30 years in the field of RNA secondary structure prediction and expands these methods to incorporate the novel local motif information available in databases. Using an integer programming framework, our method refines predicted secondary structures (i.e. removes incorrect canonical base pairs) to accommodate the insertion of RNA 3D motifs (i.e. hairpins, internal loops and k-way junctions). Then, we use predictions as templates to generate complete 3D structures with the MC-Sym program. We benchmarked RNA-MoIP on a set of 9 RNAs with sizes varying from 53 to 128 nucleotides. We show that our approach (i) improves the accuracy of canonical base pair predictions; (ii) identifies the best secondary structures in a pool of suboptimal structures; and (iii) predicts accurate 3D structures of large RNA molecules. RNA-MoIP is publicly available at: http://csb.cs.mcgill.ca/RNAMoIP.

  3. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der

    1978-01-01

    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  4. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.

    1982-01-01

    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  5. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

    1982-01-01

    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  6. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.

    2006-01-01

    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  7. Identification of RNA molecules by specific enzyme digestion and mass spectrometry: software for and implementation of RNA mass mapping

    DEFF Research Database (Denmark)

    Matthiesen, Rune; Kirpekar, Finn

    2009-01-01

    . The concept for identification is that the masses of the digestion products constitute a specific fingerprint, which characterize the given RNA. The search algorithm is based on the same principles as those used in peptide mass fingerprinting, but has here been extended to work for both RNA sequence databases...... and for genome searches. A simple and powerful probability model for ranking RNA matches is proposed. We demonstrate viability of the entire setup by identifying the DNA template of a series of RNAs of biological and of in vitro transcriptional origin in complete microbial genomes and by identifying authentic 16...

  8. Functional analysis of multiple single-stranded DNA-binding proteins from Methanosarcina acetivorans and their effects on DNA synthesis by DNA polymerase BI.

    Science.gov (United States)

    Robbins, Justin B; Murphy, Mary C; White, Bryan A; Mackie, Roderick I; Ha, Taekjip; Cann, Isaac K O

    2004-02-20

    Single-stranded DNA-binding proteins and their functional homologs, replication protein A, are essential components of cellular DNA replication, repair and recombination. We describe here the isolation and characterization of multiple replication protein A homologs, RPA1, RPA2, and RPA3, from the archaeon Methanosarcina acetivorans. RPA1 comprises four single-stranded DNA-binding domains, while RPA2 and RPA3 are each composed of two such domains and a zinc finger domain. Gel filtration analysis suggested that RPA1 exists as homotetramers and homodimers in solution, while RPA2 and RPA3 form only homodimers. Unlike the multiple RPA proteins found in other Archaea and eukaryotes, each of the M. acetivorans RPAs can act as a distinct single-stranded DNA-binding protein. Fluorescence resonance energy transfer and fluorescence polarization anisotropy studies revealed that the M. acetivorans RPAs bind to as few as 10 single-stranded DNA bases. However, more stable binding is achieved with single-stranded DNA of 18-23 bases, and for such substrates the estimated Kd was 3.82 +/- 0.28 nM, 173.6 +/- 105.17 nM, and 5.92 +/- 0.23 nM, for RPA1, RPA2, and RPA3, respectively. The architectures of the M. acetivorans RPAs are different from those of hitherto reported homologs. Thus, these proteins may represent novel forms of replication protein A. Most importantly, our results show that the three RPAs and their combinations highly stimulate the primer extension capacity of M. acetivorans DNA polymerase BI. Although bacterial SSB and eukaryotic RPA have been shown to stimulate DNA synthesis by their cognate DNA polymerases, our findings provide the first in vitro biochemical evidence for the conservation of this property in an archaeon.

  9. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  10. EFFECTOR OF TRANSCRIPTION2 is involved in xylem differentiation and includes a functional DNA single strand cutting domain.

    Science.gov (United States)

    Ivanov, Rumen; Tiedemann, Jens; Czihal, Andreas; Schallau, Anna; Diep, Le Hong; Mock, Hans-Peter; Claus, Bernhard; Tewes, Annegret; Bäumlein, Helmut

    2008-01-01

    EFFECTORS OF TRANSCRIPTION2 (ET) are plant-specific regulatory proteins characterized by the presence of two to five C-terminal DNA- and Zn-binding repeats, and a highly conserved cysteine pattern. We describe the structural characterization of the three member Arabidopsis thaliana ET gene family and reveal some allelic sequence polymorphisms. A mutation analysis showed that AtET2 affects the expression of various KNAT genes involved in the maintenance of the undifferentiated state of cambial meristem cells. It also plays a role in the regulation of GA5 (gibberellin 3-beta-dioxygenase) and the cell-cycle-related GASA4. A correlation was established between AtET2 expression and the cellular differentiation state. AtET-GFP fusion proteins shuttle between the cytoplasm and nucleus, with the AtET2 product prevented from entering the nucleus in non-differentiating cells. Within the nucleus, AtET2 probably acts via a single strand cutting domain. A more general regulatory role for ET factors is proposed, governing cell differentiation in cambial meristems, a crucial process for the development of plant vascular tissues.

  11. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.

    1985-01-01

    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  12. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))

    1993-03-01

    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  13. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA.

    Science.gov (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi

    2008-03-28

    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  14. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  15. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  16. Disease Control in Animals Using Molecular Technology by Inactivation of ASO, RNAi and ss-siRNA Genes

    Directory of Open Access Journals (Sweden)

    Muhamad Ali

    2014-03-01

    Full Text Available Globalization causes high mobility of human and livestock, hence increase the transmission of infectious diseases, including avian influenza, severe acute respiratory syndrome (SARS, and swine influenza. Therefore, prevention of those diseases is required. Vaccines are effective to prevent infectious diseases; however, their development takes a long time and they cannot provide immediate protection in pandemic cases. This paper describes several gene silencing technologies including antisense oligonucleotide (ASO, RNA interference (RNAi and single strand-small interfering RNA (ss-siRNA for controlling diseases. The primary mechanism of these technologies is inhibition of gene expression, typically by causing the destruction of specific RNA molecule of the pathogen. The use of gene silencing technologies is expected to give new alternative that is more effective in eradication of infectious diseases in animals before threaten human being.

  17. In Situ Detection of MicroRNA Expression with RNAscope Probes.

    Science.gov (United States)

    Yin, Viravuth P

    2018-01-01

    Elucidating the spatial resolution of gene transcripts provides important insight into potential gene function. MicroRNAs are short, singled-stranded noncoding RNAs that control gene expression through base-pair complementarity with target mRNAs in the 3' untranslated region (UTR) and inhibiting protein expression. However, given their small size of ~22- to 24-nt and low expression levels, standard in situ hybridization detection methods are not amendable for microRNA spatial resolution. Here, I describe a technique that employs RNAscope probe design and propriety amplification technology that provides simultaneous single molecule detection of individual microRNA and its target gene. This method allows for rapid and sensitive detection of noncoding RNA transcripts in frozen tissue sections.

  18. Different combinations of atomic interactions predict protein-small molecule and protein-DNA/RNA affinities with similar accuracy.

    Science.gov (United States)

    Dias, Raquel; Kolazckowski, Bryan

    2015-11-01

    Interactions between proteins and other molecules play essential roles in all biological processes. Although it is widely held that a protein's ligand specificity is determined primarily by its three-dimensional structure, the general principles by which structure determines ligand binding remain poorly understood. Here we use statistical analyses of a large number of protein-ligand complexes with associated binding-affinity measurements to quantitatively characterize how combinations of atomic interactions contribute to ligand affinity. We find that there are significant differences in how atomic interactions determine ligand affinity for proteins that bind small chemical ligands, those that bind DNA/RNA and those that interact with other proteins. Although protein-small molecule and protein-DNA/RNA binding affinities can be accurately predicted from structural data, models predicting one type of interaction perform poorly on the others. Additionally, the particular combinations of atomic interactions required to predict binding affinity differed between small-molecule and DNA/RNA data sets, consistent with the conclusion that the structural bases determining ligand affinity differ among interaction types. In contrast to what we observed for small-molecule and DNA/RNA interactions, no statistical models were capable of predicting protein-protein affinity with >60% correlation. We demonstrate the potential usefulness of protein-DNA/RNA binding prediction as a possible tool for high-throughput virtual screening to guide laboratory investigations, suggesting that quantitative characterization of diverse molecular interactions may have practical applications as well as fundamentally advancing our understanding of how molecular structure translates into function. © 2015 The Authors. Proteins: Structure, Function, and Bioinformatics Published by Wiley Periodicals, Inc.

  19. Assessing Specific Oligonucleotides and Small Molecule Antibiotics for the Ability to Inhibit the CRD-BP-CD44 RNA Interaction

    Science.gov (United States)

    Thomsen, Dana; Lee, Chow H.

    2014-01-01

    Studies on Coding Region Determinant-Binding Protein (CRD-BP) and its orthologs have confirmed their functional role in mRNA stability and localization. CRD-BP is present in extremely low levels in normal adult tissues, but it is over-expressed in many types of aggressive human cancers and in neonatal tissues. Although the exact role of CRD-BP in tumour progression is unclear, cumulative evidence suggests that its ability to physically associate with target mRNAs is an important criterion for its oncogenic role. CRD-BP has high affinity for the 3′UTR of the oncogenic CD44 mRNA and depletion of CRD-BP in cells led to destabilization of CD44 mRNA, decreased CD44 expression, reduced adhesion and disruption of invadopodia formation. Here, we further characterize the CRD-BP-CD44 RNA interaction and assess specific antisense oligonucleotides and small molecule antibiotics for their ability to inhibit the CRD-BP-CD44 RNA interaction. CRD-BP has a high affinity for binding to CD44 RNA nts 2862–3055 with a Kd of 645 nM. Out of ten antisense oligonucleotides spanning nts 2862–3055, only three antisense oligonucleotides (DD4, DD7 and DD10) were effective in competing with CRD-BP for binding to 32P-labeled CD44 RNA. The potency of DD4, DD7 and DD10 in inhibiting the CRD-BP-CD44 RNA interaction in vitro correlated with their ability to specifically reduce the steady-state level of CD44 mRNA in cells. The aminoglycoside antibiotics neomycin, paramomycin, kanamycin and streptomycin effectively inhibited the CRD-BP-CD44 RNA interaction in vitro. Assessing the potential inhibitory effect of aminoglycoside antibiotics including neomycin on the CRD-BP-CD44 mRNA interaction in cells proved difficult, likely due to their propensity to non-specifically bind nucleic acids. Our results have important implications for future studies in finding small molecules and nucleic acid-based inhibitors that interfere with protein-RNA interactions. PMID:24622399

  20. Porcine blood mononuclear cell cytokine responses to PAMP molecules: comparison of mRNA and protein production

    DEFF Research Database (Denmark)

    Sørensen, Nanna Skall; Skovgaard, Kerstin; Heegaard, Peter M. H.

    2011-01-01

    Pathogen-associated molecular patterns (PAMPs) are conserved molecules of microorganisms inducing innate immune cells to secrete distinct patterns of cytokines. In veterinary species, due to a lack of specific antibodies, cytokines are often monitored as expressed mRNA only. This study investigated...... the induction of IFN-α, IL-12 p40, IL-1β, TNF-α, IL-6 and IL-10 by PAMP-molecules [CpG oligonucleotide D19 (CpG), peptidoglycan (PGN), lipopolysaccharide (LPS), Pam3Cys and poly-U] in porcine blood mononuclear cells (BMC) within a 24h period. As expected, cytokine responses were PAMP-specific, CpG inducing IFN...

  1. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  2. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA.

    Science.gov (United States)

    Rogers, Cody M; Bochman, Matthew L

    2017-05-13

    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage

    Science.gov (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio

    1998-01-01

    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  4. Slowing single-stranded DNA translocation through a solid-state nanopore by decreasing the nanopore diameter.

    Science.gov (United States)

    Akahori, Rena; Haga, Takanobu; Hatano, Toshiyuki; Yanagi, Itaru; Ohura, Takeshi; Hamamura, Hirotaka; Iwasaki, Tomio; Yokoi, Takahide; Anazawa, Takashi

    2014-07-11

    To slow the translocation of single-stranded DNA (ssDNA) through a solid-state nanopore, a nanopore was narrowed, and the effect of the narrowing on the DNA translocation speed was investigated. In order to accurately measure the speed, long (5.3 kb) ssDNA (namely, ss-poly(dA)) with uniform length (±0.4 kb) was synthesized. The diameters of nanopores fabricated by a transmission electron microscope were controlled by atomic-layer deposition. Reducing the nanopore diameter from 4.5 to 2.3 nm slowed down the translocation of ssDNA by more than 16 times (to 0.18 μs base(-1)) when 300 mV was applied across the nanopore. It is speculated that the interaction between the nanopore and the ssDNA dominates the translocation speed. Unexpectedly, the translocation speed of ssDNA through the 4.5 nm nanopore is more than two orders of magnitude higher than that of double-stranded DNA (dsDNA) through a nanopore of almost the same size. The cause of such a faster translocation of ssDNA can be explained by the weaker drag force inside the nanopore. Moreover, the measured translocation speeds of ssDNA and dsDNA agree well with those calculated by molecular-dynamics (MD) simulation. The MD simulation predicted that reducing the nanopore diameter to almost the same as that of ssDNA (i.e. 1.4 nm) decreases the translocation speed (to 1.4 μs base(-1)). Narrowing the nanopore is thus an effective approach for accomplishing nanopore DNA sequencing.

  5. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler

    2007-12-01

    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  6. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines.

    Science.gov (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao

    2017-07-01

    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  7. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Alteration of RNA splicing by small molecule inhibitors of the interaction between NHP2L1 and U4

    Science.gov (United States)

    Diouf, Barthelemy; Lin, Wenwei; Goktug, Asli; Grace, Christy R. R.; Waddell, Michael Brett; Bao, Ju; Shao, Youming; Heath, Richard J.; Zheng, Jie J.; Shelat, Anang A.; Relling, Mary V.; Chen, Taosheng; Evans, William E.

    2018-01-01

    Splicing is an important eukaryotic mechanism for expanding the transcriptome and proteome, influencing a number of biological processes. Understanding its regulation and identifying small molecules that modulate this process remains a challenge. We developed an assay based on time-resolved FRET (TR-FRET) to detect the interaction between the protein NHP2L1 and U4 RNA, which are two key components of the spliceosome. We used this assay to identify small molecules that interfere with this interaction in a high-throughput screening (HTS) campaign. Topotecan and other camptothecin derivatives were among the top hits. We confirmed that topotecan disrupts the interaction between NHP2L1 and U4 by binding to U4 and inhibits RNA splicing. Our data reveal new functions of known drugs which could facilitate the development of therapeutic strategies to modify splicing and alter gene function. PMID:28985478

  9. Small Molecule Binding, Docking, and Characterization of the Interaction between Pth1 and Peptidyl-tRNA

    Directory of Open Access Journals (Sweden)

    Mary C. Hames

    2013-11-01

    Full Text Available Bacterial Pth1 is essential for viability. Pth1 cleaves the ester bond between the peptide and nucleotide of peptidyl-tRNA generated from aborted translation, expression of mini-genes, and short ORFs. We have determined the shape of the Pth1:peptidyl-tRNA complex using small angle neutron scattering. Binding of piperonylpiperazine, a small molecule constituent of a combinatorial synthetic library common to most compounds with inhibitory activity, was mapped to Pth1 via NMR spectroscopy. We also report computational docking results, modeling piperonylpiperazine binding based on chemical shift perturbation mapping. Overall these studies promote Pth1 as a novel antibiotic target, contribute to understanding how Pth1 interacts with its substrate, advance the current model for cleavage, and demonstrate feasibility of small molecule inhibition.

  10. Design of a Bioactive Small Molecule that Targets the Myotonic Dystrophy Type 1 RNA Via an RNA Motif-Ligand Database & Chemical Similarity Searching

    Science.gov (United States)

    Parkesh, Raman; Childs-Disney, Jessica L.; Nakamori, Masayuki; Kumar, Amit; Wang, Eric; Wang, Thomas; Hoskins, Jason; Tran, Tuan; Housman, David; Thornton, Charles A.; Disney, Matthew D.

    2012-01-01

    Myotonic dystrophy type 1 (DM1) is a triplet repeating disorder caused by expanded CTG repeats in the 3′ untranslated region of the dystrophia myotonica protein kinase (DMPK) gene. The transcribed repeats fold into an RNA hairpin with multiple copies of a 5′CUG/3′GUC motif that binds the RNA splicing regulator muscleblind-like 1 protein (MBNL1). Sequestration of MBNL1 by expanded r(CUG) repeats causes splicing defects in a subset of pre-mRNAs including the insulin receptor, the muscle-specific chloride ion channel, Sarco(endo)plasmic reticulum Ca2+ ATPase 1 (Serca1/Atp2a1), and cardiac troponin T (cTNT). Based on these observations, the development of small molecule ligands that target specifically expanded DM1 repeats could serve as therapeutics. In the present study, computational screening was employed to improve the efficacy of pentamidine and Hoechst 33258 ligands that have been shown previously to target the DM1 triplet repeat. A series of inhibitors of the RNA-protein complex with low micromolar IC50’s, which are >20-fold more potent than the query compounds, were identified. Importantly, a bis-benzimidazole identified from the Hoechst query improves DM1-associated pre-mRNA splicing defects in cell and mouse models of DM1 (when dosed with 1 mM and 100 mg/kg, respectively). Since Hoechst 33258 was identified as a DM1 binder through analysis of an RNA motif-ligand database, these studies suggest that lead ligands targeting RNA with improved biological activity can be identified by using a synergistic approach that combines analysis of known RNA-ligand interactions with virtual screening. PMID:22300544

  11. MicroRNA-34a is a potent tumor suppressor molecule in vivo in neuroblastoma

    LENUS (Irish Health Repository)

    Tivnan, Amanda

    2011-01-25

    ABSTRACT Background Neuroblastoma is a paediatric cancer which originates from precursor cells of the sympathetic nervous system and accounts for 15% of childhood cancer mortalities. With regards to the role of miRNAs in neuroblastoma, miR-34a, mapping to a chromosome 1p36 region that is commonly deleted, has been found to act as a tumor suppressor through targeting of numerous genes associated with cell proliferation and apoptosis. Methods A synthetic miR-34a (or negative control) precursor molecule was transfected into NB1691luc and SK-N-ASluc neuroblastoma cells. Quantitative PCR was used to verify increased miR-34a levels in NB1691luc and SK-N-ASluc cell lines prior to in vitro and in vivo analysis. In vitro analysis of the effects of miR-34a over expression on cell growth, cell cycle and phosphoprotein activation in signal transduction pathways was performed. Neuroblastoma cells over expressing miR-34a were injected retroperitoneally into immunocompromised CB17-SCID mice and tumor burden was assessed over a 21 day period by measuring bioluminescence (photons\\/sec\\/cm2). Results Over expression of miR-34a in both NB1691luc and SK-N-ASluc neuroblastoma cell lines led to a significant decrease in cell number relative to premiR-negative control treated cells over a 72 hour period. Flow cytometry results indicated that miR-34a induced cell cycle arrest and subsequent apoptosis activation. Phosphoprotein analysis highlighted key elements involved in signal transduction, whose activation was dysregulated as a result of miR-34a introduction into cells. As a potential mechanism of miR-34a action on phosphoprotein levels, we demonstrate that miR-34a over-expression results in a significant reduction of MAP3K9 mRNA and protein levels. Although MAP3K9 is a predicted target of miR-34a, direct targeting could not be validated with luciferase reporter assays. Despite this fact, any functional effects of reduced MAP3K9 expression as a result of miR-34a would be expected to

  12. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis.

    Science.gov (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J

    2012-01-01

    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  13. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.

    1992-01-01

    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  14. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  15. Synthesis of a gene for the HIV transactivator protein TAT by a novel single stranded approach involving in vivo gap repair.

    OpenAIRE

    Adams, S E; Johnson, I D; Braddock, M; Kingsman, A J; Kingsman, S M; Edwards, R M

    1988-01-01

    The synthesis of a gene for the HIV TAT protein is described using a novel approach that capitalises on the ability to synthesise oligonucleotides of greater than 100 bp in length. It involves the synthesis of large oligomers covering one strand of the desired gene in its entirety and the use of small complementary bridging and adapter oligonucleotides to direct the assembly and cloning of the large oligomers. After ligation to the cloning vector the partially single stranded intermediate is ...

  16. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers

    OpenAIRE

    Antolin, M. F.; Bosio, C. F.; Cotton, J.; Sweeney, W.; Strand, M. R.; Black-IV, W. C.

    1996-01-01

    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  17. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr

    2015-01-01

    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single- strand ed DNA -binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  18. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  19. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.

    1992-01-01

    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  20. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  1. Bioinformatics Study of Structural Patterns in Plant MicroRNA Precursors.

    Science.gov (United States)

    Miskiewicz, J; Tomczyk, K; Mickiewicz, A; Sarzynska, J; Szachniuk, M

    2017-01-01

    According to the RNA world theory, RNAs which stored genetic information and catalyzed chemical reactions had their contribution in the formation of current living organisms. In recent years, researchers studied this molecule diversity, i.a. focusing on small non-coding regulatory RNAs. Among them, of particular interest is evolutionarily ancient, 19-24 nt molecule of microRNA (miRNA). It has been already recognized as a regulator of gene expression in eukaryotes. In plants, miRNA plays a key role in the response to stress conditions and it participates in the process of growth and development. MicroRNAs originate from primary transcripts (pri-miRNA) encoded in the nuclear genome. They are processed from single-stranded stem-loop RNA precursors containing hairpin structures. While the mechanism of mature miRNA production in animals is better understood, its biogenesis in plants remains less clear. Herein, we present the results of bioinformatics analysis aimed at discovering how plant microRNAs are recognized within their precursors (pre-miRNAs). The study has been focused on sequential and structural motif identification in the neighbourhood of microRNA.

  2. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: simonaclichici@yahoo.com [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)

    2012-03-15

    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  3. Small molecule probes finely differentiate between various ds- and ss-DNA and RNA by fluorescence, CD and NMR response

    Energy Technology Data Exchange (ETDEWEB)

    Crnolatac, Ivo; Rogan, Iva; Majić, Boris; Tomić, Sanja [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia); Deligeorgiev, Todor [Faculty of Chemistry and Pharmacy, University of Sofia (Bulgaria); Horvat, Gordan [Department of Physical Chemistry, Faculty of Science/Chemistry, Horvatovac 102A, HR-10000 Zagreb (Croatia); Makuc, Damjan; Plavec, Janez [Slovenian NMR Centre, National Institute of Chemistry, Hajdrihova 19, Ljubljana (Slovenia); EN-FIST Centre of Excellence, Trg Osvobodilne Fronte 13, Ljubljana (Slovenia); Pescitelli, Gennaro [Department of Chemistry, University of Pisa, Via Moruzzi 13, Pisa (Italy); Piantanida, Ivo, E-mail: pianta@irb.hr [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia)

    2016-10-12

    Two small molecules showed intriguing properties of analytical multipurpose probes, whereby one chromophore gives different signal for many different DNA/RNA by application of several highly sensitive spectroscopic methods. Dyes revealed pronounced fluorescence ratiomeric differentiation between ds-AU-RNA, AT-DNA and GC-DNA in approximate order 10:8:1. Particularly interesting, dyes showed specific fluorimetric response for poly rA even at 10-fold excess of any other ss-RNA, and moreover such emission selectivity is preserved in multicomponent ss-RNA mixtures. The dyes also showed specific chiral recognition of poly rU in respect to the other ss-RNA by induced CD (ICD) pattern in visible range (400–500 nm), which was attributed to the dye-side-chain contribution to binding (confirmed by absence of any ICD band for reference compound lacking side-chain). Most intriguingly, minor difference in the side-chain attached to dye chromophore resulted in opposite sign of dye-ICD pattern, whereby differences in NMR NOESY contacts and proton chemical shifts between two dye/oligo rU complexes combined with MD simulations and CD calculations attributed observed bisignate ICD to the dimeric dye aggregate within oligo rU. - Highlights: • Novel dyes emit fluorescence only for poly rA even at high excess of all other ss-RNA. • Fluorescence response for AT-DNA is 8 times stronger than for GC-DNA. • Florescence induced by ds-RNA is 20% stronger that emission induced by ds-DNA. • Intrinsically non-chiral, dyes show strong and characteristic ICD response for poly rU.

  4. SARNA-Predict: accuracy improvement of RNA secondary structure prediction using permutation-based simulated annealing.

    Science.gov (United States)

    Tsang, Herbert H; Wiese, Kay C

    2010-01-01

    Ribonucleic acid (RNA), a single-stranded linear molecule, is essential to all biological systems. Different regions of the same RNA strand will fold together via base pair interactions to make intricate secondary and tertiary structures that guide crucial homeostatic processes in living organisms. Since the structure of RNA molecules is the key to their function, algorithms for the prediction of RNA structure are of great value. In this article, we demonstrate the usefulness of SARNA-Predict, an RNA secondary structure prediction algorithm based on Simulated Annealing (SA). A performance evaluation of SARNA-Predict in terms of prediction accuracy is made via comparison with eight state-of-the-art RNA prediction algorithms: mfold, Pseudoknot (pknotsRE), NUPACK, pknotsRG-mfe, Sfold, HotKnots, ILM, and STAR. These algorithms are from three different classes: heuristic, dynamic programming, and statistical sampling techniques. An evaluation for the performance of SARNA-Predict in terms of prediction accuracy was verified with native structures. Experiments on 33 individual known structures from eleven RNA classes (tRNA, viral RNA, antigenomic HDV, telomerase RNA, tmRNA, rRNA, RNaseP, 5S rRNA, Group I intron 23S rRNA, Group I intron 16S rRNA, and 16S rRNA) were performed. The results presented in this paper demonstrate that SARNA-Predict can out-perform other state-of-the-art algorithms in terms of prediction accuracy. Furthermore, there is substantial improvement of prediction accuracy by incorporating a more sophisticated thermodynamic model (efn2).

  5. RNAiFold 2.0: a web server and software to design custom and Rfam-based RNA molecules.

    Science.gov (United States)

    Garcia-Martin, Juan Antonio; Dotu, Ivan; Clote, Peter

    2015-07-01

    Several algorithms for RNA inverse folding have been used to design synthetic riboswitches, ribozymes and thermoswitches, whose activity has been experimentally validated. The RNAiFold software is unique among approaches for inverse folding in that (exhaustive) constraint programming is used instead of heuristic methods. For that reason, RNAiFold can generate all sequences that fold into the target structure or determine that there is no solution. RNAiFold 2.0 is a complete overhaul of RNAiFold 1.0, rewritten from the now defunct COMET language to C++. The new code properly extends the capabilities of its predecessor by providing a user-friendly pipeline to design synthetic constructs having the functionality of given Rfam families. In addition, the new software supports amino acid constraints, even for proteins translated in different reading frames from overlapping coding sequences; moreover, structure compatibility/incompatibility constraints have been expanded. With these features, RNAiFold 2.0 allows the user to design single RNA molecules as well as hybridization complexes of two RNA molecules. the web server, source code and linux binaries are publicly accessible at http://bioinformatics.bc.edu/clotelab/RNAiFold2.0. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. GARN2: coarse-grained prediction of 3D structure of large RNA molecules by regret minimization.

    Science.gov (United States)

    Boudard, Mélanie; Barth, Dominique; Bernauer, Julie; Denise, Alain; Cohen, Johanne

    2017-08-15

    Predicting the 3D structure of RNA molecules is a key feature towards predicting their functions. Methods which work at atomic or nucleotide level are not suitable for large molecules. In these cases, coarse-grained prediction methods aim to predict a shape which could be refined later by using more precise methods on smaller parts of the molecule. We developed a complete method for sampling 3D RNA structure at a coarse-grained model, taking a secondary structure as input. One of the novelties of our method is that a second step extracts two best possible structures close to the native, from a set of possible structures. Although our method benefits from the first version of GARN, some of the main features on GARN2 are very different. GARN2 is much faster than the previous version and than the well-known methods of the state-of-art. Our experiments show that GARN2 can also provide better structures than the other state-of-the-art methods. GARN2 is written in Java. It is freely distributed and available at http://garn.lri.fr/. melanie.boudard@lri.fr or johanne.cohen@lri.fr. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  7. A versatile method to design stem-loop primer-based quantitative PCR assays for detecting small regulatory RNA molecules.

    Directory of Open Access Journals (Sweden)

    Zsolt Czimmerer

    Full Text Available Short regulatory RNA-s have been identified as key regulators of gene expression in eukaryotes. They have been involved in the regulation of both physiological and pathological processes such as embryonal development, immunoregulation and cancer. One of their relevant characteristics is their high stability, which makes them excellent candidates for use as biomarkers. Their number is constantly increasing as next generation sequencing methods reveal more and more details of their synthesis. These novel findings aim for new detection methods for the individual short regulatory RNA-s in order to be able to confirm the primary data and characterize newly identified subtypes in different biological conditions. We have developed a flexible method to design RT-qPCR assays that are very sensitive and robust. The newly designed assays were tested extensively in samples from plant, mouse and even human formalin fixed paraffin embedded tissues. Moreover, we have shown that these assays are able to quantify endogenously generated shRNA molecules. The assay design method is freely available for anyone who wishes to use a robust and flexible system for the quantitative analysis of matured regulatory RNA-s.

  8. Quantitative PCR--new diagnostic tool for quantifying specific mRNA and DNA molecules

    DEFF Research Database (Denmark)

    Schlemmer, B O; Sorensen, B S; Overgaard, J

    2004-01-01

    , and the treatment is considered to be justified if the tumor displays an increased amount of HER2. For this reason there is a need for techniques suitable for HER2 measurements. A LightCycler real-time PCR method used for HER2/neu DNA quantification was evaluated and the results compared with those obtained...... significant (p DNA quantification kit" produces results with a high level of reproducibility and its ease of use allows rapid screening for amplification of HER2. In this paper useful information is given on how real-time PCR compares with FISH and IHC. The data show...... of mRNA or DNA in biological samples. In this study quantitative PCR was used to investigate the role of the EGF (epidermal growth factor) system in cancer both for measurements of mRNA concentrations and for measurements of the number of copies of specific genes. It is shown that the mRNA expression...

  9. Steady-state electrophoresis of RNA against a gradient of cationic charges in a polyacrylamide matrix.

    Science.gov (United States)

    Zilberstein, Gleb; Shlar, Ilya; Baskin, Emmanuil; Korol, Leonid; Righetti, Pier Giorgio; Bukshpan, Shmuel

    2009-11-01

    A novel method for separation of RNA fragments is reported here, based on migrating the polyanionic RNA fragments in a polycationic polyacrylamide gel, made by incorporating positively charged monomers (the Immobilines used for creating immobilized pH gradients) into the neutral polyacrylamide backbone. Separations are typically performed in a 0-10 mM, pK 10.3 Immobiline gradient under denaturing conditions (6 M urea). In the 100-1000 bp length, it is shown that separations of RNA are optimal and very sharp bands can be obtained, in comparison with conventional electrophoresis, due to the "focusing" effect originated by the charge balancing between the positively charged gel matrix and the negatively charged RNA species. Excellent separations are also obtained from micro-RNAs, single-stranded RNA molecules of 21-23 nucleotides in length, which appear to regulate gene expression in animal and plant tissues. As a third example, 2-D runs in control and polycationic gels are shown. Under native conditions, RNAs are not aligned in a diagonal, suggesting that molecular shape has a strong influence on the interaction between RNA and the charged gel matrix. Thus, 2-D runs in cationic matrices might be exploited for structural studies of RNA molecules.

  10. A new approach for separating low-molecular-weight RNA molecules by staircase electrophoresis in non-sequencing gels.

    Science.gov (United States)

    Velázquez, Encarna; Rivas, Raúl; del Villar, María; Valverde, Angel; Peix, Alvaro; Mateos, Pedro F; Velázquez, Enrique; Martínez-Molina, Eustoquio

    2006-05-01

    Low-molecular-weight (LMW) RNA profiles, which include ribosomal and transfer RNA molecules with similar small sizes, are molecular signatures of microorganisms with a great potential in microbial identification. The greatest resolution of these profiles was achieved by staircase electrophoresis in sequencing gels. Nevertheless, this technique is difficult to use because it takes 7 h, the gels have large sizes and it is necessary to heat the system and to recycle the buffer to maintain the denaturing conditions and avoid smile effects. Most available sequencing slabs have no internal temperature control or homogenizing devices, which by contrast are present in some newly designed non-sequencing slabs. Nevertheless, these slabs present two important problems for separating LMW RNA molecules, the size of gels is only 20 cm (instead of 40 cm) and the maximum voltage that can be reached is only 840 V (instead 2400 V). Staircase electrophoresis follows a model in which the external polarization is incrementally modified with a constant time step value. In the present work, we experimentally confirmed that by reducing the time step and increasing the total number of steps a suitable resolution is achieved. Under these conditions, despite the smaller size of the gels and the lower values of the electric field, the intensity reaches higher values than in sequencing gels and the LMW RNA profiles are correctly separated in 5 h. The resolution of these profiles obtained in non-sequencing gels is similar to that obtained in sequencing ones facilitating the analysis of large populations of microorganisms in any laboratory.

  11. RNA-dependent RNA targeting by CRISPR-Cas9

    OpenAIRE

    Strutt, Steven C; Torrez, Rachel M; Kaya, Emine; Negrete, Oscar A; Doudna, Jennifer A

    2018-01-01

    Double-stranded DNA (dsDNA) binding and cleavage by Cas9 is a hallmark of type II CRISPR-Cas bacterial adaptive immunity. All known Cas9 enzymes are thought to recognize DNA exclusively as a natural substrate, providing protection against DNA phage and plasmids. Here, we show that Cas9 enzymes from both subtypes II-A and II-C can recognize and cleave single-stranded RNA (ssRNA) by an RNA-guided mechanism that is independent of a protospacer-adjacent motif (PAM) sequence in the target RNA. RNA...

  12. How to switch the motor on: RNA polymerase initiation steps at the single-molecule level

    NARCIS (Netherlands)

    Marchetti, M.; Malinowska, A.; Heller, I.; Wuite, G. J. L.

    RNA polymerase (RNAP) is the central motor of gene expression since it governs the process of transcription. In prokaryotes, this holoenzyme is formed by the RNAP core and a sigma factor. After approaching and binding the specific promoter site on the DNA, the holoenzyme-promoter complex undergoes

  13. Suppressors of RNA silencing encoded by tomato leaf curl ...

    Indian Academy of Sciences (India)

    2013-01-06

    Jan 6, 2013 ... step in the RNA-silencing pathway that occurs after siRNA production (Zrachya et al. 2007). Geminiviruses (family Geminiviridae) are a diverse group of plant viruses with circular single-stranded DNA genomes that are composed of one or two components of 2700–. 3000 bp length which are encapsidated ...

  14. Terahertz time-domain spectroscopy and imaging of artificial RNA

    DEFF Research Database (Denmark)

    Fischer, Bernd M.; Hoffmann, Matthias; Helm, Hanspeter

    2005-01-01

    We use terahertz time-domain spectroscopy (THz-TDS) to measure the far-infrared dielectric function of two artificial RNA single strands, composed of polyadenylic acid (poly-A) and polycytidylic acid (poly-C). We find a significant difference in the absorption between the two types of RNA strands...

  15. Crystal structure analysis reveals functional flexibility in the selenocysteine-specific tRNA from mouse.

    Directory of Open Access Journals (Sweden)

    Oleg M Ganichkin

    Full Text Available Selenocysteine tRNAs (tRNA(Sec exhibit a number of unique identity elements that are recognized specifically by proteins of the selenocysteine biosynthetic pathways and decoding machineries. Presently, these identity elements and the mechanisms by which they are interpreted by tRNA(Sec-interacting factors are incompletely understood.We applied rational mutagenesis to obtain well diffracting crystals of murine tRNA(Sec. tRNA(Sec lacking the single-stranded 3'-acceptor end ((ΔGCCARNA(Sec yielded a crystal structure at 2.0 Å resolution. The global structure of (ΔGCCARNA(Sec resembles the structure of human tRNA(Sec determined at 3.1 Å resolution. Structural comparisons revealed flexible regions in tRNA(Sec used for induced fit binding to selenophosphate synthetase. Water molecules located in the present structure were involved in the stabilization of two alternative conformations of the anticodon stem-loop. Modeling of a 2'-O-methylated ribose at position U34 of the anticodon loop as found in a sub-population of tRNA(Secin vivo showed how this modification favors an anticodon loop conformation that is functional during decoding on the ribosome. Soaking of crystals in Mn(2+-containing buffer revealed eight potential divalent metal ion binding sites but the located metal ions did not significantly stabilize specific structural features of tRNA(Sec.We provide the most highly resolved structure of a tRNA(Sec molecule to date and assessed the influence of water molecules and metal ions on the molecule's conformation and dynamics. Our results suggest how conformational changes of tRNA(Sec support its interaction with proteins.

  16. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus

    Science.gov (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.

    2016-01-01

    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  17. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy

    OpenAIRE

    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried

    2013-01-01

    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  18. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  19. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.

    1989-01-01

    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  20. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  1. Molecular dynamics simulations of RNA: An in silico single molecule approach

    Czech Academy of Sciences Publication Activity Database

    McDowell, S.E.; Špačková, Naďa; Šponer, Jiří; Walter, N.G.

    2006-01-01

    Roč. 85, č. 2 (2006), s. 169-184 ISSN 0006-3525 R&D Projects: GA ČR(CZ) GA203/05/0009; GA ČR(CZ) GA203/05/0388; GA AV ČR(CZ) 1QS500040581; GA MŠk(CZ) LC06030; GA MŠk(CZ) LC512 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z40550506 Keywords : hydration and cation binding * molecular dynamics * RNA Subject RIV: BO - Biophysics Impact factor: 2.480, year: 2006

  2. Structural basis for viral 5′-PPP-RNA recognition by human IFIT proteins

    Science.gov (United States)

    Abbas, Yazan M.; Pichlmair, Andreas; Górna, Maria W.; Superti-Furga, Giulio; Nagar, Bhushan

    2016-01-01

    IFIT proteins are interferon-inducible, innate immune effector molecules that are thought to confer antiviral defence through disruption of protein-protein interactions in the host translation initiation machinery. However, recently it was discovered that IFITs could directly recognize viral RNA bearing a 5′-triphosphate group (PPP-RNA), which is a molecular signature that distinguishes it from host RNA. Here, we report crystal structures of human IFIT5, its complex with PPP-RNAs, and an N-terminal fragment of IFIT1. The structures reveal a new helical domain that houses a positively charged cavity designed to specifically engage only single stranded PPP-RNA, thus distinguishing it from the canonical cytosolic sensor of double stranded viral PPP-RNA, RIG-I. Mutational analysis, proteolysis and gel-shift assays reveal that PPP-RNA is bound in a non-sequence specific manner and requires approximately a 3-nucleotide 5′-overhang. Abrogation of PPP-RNA binding in IFIT1 and IFIT5 were found to cause a defect in the anti-viral response by HEK cells. These results demonstrate the mechanism by which IFIT proteins selectively recognize viral RNA and lend insight into their downstream effector function. PMID:23334420

  3. Structural basis for viral 5'-PPP-RNA recognition by human IFIT proteins.

    Science.gov (United States)

    Abbas, Yazan M; Pichlmair, Andreas; Górna, Maria W; Superti-Furga, Giulio; Nagar, Bhushan

    2013-02-07

    Interferon-induced proteins with tetratricopeptide repeats (IFITs) are innate immune effector molecules that are thought to confer antiviral defence through disruption of protein-protein interactions in the host translation-initiation machinery. However, it was recently discovered that IFITs can directly recognize viral RNA bearing a 5'-triphosphate group (PPP-RNA), which is a molecular signature that distinguishes it from host RNA. Here we report crystal structures of human IFIT5, its complex with PPP-RNAs, and an amino-terminal fragment of IFIT1. The structures reveal a new helical domain that houses a positively charged cavity designed to specifically engage only single-stranded PPP-RNA, thus distinguishing it from the canonical cytosolic sensor of double-stranded viral PPP-RNA, retinoic acid-inducible gene I (RIG-I, also known as DDX58). Mutational analysis, proteolysis and gel-shift assays reveal that PPP-RNA is bound in a non-sequence-specific manner and requires a 5'-overhang of approximately three nucleotides. Abrogation of PPP-RNA binding in IFIT1 and IFIT5 was found to cause a defect in the antiviral response by human embryonic kidney cells. These results demonstrate the mechanism by which IFIT proteins selectively recognize viral RNA, and lend insight into their downstream effector function.

  4. RNA virus interference via CRISPR/Cas13a system in plants

    KAUST Repository

    Aman, Rashid

    2018-01-04

    CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single-stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants.CRISPR/Cas13a produces interference against green fluorescent protein (GFP)-expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. CRISPR RNA (crRNAs) targeting the HC-Pro and GFP sequences exhibit better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs.Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses and for other RNA manipulations in plants.

  5. The effect of RNA stiffness on the self-assembly of virus particles

    Science.gov (United States)

    Li, Siyu; Erdemci-Tandogan, Gonca; van der Schoot, Paul; Zandi, Roya

    2018-01-01

    Under many in vitro conditions, some small viruses spontaneously encapsidate a single stranded (ss) RNA into a protein shell called the capsid. While viral RNAs are found to be compact and highly branched because of long distance base-pairing between nucleotides, recent experiments reveal that in a head-to-head competition between an ssRNA with no secondary or higher order structure and a viral RNA, the capsid proteins preferentially encapsulate the linear polymer! In this paper, we study the impact of genome stiffness on the encapsidation free energy of the complex of RNA and capsid proteins. We show that an increase in effective chain stiffness because of base-pairing could be the reason why under certain conditions linear chains have an advantage over branched chains when it comes to encapsidation efficiency. While branching makes the genome more compact, RNA base-pairing increases the effective Kuhn length of the RNA molecule, which could result in an increase of the free energy of RNA confinement, that is, the work required to encapsidate RNA, and thus less efficient packaging.

  6. Machine Learning Approaches Toward Building Predictive Models for Small Molecule Modulators of miRNA and Its Utility in Virtual Screening of Molecular Databases.

    Science.gov (United States)

    Periwal, Vinita; Scaria, Vinod

    2017-01-01

    The ubiquitous role of microRNAs (miRNAs) in a number of pathological processes has suggested that they could act as potential drug targets. RNA-binding small molecules offer an attractive means for modulating miRNA function. The availability of bioassay data sets for a variety of biological assays and molecules in public domain provides a new opportunity toward utilizing them to create models and further utilize them for in silico virtual screening approaches to prioritize or assign potential functions for small molecules. Here, we describe a computational strategy based on machine learning for creation of predictive models from high-throughput biological screens for virtual screening of small molecules with the potential to inhibit microRNAs. Such models could be potentially used for computational prioritization of small molecules before performing high-throughput biological assay.

  7. Oxidized base damage and single-strand break repair in mammalian genomes: role of disordered regions and posttranslational modifications in early enzymes.

    Science.gov (United States)

    Hegde, Muralidhar L; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic endonuclease 1 (APE1), form complexes with downstream repair (and other noncanonical) proteins via pairwise interactions. Furthermore, a unique feature of mammalian early BER/SSBR enzymes is the presence of a disordered terminal extension that is absent in their Escherichia coli prototypes. These nonconserved segments usually contain organelle-targeting signals, common interaction interfaces, and sites of posttranslational modifications that may be involved in regulating their repair function including lesion scanning. Finally, the linkage of BER/SSBR deficiency to cancer, aging, and human neurodegenerative diseases, and therapeutic targeting of BER/SSBR are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. Isolation and characterization of a single-stranded DNA virus infecting the marine diatom Chaetoceros sp. strain SS628-11 isolated from western Japan.

    Directory of Open Access Journals (Sweden)

    Kei Kimura

    Full Text Available Diatoms are significant organisms for primary production in the earth's aquatic environment. Hence, their dynamics are an important focus area in current studies. Viruses are a great concern as potential factors of diatom mortality, along with other physical, chemical, and biological factors. We isolated and characterized a new diatom virus (Csp07DNAV that lyses the marine planktonic diatom Chaetoceros sp. strain SS628-11. This paper examines the physiological, morphological, and genomic characteristics of Csp07DNAV. The virus was isolated from a surface water sample that was collected at Hiroshima Bay, Japan. It was icosahedral, had a diameter of 34 nm, and accumulated in the nuclei of host cells. Rod-shaped virus particles also coexisted in the host nuclei. The latent period and burst size were estimated to be <12 h and 29 infectious units per host cell, respectively. Csp07DNAV had a closed circular single-stranded DNA genome (5,552 nucleotides, which included a double-stranded region and 3 open reading frames. The monophyly of Csp07DNAV and other Bacilladnavirus group single-stranded DNA viruses was supported by phylogenetic analysis that was based on the amino acid sequence of each virus protein. On the basis of these results, we considered Csp07DNAV to be a new member of the genus Bacilladnavirus.

  9. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  10. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H

    2012-02-22

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  11. On-site detection of Phytophthora spp.—single-stranded target DNA as the limiting factor to improve on-chip hybridization

    International Nuclear Information System (INIS)

    Schwenkbier, Lydia; Pollok, Sibyll; Popp, Jürgen; Weber, Karina; König, Stephan; Wagner, Stefan; Werres, Sabine; Weber, Jörg; Hentschel, Martin

    2014-01-01

    We report on a lab-on-a-chip approach for on-site detection of Phytophthora species that allows visual signal readout. The results demonstrate the significance of single-stranded DNA (ssDNA) generation in terms of improving the intensity of the hybridization signal and to improve the reliability of the method. Conventional PCR with subsequent heat denaturation, sodium hydroxide-based denaturation, lambda exonuclease digestion and two asymmetric PCR methods were investigated for the species P. fragariae, P. kernoviae, and P. ramorum. The positioning of the capture probe within the amplified yeast GTP-binding protein (YPT1) target DNA was also of interest because it significantly influences the intensity of the signal. Statistical tests were used to validate the impact of the ssDNA generation methods and the capture-target probe position. The single-stranded target DNA generated by Linear-After-The-Exponential PCR (LATE-PCR) was found to produce signal intensities comparable to post-PCR exonuclease treatment. The LATE-PCR is the best method for the on-site detection of Phytophthora because the enzymatic digestion after PCR is more laborious and time-consuming. (author)

  12. Alpha-Helical Fragaceatoxin C Nanopore Engineered for Double-Stranded and Single-Stranded Nucleic Acid Analysis

    NARCIS (Netherlands)

    Wloka, Carsten; Mutter, Natalie Lisa; Soskine, Misha; Maglia, Giovanni

    2016-01-01

    Nanopores are used in single-molecule DNA analysis and sequencing. Herein, we show that Fragaceatoxin C (FraC), an α-helical pore-forming toxin from an actinoporin protein family, can be reconstituted in sphingomyelin-free standard planar lipid bilayers. We engineered FraC for DNA analysis and show

  13. Direct imaging of hexaamine-ruthenium(III) in domain boundaries in monolayers of single-stranded DNA

    DEFF Research Database (Denmark)

    Grubb, Mikala; Wackerbarth, Hainer; Wengel, J.

    2007-01-01

    We describe adsorption and identification of the binding sites of [Ru(NH3)(6)](3+) (RuHex) molecules in a closely packed monolayer of a 13-base ss-DNA on Au(111) electrodes by electrochemical in situ scanning tunneling microscopy (STM), cyclic voltammetry and interfacial capacitance data. In situ...

  14. Atomic force spectroscopic and SPR kinetic analysis of long circular and short ssDNA molecules interacting with single-stranded DNA-binding protein

    Czech Academy of Sciences Publication Activity Database

    Horáčková, V.; Hlaváček, Antonín; Čundlerová, V.; Pastucha, M.; Skládal, P.

    2017-01-01

    Roč. 148, č. 11 (2017), s. 2011-2018 ISSN 0026-9247 Institutional support: RVO:68081715 Keywords : microscopy * biology * specificity * surface Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 1.282, year: 2016

  15. Atomic force spectroscopic and SPR kinetic analysis of long circular and short ssDNA molecules interacting with single-stranded DNA-binding protein

    Czech Academy of Sciences Publication Activity Database

    Horáčková, V.; Hlaváček, Antonín; Čundlerová, V.; Pastucha, M.; Skládal, P.

    2017-01-01

    Roč. 148, č. 11 (2017), s. 2011- 2018 ISSN 0026-9247 Institutional support: RVO:68081715 Keywords : microscopy * biology * specificity * surface Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 1.282, year: 2016

  16. Widespread Polycistronic Transcripts in Fungi Revealed by Single-Molecule mRNA Sequencing.

    Directory of Open Access Journals (Sweden)

    Sean P Gordon

    Full Text Available Genes in prokaryotic genomes are often arranged into clusters and co-transcribed into polycistronic RNAs. Isolated examples of polycistronic RNAs were also reported in some higher eukaryotes but their presence was generally considered rare. Here we developed a long-read sequencing strategy to identify polycistronic transcripts in several mushroom forming fungal species including Plicaturopsis crispa, Phanerochaete chrysosporium, Trametes versicolor, and Gloeophyllum trabeum. We found genome-wide prevalence of polycistronic transcription in these Agaricomycetes, involving up to 8% of the transcribed genes. Unlike polycistronic mRNAs in prokaryotes, these co-transcribed genes are also independently transcribed. We show that polycistronic transcription may interfere with expression of the downstream tandem gene. Further comparative genomic analysis indicates that polycistronic transcription is conserved among a wide range of mushroom forming fungi. In summary, our study revealed, for the first time, the genome prevalence of polycistronic transcription in a phylogenetic range of higher fungi. Furthermore, we systematically show that our long-read sequencing approach and combined bioinformatics pipeline is a generic powerful tool for precise characterization of complex transcriptomes that enables identification of mRNA isoforms not recovered via short-read assembly.

  17. Regulating Cdc42 and Its Signaling Pathways in Cancer: Small Molecules and MicroRNA as New Treatment Candidates.

    Science.gov (United States)

    Xiao, Xing-Hua; Lv, Lin-Chen; Duan, Jing; Wu, Ye-Meng; He, Shu-Jin; Hu, Zhen-Zhen; Xiong, Li-Xia

    2018-03-29

    Despite great improvements in the diagnosis and treatment of neoplasms, metastatic disease is still the leading cause of death in cancer patients, with mortality rates still rising. Given this background, new ways to treat cancer will be important for development of improved cancer control strategies. Cdc42 is a member of the Rho GTPase family and plays an important role in cell-to-cell adhesion, formation of cytoskeletal structures, and cell cycle regulation. It thus influences cellular proliferation, transformation, and homeostasis, as well as the cellular migration and invasion processes underlying tumor formation. Cdc42 acts as a collection point for signal transduction and regulates multiple signaling pathways. Moreover, recent studies show that in most human cancers Cdc42 is abnormally expressed and promoting neoplastic growth and metastasis. Regarding possible new treatments for cancer, miRNA and small molecules targeting Cdc42 and related pathways have been recently found to be effective on cancer. In this review, we analyze the newly recognized regulation mechanisms for Cdc42 and Cdc42-related signal pathways, and particularly new treatments using small molecules and miRNAs to inhibit the abnormal overexpression of Cdc42 that may slow down the metastasis process, improve cancer therapy and lead to novel strategies for development of antineoplastic drugs.

  18. RNA virus interference via CRISPR/Cas13a system in plants

    KAUST Repository

    Aman, Rashid

    2017-11-04

    CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants. CRISPR/Cas13a produced interference against green fluorescent protein (GFP) expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. crRNAs targeting the HC-Pro and GFP sequences exhibited better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs. Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses, and for other RNA manipulations in plants.

  19. Prediction of MicroRNA-Disease Associations Based on Social Network Analysis Methods

    Directory of Open Access Journals (Sweden)

    Quan Zou

    2015-01-01

    Full Text Available MicroRNAs constitute an important class of noncoding, single-stranded, ~22 nucleotide long RNA molecules encoded by endogenous genes. They play an important role in regulating gene transcription and the regulation of normal development. MicroRNAs can be associated with disease; however, only a few microRNA-disease associations have been confirmed by traditional experimental approaches. We introduce two methods to predict microRNA-disease association. The first method, KATZ, focuses on integrating the social network analysis method with machine learning and is based on networks derived from known microRNA-disease associations, disease-disease associations, and microRNA-microRNA associations. The other method, CATAPULT, is a supervised machine learning method. We applied the two methods to 242 known microRNA-disease associations and evaluated their performance using leave-one-out cross-validation and 3-fold cross-validation. Experiments proved that our methods outperformed the state-of-the-art methods.

  20. RNA topology

    OpenAIRE

    Frank-Kamenetskii, Maxim D.

    2013-01-01

    A new variety on non-coding RNA has been discovered by several groups: circular RNA (circRNA). This discovery raises intriguing questions about the possibility of the existence of knotted RNA molecules and the existence of a new class of enzymes changing RNA topology, RNA topoisomerases.

  1. Simultaneous delivery of hydrophobic small molecules and siRNA using Sterosomes to direct mesenchymal stem cell differentiation for bone repair.

    Science.gov (United States)

    Cui, Zhong-Kai; Sun, Justin A; Baljon, Jessalyn J; Fan, Jiabing; Kim, Soyon; Wu, Benjamin M; Aghaloo, Tara; Lee, Min

    2017-08-01

    The use of small molecular drugs with gene manipulation offers synergistic therapeutic efficacy by targeting multiple signaling pathways for combined treatment. Stimulation of mesenchymal stem cells (MSCs) with osteoinductive small molecule phenamil combined with suppression of noggin is a promising therapeutic strategy that increases bone morphogenetic protein (BMP) signaling and bone repair. Our cationic Sterosome formulated with stearylamine (SA) and cholesterol (Chol) is an attractive co-delivery system that not only forms stable complexes with small interfering RNA (siRNA) molecules but also solubilizes hydrophobic small molecules in a single vehicle, for directing stem cell differentiation. Herein, we demonstrate the ability of SA/Chol Sterosomes to simultaneously deliver hydrophobic small molecule phenamil and noggin-directed siRNA to enhance osteogenic differentiation of MSCs both in in vitro two- and three-dimensional settings as well as in a mouse calvarial defect model. These results suggest a novel liposomal platform to simultaneously deliver therapeutic genes and small molecules for combined therapy. Application of phenamil, a small molecular bone morphogenetic protein (BMP) stimulator, combined with suppression of natural BMP antagonists such as noggin is a promising therapeutic strategy to enhance bone regeneration. Here, we present a novel strategy to co-deliver hydrophobic small molecule phenamil and noggin-targeted siRNA via cationic Sterosomes formed with stearylamine (SA) and high content of cholesterol (Chol) to enhance osteogenesis and bone repair. SA/Chol Sterosomes demonstrated high phenamil encapsulation efficiency, supported sustained release of encapsulated drugs, and significantly reduced drug dose requirements to induce osteogenic differentiation of mesenchymal stem cells (MSCs). Simultaneous deliver of phenamil and noggin siRNA in a single vehicle synergistically enhanced MSC osteogenesis and calvarial bone repair. This study suggests

  2. Insects’ RNA Profiling Reveals Absence of “Hidden Break” in 28S Ribosomal RNA Molecule of Onion Thrips, Thrips tabaci

    OpenAIRE

    Rosaline Wanjiru Macharia; Fidelis Levi Ombura; Erick Onyango Aroko

    2015-01-01

    With an exception of aphids, insects' 28S rRNA is thought to harbor a ?hidden break? which cleaves under denaturing conditions to comigrate with 18S rRNA band to exhibit a degraded appearance on native agarose gels. The degraded appearance confounds determination of RNA integrity in laboratories that rely on gel electrophoresis. To provide guidelines for RNA profiles, RNA from five major insect orders, namely, Diptera, Hemiptera, Thysanoptera, Hymenoptera, and Lepidoptera, was compared under ...

  3. RNA-dependent RNA targeting by CRISPR-Cas9.

    Science.gov (United States)

    Strutt, Steven C; Torrez, Rachel M; Kaya, Emine; Negrete, Oscar A; Doudna, Jennifer A

    2018-01-05

    Double-stranded DNA (dsDNA) binding and cleavage by Cas9 is a hallmark of type II CRISPR-Cas bacterial adaptive immunity. All known Cas9 enzymes are thought to recognize DNA exclusively as a natural substrate, providing protection against DNA phage and plasmids. Here, we show that Cas9 enzymes from both subtypes II-A and II-C can recognize and cleave single-stranded RNA (ssRNA) by an RNA-guided mechanism that is independent of a protospacer-adjacent motif (PAM) sequence in the target RNA. RNA-guided RNA cleavage is programmable and site-specific, and we find that this activity can be exploited to reduce infection by single-stranded RNA phage in vivo. We also demonstrate that Cas9 can direct PAM-independent repression of gene expression in bacteria. These results indicate that a subset of Cas9 enzymes have the ability to act on both DNA and RNA target sequences, and suggest the potential for use in programmable RNA targeting applications. © 2018, Strutt et al.

  4. Synthesis of a wild-type and three mutant Cucurbita maxima trypsin inhibitor-encoding genes by a single-strand approach.

    Science.gov (United States)

    Botes, D P; Qobose, M D; Corfield, V A

    1991-09-15

    A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.

  5. The casein genes in goat breeds from different Continents: analysis by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP

    Directory of Open Access Journals (Sweden)

    A. Caroli

    2010-04-01

    Full Text Available A screening of casein gene variability was carried out by Polymerase Chain Reaction – Single Strand Conformation Polymorphism in 8 goat breeds from Sudan (Nubian goat, Turkey (Angora Goat Lalahan Tiftic, Angora Goat Yerkoy, Hair goat and India (Jammu, Maharashtra, Rajasthan, South Goat. A total of 16 different alleles or groups of alleles were found, showing conspicuous differences among breeds. The allele frequencies were submitted to cluster analysis in order to highlight differences between breeds, also including data from Red Sokoto, West African Dwarf Nigeria, West African Dwarf Cameroon, and Borno Goat. The tree obtained from the cluster analysis showed two main lineages. The West African goat clustered together, the Indian and Turkish breeds were in the other group. Nubian goat was found in an intermediate position.

  6. Investigation of single-strand conformational polymorphism of the TP53 gene in women with a family history of breast cancer

    Directory of Open Access Journals (Sweden)

    R.R. Burbano

    2000-11-01

    Full Text Available Breast cancer in families with germ line mutations in the TP53 gene has been described in the medical literature. Mutation screening for susceptibility genes should allow effective prophylactic and preventive measures. Using single-strand conformational polymorphism, we screened for mutations in exons 5, 6, 7 and 8 of gene TP53 in the peripheral blood of 8 young non-affected members (17 to 36 years old of families with a history of breast cancer. Studies of this type on young patients (mean age, 25 years are very rare in the literature. The identification of these mutations would contribute to genetic counseling of members of families with predisposition to breast cancer. The results obtained did not show any polymorphism indicating mutation. In our sample, the familial tumorigenesis is probably related to other gene etiologies.

  7. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.

    1994-01-01

    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  8. Influence of the single-strand linker composition on the structural/dynamical properties of a truncated octahedral DNA nano-cage family.

    Science.gov (United States)

    Iacovelli, Federico; Alves, Cassio; Falconi, Mattia; Oteri, Francesco; de Oliveira, Cristiano L P; Desideri, Alessandro

    2014-10-01

    The structural/dynamical properties of three truncated octahedral DNA nano-cages composed by identical double helices but single strand linkers with different composition, namely 7 thymidines, 7 adenines, and 7 alternated thymidines and adenines, have been investigated through classical molecular dynamics simulations. Trajectories have been analyzed to investigate the role of the linkers in defining nano-cages stability and flexibility, including possible influence on the internal cages motions. The data indicate that the cages behavior is almost identical and that the structural/dynamical parameters measured along the trajectories are not particularly affected by the presence of different bases. These results demonstrate that the constraints imposed by the nano-structure geometry are the main factor in modulating these properties

  9. Overexpression, crystallization and preliminary X-ray crystallographic analysis of the RNA polymerase domain of primase from Streptococcus mutans strain UA159

    International Nuclear Information System (INIS)

    Im, Dong-Won; Kim, Tae-O; Jung, Ha Yun; Oh, Ji Eun; Lee, Se Jin; Heo, Yong-Seok

    2011-01-01

    The RNA polymerase domain of primase from S. mutans strain UA159 was cloned, overexpressed, purified and crystallized. X-ray diffraction data were collected to a resolution of 1.60 Å. Primase is the enzyme that synthesizes RNA primers on single-stranded DNA during normal DNA replication. In this study, the catalytic core domain of primase from Streptococcus mutans UA159 was overexpressed in Escherichia coli, purified and crystallized. Diffraction data were collected to 1.60 Å resolution using a synchrotron-radiation source. The crystal belonged to space group P4 1 or P4 3 , with unit-cell parameters a = b = 52.63, c = 110.31 Å. The asymmetric unit is likely to contain one molecule, with a corresponding V M of 1.77 Å 3 Da −1 and a solvent content of 30.7%

  10. Localization of specific sequences and DNA single-strand breaks in individual UV-A-irradiated human lymphocytes by COMET FISH

    Science.gov (United States)

    Bock, Claudia; Rapp, Alexander; Dittmar, Heike; Monajembashi, Shamci; Greulich, Karl-Otto

    1999-01-01

    The COMET assay, a single cell electrophoresis technique which allows to separate electrophoretically fractionated DNA according to size has been combined with fluorescence in situ hybridization (FISH) which allows to localize specific genes or gene regions. This combination (COMET FISH) allows the detection of DNA single strand breaks in specific regions of the genome of human lymphocytes at the single cell level. Various types of DNA probes, e.g. centromere-, (alpha) - satellite-, telomere-, whole chromosome-, single copy- and region specific DNA probes have been used to investigate whether the UV-A induced DNA single strand breaks are distributed randomly all over the human genome or induced at specific sites ('hot spots'). In the investigated human peripheral blood lymphocytes all but one centromere reveal low sensitivity for UV-A irradiation (500 kJ/m2), while telomeres are randomly distributed over COMET heads and tails. The human chromosome 1 is fractionated by irradiation, but remains in the COMET head, indicating an only moderate degree of fractionation. Among three tested single copy probes, c- myc, p53 and p58, the p53 gene located on chromosome 17p13.1 and the p58 gene (1p36) appear to be located in UV-A stable regions of the human genome in 95% of 65 investigated lymphocytes. In contrast, the c-myc proto-oncogene (8q24) is found in the COMET tail in 90% of the 27 investigated lymphocytes and thus appears to be more sensitive to UV-A irradiation.

  11. Functional roles of the N- and C-terminal regions of the human mitochondrial single-stranded DNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Marcos T Oliveira

    2010-10-01

    Full Text Available Biochemical studies of the mitochondrial DNA (mtDNA replisome demonstrate that the mtDNA polymerase and the mtDNA helicase are stimulated by the mitochondrial single-stranded DNA-binding protein (mtSSB. Unlike Escherichia coli SSB, bacteriophage T7 gp2.5 and bacteriophage T4 gp32, mtSSBs lack a long, negatively charged C-terminal tail. Furthermore, additional residues at the N-terminus (notwithstanding the mitochondrial presequence are present in the sequence of species across the animal kingdom. We sought to analyze the functional importance of the N- and C-terminal regions of the human mtSSB in the context of mtDNA replication. We produced the mature wild-type human mtSSB and three terminal deletion variants, and examined their physical and biochemical properties. We demonstrate that the recombinant proteins adopt a tetrameric form, and bind single-stranded DNA with similar affinities. They also stimulate similarly the DNA unwinding activity of the human mtDNA helicase (up to 8-fold. Notably, we find that unlike the high level of stimulation that we observed previously in the Drosophila system, stimulation of DNA synthesis catalyzed by human mtDNA polymerase is only moderate, and occurs over a narrow range of salt concentrations. Interestingly, each of the deletion variants of human mtSSB stimulates DNA synthesis at a higher level than the wild-type protein, indicating that the termini modulate negatively functional interactions with the mitochondrial replicase. We discuss our findings in the context of species-specific components of the mtDNA replisome, and in comparison with various prokaryotic DNA replication machineries.

  12. The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange.

    Science.gov (United States)

    Qian, Yufeng; Johnson, Kenneth A

    2017-08-04

    The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB-ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB) 30 and (SSB) 60 , defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB) 60 and (SSB) 30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 10 9 m -1 s -1 ) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

    2003-01-01

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  14. Effect of siRNA silencing of inducible co-stimulatory molecule on myocardial cell hypertrophy after cardiac infarction in rats.

    Science.gov (United States)

    Wang, W M; Liu, Z; Chen, G

    2016-05-20

    As the most common cardiac disease, myocardial infarction is followed by hypertrophy of cardiac myocytes and reconstruction of ventricular structure. The up-regulation of a series of factors including metalloproteinases, inflammatory factors, and growth factors after primary infarction lead to the hypertrophy, apoptosis, necrosis, and fibroblast proliferation in cardiac muscle tissues. Recent studies have reported on the potency of small interfering RNA (siRNA) in treating cardiac diseases. We thus investigated the efficacy of inducible co-stimulatory molecule (ICOS)-specific siRNA silencing in myocardial hypertrophy in a cardiac infarction rat model. This cardiac infarction model was prepared by ligating the left anterior descending coronary artery. ICOS-siRNA treatment was administered in parallel with non-sense siRNA. After 18 days, the cross-sectional area of cardiac muscle tissues and the left ventricle weight index were measured, along with ICOS mRNA and protein expression levels, and pathological staining. Compared to those in the control groups, in myocardial infarcted rats, the application of ICOS-siRNA effectively decreased the left ventricle weight index, as well as the surface area of cardiac myocytes. Both mRNA and protein levels of ICOS were also significantly decreased. HE staining was consistent with these results. In conclusion, ICOS-targeted siRNA can effectively silence gene expression of ICOS, and provided satisfactory treatment efficacy for myocardial cell hypertrophy after infarction.

  15. Exogenous application of double-stranded RNA molecules from TMV p126 and CP genes confers resistance against TMV in tobacco.

    Science.gov (United States)

    Konakalla, Naga Charan; Kaldis, Athanasios; Berbati, Margarita; Masarapu, Hema; Voloudakis, Andreas E

    2016-10-01

    External application of dsRNA molecules from Tobacco mosaic virus (TMV) p126 and CP genes confers significant resistance against TMV infection. Exogenously applied dsRNA exhibits a rapid systemic trafficking in planta , and it is processed successfully by DICER-like proteins producing small interfering RNAs. RNA interference (RNAi) is a sequence-specific, post-transcriptional gene silencing mechanism, induced by double-stranded RNA (dsRNA), which protects eukaryotic cells against invasive nucleic acids like viruses and transposons. In the present study, we used a non-transgenic strategy to induce RNAi in Nicotiana tabacum cv. Xanthi plants against TMV. DsRNA molecules for the p126 (TMV silencing suppressor) and coat protein (CP) genes were produced by a two-step PCR approach followed by in vitro transcription. The application of TMV p126 dsRNA onto tobacco plants induced greater resistance against TMV infection as compared to CP dsRNA (65 vs. 50 %). This study also reported the fast systemic spread of TMV p126 dsRNA from the treated (local) to non-treated (systemic) leaves beginning from 1 h post-application, confirmed by both conventional and real-time RT-PCR. Furthermore, we employed a stem-loop RT-PCR and confirmed the presence of a putative viral siRNA for up to 9 days in local leaves and up to 6 days in systemic leaves post-application. The approach employed could represent a simple and environmentally safe way for the control of plant viruses in future agriculture.

  16. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes.

    Science.gov (United States)

    Pietilä, Maija K; Roine, Elina; Sencilo, Ana; Bamford, Dennis H; Oksanen, Hanna M

    2016-01-01

    Viruses infecting archaea show a variety of virion morphotypes, and they are currently classified into more than ten viral families or corresponding groups. A pleomorphic virus morphotype is very common among haloarchaeal viruses, and to date, several such viruses have been isolated. Here, we propose the classification of eight such viruses and formation of a new family, Pleolipoviridae (from the Greek pleo for more or many and lipos for lipid), containing three genera, Alpha-, Beta-, and Gammapleolipovirus. The proposal is currently under review by the International Committee on Taxonomy of Viruses (ICTV). The members of the proposed family Pleolipoviridae infect halophilic archaea and are nonlytic. They share structural and genomic features and differ from any other classified virus. The virion of pleolipoviruses is composed of a pleomorphic membrane vesicle enclosing the genome. All pleolipoviruses have two major structural protein species, internal membrane and spike proteins. Although the genomes of the pleolipoviruses are single- or double-stranded, linear or circular DNA molecules, they share the same genome organization and gene synteny and show significant similarity at the amino acid level. The canonical features common to all members of the proposed family Pleolipoviridae show that they are closely related and thus form a new viral family.

  17. High sensitivity surface plasmon resonance biosensor for detection of microRNA and small molecule based on graphene oxide-gold nanoparticles composites.

    Science.gov (United States)

    Li, Qing; Wang, Qing; Yang, Xiaohai; Wang, Kemin; Zhang, Hua; Nie, Wenyan

    2017-11-01

    A versatile and sensitive surface plasmon resonance (SPR) biosensor based on two layers of graphene oxide-gold nanoparticles (GO-AuNPs) composites was designed for the detection of microRNA (miRNA) and small molecule adenosine. The bottom layer, which acted as a functionalized substrate on the sensor chip, provided a high specific surface area convenient for the immobilization of capture DNA molecules. The upper layer served as a signal-amplification element. By employing these two layers of GO-AuNPs composites, the dual amplification strategy was achieved so that a measurement of miRNA-141 with a detection limit of 0.1fM was obtained. Moreover, the developed SPR biosensor showed decent selectivity toward miRNA-200 family members. Especially, the SPR biosensor demonstrated its applicability for the detection of miRNA-141 in cancer cell extractions, and the results obtained were consistent with those obtained by qRT-PCR. Interestingly, small molecule adenosine could also be detected using this SPR biosensor in combination with a split aptamer. Considering the superior sensitivity, selectivity and generality, this work promised much potential for the detection of various biomolecules. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. MicroRNAs, macrocontrol : Regulation of miRNA processing

    NARCIS (Netherlands)

    Slezak-Prochazka, Izabella; Durmus, Selvi; Kroesen, Bart-Jan; van den Berg, Anke

    MicroRNAs (miRNAs) are a set of small, non-protein-coding RNAs that regulate gene expression at the post-transcriptional level. Maturation of miRNAs comprises several regulated steps resulting in similar to 22-nucleotide single-stranded mature miRNAs. Regulation of miRNA expression can occur both at

  19. Nanomechanical microcantilever operated in vibration modes with use of RNA aptamer as receptor molecules for label-free detection of HCV helicase.

    Science.gov (United States)

    Hwang, Kyo Seon; Lee, Sang-Myung; Eom, Kilho; Lee, Jeong Hoon; Lee, Yoon-Sik; Park, Jung Ho; Yoon, Dae Sung; Kim, Tae Song

    2007-11-30

    We report the nanomechanical microcantilevers operated in vibration modes (oscillation) with use of RNA aptamers as receptor molecules for label-free detection of hepatitis C virus (HCV) helicase. The nanomechanical detection principle is that the ligand-receptor binding on the microcantilever surface induces the dynamic response change of microcantilevers. We implemented the label-free detection of HCV helicase in the low concentration as much as 100 pg/ml from measuring the dynamic response change of microcantilevers. Moreover, from the recent studies showing that the ligand-receptor binding generates the surface stress on the microcantilever, we estimate the surface stress, on the oscillating microcantilevers, induced by ligand-receptor binding, i.e. binding between HCV helicase and RNA aptamer. In this article, it is suggested that the oscillating microcantilevers with use of RNA aptamers as receptor molecules may enable one to implement the sensitive label-free detection of very small amount of small-scale proteins.

  20. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.

    1999-01-01

    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  1. Insects’ RNA Profiling Reveals Absence of “Hidden Break” in 28S Ribosomal RNA Molecule of Onion Thrips, Thrips tabaci

    Directory of Open Access Journals (Sweden)

    Rosaline Wanjiru Macharia

    2015-01-01

    Full Text Available With an exception of aphids, insects’ 28S rRNA is thought to harbor a “hidden break” which cleaves under denaturing conditions to comigrate with 18S rRNA band to exhibit a degraded appearance on native agarose gels. The degraded appearance confounds determination of RNA integrity in laboratories that rely on gel electrophoresis. To provide guidelines for RNA profiles, RNA from five major insect orders, namely, Diptera, Hemiptera, Thysanoptera, Hymenoptera, and Lepidoptera, was compared under denaturing and nondenaturing conditions. This study confirmed that although present in most of insect’s RNA, the “hidden break” is absent in the 28S rRNA of onion thrips, Thrips tabaci. On the other hand, presence of “hidden break” was depicted in whiteflies’ 28S rRNA despite their evolutionary grouping under same order with aphids. Divergence of 28S rRNA sequences confirms variation of both size and composition of gap region among insect species. However, phylogeny reconstruction does not support speciation as a possible source of the hidden break in insect’s 28S rRNA. In conclusion, we show that RNA from a given insect order does not conform to a particular banding profile and therefore this approach cannot be reliably used to characterize newly discovered species.

  2. Insects' RNA Profiling Reveals Absence of “Hidden Break” in 28S Ribosomal RNA Molecule of Onion Thrips, Thrips tabaci

    Science.gov (United States)

    Macharia, Rosaline Wanjiru; Ombura, Fidelis Levi; Aroko, Erick Onyango

    2015-01-01

    With an exception of aphids, insects' 28S rRNA is thought to harbor a “hidden break” which cleaves under denaturing conditions to comigrate with 18S rRNA band to exhibit a degraded appearance on native agarose gels. The degraded appearance confounds determination of RNA integrity in laboratories that rely on gel electrophoresis. To provide guidelines for RNA profiles, RNA from five major insect orders, namely, Diptera, Hemiptera, Thysanoptera, Hymenoptera, and Lepidoptera, was compared under denaturing and nondenaturing conditions. This study confirmed that although present in most of insect's RNA, the “hidden break” is absent in the 28S rRNA of onion thrips, Thrips tabaci. On the other hand, presence of “hidden break” was depicted in whiteflies' 28S rRNA despite their evolutionary grouping under same order with aphids. Divergence of 28S rRNA sequences confirms variation of both size and composition of gap region among insect species. However, phylogeny reconstruction does not support speciation as a possible source of the hidden break in insect's 28S rRNA. In conclusion, we show that RNA from a given insect order does not conform to a particular banding profile and therefore this approach cannot be reliably used to characterize newly discovered species. PMID:25767721

  3. G-quadruplex RNA binding and recognition by the lysine-specific histone demethylase-1 enzyme.

    Science.gov (United States)

    Hirschi, Alexander; Martin, William J; Luka, Zigmund; Loukachevitch, Lioudmila V; Reiter, Nicholas J

    2016-08-01

    Lysine-specific histone demethylase 1 (LSD1) is an essential epigenetic regulator in metazoans and requires the co-repressor element-1 silencing transcription factor (CoREST) to efficiently catalyze the removal of mono- and dimethyl functional groups from histone 3 at lysine positions 4 and 9 (H3K4/9). LSD1 interacts with over 60 regulatory proteins and also associates with lncRNAs (TERRA, HOTAIR), suggesting a regulatory role for RNA in LSD1 function. We report that a stacked, intramolecular G-quadruplex (GQ) forming TERRA RNA (GG[UUAGGG]8UUA) binds tightly to the functional LSD1-CoREST complex (Kd ≈ 96 nM), in contrast to a single GQ RNA unit ([UUAGGG]4U), a GQ DNA ([TTAGGG]4T), or an unstructured single-stranded RNA. Stabilization of a parallel-stranded GQ RNA structure by monovalent potassium ions (K(+)) is required for high affinity binding to the LSD1-CoREST complex. These data indicate that LSD1 can distinguish between RNA and DNA as well as structured versus unstructured nucleotide motifs. Further, cross-linking mass spectrometry identified the primary location of GQ RNA binding within the SWIRM/amine oxidase domain (AOD) of LSD1. An ssRNA binding region adjacent to this GQ binding site was also identified via X-ray crystallography. This RNA binding interface is consistent with kinetic assays, demonstrating that a GQ-forming RNA can serve as a noncompetitive inhibitor of LSD1-catalyzed demethylation. The identification of a GQ RNA binding site coupled with kinetic data suggests that structured RNAs can function as regulatory molecules in LSD1-mediated mechanisms. © 2016 Hirschi et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  4. Biopolymers under large external forces and mean-field RNA virus evolutionary dynamics

    Science.gov (United States)

    Ahsan, Syed Amir

    The modeling of the mechanical response of single-molecules of DNA and RNA under large external forces through statistical mechanical methods is central to this thesis with a small portion devoted to modeling the evolutionary dynamics of positive-sense single-stranded RNA viruses. In order to develop and test models of biopolymer mechanics and illuminate the mechanisms underlying biological processes where biopolymers undergo changes in energy on the order of the thermal energy, , entails measuring forces and lengths on the scale of piconewtons (pN) and nanometers (nm), respectively. A capacity achieved in the past two decades at the single-molecule level through the development of micromanipulation techniques such as magnetic and optical tweezers, atomic force microscopy, coupled with advances in micro- and nanofabrication. The statistical mechanical models of biopolymers developed in this dissertation are dependent upon and the outcome of these advancements and resulting experiments. The dissertation begins in chapter 1 with an introduction to the structure and thermodynamics of DNA and RNA, highlighting the importance and effectiveness of simple, two-state models in their description as a prelude to the emergence of two-state models in the research manuscripts. In chapter 2 the standard models of the elasticity of polymers and of a polymer gel are reviewed, characterizing the continuum and mean-field models, including the scaling behavior of DNA in confined spaces. The research manuscript presented in the last section of chapter 2 (section 2.5), subsequent to a review of a Flory gel and in contrast to it, is a model of the elasticity of RNA as a gel, with viral RNA illustrating an instance of such a network, and shown to exhibit anomalous elastic behavior, a negative Poisson ratio, and capable of facilitating viral RNA encapsidation with further context provided in section 5.1. In chapter 3 the experimental methods and behavior of DNA and RNA under mechanical

  5. [Detection and clinical value of epithelial cellular adhesion molecule (EpCAM) mRNA positive circulating tumor cells in metastatic breast cancer].

    Science.gov (United States)

    Yan, Ying; Cheng, Jian-ping; Di, Li-jun; Song, Guo-hong; Ren, Jun

    2012-04-18

    To test for circulating tumor cells (CTCs) relying on epithelial cellular adhesion molecule (EpCAM) expression in metastatic breast cancer by quantitative real-time reverse transcription-PCR. In the study,47 metastatic breast cancer patients were evaluated by quantitative real-time PCR for detecting EpCAM mRNA. In addition, analyses were carried out for their correlation with patients' clinicopathologic features, response, and the time to progression (TTP). The sensitivity of EpCAM mRNA in the metastatic breast cancer patients was about 40%. However, the specificity of EpCAM mRNA for 20 healthy controls was 100%. TTP was calculated, and compared with that between EpCAM mRNA-positive and EpCAM mRNA-negative groups. For the retrospective study, the median TTP was 7.1 months and 11.1 months (P=0.013) for patients with EpCAM mRNA-positive and EpCAM mRNA-negative, respectively, after the first cycle chemotherapy. Moreover, a statistically significant correlation was demonstrated between EpCAM mRNA and TTP in patients who underwent the first or the second-line chemotherapy (P=0.018), but there was no significance in the patients pretreated with two or more previous chemotherapy lines (P=0.471). This study provides evidence of the presence of EpCAM mRNA in approximately 40% of patients with metastatic breast cancer. There is a strong correlation between EpCAM mRNA results after the first cycle therapy and TTP in metastatic breast cancer patients, and EpCAM mRNA positive after chemotherapy may predict shorter TTP.

  6. RNA secondary structure prediction based on SHAPE data in helix regions.

    Science.gov (United States)

    Lotfi, Mohadeseh; Zare-Mirakabad, Fatemeh; Montaseri, Soheila

    2015-09-07

    RNA molecules play important and fundamental roles in biological processes. Frequently, the functional form of single-stranded RNA molecules requires a specific tertiary structure. Classically, RNA structure determination has mostly been accomplished by X-Ray crystallography or Nuclear Magnetic Resonance approaches. These experimental methods are time consuming and expensive. In the past two decades, some computational methods and algorithms have been developed for RNA secondary structure prediction. In these algorithms, minimum free energy is known as the best criterion. However, the results of algorithms show that minimum free energy is not a sufficient criterion to predict RNA secondary structure. These algorithms need some additional knowledge about the structure, which has to be added in the methods. Recently, the information obtained from some experimental data, called SHAPE, can greatly improve the consistency between the native and predicted RNA secondary structure. In this paper, we investigate the influence of SHAPE data on four types of RNA substructures, helices, loops, base pairs from the start and end of helices and two base pairs from the start and end of helices. The results show that SHAPE data in helix regions can improve the prediction. We represent a new method to apply SHAPE data in helix regions for finding RNA secondary structure. Finally, we compare the results of the method on a set of RNAs to predict minimum free energy structure based on considering all SHAPE data and only SHAPE data in helix regions as pseudo free energy and without SHAPE data (without any pseudo free energy). The results show that RNA secondary structure prediction based on considering only SHAPE data in helix regions is more successful than not considering SHAPE data and it provides competitive results in comparison with considering all SHAPE data. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide

    2015-10-01

    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  8. Elastic Properties of Nucleic Acids by Single-Molecule Force Spectroscopy.

    Science.gov (United States)

    Camunas-Soler, Joan; Ribezzi-Crivellari, Marco; Ritort, Felix

    2016-07-05

    We review the current knowledge on the use of single-molecule force spectroscopy techniques to extrapolate the elastic properties of nucleic acids. We emphasize the lesser-known elastic properties of single-stranded DNA. We discuss the importance of accurately determining the elastic response in pulling experiments, and we review the simplest models used to rationalize the experimental data as well as the experimental approaches used to pull single-stranded DNA. Applications used to investigate DNA conformational transitions and secondary structure formation are also highlighted. Finally, we provide an overview of the effects of salt and temperature and briefly discuss the effects of contour length and sequence dependence.

  9. Structure-function relationship of viral cis-acting RNA elements : the role of the OriI and OriR in enterovirus replication

    NARCIS (Netherlands)

    Ooij, Martinus Johannes Maria van

    2007-01-01

    The genus Enterovirus belongs to Picornaviridae, a family of small, non-enveloped, lytic RNA viruses. They contain a single-stranded RNA genome of positive polarity of approximately 7,500 nucleotides. A viral protein VPg is specifically linked to the 5'terminus of the viral RNA. IRES-mediated

  10. Mechanism and stoichiometry of interaction of DnaG primase with DnaB helicase of Escherichia coli in RNA primer synthesis.

    Science.gov (United States)

    Mitkova, Atanaska V; Khopde, Sujata M; Biswas, Subhasis B

    2003-12-26

    Initiation and synthesis of RNA primers in the lagging strand of the replication fork in Escherichia coli requires the replicative DnaB helicase and the DNA primase, the DnaG gene product. In addition, the physical interaction between these two replication enzymes appears to play a role in the initiation of chromosomal DNA replication. In vitro, DnaB helicase stimulates primase to synthesize primers on single-stranded (ss) oligonucleotide templates. Earlier studies hypothesized that multiple primase molecules interact with each DnaB hexamer and single-stranded DNA. We have examined this hypothesis and determined the exact stoichiometry of primase to DnaB hexamer. We have also demonstrated that ssDNA binding activity of the DnaB helicase is necessary for directing the primase to the initiator trinucleotide and synthesis of 11-20-nucleotide long primers. Although, association of these two enzymes determines the extent and rate of synthesis of the RNA primers in vitro, direct evidence of the formation of primase-DnaB complex has remained elusive in E. coli due to the transient nature of their interaction. Therefore, we stabilized this complex using a chemical cross-linker and carried out a stoichiometric analysis of this complex by gel filtration. This allowed us to demonstrate that the primase-helicase complex of E. coli is comprised of three molecules of primase bound to one DnaB hexamer. Fluorescence anisotropy studies of the interaction of DnaB with primase, labeled with the fluorescent probe Ru(bipy)3, and Scatchard analysis further supported this conclusion. The addition of DnaC protein, leading to the formation of the DnaB-DnaC complex, to the simple priming system resulted in the synthesis of shorter primers. Therefore, interactions of the DnaB-primase complex with other replication factors might be critical for determining the physiological length of the RNA primers in vivo and the overall kinetics of primer synthesis.

  11. On the identification techniques for ionizing radiation structure breaks in the DNA molecule

    International Nuclear Information System (INIS)

    Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.

    2012-01-01

    In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)

  12. A biomarker model of sublethal genotoxicity (DNA single-strand breaks and adducts) using the sentinel organism Aporrectodea longa in spiked soil

    International Nuclear Information System (INIS)

    Martin, Francis L.; Piearce, Trevor G.; Hewer, Alan; Phillips, David H.; Semple, Kirk T.

    2005-01-01

    There is a need to develop risk biomarkers during the remediation of contaminated land. We employed the earthworm, Aporrectodea longa (Ude), to determine whether genotoxicity measures could be applied to this organism's intestinal tissues. Earthworms were added, for 24 h or 7 days, to soil samples spiked with benzo[a]pyrene (B[a]P) and/or lindane. After exposure, intestinal tissues (crop/gizzard or intestine) were removed prior to the measurement in disaggregated cells of DNA single-strand breaks (SSBs) by the alkaline comet assay. Damage was quantified by comet tail length (CTL, μm). B[a]P 24-h exposure induced dose-related increases (P 32 P-postlabelling, showed a two-adduct-spot pattern. This preliminary investigation suggests that earthworm tissues may be incorporated into genotoxicity assays to facilitate hazard identification within terrestrial ecosystems. - Sublethal genotoxicity in the sentinel organism A. longa can be used to monitor the effects of contaminants in soil

  13. Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Krzysztof Lepek

    2015-01-01

    Full Text Available Monitoring and control of infections are key parts of surveillance systems and epidemiological risk prevention. In the case of influenza A viruses (IAVs, which show high variability, a wide range of hosts, and a potential of reassortment between different strains, it is essential to study not only people, but also animals living in the immediate surroundings. If understated, the animals might become a source of newly formed infectious strains with a pandemic potential. Special attention should be focused on pigs, because of the receptors specific for virus strains originating from different species, localized in their respiratory tract. Pigs are prone to mixed infections and may constitute a reservoir of potentially dangerous IAV strains resulting from genetic reassortment. It has been reported that a quadruple reassortant, A(H1N1pdm09, can be easily transmitted from humans to pigs and serve as a donor of genetic segments for new strains capable of infecting humans. Therefore, it is highly desirable to develop a simple, cost-effective, and rapid method for evaluation of IAV genetic variability. We describe a method based on multitemperature single-strand conformational polymorphism (MSSCP, using a fragment of the hemagglutinin (HA gene, for detection of coinfections and differentiation of genetic variants of the virus, difficult to identify by conventional diagnostic.

  14. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS.

    Science.gov (United States)

    Pachkowski, Brian F; Tano, Keizo; Afonin, Valeriy; Elder, Rhoderick H; Takeda, Shunichi; Watanabe, Masami; Swenberg, James A; Nakamura, Jun

    2009-12-01

    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase beta.

  15. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against the Pesticide Fipronil and Sensitive Detection in River Water

    Directory of Open Access Journals (Sweden)

    Ka L. Hong

    2017-12-01

    Full Text Available Fipronil is a commonly used insecticide that has been shown to have environmental and human health risks. The current standard methods of detection for fipronil and its metabolites, such as GC-MS, are time consuming and labor intensive. In this study, a variant of systematic evolution of ligands by exponential enrichment (SELEX, was utilized to identify the first single-stranded DNA (ssDNA molecular recognition element (MRE that binds to fipronil with high affinity (Kd = 48 ± 8 nM. The selected MRE displayed low cross binding activity on various environmentally relevant, structurally unrelated herbicides and pesticides, in addition to broad-spectrum binding activity on major metabolites of fipronil and a structurally similar pesticide in prepared river samples. Additionally, a proof-of-principle fluorescent detection assay was developed by using the selected ssDNA MRE as a signal-reporting element, with a limit of detection of 105 nM in a prepared river water sample.

  16. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Boye, E.; Johansen, I.; Brustad, T.

    1976-01-01

    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 2 0 C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 2 0 C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  17. Clonal origin of multiple lung cancers: K-ras and p53 mutations determined by nonradioisotopic single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Lau, D H; Yang, B; Hu, R; Benfield, J R

    1997-08-01

    Disease stage is the most important factor in determining prognosis and treatment of lung cancer. Staging of lung cancer is complicated by presentation of multiple pulmonary malignant lesions with a similar histology. It is a dilemma to decide if these lesions are synchronous primaries arising from different malignant clones or metastases from a single clone. Lung cancer is associated with multiple genetic abnormalities including mutations of K-ras and p53, which are believed to occur prior to onset of metastasis. To determine the clonal origin of multiple pulmonary malginant nodules, we analyzed point-mutations of K-ras and p53 by microdissection, polymerase chain reactions (PCR), nonradioisotopic single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. Each pulmonary lesion was microdissected from paraffin slides. Genomic DNA was amplified by two sequential PCRs followed by electrophoresis in a minigel and silver staining. Deoxyribonucleic acid sequencing was performed if necessary to confirm a mutation found upon SSCP analysis. Applying this molecular approach, we were able to differentiate the clonal origins of multiple malignant nodules of the lung as exemplified by the two cases presented.

  18. Selection and Characterization of Single-Stranded DNA Aptamers Binding Human B-Cell Surface Protein CD20 by Cell-SELEX

    Directory of Open Access Journals (Sweden)

    Mansoureh Haghighi

    2018-03-01

    Full Text Available The B-lymphocyte antigen (CD20 is a suitable target for single-stranded (ss nucleic acid oligomer (aptamers. The aim of study was selection and characterization of a ssDNA aptamer against CD20 using Cell-Systematic Evolution of Ligands by Exponential Enrichment (Cell-SELEX. The cDNA clone of CD20 (pcDNA-CD20 was transfected to human embryonic kidney (HEK293T cells. Ten rounds of Cell-SELEX was performed on recombinant HEK-CD20 cells. The final eluted ssDNA pool was amplified and ligated in T/A vector for cloning. The plasmids of positive clones were extracted, sequenced and the secondary structures of the aptamers predicted using DNAMAN® software. The sequencing results revealed 10 different types; three of them had the highest thermodynamic stability, named AP-1, AP-2 and AP-3. The AP-1 aptamer was the most thermodynamically stable one (ΔGAP-1 = −10.87 kcal/mol with the highest binding affinity to CD20 (96.91 ± 4.5 nM. Since, the CD20 is a suitable target for recognition of B-Cell. The selected aptamers could be comparable to antibodies with many advantages. The AP-1, AP-2 and AP-3 could be candidate instead of antibodies for diagnostic and therapeutic applications in immune deficiency, autoimmune diseases, leukemia and lymphoma.

  19. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    Science.gov (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Integrative modelling coupled with ion mobility mass spectrometry reveals structural features of the clamp loader in complex with single-stranded DNA binding protein.

    Science.gov (United States)

    Politis, Argyris; Park, Ah Young; Hall, Zoe; Ruotolo, Brandon T; Robinson, Carol V

    2013-11-29

    DNA polymerase III, a decameric 420-kDa assembly, simultaneously replicates both strands of the chromosome in Escherichia coli. A subassembly of this holoenzyme, the seven-subunit clamp loader complex, is responsible for loading the sliding clamp (β2) onto DNA. Here, we use structural information derived from ion mobility mass spectrometry (IM-MS) to build three-dimensional models of one form of the full clamp loader complex, γ3δδ'ψχ (254 kDa). By probing the interaction between the clamp loader and a single-stranded DNA (ssDNA) binding protein (SSB4) and by identifying two distinct conformational states, with and without ssDNA, we assemble models of ψχ-SSB4 (108 kDa) and the clamp loader-SSB4 (340 kDa) consistent with IM data. A significant increase in measured collision cross-section (~10%) of the clamp loader-SSB4 complex upon DNA binding suggests large conformational rearrangements. This DNA bound conformation represents the active state and, along with the presence of ψχ, stabilises the clamp loader-SSB4 complex. Overall, this study of a large heteromeric complex analysed by IM-MS, coupled with integrative modelling, highlights the potential of such an approach to reveal structural features of previously unknown complexes of high biological importance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Direct detection of RNA in vitro and in situ by target-primed RCA: The impact of E. coli RNase III on the detection efficiency of RNA sequences distanced far from the 3'-end.

    Science.gov (United States)

    Merkiene, Egle; Gaidamaviciute, Edita; Riauba, Laurynas; Janulaitis, Arvydas; Lagunavicius, Arunas

    2010-08-01

    We improved the target RNA-primed RCA technique for direct detection and analysis of RNA in vitro and in situ. Previously we showed that the 3' --> 5' single-stranded RNA exonucleolytic activity of Phi29 DNA polymerase converts the target RNA into a primer and uses it for RCA initiation. However, in some cases, the single-stranded RNA exoribonucleolytic activity of the polymerase is hindered by strong double-stranded structures at the 3'-end of target RNAs. We demonstrate that in such hampered cases, the double-stranded RNA-specific Escherichia coli RNase III efficiently assists Phi29 DNA polymerase in converting the target RNA into a primer. These observations extend the target RNA-primed RCA possibilities to test RNA sequences distanced far from the 3'-end and customize this technique for the inner RNA sequence analysis.

  2. Gold Nanoparticle Coated Silica Nanorods for Sensitive Visual Detection of microRNA on a Lateral Flow Strip Biosensor.

    Science.gov (United States)

    Takalkar, Sunitha; Xu, Hui; Chen, Jiao; Baryeh, Kwaku; Qiu, Wanwei; Zhao, Julia X; Liu, And Guodong

    2016-01-01

    We present a rapid and highly sensitive approach for visual detection of microRNA (miRNA) using a gold nanoparticles coated silica nanorod label and lateral flow strip biosensor. Gold nanoparticles were decorated on the silica nanorod surface by a seeding and growth procedure. A single strand DNA probe was immobilized on the gold nanoparticles-silica nanorod surface by a self-assembling process, and the formed DNA-gold nanoparticles-silica nanorod conjugate was used to construct the lateral flow nucleic acid biosensor for detecting miRNA. The captured gold nanoparticles-silica nanorods by sandwich-type hybridization reactions (DNA-RNA-DNA) on the test zone of the lateral flow nucleic acid biosensor produced the characteristic color bands, enabling visual detection of miRNA. After systematic optimization, the new lateral flow nucleic acid biosensor was capable of detecting 10 pM of the miRNA target without instrumentation, which is six times lower than that obtained with the gold nanoparticle-based lateral flow nucleic acid biosensor. The gold nanoparticles coated silica nanorod thus provides a new and sensitive nanolabel for visual detection of biological molecules on the lateral flow biosensor.

  3. Two Negative-Strand RNA Viruses Identified in Watermelon Represent a Novel Clade in the Order Bunyavirales

    Directory of Open Access Journals (Sweden)

    Min Xin

    2017-08-01

    Full Text Available Two novel negative-sense, single-stranded (ss RNA viruses were identified in watermelon plants and named watermelon crinkle leaf-associated virus 1 and 2 (WCLaV-1 and -2, respectively. The multipartite genomes consist of three RNA molecules of ~6.8, 1.4, and 1.3 kb. The genomes and the deduced proteins of RNA1 and RNA3 show features resembling those of members in the genus Phlebovirus and Tenuivirus; however, the predicted proteins encoded by RNA2 are related to the movement protein (MP in the genus Ophiovirus and Emaravirus. Furthermore, these two viruses define a novel clade in the family Phenuiviridae, order Bunyavirales, which is phylogenetically related to the viruses in the above four genera. Moreover, after mechanical inoculation with WCLaV-1 seedlings of the natural host watermelon plants develop crinkling similar to those observed in the field. These findings enhance our understanding of the evolution and the classification of ssRNA viruses.

  4. Programmed self-assembly of DNA/RNA for biomedical applications

    Science.gov (United States)

    Wang, Pengfei

    Three self-assembly strategies were utilized for assembly of novel functional DNA/RNA nanostructures. RNA-DNA hybrid origami method was developed to fabricate nano-objects (ribbon, rectangle, and triangle) with precisely controlled geometry. Unlike conventional DNA origami which use long DNA single strand as scaffold, a long RNA single strand was used instead, which was folded by short DNA single strands (staples) into prescribed objects through sequence specific hybridization between RNA and DNA. Single stranded tiles (SST) and RNA-DNA hybrid origami were utilized to fabricate a variety of barcode-like nanostructures with unique patterns by expanding a plain rectangle via introducing spacers (10-bp dsDNA segment) between parallel duplexes. Finally, complex 2D array and 3D polyhedrons with multiple patterns within one structure were assembled from simple DNA motifs. Two demonstrations of biomedical applications of DNA nanotechnology were presented. Firstly, lambda-DNA was used as template to direct the fabrication of multi-component magnetic nanoparticle chains. Nuclear magnetic relaxation (NMR) characterization showed superb magnetic relaxativity of the nanoparticle chains which have large potential to be utilized as MRI contrast agents. Secondly, DNA nanotechnology was introduced into the conformational study of a routinely used catalytic DNAzyme, the RNA-cleaving 10-23 DNAzyme. The relative angle between two flanking duplexes of the catalytic core was determined (94.8°), which shall be able to provide a clue to further understanding of the cleaving mechanism of this DNAzyme from a conformational perspective.

  5. Targeting ribonucleic acids by toxic small molecules: structural perturbation and energetics of interaction of phenothiazinium dyes thionine and toluidine blue O to tRNA phe.

    Science.gov (United States)

    Paul, Puja; Kumar, Gopinatha Suresh

    2013-12-15

    This study was designed to examine the toxic interaction of two phenothiazinium dyes thionine (TO) and toluidine blue O (TBO) with tRNA(phe) by spectroscopic and calorimetric techniques. While phenothiazinium dye complexation with DNA is known, their bindings to RNA are not fully investigated. The non cooperative binding of both the dyes to tRNA was revealed from absorbance and fluorescence studies. From absorption, steady-state emission, the effect of ferrocyanide ion-induced steady-state fluorescence quenching, circular dichroism, the mode of binding of these dyes into the tRNA helix has been substantiated to be principally by intercalative in nature. Both dyes enhanced the thermal stability of tRNA. Circular dichroism studies provided evidence for the structural perturbations associated with the tRNA structure with induction of optical activity in the CD inactive dye molecules. Results from isothermal titration calorimetry experiments suggested that the binding of both dyes was predominantly entropy driven with a smaller but favorable enthalpy term that increased with temperature. The binding was dependent on the Na(+) concentration, but had a larger non-electrostatic contribution to the Gibbs energy. A small heat capacity value and the enthalpy-entropy compensation in the energetics of the interaction characterized the binding of the dyes to tRNA. This study confirms that the tRNA(phe) binding affinity is greater for TO compared to TBO. The utility of the present work lies in understanding the potential binding and consequent damage to tRNA by these toxic dyes in their development as therapeutic agents. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Single-Molecule Counting of Point Mutations by Transient DNA Binding

    Science.gov (United States)

    Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

    2017-03-01

    High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

  7. On RNA-RNA interaction structures of fixed topological genus.

    Science.gov (United States)

    Fu, Benjamin M M; Han, Hillary S W; Reidys, Christian M

    2015-04-01

    Interacting RNA complexes are studied via bicellular maps using a filtration via their topological genus. Our main result is a new bijection for RNA-RNA interaction structures and a linear time uniform sampling algorithm for RNA complexes of fixed topological genus. The bijection allows to either reduce the topological genus of a bicellular map directly, or to lose connectivity by decomposing the complex into a pair of single stranded RNA structures. Our main result is proved bijectively. It provides an explicit algorithm of how to rewire the corresponding complexes and an unambiguous decomposition grammar. Using the concept of genus induction, we construct bicellular maps of fixed topological genus g uniformly in linear time. We present various statistics on these topological RNA complexes and compare our findings with biological complexes. Furthermore we show how to construct loop-energy based complexes using our decomposition grammar. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Hemostatic disorders of the menopausal period: the role of microRNA

    Directory of Open Access Journals (Sweden)

    Grzegorz Stachowiak

    2015-06-01

    Full Text Available Adverse changes in hemostasis of menopausal women, observed e.g. in atherosclerotic or neoplastic cases, are of multicausal origin. It is believed that in the development and regulation of these processes, an important role is played by microRNA particles, which presence is ascertained in endothelial cells, atherosclerotic plaques and systemic circulation. Discovered for the first time over 20 years ago, up to now over two and a half thousand types of microRNA have been identified in the human body. MicroRNAs are single stranded RNA molecules of 20-24 nucleotides, encoded by the cell’s genome and then transcribed by polymerase II. They regulate the expression of a large gene pool, approximately 30% of all genes, in the human body. MicroRNA molecules, like other bioactive moleculesRNA, protein – both play important roles in tumor invasion, metastasis, inflammation, coagulation, and regeneration. What is important, they can be detected not only in tissues (e.g. tumor tissues, but also in circulation (blood serum, where they are released. Accurate understanding of the role played by certain types of microRNA (e.g. miR-126, miR-17-92, miR-33, miR-613, miR-27a/b, miR-143, miR-335, miR-370, miR-122, miR-19b, miR-520, or miR-220 in hemostatic processes may allow in the future for their use not only as specific biomarkers of cardiovascular diseases but also as the target for innovative gene therapies.

  9. Hemostatic disorders of the menopausal period: the role of microRNA.

    Science.gov (United States)

    Stachowiak, Grzegorz; Zając, Agnieszka; Nowak, Marek; Stetkiewicz, Tomasz; Wilczyński, Jacek R

    2015-06-01

    Adverse changes in hemostasis of menopausal women, observed e.g. in atherosclerotic or neoplastic cases, are of multicausal origin. It is believed that in the development and regulation of these processes, an important role is played by microRNA particles, which presence is ascertained in endothelial cells, atherosclerotic plaques and systemic circulation. Discovered for the first time over 20 years ago, up to now over two and a half thousand types of microRNA have been identified in the human body. MicroRNAs are single stranded RNA molecules of 20-24 nucleotides, encoded by the cell's genome and then transcribed by polymerase II. They regulate the expression of a large gene pool, approximately 30% of all genes, in the human body. MicroRNA molecules, like other bioactive molecules - RNA, protein - both play important roles in tumor invasion, metastasis, inflammation, coagulation, and regeneration. What is important, they can be detected not only in tissues (e.g. tumor tissues), but also in circulation (blood serum), where they are released. Accurate understanding of the role played by certain types of microRNA (e.g. miR-126, miR-17-92, miR-33, miR-613, miR-27a/b, miR-143, miR-335, miR-370, miR-122, miR-19b, miR-520, or miR-220) in hemostatic processes may allow in the future for their use not only as specific biomarkers of cardiovascular diseases but also as the target for innovative gene therapies.

  10. Identification of Small-Molecule Inhibitors of the HuR/RNA Interaction Using a Fluorescence Polarization Screening Assay Followed by NMR Validation.

    Directory of Open Access Journals (Sweden)

    Zhonghua Wang

    Full Text Available The human antigen R (HuR stabilizes many mRNAs of proto-oncogene, transcription factors, cytokines and growth factors by recognizing AU-rich elements (AREs presented in their 3' or 5' untranslated region (UTR. Multiple lines of experimental evidence suggest that this process plays a key role in cancer development. Thus, destabilizing HuR/RNA interaction by small molecules presents an opportunity for cancer treatment/prevention. Here we present an integrated approach to identify inhibitors of HuR/RNA interaction using a combination of fluorescence-based and NMR-based high throughput screening (HTS. The HTS assay with fluorescence polarization readout and Z'-score of 0.8 was used to perform a screen of the NCI diversity set V library in a 384 well plate format. An NMR-based assay with saturation transfer difference (STD detection was used for hits validation. Protein NMR spectroscopy was used to demonstrate that some hit compounds disrupt formation of HuR oligomer, whereas others block RNA binding. Thus, our integrated high throughput approach provides a new avenue for identification of small molecules targeting HuR/RNA interaction.

  11. Construction of a laser combiner for dual fluorescent single molecule imaging of pRNA of phi29 DNA packaging motor.

    Science.gov (United States)

    Zhang, Hui; Shu, Dan; Browne, Mark; Guo, Peixuan

    2010-02-01

    A customized laser combiner was designed and constructed for dual channel single molecule imaging. The feasibility of a combiner-incorporated imaging system was demonstrated in studies of single molecule FRET. Distance rulers made of dual-labeled dsDNA were used to evaluate the system by determining the distance between one FRET pair. The results showed that the system is sensitive enough to distinguish between distances differing by two base pair and the distances calculated from FRET efficiencies are close to those documented in the literature. The single molecule FRET with the dual-color imaging system was also applied to reconstructed phi29 motor pRNA monomers. Finally, techniques for dual laser alignment and tuning of laser power for dual-color excitation are discussed.

  12. RNA

    African Journals Online (AJOL)

    SARAH

    30 nov. 2013 ... RÉSUMÉ. Objectif : La présente étude est conduite dans les régions de Maradi et Zinder situées dans le Centre-Sud du. Niger où la pratique de la régénération naturelle assistée des ligneux dans les champs (RNA) a permis de reverdir plus de 5 millions d'hectares. Le but de ce travail est d'évaluer ...

  13. Small molecule inhibitors of Staphylococcus aureus RnpA alter cellular mRNA turnover, exhibit antimicrobial activity, and attenuate pathogenesis.

    Directory of Open Access Journals (Sweden)

    Patrick D Olson

    2011-02-01

    Full Text Available Methicillin-resistant Staphylococcus aureus is estimated to cause more U.S. deaths annually than HIV/AIDS. The emergence of hypervirulent and multidrug-resistant strains has further amplified public health concern and accentuated the need for new classes of antibiotics. RNA degradation is a required cellular process that could be exploited for novel antimicrobial drug development. However, such discovery efforts have been hindered because components of the Gram-positive RNA turnover machinery are incompletely defined. In the current study we found that the essential S. aureus protein, RnpA, catalyzes rRNA and mRNA digestion in vitro. Exploiting this activity, high through-put and secondary screening assays identified a small molecule inhibitor of RnpA-mediated in vitro RNA degradation. This agent was shown to limit cellular mRNA degradation and exhibited antimicrobial activity against predominant methicillin-resistant S. aureus (MRSA lineages circulating throughout the U.S., vancomycin intermediate susceptible S. aureus (VISA, vancomycin resistant S. aureus (VRSA and other Gram-positive bacterial pathogens with high RnpA amino acid conservation. We also found that this RnpA-inhibitor ameliorates disease in a systemic mouse infection model and has antimicrobial activity against biofilm-associated S. aureus. Taken together, these findings indicate that RnpA, either alone, as a component of the RNase P holoenzyme, and/or as a member of a more elaborate complex, may play a role in S. aureus RNA degradation and provide proof of principle for RNA catabolism-based antimicrobial therapy.

  14. RNA deep sequencing reveals differential microRNA expression during development of sea urchin and sea star.

    Directory of Open Access Journals (Sweden)

    Sabah Kadri

    Full Text Available microRNAs (miRNAs are small (20-23 nt, non-coding single stranded RNA molecules that act as post-transcriptional regulators of mRNA gene expression. They have been implicated in regulation of developmental processes in diverse organisms. The echinoderms, Strongylocentrotus purpuratus (sea urchin and Patiria miniata (sea star are excellent model organisms for studying development with well-characterized transcriptional networks. However, to date, nothing is known about the role of miRNAs during development in these organisms, except that the genes that are involved in the miRNA biogenesis pathway are expressed during their developmental stages. In this paper, we used Illumina Genome Analyzer (Illumina, Inc. to sequence small RNA libraries in mixed stage population of embryos from one to three days after fertilization of sea urchin and sea star (total of 22,670,000 reads. Analysis of these data revealed the miRNA populations in these two species. We found that 47 and 38 known miRNAs are expressed in sea urchin and sea star, respectively, during early development (32 in common. We also found 13 potentially novel miRNAs in the sea urchin embryonic library. miRNA expression is generally conserved between the two species during development, but 7 miRNAs are highly expressed in only one species. We expect that our two datasets will be a valuable resource for everyone working in the field of developmental biology and the regulatory networks that affect it. The computational pipeline to analyze Illumina reads is available at http://www.benoslab.pitt.edu/services.html.

  15. RNA deep sequencing reveals differential microRNA expression during development of sea urchin and sea star.

    Science.gov (United States)

    Kadri, Sabah; Hinman, Veronica F; Benos, Panayiotis V

    2011-01-01

    microRNAs (miRNAs) are small (20-23 nt), non-coding single stranded RNA molecules that act as post-transcriptional regulators of mRNA gene expression. They have been implicated in regulation of developmental processes in diverse organisms. The echinoderms, Strongylocentrotus purpuratus (sea urchin) and Patiria miniata (sea star) are excellent model organisms for studying development with well-characterized transcriptional networks. However, to date, nothing is known about the role of miRNAs during development in these organisms, except that the genes that are involved in the miRNA biogenesis pathway are expressed during their developmental stages. In this paper, we used Illumina Genome Analyzer (Illumina, Inc.) to sequence small RNA libraries in mixed stage population of embryos from one to three days after fertilization of sea urchin and sea star (total of 22,670,000 reads). Analysis of these data revealed the miRNA populations in these two species. We found that 47 and 38 known miRNAs are expressed in sea urchin and sea star, respectively, during early development (32 in common). We also found 13 potentially novel miRNAs in the sea urchin embryonic library. miRNA expression is generally conserved between the two species during development, but 7 miRNAs are highly expressed in only one species. We expect that our two datasets will be a valuable resource for everyone working in the field of developmental biology and the regulatory networks that affect it. The computational pipeline to analyze Illumina reads is available at http://www.benoslab.pitt.edu/services.html. © 2011 Kadri et al.

  16. RNA Deep Sequencing Reveals Differential MicroRNA Expression during Development of Sea Urchin and Sea Star

    Science.gov (United States)

    Kadri, Sabah; Hinman, Veronica F.; Benos, Panayiotis V.

    2011-01-01

    microRNAs (miRNAs) are small (20–23 nt), non-coding single stranded RNA molecules that act as post-transcriptional regulators of mRNA gene expression. They have been implicated in regulation of developmental processes in diverse organisms. The echinoderms, Strongylocentrotus purpuratus (sea urchin) and Patiria miniata (sea star) are excellent model organisms for studying development with well-characterized transcriptional networks. However, to date, nothing is known about the role of miRNAs during development in these organisms, except that the genes that are involved in the miRNA biogenesis pathway are expressed during their developmental stages. In this paper, we used Illumina Genome Analyzer (Illumina, Inc.) to sequence small RNA libraries in mixed stage population of embryos from one to three days after fertilization of sea urchin and sea star (total of 22,670,000 reads). Analysis of these data revealed the miRNA populations in these two species. We found that 47 and 38 known miRNAs are expressed in sea urchin and sea star, respectively, during early development (32 in common). We also found 13 potentially novel miRNAs in the sea urchin embryonic library. miRNA expression is generally conserved between the two species during development, but 7 miRNAs are highly expressed in only one species. We expect that our two datasets will be a valuable resource for everyone working in the field of developmental biology and the regulatory networks that affect it. The computational pipeline to analyze Illumina reads is available at http://www.benoslab.pitt.edu/services.html. PMID:22216218

  17. MicroRNA and Male Infertility: A Potential for Diagnosis

    Directory of Open Access Journals (Sweden)

    Yahya Khazaie

    2014-07-01

    Full Text Available MicroRNAs (miRNAs are small non-coding single stranded RNA molecules that are physiologically produced in eukaryotic cells to regulate or mostly down-regulate genes by pairing with their complementary base-sequence in related mRNA molecules in the cytoplasm. It has been reported that other than its function in many physiological cell processes, dysregulation of miRNAs plays a role in the development of many diseases. In this short review, the association between miRNAs and some male reproductive disorders is surveyed. Male factor Infertility is a devastating problem from which a notable percentage of couples suffer. However, the molecular mechanism of many infertility disorders has not been clearly elucidated. Since miRNAs have an important role in numerous biological cell processes and cellular dysfunctions, it is of interest to review the related literature on the role of miRNAs in the male reproductive organs. Aberrant expression of specific miRNAs is associated with certain male reproductive dysfunctions. For this reason, assessment of expression of such miRNAs may serve as a suitable molecular biomarker for diagnosis of those male infertility disorders. The presence of a single nucleotide polymorphism (SNP at the miRNAs’ binding site in its targeted mRNA has been reported to have an association with idiopathic male infertility. Also, a relation with male infertility has been shown with SNP in the genes of the factors necessary for miRNA biogenesis. Therefore, focusing on the role of miRNAs in male reproductive disorders can further elucidate the molecular mechanisms of male infertility and generate the potential for locating efficient biomarkers and therapeutic agents for these disorders.

  18. The elastic theory of a single DNA molecule

    Indian Academy of Sciences (India)

    the other hand, if there is a negative torsional stress, a pulling force as small as 0.3 pN can distort the native structure of DNA considerably [5,6]. Related to the latter, there has been recent progress in understanding the force–extension curves of single-stranded DNA. (ssDNA) and RNA [7–12]. Many distinct transitions have ...

  19. Efficient DNA ligation in DNA–RNA hybrid helices by Chlorella virus DNA ligase

    Science.gov (United States)

    Lohman, Gregory J. S.; Zhang, Yinhua; Zhelkovsky, Alexander M.; Cantor, Eric J.; Evans, Thomas C.

    2014-01-01

    Single-stranded DNA molecules (ssDNA) annealed to an RNA splint are notoriously poor substrates for DNA ligases. Herein we report the unexpectedly efficient ligation of RNA-splinted DNA by Chlorella virus DNA ligase (PBCV-1 DNA ligase). PBCV-1 DNA ligase ligated ssDNA splinted by RNA with kcat ≈ 8 x 10−3 s−1 and KM DNA ligase produced only 5′-adenylylated DNA with a 20-fold lower kcat and a KM ≈ 300 nM. The rate of ligation increased with addition of Mn2+, but was strongly inhibited by concentrations of NaCl >100 mM. Abortive adenylylation was suppressed at low ATP concentrations (8, leading to increased product yields. The ligation reaction was rapid for a broad range of substrate sequences, but was relatively slower for substrates with a 5′-phosphorylated dC or dG residue on the 3′ side of the ligation junction. Nevertheless, PBCV-1 DNA ligase ligated all sequences tested with 10-fold less enzyme and 15-fold shorter incubation times than required when using T4 DNA ligase. Furthermore, this ligase was used in a ligation-based detection assay system to show increased sensitivity over T4 DNA ligase in the specific detection of a target mRNA. PMID:24203707

  20. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA.

    Science.gov (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S

    2000-09-20

    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  1. Flow cytometry analysis of single-strand DNA damage in neuroblastoma cell lines using the F7-26 monoclonal antibody.

    Science.gov (United States)

    Grigoryan, Rita S; Yang, Bo; Keshelava, Nino; Barnhart, Jerry R; Reynolds, C Patrick

    2007-11-01

    The F7-26 monoclonal antibody (Mab) has been reported to be specific for single-strand DNA damage (ssDNA) and to also identify cells in apoptosis. We carriedout studies to determine if F7-26 binding measured by flow cytometry was able to specifically identify exogenous ssDNA as opposed to DNA damage from apoptosis. Neuroblastoma cells were treated with melphalan (L-PAM), fenretinide, 4-hydroperoxycyclophosphamide (4-HC)+/-pan-caspase inhibitor BOC-d-fmk, topotecan or with 10Gy gamma radiation+/-hydrogen peroxide (H2O2) and fixed immediately postradiation. Cytotoxicity was measured by DIMSCAN digital imaging fluorescence assay. The degree of ssDNA damage was analyzed by flow cytometry using Mab F7-26, with DNA visualized by propidium iodide counterstaining. Flow cytometry was used to measure apoptosis detected by terminal deoxynucleotidyltransferase (TUNEL) assay and reactive oxygen species (ROS) by carboxy-dichlorofluorescein diacetate. Irradiated and immediately fixed neuroblastoma cells showed increased ssDNA, but not apoptosis by TUNEL (TUNEL-negative). 4-HC or L-PAM+/-BOC-d-fmk increased ssDNA (F7-26-positive), but BOC-d-fmk prevented TUNEL staining. Fenretinide increased apoptosis by TUNEL but not ssDNA damage detected with F7-26. Enhanced ssDNA in neuroblastoma cells treated with radiation+H2O2 was associated with increased ROS. Topotecan increased both ssDNA and cytotoxicity in 4-HC-treated cells. These data demonstrate that Mab F7-26 recognized ssDNA due to exogenous DNA damage, rather than apoptosis. This assay should be useful to characterize the mechanism of action of antineoplastic drugs. Copyright (c) 2007 International Society for Analytical Cytology.

  2. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani

    2006-09-01

    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  3. Detection of p53 mutations by single-strand conformation polymorphisms (SSCP) gel electrophoresis. A comparative study of radioactive and nonradioactive silver-stained SSCP analysis.

    Science.gov (United States)

    Bosari, S; Marchetti, A; Buttitta, F; Graziani, D; Borsani, G; Loda, M; Bevilacqua, G; Coggi, G

    1995-12-01

    p53 mutations are the most common genetic abnormality in humans tumors, but their clinical significance remains to be precisely elucidated. Conventional single-strand conformation polymorphism (SSCP) analysis, a well-established technique for detecting p53 mutations, uses radioactively labeled polymerase chain reaction (PCR) products, which migrate abnormally in the presence of mutations. We performed radioactive PCR-SSCP analysis in a series of 30 formalin-fixed, paraffin-embedded ovarian carcinomas and two cell lines (SW480 and Caov4) harboring known homozygous p53 mutations and compared the results with nonradioactive silver-stained SSCP. The purpose was to assess whether nonradioactive SSCP is suitable for detecting p53 mutations in a rapid, sensitive, cost-effective fashion, without the need of radioactive isotopes. We accomplished PCR amplification of p53 exons 5 through 8 in 26 carcinomas, and radioactive SSCP detected p53 mutations in 13 tumors; three mutations were localized in exon 5, six in exon 6, two in exon 7, and two in exon 8. All mutations were correctly identified with nonradioactive SSCP, except for one exon 8 mutation. To establish the sensitivity of nonradioactive SSCP, DNA samples of SW480 and Caov4 were mixed with increasing amounts (0-90%) of normal DNA and subjected to PCR-SSCP analysis. Mutations were detected until the concentration of SW480 and Caov4 was 15% and 10%, respectively, of the total sample. The results of our investigation demonstrate that nonradioactive silver-stained SSCP is a sensitive, rapid, and simple technique to detect p53 mutations, even in formalin-fixed tissues, and could be easily used to investigate large series of patients to assess the clinical significance of p53 mutations in human tumors.

  4. Ampelomyces mycoparasites from apple powdery mildew identified as a distinct group based on single-stranded conformation polymorphism analysis of the rDNA ITS region.

    Science.gov (United States)

    Szentiványi, Orsolya; Kiss, Levente; Russell, John C; Kovács, Gábor M; Varga, Krisztina; Jankovics, Tünde; Lesemann, Silke; Xu, Xiang-Ming; Jeffries, Peter

    2005-04-01

    Pycnidial fungi belonging to the genus Ampelomyces are the most common natural antagonists of powdery mildews worldwide. During a study of the interactions between apple powdery mildew (Podosphaera leucotricha) and Ampelomyces mycoparasites, 52 new Ampelomyces isolates were obtained from P. leucotricha and, in addition, 13 new isolates from other species of the Erysiphaceae in four European countries. Their genetic diversity was screened using single-stranded conformation polymorphism (SSCP) analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). For comparison, 24 isolates obtained from genetic resource collections or other sources were included in this study. Based on the ITS-SSCP patterns, the isolates were placed in eight groups. The isolates belonged to two types based on their growth in culture. The faster-growing and the slower-growing isolates were included in different SSCP groups. A phylogenetic analysis of the ITS sequences of representatives of these groups confirmed the results obtained with the SSCP method, and showed that the faster-growing isolates do not belong to Ampelomyces as suggested by earlier studies. All the isolates from P. leucotricha fell into a distinct SSCP group of genetically homogeneous isolates. This suggests that Ampelomyces mycoparasites which occur in apple powdery mildew are slightly different from the other Ampelomyces groups which contain mycoparasites from various powdery mildew species. This may be because the main growth period of Ampelomyces mycoparasites in apple powdery mildew is isolated in time from that of Ampelomyces isolates that occur in other species of the Erysiphaceae. P. leucotricha starts its life-cycle early in the season, usually in March-April, while most powdery mildews are active in the same environments only late in the year.

  5. Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody: a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody.

    Science.gov (United States)

    Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua

    2018-02-01

    Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.

  6. Variabilidad genética de Aedes aegypti en algunas áreas del Perú usando Single Stranded Conformational Polymorphism (SSCP

    Directory of Open Access Journals (Sweden)

    Nélida Leiva G

    2004-07-01

    Full Text Available Aedes aegypti es el vector responsable de la transmisión del virus del dengue, su distribución geográfica se ha ampliado rápidamente debido principalmente a la intervención de los seres humanos. Objetivo: Analizar la variabilidad genética de este mosquito mediante la comparación del Segundo Espaciador Transcrito Interno (ITS 2 perteneciente al ADN ribosomal (rADN. Materiales y Métodos: Se analizaron muestras de ocho localidades (Jaén, Tingo María, Iquitos, Lambayeque, el distrito de El Rimac, Sullana y Zarumilla y uno de la provincia de Huaquillas (Ecuador. El análisis de la variabilidad se determinó usando la técnica conocida como SSCP (Single Stranded Conformation Polymorphism. Resultados: El estudio muestra que existe variabilidad genética entre las poblaciones analizadas, principalmente entre las muestras localizadas en la costa del Perú (Zarumilla, El Rímac, Sullana y Huaquillas y las muestras del nororiente (Tingo María, Iquitos, Jaén y Lambayeque Conclusión: Se determinaron dos variantes genéticas entre las poblaciones de Aedes aegypti: Costeña y Nororiental, que probablemente provienen de dos ancestros diferentes y cuyo ancestro común sufrió de aislamiento por distancia. Se observó que no existe relación entre las distancias genéticas y las distancias geográficas indicando que la migración de estas poblaciones es el resultado de la intervención de los seres humanos que diseminan al vector y no por la migración activa del mosquito. Se plantea el papel de la Cordillera de los Andes en la migración y separación de las poblaciones de Aedes.

  7. Detection of hybridization of single-strand DNA PCR products in temperature change process by a novel metal-clamping piezoelectric sensor.

    Science.gov (United States)

    Chen, Qinghai; Bian, Zhiheng; Hua, Xing; Yao, Chunyan; Wu, Wei; Zhang, Xue; Zhang, Bo; Huang, Junfu; Tang, Wanli; Fu, Weiling

    2010-05-15

    Oligonucleotide probes on the sensor surface can be hybridized with single-strand DNA (ssDNA) that is formed from PCR products in ice bath after degeneration. Thus, detection of PCR products by piezoelectric sensors requires the participation of ssDNA PCR products in ice bath. When PCR products in ice bath are added into the buffer of the sensor well at room temperature, there will be a temperature change process during mixing. However, it still remains unclear whether the temperature change affects the frequency baseline stability of the sensor and the result judgment, which is the basic condition for detecting hybridization of nucleic acid. In this study, we detected the hybridization of HPV PCR products during temperature change process by a self-designed adjustable metal-clamping piezoelectric sensor. The study mainly involves sensor adjustment, probe immobilization and ice bath sample addition (at different concentrations and different volumes). The response curve of basic frequency in temperature change process showed three stages, i.e., increase, decrease to baseline, and continuous decrease to stability. The early increase of frequency and duration of the time can reach 55+/-7.4 Hz and 39 min when 40 microL sample (0-1 degrees C) was added into 110 microL buffer (25 degrees C). The frequency increase effect caused by temperature difference at early stage depends on the volume ratio of two liquids and on the temperature difference. The results indicate that we should pay more attention to possibly small volume of PCR products in ice bath and minor temperature difference of two liquids in operation. 2010 Elsevier B.V. All rights reserved.

  8. Gauging the Nanotoxicity of h2D-C2N toward Single-Stranded DNA: An in Silico Molecular Simulation Approach.

    Science.gov (United States)

    Mukhopadhyay, Titas Kumar; Bhattacharyya, Kalishankar; Datta, Ayan

    2018-04-12

    Recent toxicological assessments of graphene, graphene oxides, and some other two-dimensional (2D) materials have shown them to be substantially toxic at the nanoscale, where they inhibit and eventually disrupt biological processes. These shortfalls of graphene and analogs have resulted in a quest for novel biocompatible 2D materials with minimum cytotoxicity. In this article, we demonstrate C 2 N (h2D-C 2 N), a newly synthesized 2D porous graphene analog, to be non-nanotoxic toward genetic materials from an "in-silico" point of view through sequence-dependent binding of different polynucleotide single-stranded DNA (ssDNA) onto it. The calculated binding energy of nucleobases and the free energy of binding of polynucleotides follow the common trait, cytosine > guanine > adenine > thymine, and are well within the limits of physisorption. Ab-initio simulations completely exclude the possibility of any chemical reaction, demonstrating purely noncovalent binding of nucleobases with C 2 N through a crucial interplay between hydrogen bonding and π-stacking interactions with the surface. Further, we show that the extent of distortion inflicted upon ssDNA by C 2 N is negligible. Analysis of the density of states of the nucleobase-C 2 N hybrids confirms minimum electronic perturbation of the bases after adsorption. Most importantly, we demonstrate the potency of C 2 N in nucleic acid transportation via reversible binding of ssDNA. The plausible use of C 2 N as a template for DNA repair is illustrated through an example of C 2 N-assisted complementary ssDNA winding.

  9. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Specificity in the association of tomato black ring virus satellite RNA with helper virus.

    Science.gov (United States)

    Oncino, C; Hemmer, O; Fritsch, C

    1995-10-20

    The satellite RNAs (sat-RNAs) associated with some isolates of tomato black ring virus (TBRV) consist of single-stranded molecules of about 1375 nucleotides, encoding a nonstructural protein of 48K which has been shown to be involved in the replication of the sat-RNA. The TBRV sat-RNAs are also dependent for their replication and for their encapsidation on the helper virus. To characterize the nature of the association between sat-RNA and helper virus, transcripts of sat-RNA from TBRV isolates C and L (respectively, of serotypes G and S) have been prepared and inoculated onto Chenopodium quinoa leaves or protoplasts. Transcript of the TBRV sat-RNA C is efficiently multiplied when coinoculated with the genomic RNAs of TBRV isolate G (used instead of TBRV isolate C, because isolate G was depleted of sat-RNA), but does not multiply with TBRV isolate L. On the other hand, transcript of the sat-RNA L is able to multiply with the cognate helper virus and, less efficiently, with grapevine chrome mosaic virus (another nepovirus, 80% similar to TBRV), but does not multiply with TBRV G. The specificity of the association resides at the level of sat-RNA replication. Analysis of the multiplication of chimeric sat-RNAs, obtained by exchanging different regions between the two sat-RNAs C and L, showed that the 5' and the 3' noncoding regions of the sat-RNA, although important for replication, are not implicated in specificity. The results suggest that the determinants of the specificity are contained in the 48K sat-RNA-encoded protein.

  11. Characterization and subcellular localization of an RNA silencing suppressor encoded by Rice stripe tenuivirus

    International Nuclear Information System (INIS)

    Xiong Ruyi; Wu Jianxiang; Zhou Yijun; Zhou Xueping

    2009-01-01

    Rice stripe virus (RSV) is a single-stranded (ss) RNA virus belonging to the genus Tenuivirus. RSV is present in many East Asian countries and causes severe diseases in rice fields, especially in China. In this study, we analyzed six proteins encoded by the virus for their abilities to suppress RNA silencing in plant using a green fluorescent protein (GFP)-based transient expression assay. Our results indicate that NS3 encoded by RSV RNA3, but not other five RSV encoded proteins, can strongly suppress local GFP silencing in agroinfiltrated Nicotiana benthamiana leaves. NS3 can reverse the GFP silencing, it can also prevent long distance spread of silencing signals which have been reported to be necessary for inducing systemic silencing in host plants. The NS3 protein can significantly reduce the levels of small interfering RNAs (siRNAs) in silencing cells, and was found to bind 21-nucleotide ss-siRNA, siRNA duplex and long ssRNA but not long double-stranded (ds)-RNA. Both N and C terminal of the NS3 protein are critical for silencing suppression, and mutation of the putative nuclear localization signal decreases its local silencing suppression efficiency and blocks its systemic silencing suppression. The NS3-GFP fusion protein and NS3 were shown to accumulate predominantly in nuclei of onion, tobacco and rice cells through transient expression assay or immunocytochemistry and electron microscopy. In addition, transgenic rice and tobacco plants expressing the NS3 did not show any apparent alteration in plant growth and morphology, although NS3 was proven to be a pathogenicity determinant in the PVX heterogenous system. Taken together, our results demonstrate that RSV NS3 is a suppressor of RNA silencing in planta, possibly through sequestering siRNA molecules generated in cells that are undergoing gene silencing.

  12. Reduction of Adhesion Molecule Production and Alteration of eNOS and Endothelin-1 mRNA Expression in Endothelium by Euphorbia hirta L. through Its Beneficial β-Amyrin Molecule

    Directory of Open Access Journals (Sweden)

    Mei Fen Shih

    2014-07-01

    Full Text Available The inflammatory reaction in large blood vessels involves up-regulation of vascular adhesion molecules such as endothelial cell selectin (E-selectin, soluble vascular cell adhesion molecule (sVCAM-1, and soluble intercellular adhesion molecule (sICAM-1. These vascular dysfunctions are associated with the development of atherosclerosis. β-Amyrin, an active component of Euphorbia hirta L., has potent anti-inflammatory effects. So far, its preventive effects against the expression of inflammatory mediator-induced adhesion molecules have not been investigated. Endothelial cells (SVEC4-10 cell line were treated with 50% RAW conditioned media (i.e., normal SVEC4-10 culture media contains 50% of lipopolysaccharide-activated macrophage culture media without or with β-amyrin (0.6 and 0.3 µM. The production levels of E-selectin, sICAM-1, and sVCAM-1 in the SVEC4-10 cells were measured with ELISA assay kits. Under the same treatment conditions, expression of endothelin (ET-1 and endothelial type of NO synthase (eNOS mRNA were analyzed by RT-PCR and agarose gel. With β-amyrin, the 50% RAW conditioned media-induced E-selectin, sICAM-1, and sVCAM-1 levels as well as ET-1 gene expression were all suppressed. β-Amyrin treatment also restored the 50% RAW conditioned media-suppressed eNOS mRNA expression. These data indicate that β-amyrin is potentially useful in preventing chronic inflammation-related vascular diseases.

  13. Reduction of adhesion molecule production and alteration of eNOS and endothelin-1 mRNA expression in endothelium by Euphorbia hirta L. through its beneficial β-amyrin molecule.

    Science.gov (United States)

    Shih, Mei Fen; Cherng, Jong Yuh

    2014-07-18

    The inflammatory reaction in large blood vessels involves up-regulation of vascular adhesion molecules such as endothelial cell selectin (E-selectin), soluble vascular cell adhesion molecule (sVCAM)-1, and soluble intercellular adhesion molecule (sICAM)-1. These vascular dysfunctions are associated with the development of atherosclerosis. β-Amyrin, an active component of Euphorbia hirta L., has potent anti-inflammatory effects. So far, its preventive effects against the expression of inflammatory mediator-induced adhesion molecules have not been investigated. Endothelial cells (SVEC4-10 cell line) were treated with 50% RAW conditioned media (i.e., normal SVEC4-10 culture media contains 50% of lipopolysaccharide-activated macrophage culture media) without or with β-amyrin (0.6 and 0.3 µM). The production levels of E-selectin, sICAM-1, and sVCAM-1 in the SVEC4-10 cells were measured with ELISA assay kits. Under the same treatment conditions, expression of endothelin (ET)-1 and endothelial type of NO synthase (eNOS) mRNA were analyzed by RT-PCR and agarose gel. With β-amyrin, the 50% RAW conditioned media-induced E-selectin, sICAM-1, and sVCAM-1 levels as well as ET-1 gene expression were all suppressed. β-Amyrin treatment also restored the 50% RAW conditioned media-suppressed eNOS mRNA expression. These data indicate that β-amyrin is potentially useful in preventing chronic inflammation-related vascular diseases.

  14. Irradiation of biological molecules (DNA and RNA bases) by proton impact in the velocity range of the Bragg peak (20-150 keV/amu)

    International Nuclear Information System (INIS)

    Tabet, J.

    2007-11-01

    The aim of this work was to study the ionization of DNA and RNA base molecules by proton impact at energies between 20 and 150 keV/amu. The experiments developed over the course of this project made it possible not only to study the fragmentation of uracil, thymine, adenine, and cytosine, but also to measure absolute cross sections for different ionization processes initiated by proton interactions with these important biological molecules. Firstly, the experimental system enabled the contributions of two key ionization processes to be separated: direct ionization and electron capture. The corresponding mass spectra were measured and analyzed on an event-by-event basis. For uracil, the branching ratios for these two processes were measured as function of the projectile velocity. Secondly, we have developed a system to measure absolute cross sections for the electron capture process. The production rate of neutral atoms compared to protons was measured for the four biological molecules: uracil, cytosine, thymine, and adenine at different vaporization temperatures. This production rate varies as a function of the thickness of the target jet traversed by the protons. Accordingly, a deposit experiment was developed in order to characterize the density of molecules in the targeted gas jets. Theoretical and experimental study of the total effusion and density-profile of the gaseous molecular beams enabled us to deduce the thickness of the target jets traversed by the protons. Thus it was possible to determine absolute cross sections for the ionization of each of the four isolated biological molecules by 80 keV protons impact. To our knowledge, this work provides the first experimental absolute cross sections for DNA and RNA base ionization processes initiated by proton impact in the velocity range corresponding to the Bragg peak. (author)

  15. Noise Stress-Induced Changes in mRNA Levels of Corticotropin-Releasing Hormone Family Molecules and Glucocorticoid Receptors in the Rat Brain.

    Science.gov (United States)

    Eraslan, E; Akyazi, İ; Ergül-Ekiz, E; Matur, E

    2015-01-01

    Noise is a widespread stress resource that may lead to detrimental effects on the health. However, the molecular basis of the stress response caused by noise remains elusive. We have studied the effects of acute and chronic noise stress on stress-related molecules in the hypothalamus and hippocampus and also corticosterone responses. Sprague Dawley rats were randomized into control, acute and chronic noise stress groups. While the chronic noise stress group animals were exposed to 100 dB white noise for 4 h/a day during 30 days, the acute noise stress group of animals was exposed to the same level of stress once for 4 h. The expression profiles of corticotropin releasing hormone (CRH), CRH1, CRH2 receptors and glucocorticoid receptor (GR) mRNAs were analysed by RT-PCR. Chronic noise stress upregulated CRH mRNA levels in the hypothalamus. Both acute and chronic noise increased CRH-R1 mRNA in the hypothalamus but decreased it in the hippocampus. GR mRNA levels were decreased by chronic noise stress in the hippocampus. The present results suggest that while corticosterone responses have habituated to continuous noise stress, the involvement of CRH family molecules and glucocorticoid receptors in the noise stress responses are different and structure specific.

  16. Brickworx builds recurrent RNA and DNA structural motifs into medium- and low-resolution electron-density maps

    Energy Technology Data Exchange (ETDEWEB)

    Chojnowski, Grzegorz, E-mail: gchojnowski@genesilico.pl [International Institute of Molecular and Cell Biology, Trojdena 4, 02-109 Warsaw (Poland); Waleń, Tomasz [International Institute of Molecular and Cell Biology, Trojdena 4, 02-109 Warsaw (Poland); University of Warsaw, Banacha 2, 02-097 Warsaw (Poland); Piątkowski, Paweł; Potrzebowski, Wojciech [International Institute of Molecular and Cell Biology, Trojdena 4, 02-109 Warsaw (Poland); Bujnicki, Janusz M. [International Institute of Molecular and Cell Biology, Trojdena 4, 02-109 Warsaw (Poland); Adam Mickiewicz University, Umultowska 89, 61-614 Poznan (Poland)

    2015-03-01

    A computer program that builds crystal structure models of nucleic acid molecules is presented. Brickworx is a computer program that builds crystal structure models of nucleic acid molecules using recurrent motifs including double-stranded helices. In a first step, the program searches for electron-density peaks that may correspond to phosphate groups; it may also take into account phosphate-group positions provided by the user. Subsequently, comparing the three-dimensional patterns of the P atoms with a database of nucleic acid fragments, it finds the matching positions of the double-stranded helical motifs (A-RNA or B-DNA) in the unit cell. If the target structure is RNA, the helical fragments are further extended with recurrent RNA motifs from a fragment library that contains single-stranded segments. Finally, the matched motifs are merged and refined in real space to find the most likely conformations, including a fit of the sequence to the electron-density map. The Brickworx program is available for download and as a web server at http://iimcb.genesilico.pl/brickworx.

  17. RNA Crystallization

    Science.gov (United States)

    Golden, Barbara L.; Kundrot, Craig E.

    2003-01-01

    RNA molecules may be crystallized using variations of the methods developed for protein crystallography. As the technology has become available to syntheisize and purify RNA molecules in the quantities and with the quality that is required for crystallography, the field of RNA structure has exploded. The first consideration when crystallizing an RNA is the sequence, which may be varied in a rational way to enhance crystallizability or prevent formation of alternate structures. Once a sequence has been designed, the RNA may be synthesized chemically by solid-state synthesis, or it may be produced enzymatically using RNA polymerase and an appropriate DNA template. Purification of milligram quantities of RNA can be accomplished by HPLC or gel electrophoresis. As with proteins, crystallization of RNA is usually accomplished by vapor diffusion techniques. There are several considerations that are either unique to RNA crystallization or more important for RNA crystallization. Techniques for design, synthesis, purification, and crystallization of RNAs will be reviewed here.

  18. Phosphate-methylated DNA aimed at HIV-1 RNA loops and integrated DNA inhibits viral infectivity

    NARCIS (Netherlands)

    Buck, H. M.; Koole, L. H.; van Genderen, M. H.; Smit, L.; Geelen, J. L.; Jurriaans, S.; Goudsmit, J.

    1990-01-01

    Phosphate-methylated DNA hybridizes strongly and specifically to natural DNA and RNA. Hybridization to single-stranded and double-stranded DNA leads to site-selective blocking of replication and transcription. Phosphate-methylated DNA was used to interrupt the life cycle of the human

  19. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    In this study, shRNA vectors having different stem length were constructed and their silencing effect was tested in mouse embryonic fibroblast and in vivo. Interfering RNAs were designed with stems of 21, 27, and 29 bp. The enhanced green fluorescent protein gene was used as target gene. The synthesized single strands ...

  20. Locked nucleic acid (LNA): High affinity targeting of RNA for diagnostics and therapeutics

    DEFF Research Database (Denmark)

    Kauppinen, S.; Vester, Birte; Wengel, Jesper

    2005-01-01

    Locked nucleic acid (LNA) is a nucleic acid analogue containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA mimicking sugar conformation. This conformational restriction results in unprecedented hybridization affinity towards complementary single stranded RN...

  1. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W

    2009-12-23

    Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation

  2. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  3. The Fuzzy Logic of MicroRNA Regulation: A Key to Control Cell Complexity.

    Science.gov (United States)

    Ripoli, Andrea; Rainaldi, Giuseppe; Rizzo, Milena; Mercatanti, Alberto; Pitto, Letizia

    2010-08-01

    Genomic and clinical evidence suggest a major role of microRNAs (miRNAs) in the regulatory mechanisms of gene expression, with a clear impact on development and physiology; miRNAs are a class of endogenous 22-25 nt single-stranded RNA molecules, that negatively regulate gene expression post-transcriptionally, by imperfect base pairing with the 3' UTR of the corresponding mRNA target. Because of this imperfection, each miRNA can bind multiple targets, and multiple miRNAs can bind the same mRNA target; although digital, the miRNAs control mechanism is characterized by an imprecise action, naturally understandable in the theoretical framework of fuzzy logic.A major practical application of fuzzy logic is represented by the design and the realization of efficient and robust control systems, even when the processes to be controlled show chaotic, deterministic as well unpredictable, behaviours. The vagueness of miRNA action, when considered together with the controlled and chaotic gene expression, is a hint of a cellular fuzzy control system. As a demonstration of the possibility and the effectiveness of miRNA based fuzzy mechanism, a fuzzy cognitive map -a mathematical formalism combining neural network and fuzzy logic- has been developed to study the apoptosis/proliferation control performed by the miRNA-17-92 cluster/E2F1/cMYC circuitry.When experimentally demonstrated, the concept of fuzzy control could modify the way we analyse and model gene expression, with a possible impact on the way we imagine and design therapeutic intervention based on miRNA silencing.

  4. Double-Stranded RNA Is Detected by Immunofluorescence Analysis in RNA and DNA Virus Infections, Including Those by Negative-Stranded RNA Viruses.

    Science.gov (United States)

    Son, Kyung-No; Liang, Zhiguo; Lipton, Howard L

    2015-09-01

    Early biochemical studies of viral replication suggested that most viruses produce double-stranded RNA (dsRNA), which is essential for the induction of the host immune response. However, it was reported in 2006 that dsRNA could be detected by immunofluorescence antibody staining in double-stranded DNA and positive-strand RNA virus infections but not in negative-strand RNA virus infections. Other reports in the literature seemed to support these observations. This suggested that negative-strand RNA viruses produce little, if any, dsRNA or that more efficient viral countermeasures to mask dsRNA are mounted. Because of our interest in the use of dsRNA antibodies for virus discovery, particularly in pathological specimens, we wanted to determine how universal immunostaining for dsRNA might be in animal virus infections. We have detected the in situ formation of dsRNA in cells infected with vesicular stomatitis virus, measles virus, influenza A virus, and Nyamanini virus, which represent viruses from different negative-strand RNA virus families. dsRNA was also detected in cells infected with lymphocytic choriomeningitis virus, an ambisense RNA virus, and minute virus of mice (MVM), a single-stranded DNA (ssDNA) parvovirus, but not hepatitis B virus. Although dsRNA staining was primarily observed in the cytoplasm, it was also seen in the nucleus of cells infected with influenza A virus, Nyamanini virus, and MVM. Thus, it is likely that most animal virus infections produce dsRNA species that can be detected by immunofluorescence staining. The apoptosis induced in several uninfected cell lines failed to upregulate dsRNA formation. An effective antiviral host immune response depends on recognition of viral invasion and an intact innate immune system as a first line of defense. Double-stranded RNA (dsRNA) is a viral product essential for the induction of innate immunity, leading to the production of type I interferons (IFNs) and the activation of hundreds of IFN

  5. Contribution of single-strand breaks and alkali-labile bonds to the loss of infectivity of γ-irradiated phiX174 RF-DNA in E. coli cells mutant in various repair functions

    International Nuclear Information System (INIS)

    McKee, R.H.

    1975-01-01

    Twenty-one radiation sensitive mutants have been examined for their capacity to support gamma-irradiated phiX174 RF-DNA. The survival of phiX174 RF-DNA was reduced in essentially all of the sensitive mutants. The irradiated phiX174 RF-DNA was then separated into populations containing either single-strand breaks or alkali-labile bonds to examine the capacity of the mutants to repair each of the classes of lesions. It was found that all E. coli strains are unable to repair 22 percent of the single-strand breaks and all sensitive mutants are unable to repair an additional 10 percent of the breaks. All the repair functions examined are involved in single-strand break repair and none are more or less necessary than any of the others. PhiX174 RF-DNA is also inactivated by alkali-labile bonds. In the normal strains the inactivation efficiency is 0.16 lethal events per lesion with a threshold dose of 15 to 20 krads. The mutants are divided into two classes by their sensitivity to alkali-labile bonds. Both classes of mutants are also inactivated by alkali-labile bonds with efficiencies of about 0.17 and 0.29 lethal events per lesion, respectively. It is proposed that the differences seen in survival curves of phiX174 measured in the sensitive mutants is due to this difference. Although in normal cells the efficiency of inactivation of phiX174 by single-strand breaks is 50 percent greater than by alkali-labile bonds, alkali-labile bonds are produced at approximately twice the rate of single-strand breaks so alkali-labile bonds account for about 61 percent of the overall inactivation. In the mutants of least sensitivity alkali-labile bonds account for about 54 percent of the inactivating events and in the most sensitive about 67 percent

  6. Polymerase-free measurement of microRNA-122 with single base specificity using single molecule arrays: Detection of drug-induced liver injury.

    Directory of Open Access Journals (Sweden)

    David M Rissin

    Full Text Available We have developed a single probe method for detecting microRNA from human serum using single molecule arrays, with sequence specificity down to a single base, and without the use of amplification by polymerases. An abasic peptide nucleic acid (PNA probe-containing a reactive amine instead of a nucleotide at a specific position in the sequence-for detecting a microRNA was conjugated to superparamagnetic beads. These beads were incubated with a sample containing microRNA, a biotinylated reactive nucleobase-containing an aldehyde group-that was complementary to the missing base in the probe sequence, and a reducing agent. When a target molecule with an exact match in sequence hybridized to the capture probe, the reactive nucleobase was covalently attached to the backbone of the probe by a dynamic covalent chemical reaction. Single molecules of the biotin-labeled probe were then labeled with streptavidin-β-galactosidase (SβG, the beads were resuspended in a fluorogenic enzyme substrate, loaded into an array of femtoliter wells, and sealed with oil. The array was imaged fluorescently to determine which beads were associated with single enzymes, and the average number of enzymes per bead was determined. The assay had a limit of detection of 500 fM, approximately 500 times more sensitive than a corresponding analog bead-based assay, with target specificity down to a single base mis-match. This assay was used to measure microRNA-122 (miR-122-an established biomarker of liver toxicity-extracted from the serum of patients who had acute liver injury due to acetaminophen, and control healthy patients. All patients with liver injury had higher levels of miR-122 in their serum compared to controls, and the concentrations measured correlated well with those determined using RT-qPCR. This approach allows rapid quantification of circulating microRNA with single-based specificity and a limit of quantification suitable for clinical use.

  7. Variation in secondary structure of the 16S rRNA molecule in cyanobacteria with implications for phylogenetic analysis

    Czech Academy of Sciences Publication Activity Database

    Řeháková, Klára; Johansen, J. R.; Bowen, M.B.; Martin, M.P.; Sheil, C.A.

    2014-01-01

    Roč. 14, č. 2 (2014), s. 161-178 ISSN 1802-5439 Institutional support: RVO:60077344 Keywords : 16S rRNA secondary structure * cyanobacteria * phylogeny Subject RIV: EE - Microbiology, Virology Impact factor: 1.930, year: 2014

  8. High throughput mRNA profiling highlights associations between myocardial infarction and aberrant expression of inflammatory molecules in blood cells

    NARCIS (Netherlands)

    Wettinger, Stephanie Bezzina; Doggen, Catharina Jacoba Maria; Spek, C. Arnold; Rosendaal, Frits R.; Reitsma, Pieter H.

    2005-01-01

    Studies on the role of inflammation in cardiovascular disease focus on surrogate markers like plasma levels of C-reactive protein or interleukins that are affected by several factors. In this study we employ an approach in which the inflammatory mRNA profile of leucocytes is measured directly in a

  9. Novel AgoshRNA molecules for silencing of the CCR5 co-receptor for HIV-1 infection

    NARCIS (Netherlands)

    Herrera-Carrillo, Elena; Berkhout, Ben

    2017-01-01

    Allogeneic transplantation of blood stem cells from a CCR5-Δ32 homozygous donor to an HIV-infected individual, the "Berlin patient", led to a cure. Since then there has been a search for approaches that mimic this intervention in a gene therapy setting. RNA interference (RNAi) has evolved as a

  10. Exosomes from iPSCs Delivering siRNA Attenuate Intracellular Adhesion Molecule-1 Expression and Neutrophils Adhesion in Pulmonary Microvascular Endothelial Cells.

    Science.gov (United States)

    Ju, Zhihai; Ma, Jinhui; Wang, Chen; Yu, Jie; Qiao, Yeru; Hei, Feilong

    2017-04-01

    The pro-inflammatory activation of pulmonary microvascular endothelial cells resulting in continuous expression of cellular adhesion molecules, and subsequently recruiting primed neutrophils to form a firm neutrophils-endothelium (PMN-EC) adhesion, has been examined and found to play a vital role in acute lung injury (ALI). RNA interference (RNAi) is a cellular process through harnessing a natural pathway silencing target gene based on recognition and subsequent degradation of specific mRNA sequences. It opens a promising approach for precision medicine. However, this application was hampered by many obstacles, such as immunogenicity, instability, toxicity problems, and difficulty in across the biological membrane. In this study, we reprogrammed urine exfoliated renal epithelial cells into human induced pluripotent stem cells (huiPSCs) and purified the exosomes (Exo) from huiPSCs as RNAi delivery system. Through choosing the episomal system to deliver transcription factors, we obtained a non-integrating huiPSCs. Experiments in both vitro and vivo demonstrated that these huiPSCs possess the pluripotent properties. The exosomes of huiPSCs isolated by differential centrifugation were visualized by transmission electron microscopy (TEM) showing a typical exosomal appearance with an average diameter of 122 nm. Immunoblotting confirmed the presence of the typical exosomal markers, including CD63, TSG 101, and Alix. Co-cultured PKH26-labeled exosomes with human primary pulmonary microvascular endothelial cells (HMVECs) confirmed that they could be internalized by recipient cells at a time-dependent manner. Then, electroporation was used to introduce siRNA against intercellular adhesion molecule-1 (ICAM-1) into exosomes to form an Exo/siRNA compound. The Exo/siRNA compound efficiently delivered the target siRNA into HMVECs causing selective gene silencing, inhibiting the ICAM-1 protein expression, and PMN-EC adhesion induced by lipopolysaccharide (LPS). These data suggest

  11. Single-Molecule Imaging of PSD-95 mRNA Translation in Dendrites and Its Dysregulation in a Mouse Model of Fragile X Syndrome.

    Science.gov (United States)

    Ifrim, Marius F; Williams, Kathryn R; Bassell, Gary J

    2015-05-06

    Fragile X syndrome (FXS) is caused by the loss of the fragile X mental retardation protein (FMRP), an RNA binding protein that regulates translation of numerous target mRNAs, some of which are dendritically localized. Our previous biochemical studies using synaptoneurosomes demonstrate a role for FMRP and miR-125a in regulating the translation of PSD-95 mRNA. However, the local translation of PSD-95 mRNA within dendrites and spines, as well as the roles of FMRP or miR-125a, have not been directly studied. Herein, local synthesis of a Venus-PSD-95 fusion protein was directly visualized in dendrites and spines using single-molecule imaging of a diffusion-restricted Venus-PSD-95 reporter under control of the PSD-95 3'UTR. The basal translation rates of Venus-PSD-95 mRNA was increased in cultured hippocampal neurons from Fmr1 KO mice compared with WT neurons, which correlated with a transient elevation of endogenous PSD-95 within dendrites. Following mGluR stimulation with (S)-3,5-dihydroxyphenylglycine, the rate of Venus-PSD-95 mRNA translation increased rapidly in dendrites of WT hippocampal neurons, but not in those of Fmr1 KO neurons or when the binding site of miR125a, previously shown to bind PSD-95 3'UTR, was mutated. This study provides direct support for the hypothesis that local translation within dendrites and spines is dysregulated in FXS. Impairments in the regulated local synthesis of PSD-95, a critical regulator of synaptic structure and function, may affect the spatiotemporal control of PSD-95 levels and affect dendritic spine development and synaptic plasticity in FXS. Copyright © 2015 the authors 0270-6474/15/357116-15$15.00/0.

  12. In vitro transcribed RNA molecules for the diagnosis of pandemic 2009 influenza A(H1N1) virus by real-time RT-PCR.

    Science.gov (United States)

    Bermúdez de León, Mario; Peñuelas-Urquides, Katia; Aguado-Barrera, Miguel E; Currás-Tuala, María José; Escobedo-Guajardo, Brenda L; González-Ríos, Rosa Nelly; Mata-Tijerina, Viviana L; Vázquez-Monsiváis, Ofelia E

    2013-11-01

    The 2009 influenza A(H1N1) outbreak allowed the implementation of new epidemiologic surveillance tools in several countries around the world. A new molecular protocol with appropriate sensitivity and specificity using real-time RT-PCR was developed by the Centers for Disease Control and Prevention (CDC) to identify the pandemic 2009 influenza A (H1N1) virus in human specimens. In the CDC protocol, positive controls are available only upon request and they are taken from cell cultures infected with 2009 influenza A(H1N1) virus, representing a handling risk for laboratory technicians. The poor availability of positive control materials in diagnostic laboratories may limit the public health response. The aim of the work presented in this paper was to develop positive controls for the diagnostic testing of influenza A(H1N1) virus that could be used in the CDC real-time RT-PCR protocol. A series of plasmid constructs bearing partial sequences of the viral genes were created and each construct was used as a template for in vitro transcription. RNA molecules were obtained successfully at high yield, i.e., 2×10(7) assays per microliter. Thus, the inclusion of these molecules in the influenza panel as positive controls is proposed. The in vitro transcribed RNA could also be used as quality standards in the design of international proficiency studies. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Design, synthesis, and evaluation of bioactive molecules; Quantification of tricyclic pyrones from pharmacokinetic studies; Nanodelivery of siRNA; and Synthesis of viral protease inhibitors

    Science.gov (United States)

    Weerasekara, Sahani Manjitha

    Four research projects were carried out and they are described in this dissertation. Glycogen synthase kinase-3 beta (GSK3?) plays a pivotal and central role in the pathogenesis of Alzheimer's disease (AD) and protein kinase C (PKC) controls the function of other proteins via phosphorylation and involves in tumor promotion. In pursuit of identifying novel GSK3beta and/or PKC inhibitors, substituted quinoline molecules were designed and synthesized based on the structure-activity-relationship studies. Synthesized molecules were evaluated for their neural protective activities and selected molecules were further tested for inhibitory activities on GSK3beta and PKC enzymes. Among these compounds, compound 2 was found to have better GSK3beta enzyme inhibitory and MC65 cell protection activities at low nanomolar concentrations and poor PKC inhibitory activity whereas compound 3 shows better PKC inhibitory activity. This demonstrates the potential for uses of quinoline scaffold in designing novel compounds for AD and cancer. Pharmacokinetics and distribution profiles of two anti-Alzheimer molecules, CP2 and TP70, discovered in our laboratory were assessed using HPLC/MS. Plasma samples of mice and rats fed with TP70 via different routes over various times were analyzed to quantify the amounts of TP70 in plasma of both species. Distribution profiles of TP70 in various tissues of mice were studied and results show that TP70 penetrated the blood brain barrier and accumulated in the brain tissue in significant amounts. Similarly, the amount of CP2 in plasma of mice was analyzed. The HPLC analysis revealed that both compounds have good PK profiles and bioavailability, which would make them suitable candidates for further in vivo efficacy studies. Nanodelivery of specific dsRNA for suppressing the western corn rootworm (WCR, Diabrotica virgifera virgifera) genes was studied using modified chitosan or modified polyvinylpyrrolidinone (PVP) as nanocarriers. Computational

  14. Phage-mediated counting by the naked eye of miRNA molecules at attomolar concentrations in a Petri dish

    Science.gov (United States)

    Zhou, Xin; Cao, Peng; Zhu, Ye; Lu, Wuguang; Gu, Ning; Mao, Chuanbin

    2015-10-01

    The ability to count biomolecules such as cancer-biomarker miRNAs with the naked eye is seemingly impossible in molecular diagnostics. Here, we show an ultrasensitive naked-eye-counting strategy for quantifying miRNAs by employing T7 phage--a bacteria-specific virus nanoparticle--as a surrogate. The phage is genetically engineered to become fluorescent and capable of binding a miRNA-capturing gold nanoparticle (GNP) in a one-to-one manner. Target miRNAs crosslink the resultant phage-GNP couple and miRNA-capturing magnetic microparticles, forming a sandwich complex containing equimolar phage and miRNA. The phage is then released from the complex and developed into one macroscopic fluorescent plaque in a Petri dish by plating it in a host bacterial medium. Counting the plaques by the naked eye enables the quantification of miRNAs with detection limits of ~3 and ~5 aM for single-target and two-target miRNAs, respectively. This approach offers ultrasensitive and convenient quantification of disease biomarkers by the naked eye.

  15. Phage-mediated counting by the naked eye of miRNA molecules at attomolar concentrations in a Petri dish.

    Science.gov (United States)

    Zhou, Xin; Cao, Peng; Zhu, Ye; Lu, Wuguang; Gu, Ning; Mao, Chuanbin

    2015-10-01

    The ability to count biomolecules such as cancer-biomarker miRNAs with the naked eye is seemingly impossible in molecular diagnostics. Here, we show an ultrasensitive naked-eye-counting strategy for quantifying miRNAs by employing T7 phage-a bacteria-specific virus nanoparticle-as a surrogate. The phage is genetically engineered to become fluorescent and capable of binding a miRNA-capturing gold nanoparticle (GNP) in a one-to-one manner. Target miRNAs crosslink the resultant phage-GNP couple and miRNA-capturing magnetic microparticles, forming a sandwich complex containing equimolar phage and miRNA. The phage is then released from the complex and developed into one macroscopic fluorescent plaque in a Petri dish by plating it in a host bacterial medium. Counting the plaques by the naked eye enables the quantification of miRNAs with detection limits of ∼3 and ∼5 aM for single-target and two-target miRNAs, respectively. This approach offers ultrasensitive and convenient quantification of disease biomarkers by the naked eye.

  16. The untranslated regions of classic swine fever virus RNA trigger apoptosis.

    Directory of Open Access Journals (Sweden)

    Wei-Li Hsu

    Full Text Available Classical swine fever virus (CSFV causes a broad range of disease in pigs, from acute symptoms including high fever and hemorrhages, to chronic disease or unapparent infection, depending on the virus strain. CSFV belongs to the genus Pestivirus of the family Flaviviridae. It carries a single-stranded positive-sense RNA genome. An internal ribosomal entry site (IRES in the 5' untranslated region (UTR drives the translation of a single open reading frame encoding a 3898 amino acid long polypeptide chain. The open reading frame is followed by a 3' UTR comprising four highly structured stem-loops. In the present study, a synthetic RNA composed of the 5' and 3' UTRs of the CSFV genome devoid of any viral coding sequence and separated by a luciferase gene cassette (designated 5'UTR-Luc-3'UTR triggered apoptotic cell death as early as 4 h post-transfection. The apoptosis was measured by DNA laddering analysis, TUNEL assay, annexin-V binding determined by flow cytometry, and by analysis of caspase activation. Contrasting with this, only trace DNA laddering was observed in cells transfected with the individual 5' or 3' UTR RNA; even when the 5' UTR and 3' UTR were co-transfected as separate RNA molecules, DNA laddering did not reach the level induced by the chimeric 5'UTR-Luc-3'UTR RNA. Interestingly, RNA composed of the 5'UTR and of stem-loop I of the 3'UTR triggered much stronger apoptosis than the 5' or 3'UTR alone. These results indicate that the 5' and 3' UTRs act together in cis induce apoptosis. We furthered obtained evidence that the UTR-mediated apoptosis required double-stranded RNA and involved translation shutoff possibly through activation of PKR.

  17. Evolutionary rate variation and RNA secondary structure prediction

    DEFF Research Database (Denmark)

    Knudsen, B.; Andersen, E.S.; Damgaard, C.

    2004-01-01

    Predicting RNA secondary structure using evolutionary history can be carried out by using an alignment of related RNA sequences with conserved structure. Accurately determining evolutionary substitution rates for base pairs and single stranded nucleotides is a concern for methods based on this type...... by applying rates derived from tRNA and rRNA to the prediction of the much more rapidly evolving 5'-region of HIV-1. We find that the HIV-1 prediction is in agreement with experimental data, even though the relative evolutionary rate between A and G is significantly increased, both in stem and loop regions...

  18. Conformationally locked aryl C-nucleosides: synthesis of phosphoramidite monomers and incorporation into single-stranded DNA and LNA (locked nucleic acid)

    DEFF Research Database (Denmark)

    Babu, B. Ravindra; Prasad, Ashok K.; Trikha, Smriti

    2002-01-01

    . The phosphoramidite approach was used for automated incorporation of the LNA-type beta-configured C-aryl monomers 17a-17e into short DNA and 2'-OMe-RNA/LNA strands. It is shown that universal hybridization can be obtained with a conformationally restricted monomer as demonstrated most convincingly for the pyrene LNA...... monomer 17d, both in a DNA context and in an RNA-like context. Increased binding affinity of oligonucleotide probes for universal hybridization can be induced by combining the pyrene LNA monomer 17d with affinity-enhancing 2'-OMe-RNA/LNA monomers....

  19. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D

    2010-01-01

    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  20. Increased type I collagen content and DNA binding activity of a single-stranded, cytosine-rich sequence in the high-salt buffer protein extract of the copper-deficient rat heart.

    Science.gov (United States)

    Zeng, Huawei; Saari, Jack T

    2004-11-01

    Dietary copper (Cu) deficiency not only causes a hypertrophic cardiomyopathy but also increases cancer risk in rodent models. However, a possible alteration in gene expression has not been fully examined. The present study was undertaken to determine the effect of Cu deficiency on protein profiles in rat heart tissue. Male Sprague-Dawley rats were fed diets that were either a Cu-adequate diet (6.0 microg Cu/g diet, n = 6) or a Cu-deficient diet (0.3 microg Cu/g diet, n = 6) for 5 weeks. The high-salt buffer (HSB) protein extract from heart tissue of Cu-deficient, but not Cu-adequate rats showed a 132 kDa protein band by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. This protein band stained pink with Coomassie Blue, suggesting the presence of collagens or other proline-rich proteins. Dot immunoblotting demonstrated that total type I collagen was increased by 110% in HSB protein extract from Cu-deficient, relative to Cu-adequate, rats. Liquid chromatography with mass spectrometry analysis indicated that the 132 kDa protein band contained a collagen alpha (I) chain precursor as well as a leucine-rich protein 130 (LRP130) in HSB protein extract from Cu-deficient but not Cu-adequate rats. A gel shift assay showed that HSB protein extract from Cu-deficient rats bound to a single-stranded cytosine-rich DNA with higher affinity than the extract of Cu-adequate rats, similar to reports of an increase in LRP130 single-stranded DNA binding activity in several types of tumor cells. Collectively, these results not only suggest an additional feature of altered collagen metabolism with Cu deficiency but also demonstrate for the first time an increase in single-stranded cytosine-rich DNA binding in Cu-deficient rat heart.

  1. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: tcheng@ntu.edu.tw [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)

    2013-02-01

    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ► To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ► ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ► PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ► The findings

  2. Integrated mRNA and microRNA analysis identifies genes and small miRNA molecules associated with transcriptional and post-transcriptional-level responses to both drought stress and re-watering treatment in tobacco.

    Science.gov (United States)

    Chen, Qiansi; Li, Meng; Zhang, Zhongchun; Tie, Weiwei; Chen, Xia; Jin, Lifeng; Zhai, Niu; Zheng, Qingxia; Zhang, Jianfeng; Wang, Ran; Xu, Guoyun; Zhang, Hui; Liu, Pingping; Zhou, Huina

    2017-01-10

    Drought stress is one of the most severe problem limited agricultural productivity worldwide. It has been reported that plants response to drought-stress by sophisticated mechanisms at both transcriptional and post-transcriptional levels. However, the precise molecular mechanisms governing the responses of tobacco leaves to drought stress and water status are not well understood. To identify genes and miRNAs involved in drought-stress responses in tobacco, we performed both mRNA and small RNA sequencing on tobacco leaf samples from the following three treatments: untreated-control (CL), drought stress (DL), and re-watering (WL). In total, we identified 798 differentially expressed genes (DEGs) between the DL and CL (DL vs. CL) treatments and identified 571 DEGs between the WL and DL (WL vs. DL) treatments. Further analysis revealed 443 overlapping DEGs between the DL vs. CL and WL vs. DL comparisons, and, strikingly, all of these genes exhibited opposing expression trends between these two comparisons, strongly suggesting that these overlapping DEGs are somehow involved in the responses of tobacco leaves to drought stress. Functional annotation analysis showed significant up-regulation of genes annotated to be involved in responses to stimulus and stress, (e.g., late embryogenesis abundant proteins and heat-shock proteins) antioxidant defense (e.g., peroxidases and glutathione S-transferases), down regulation of genes related to the cell cycle pathway, and photosynthesis processes. We also found 69 and 56 transcription factors (TFs) among the DEGs in, respectively, the DL vs. CL and the WL vs. DL comparisons. In addition, small RNA sequencing revealed 63 known microRNAs (miRNA) from 32 families and 368 novel miRNA candidates in tobacco. We also found that five known miRNA families (miR398, miR390, miR162, miR166, and miR168) showed differential regulation under drought conditions. Analysis to identify negative correlations between the differentially expressed mi

  3. Suppression of RNAi by dsRNA-degrading RNaseIII enzymes of viruses in animals and plants.

    Directory of Open Access Journals (Sweden)

    Isabel Weinheimer

    2015-03-01

    Full Text Available Certain RNA and DNA viruses that infect plants, insects, fish or poikilothermic animals encode Class 1 RNaseIII endoribonuclease-like proteins. dsRNA-specific endoribonuclease activity of the RNaseIII of rock bream iridovirus infecting fish and Sweet potato chlorotic stunt crinivirus (SPCSV infecting plants has been shown. Suppression of the host antiviral RNA interference (RNAi pathway has been documented with the RNaseIII of SPCSV and Heliothis virescens ascovirus infecting insects. Suppression of RNAi by the viral RNaseIIIs in non-host organisms of different kingdoms is not known. Here we expressed PPR3, the RNaseIII of Pike-perch iridovirus, in the non-hosts Nicotiana benthamiana (plant and Caenorhabditis elegans (nematode and found that it cleaves double-stranded small interfering RNA (ds-siRNA molecules that are pivotal in the host RNA interference (RNAi pathway and thereby suppresses RNAi in non-host tissues. In N. benthamiana, PPR3 enhanced accumulation of Tobacco rattle tobravirus RNA1 replicon lacking the 16K RNAi suppressor. Furthermore, PPR3 suppressed single-stranded RNA (ssRNA--mediated RNAi and rescued replication of Flock House virus RNA1 replicon lacking the B2 RNAi suppressor in C. elegans. Suppression of RNAi was debilitated with the catalytically compromised mutant PPR3-Ala. However, the RNaseIII (CSR3 produced by SPCSV, which cleaves ds-siRNA and counteracts antiviral RNAi in plants, failed to suppress ssRNA-mediated RNAi in C. elegans. In leaves of N. benthamiana, PPR3 suppressed RNAi induced by ssRNA and dsRNA and reversed silencing; CSR3, however, suppressed only RNAi induced by ssRNA and was unable to reverse silencing. Neither PPR3 nor CSR3 suppressed antisense-mediated RNAi in Drosophila melanogaster. These results show that the RNaseIII enzymes of RNA and DNA viruses suppress RNAi, which requires catalytic activities of RNaseIII. In contrast to other viral silencing suppression proteins, the RNaseIII enzymes are

  4. Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

    Science.gov (United States)

    Douzery, E; Catzeflis, F M

    1995-11-01

    The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

  5. Understanding the similarity in thermophoresis between single- and double-stranded DNA or RNA

    Science.gov (United States)

    Reichl, Maren; Herzog, Mario; Greiss, Ferdinand; Wolff, Manuel; Braun, Dieter

    2015-06-01

    Thermophoresis is the movement of molecules in a temperature gradient. For aqueous solutions its microscopic basis is debated. Understanding thermophoresis for this case is, however, important since it proved very useful to detect the binding affinity of biomolecules and since thermophoresis could have played an important role in early molecular evolution. Here we discuss why the thermophoresis of single- and double-stranded oligonucleotides - DNA and RNA - is surprisingly similar. This finding is understood by comparing the spherical capacitor model for single-stranded species with the case of a rod-shaped model for double-stranded oligonucleotides. The approach describes thermophoresis of DNA and RNA with fitted effective charges consistent with electrophoresis measurements and explains the similarity between single- and double-stranded species. We could not confirm the sign change for the thermophoresis of single- versus double-stranded DNA in crowded solutions containing polyethylene glycol [Y. T. Maeda, T. Tlusty, and A. Libchaber, Proc. Natl. Acad. Sci. USA 109, 17972 (2012), 10.1073/pnas.1215764109], but find a salt-independent offset while the Debye length dependence still satisfies the capacitor model. Overall, the analysis documents the continuous progress in the microscopic understanding of thermophoresis.

  6. Characterization of RNA-Like Oligomers from Lipid-Assisted Nonenzymatic Synthesis: Implications for Origin of Informational Molecules on Early Earth

    Directory of Open Access Journals (Sweden)

    Chaitanya V. Mungi

    2015-01-01

    Full Text Available Prebiotic polymerization had to be a nonenzymatic, chemically driven process. These processes would have been particularly favored in scenarios which push reaction regimes far from equilibrium. Dehydration-rehydration (DH-RH cycles are one such regime thought to have been prevalent on prebiotic Earth in niches like volcanic geothermal pools. The present study defines the optimum DH-RH reaction conditions for lipid-assisted polymerization of nucleotides. The resultant products were characterized to understand their chemical makeup. Primarily, our study demonstrates that the resultant RNA-like oligomers have abasic sites, which means these oligomers lack information-carrying capability because of losing most of their bases during the reaction process. This results from low pH and high temperature conditions, which, importantly, also allows the formation of sugar-phosphate oligomers when ribose 5'-monophosphates are used as the starting monomers instead. Formation of such oligomers would have permitted sampling of a large variety of bases on a preformed polymer backbone, resulting in “prebiotic phosphodiester polymers” prior to the emergence of modern RNA-like molecules. This suggests that primitive genetic polymers could have utilized bases that conferred greater N-glycosyl bond stability, a feature crucial for information propagation in low pH and high temperature regimes of early Earth.

  7. Toll-Like Receptor and Accessory Molecule mRNA Expression in Humans and Mice as Well as in Murine Autoimmunity, Transient Inflammation, and Progressive Fibrosis

    Science.gov (United States)

    Ramaiah, Santhosh Kumar Vankayala; Günthner, Roman; Lech, Maciej; Anders, Hans-Joachim

    2013-01-01

    The cell type-, organ-, and species-specific expression of the Toll-like receptors (TLRs) are well described, but little is known about the respective expression profiles of their accessory molecules. We therefore determined the mRNA expression levels of LBP, MD2, CD36, CD14, granulin, HMGB1, LL37, GRP94, UNC93b1, TRIL, PRAT4A, AP3B1, AEP and the respective TLRs in human and mouse solid organs. Humans and mice displayed significant differences between their respective mRNA expression patterns of these factors. In addition, the expression profiles in transient tissue inflammation upon renal ischemia-reperfusion injury, in spleens and kidneys from mice with lupus-like systemic autoimmunity, and in progressive tissue fibrosis upon unilateral ureteral obstruction were studied. Several TLR co-factors were specifically regulated during the different phases of these disease entities, suggesting a functional involvement in the disease process. Thus, the organ- and species-specific expression patterns need to be considered in the design and interpretation of studies related to TLR-mediated innate immunity, which seems to be involved in the tissue injury phase, in the phase of tissue regeneration, and in progressive tissue remodelling. PMID:23803655

  8. Small-molecule inhibition of HIV pre-mRNA splicing as a novel antiretroviral therapy to overcome drug resistance.

    Directory of Open Access Journals (Sweden)

    Nadia Bakkour

    2007-10-01

    Full Text Available The development of multidrug-resistant viruses compromises antiretroviral therapy efficacy and limits therapeutic options. Therefore, it is an ongoing task to identify new targets for antiretroviral therapy and to develop new drugs. Here, we show that an indole derivative (IDC16 that interferes with exonic splicing enhancer activity of the SR protein splicing factor SF2/ASF suppresses the production of key viral proteins, thereby compromising subsequent synthesis of full-length HIV-1 pre-mRNA and assembly of infectious particles. IDC16 inhibits replication of macrophage- and T cell-tropic laboratory strains, clinical isolates, and strains with high-level resistance to inhibitors of viral protease and reverse transcriptase. Importantly, drug treatment of primary blood cells did not alter splicing profiles of endogenous genes involved in cell cycle transition and apoptosis. Thus, human splicing factors represent novel and promising drug targets for the development of antiretroviral therapies, particularly for the inhibition of multidrug-resistant viruses.

  9. The master switchers in the aging of cardiovascular system, reverse senescence by microRNA signatures; as highly conserved molecules.

    Science.gov (United States)

    Pourrajab, Fatemeh; Vakili Zarch, Abbas; Hekmatimoghaddam, Seyedhossein; Zare-Khormizi, Mohamad Reza

    2015-11-01

    The incidence of CVD increases with aging, because of long-term exposure to risk factors/stressors. Aging is a complex biological process resulting in progressive loss of physiological integrity, leading to impaired function and increased vulnerability to death. The main hallmarks of aging are cellular senescence, stem cell exhaustion, and altered intracellular communication. The major hallmarks of senescence are mitochondrial dysfunction, genomic instability, telomere attrition and epigenetic alterations, all of which contributing to cellular aging. Such events are controls by a family of small, non-coding RNAs (miRNAs) that interact with component of cellular senescence pathway; mitochondrial biogenesis/removal, DNA damage response machinery and IGF-1 signaling pathway. Here, we review recent in vivo/in vitro reports that miRNAs are key modulators of heart senescence, and act as master switchers to influence reprogramming pathway. We discuss evidence that abrupt deregulation of some mit-miRNAs governing senescence programs underlies age-associated CVD. In particular, due to the highly conserved nature and well-recognized target sites, miRNAs have been defined as master switchers in controlling heart progenitor cell biology. Modulation of mit-miRNA expression holds the great promise in switching off/on cellular senescence/reprogramming to rejuvenate stem cells to aid regenerative process. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Efficient Detection of Long dsRNA in Vitro and in Vivo Using the dsRNA Binding Domain from FHV B2 Protein

    Directory of Open Access Journals (Sweden)

    Baptiste Monsion

    2018-02-01

    Full Text Available Double-stranded RNA (dsRNA plays essential functions in many biological processes, including the activation of innate immune responses and RNA interference. dsRNA also represents the genetic entity of some viruses and is a hallmark of infections by positive-sense single-stranded RNA viruses. Methods for detecting dsRNA rely essentially on immunological approaches and their use is often limited to in vitro applications, although recent developments have allowed the visualization of dsRNA in vivo. Here, we report the sensitive and rapid detection of long dsRNA both in vitro and in vivo using the dsRNA binding domain of the B2 protein from Flock house virus. In vitro, we adapted the system for the detection of dsRNA either enzymatically by northwestern blotting or by direct fluorescence labeling on fixed samples. In vivo, we produced stable transgenic Nicotiana benthamiana lines allowing the visualization of dsRNA by fluorescence microscopy. Using these techniques, we were able to discriminate healthy and positive-sense single-stranded RNA virus-infected material in plants and insect cells. In N. benthamiana, our system proved to be very potent for the spatio-temporal visualization of replicative RNA intermediates of a broad range of positive-sense RNA viruses, including high- vs. low-copy number viruses.

  11. Simultaneous siRNA targeting of Src and downstream signaling molecules inhibit tumor formation and metastasis of a human model breast cancer cell line.

    Directory of Open Access Journals (Sweden)

    Jeffrey D Bjorge

    2011-04-01

    Full Text Available Src and signaling molecules downstream of Src, including signal transducer and activator of transcription 3 (Stat3 and cMyc, have been implicated in the development, maintenance and/or progression of several types of human cancers, including breast cancer. Here we report the ability of siRNA-mediated Src knock-down alone, and simultaneous knock-down of Src and Stat3 and/or cMyc to inhibit the neoplastic phenotype of a highly metastatic human model breast cancer cell line, MDA-MB-435S, a widely used model for breast cancer research.Src and its downstream signaling partners were specifically targeted and knocked-down using siRNA. Changes in the growth properties of the cultured cancer cells/tumors were documented using assays that included anchorage-dependent and -independent (in soft agar cell growth, apoptosis, and both primary and metastatic tumor growth in the mouse tumor model. siRNA-mediated Src knock-down alone, and simultaneous knock-down of Src and Stat3 and/or cMyc inhibited the neoplastic phenotype of a highly metastatic human model breast cancer cell line, MDA-MB-435S. This knock-down resulted in reduced growth in monolayer and soft agar cultures, and a reduced ability to form primary tumors in NOD/SCID mice. In addition, direct intra-tumoral injection of siRNAs targeting these signaling molecules resulted in a substantial inhibition of tumor metastases as well as of primary tumor growth. Simultaneous knock-down of Src and Stat3, and/or Myc exhibited the greatest effects resulting in substantial inhibition of primary tumor growth and metastasis.These findings demonstrate the effectiveness of simultaneous targeting of Src and the downstream signaling partners Stat3 and/or cMyc to inhibit the growth and oncogenic properties of a human cancer cell line. This knowledge may be very useful in the development of future therapeutic approaches involving targeting of specific genes products involved in tumor growth and metastasis.

  12. Cartography of neurexin alternative splicing mapped by single-molecule long-read mRNA sequencing.

    Science.gov (United States)

    Treutlein, Barbara; Gokce, Ozgun; Quake, Stephen R; Südhof, Thomas C

    2014-04-01

    Neurexins are evolutionarily conserved presynaptic cell-adhesion molecules that are essential for normal synapse formation and synaptic transmission. Indirect evidence has indicated that extensive alternative splicing of neurexin mRNAs may produce hundreds if not thousands of neurexin isoforms, but no direct evidence for such diversity has been available. Here we use unbiased long-read sequencing of full-length neurexin (Nrxn)1α, Nrxn1β, Nrxn2β, Nrxn3α, and Nrxn3β mRNAs to systematically assess how many sites of alternative splicing are used in neurexins with a significant frequency, and whether alternative splicing events at these sites are independent of each other. In sequencing more than 25,000 full-length mRNAs, we identified a novel, abundantly used alternatively spliced exon of Nrxn1α and Nrxn3α (referred to as alternatively spliced sequence 6) that encodes a 9-residue insertion in the flexible hinge region between the fifth LNS (laminin-α, neurexin, sex hormone-binding globulin) domain and the third EGF-like sequence. In addition, we observed several larger-scale events of alternative splicing that deleted multiple domains and were much less frequent than the canonical six sites of alternative splicing in neurexins. All of the six canonical events of alternative splicing appear to be independent of each other, suggesting that neurexins may exhibit an even larger isoform diversity than previously envisioned and comprise thousands of variants. Our data are consistent with the notion that α-neurexins represent extracellular protein-interaction scaffolds in which different LNS and EGF domains mediate distinct interactions that affect diverse functions and are independently regulated by independent events of alternative splicing.

  13. The Conserved RNA Exonuclease Rexo5 Is Required for 3′ End Maturation of 28S rRNA, 5S rRNA, and snoRNAs

    Directory of Open Access Journals (Sweden)

    Stefanie Gerstberger

    2017-10-01

    Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.

  14. Protein kinase A-alpha directly phosphorylates FoxO1 in vascular endothelial cells to regulate expression of vascular cellular adhesion molecule-1 mRNA.

    Science.gov (United States)

    Lee, Ji-Won; Chen, Hui; Pullikotil, Philomena; Quon, Michael J

    2011-02-25

    FoxO1, a forkhead box O class transcription factor, is abundant in insulin-responsive tissues. Akt, downstream from phosphatidylinositol 3-kinase in insulin signaling, phosphorylates FoxO1 at Thr(24), Ser(256), and Ser(319), negatively regulating its function. We previously reported that dehydroepiandrosterone-stimulated phosphorylation of FoxO1 in endothelial cells requires cAMP-dependent protein kinase α (PKA-α). Therefore, we hypothesized that FoxO1 is a novel direct substrate for PKA-α. Using an immune complex kinase assay with [γ-(32)P]ATP, purified PKA-α directly phosphorylated wild-type FoxO1 but not FoxO1-AAA (mutant with alanine substitutions at known Akt phosphorylation sites). Phosphorylation of wild-type FoxO1 (but not FoxO1-AAA) was detectable using phospho-specific antibodies. Similar results were obtained using purified GST-FoxO1 protein as the substrate. Thus, FoxO1 is a direct substrate for PKA-α in vitro. In bovine aortic endothelial cells, interaction between endogenous PKA-α and endogenous FoxO1 was detected by co-immunoprecipitation. In human aortic endothelial cells (HAEC), pretreatment with H89 (PKA inhibitor) or siRNA knockdown of PKA-α decreased forskolin- or prostaglandin E(2)-stimulated phosphorylation of FoxO1. In HAEC transfected with a FoxO-promoter luciferase reporter, co-expression of the catalytic domain of PKA-α, catalytically inactive mutant PKA-α, or siRNA against PKA-α caused corresponding increases or decreases in transactivation of the FoxO promoter. Expression of vascular cellular adhesion molecule-1 mRNA, up-regulated by FoxO1 in endothelial cells, was enhanced by siRNA knockdown of PKA-α or treatment of HAEC with the PKA inhibitor H89. Adhesion of monocytes to endothelial cells was enhanced by H89 treatment or overexpression of FoxO1-AAA, similar to effects of TNF-α treatment. We conclude that FoxO1 is a novel physiological substrate for PKA-α in vascular endothelial cells.

  15. Influenza virus RNA polymerase: insights into the mechanisms of viral RNA synthesis

    Science.gov (United States)

    te Velthuis, Aartjan J.W.; Fodor, Ervin

    2016-01-01

    The genome of influenza viruses consists of multiple segments of single stranded negative-sense RNA. Each of these segments is bound by the heterotrimeric viral RNA-dependent RNA polymerase and multiple copies of nucleoprotein, forming viral ribonucleoprotein (vRNP) complexes. It is in the context of these vRNPs that the viral RNA polymerase carries out transcription of viral genes and replication of the viral RNA genome. In this Review, we discuss our current knowledge of the structure of the influenza virus RNA polymerase, how it carries out transcription and replication, and how its activities are modulated by viral and host factors. Furthermore, we discuss how advances in our understanding of polymerase function could help identifying new antiviral targets. PMID:27396566

  16. Simulating movement of tRNA through the ribosome during hybrid-state formation.

    Science.gov (United States)

    Whitford, Paul C; Sanbonmatsu, Karissa Y

    2013-09-28

    Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

  17. The Transcription Bubble of the RNA Polymerase-Promoter Open Complex Exhibits Conformational Heterogeneity and Millisecond-Scale Dynamics : Implications for Transcription Start-Site Selection

    NARCIS (Netherlands)

    Robb, Nicole C.; Cordes, Thorben; Hwang, Ling Chin; Gryte, Kristofer; Duchi, Diego; Craggs, Timothy D.; Santoso, Yusdi; Weiss, Shimon; Ebright, Richard H.; Kapanidis, Achillefs N.

    2013-01-01

    Bacterial transcription is initiated after RNA polymerase (RNAP) binds to promoter DNA, melts similar to 14 bp around the transcription start site and forms a single-stranded "transcription bubble" within a catalytically active RNAP-DNA open complex (RPo). There is significant flexibility in the

  18. An Internal Ribosome Entry Site Directs Translation of the 39-Gene from Pelargonium Flower Break Virus Genomic RNA: Implications for Infectivity

    OpenAIRE

    Fernandez Miragall, Olga; HERNANDEZ FORT, CARMEN

    2011-01-01

    [EN] Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 59-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 39-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 59-proximal from subgenomic RNAs. However, in one...

  19. Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications

    Directory of Open Access Journals (Sweden)

    Annamaria eRuscito

    2016-05-01

    Full Text Available Aptamers are single-stranded, synthetic oligonucleotides that fold into 3-dimensional shapes capable of binding non-covalently with high affinity and specificity to a target molecule. They are generated via an in vitro process known as the Systematic Evolution of Ligands by EXponential enrichment, from which candidates are screened and characterized, and then applied in aptamer-based biosensors for target detection. Aptamers for small molecule targets such as toxins, antibiotics, molecular markers, drugs, and heavy metals will be the focus of this review. Their accurate detection is ultimately needed for the protection and wellbeing of humans and animals. However, issues such as the drastic difference in size of the aptamer and small molecule make it challenging to select, characterize, and apply aptamers for the detection of small molecules. Thus, recent (since 2012 notable advances in small molecule aptamers, which have overcome some of these challenges, are presented here, while defining challenges that still exist are discussed

  20. Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications

    Science.gov (United States)

    Ruscito, Annamaria; DeRosa, Maria

    2016-05-01

    Aptamers are single-stranded, synthetic oligonucleotides that fold into 3-dimensional shapes capable of binding non-covalently with high affinity and specificity to a target molecule. They are generated via an in vitro process known as the Systematic Evolution of Ligands by EXponential enrichment, from which candidates are screened and characterized, and then applied in aptamer-based biosensors for target detection. Aptamers for small molecule targets such as toxins, antibiotics, molecular markers, drugs, and heavy metals will be the focus of this review. Their accurate detection is ultimately needed for the protection and wellbeing of humans and animals. However, issues such as the drastic difference in size of the aptamer and small molecule make it challenging to select, characterize, and apply aptamers for the detection of small molecules. Thus, recent (since 2012) notable advances in small molecule aptamers, which have overcome some of these challenges, are presented here, while defining challenges that still exist are discussed

  1. Structural and Energetic Impact of Non-Natural 7-Deaza-8-Azaadenine and its 7-Substituted Derivatives on H-Bonding Potential with Uracil in RNA Molecules

    KAUST Repository

    Chawla, Mohit

    2015-09-21

    Non-natural (synthetic) nucleobases, including 7-ethynyl- and 7-triazolyl-8-aza-7-deazaadenosine, have been introduced in RNA molecules for targeted applications, and have been characterized experimentally. However, no theoretical characterization of the impact of these modifications on the structure and energetics of the corresponding H-bonded base pair is available. To fill this gap, we performed quantum mechanics calculations, starting with the analysis of the impact of the 8-aza-7-deaza modification of the adenosine skeleton, and we moved then to analyze the impact of the specific substituents on the modified 8-aza-7-deazaadenosine. Our analysis indicates that, despite of these severe structural modifications, the H-bonding properties of the modified base pair gratifyingly replicate those of the unmodified base pair. Similar behavior is predicted when the same skeleton modifications are applied to guanosine when paired to cytosine. To stress further the H-bonding pairing in the modified adenosine-uracil base pair, we explored the impact of strong electron donor and electron withdrawing substituents on the C7 position. Also in this case we found minimal impact on the base pair geometry and energy, confirming the validity of this modification strategy to functionalize RNAs without perturbing its stability and biological functionality.

  2. Tudor staphylococcal nuclease is a structure-specific ribonuclease that degrades RNA at unstructured regions during microRNA decay.

    Science.gov (United States)

    Li, Chia-Lung; Yang, Wei-Zen; Shi, Zhonghao; Yuan, Hanna S

    2018-02-13

    Tudor staphylococcal nuclease (TSN) is an evolutionarily conserved ribonuclease in eukaryotes that is composed of five staphylococcal nuclease-like domains (SN1 to SN5) and a Tudor domain. TSN degrades hyper-edited double-stranded RNA, including primary miRNA precursors containing multiple I-U and U-I pairs, and mature miRNA during miRNA decay. However, how TSN binds and degrades its RNA substrates remains unclear. Here, we show that the C. elegans TSN (cTSN) is a monomeric Ca 2+ -dependent ribonuclease, cleaving RNA chains at the 5'-side of the phosphodiester linkage to produce degraded fragments with 5'-hydroxyl and 3'-phosphate ends. cTSN degrades single-stranded RNA and double-stranded RNA containing mismatched base pairs, but is not restricted to those containing multiple I-U and U-I pairs. cTSN has at least two catalytic active sites located in the SN1 and SN3 domains, since mutations of the putative Ca 2+ -binding residues in these two domains strongly impaired its ribonuclease activity. We further show by small-angle X-ray scattering that rice osTSN has a flexible two-lobed structure with open to closed conformations, indicating that TSN may change its conformation upon RNA binding. We conclude that TSN is a structure-specific ribonuclease targeting not only single-stranded RNA, but also unstructured regions of double-stranded RNA. This study provides the molecular basis for how TSN cooperates with RNA editing to eliminate duplex RNA in cell defense, and how TSN selects and degrades RNA during microRNA decay. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  3. N. meningitidis 1681 is a member of the FinO family of RNA chaperones.

    Energy Technology Data Exchange (ETDEWEB)

    Chaulk, S.; Lu, J.; Tan, K.; Arthur, D.; Edwards, R.; Frost, L.; Joachimiak, A.; Glover, J. (Biosciences Division); (Univ. of Alberta)

    2010-11-01

    The conjugative transfer of F-like plasmids between bacteria is regulated by the plasmid-encoded RNA chaperone, FinO, which facilitates sense - antisense RNA interactions to regulate plasmid gene expression. FinO was thought to adopt a unique structure, however many putative homologs have been identified in microbial genomes and are considered members of the FinO-conjugation-repressor superfamily. We were interested in determining whether other members were also able to bind RNA and promote duplex formation, suggesting that this motif does indeed identify a putative RNA chaperone. We determined the crystal structure of the N. meningitidis MC58 protein NMB1681. It revealed striking similarity to FinO, with a conserved fold and a large, positively charged surface that could function in RNA interactions. Using assays developed to study FinO-FinP sRNA interactions, NMB1681, like FinO, bound tightly to FinP RNA stem-loops with short 5-foot and 3-foot single-stranded tails but not to ssRNA. It also was able to catalyze strand exchange between an RNA duplex and a complementary single-strand, and facilitated duplexing between complementary RNA hairpins. Finally, NMB1681 was able to rescue a finO deficiency and repress F plasmid conjugation. This study strongly suggests that NMB1681 is a FinO-like RNA chaperone that likely regulates gene expression through RNA-based mechanisms in N. meningitidis.

  4. Single-molecule chemical reactions on DNA origami

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther; Tørring, Thomas; Rotaru, Alexandru

    2010-01-01

    DNA nanotechnology and particularly DNA origami, in which long, single-stranded DNA molecules are folded into predetermined shapes, can be used to form complex self-assembled nanostructures. Although DNA itself has limited chemical, optical or electronic functionality, DNA nanostructures can serve...... on a DNA origami scaffold by atomic force microscopy. The high yields and chemoselectivities of successive cleavage and bond-forming reactions observed in these experiments demonstrate the feasibility of post-assembly chemical modification of DNA nanostructures and their potential use as locally...

  5. Chimeric snRNA molecules carrying antisense sequences against the splice junctions of exon 51 of the dystrophin pre-mRNA induce exon skipping and restoration of a dystrophin synthesis in Δ48-50 DMD cells

    Science.gov (United States)

    De Angelis, Fernanda Gabriella; Sthandier, Olga; Berarducci, Barbara; Toso, Silvia; Galluzzi, Giuliana; Ricci, Enzo; Cossu, Giulio; Bozzoni, Irene

    2002-01-01

    Deletions and point mutations in the dystrophin gene cause either the severe progressive myopathy Duchenne muscular dystrophy (DMD) or the milder Becker muscular dystrophy, depending on whether the translational reading frame is lost or maintained. Because internal in-frame deletions in the protein produce only mild myopathic symptoms, it should be possible, by preventing the inclusion of specific mutated exon(s) in the mature dystrophin mRNA, to restore a partially corrected phenotype. Such control has been previously accomplished by the use of synthetic oligonucleotides; nevertheless, a significant drawback to this approach is caused by the fact that oligonucleotides would require periodic administrations. To circumvent this problem, we have produced several constructs able to express in vivo, in a stable fashion, large amounts of chimeric RNAs containing antisense sequences. In this paper we show that antisense molecules against exon 51 splice junctions are able to direct skipping of this exon in the human DMD deletion 48–50 and to rescue dystrophin synthesis. We also show that the highest skipping activity was found when antisense constructs against the 5′ and 3′ splice sites are coexpressed in the same cell. PMID:12077324

  6. Comparative structural analysis of cytoplasmic and chloroplastic 5S rRNA from spinach.

    Science.gov (United States)

    Pieler, T; Digweed, M; Bartsch, M; Erdmann, V A

    1983-01-01

    5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2). Images PMID:6340063

  7. Comparative structural analysis of cytoplasmic and chloroplastic 5S rRNA from spinach.

    OpenAIRE

    Pieler, T; Digweed, M; Bartsch, M; Erdmann, V A

    1983-01-01

    5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2).

  8. Effects of Modeled Microgravity on Expression Profiles of Micro RNA in Human Lymphoblastoid Cells

    Science.gov (United States)

    Mangala, Lingegowda S.; Emami, Kamal; Story, Michael; Ramesh, Govindarajan; Rohde, Larry; Wu, Honglu

    2010-01-01

    Among space radiation and other environmental factors, microgravity or an altered gravity is undoubtedly the most significant stress experienced by living organisms during flight. In comparison to the static 1g, microgravity has been shown to alter global gene expression patterns and protein levels in cultured cells or animals. Micro RNA (miRNA) has recently emerged as an important regulator of gene expression, possibly regulating as many as one-third of all human genes. miRNA represents a class of single-stranded noncoding regulatory RNA molecules ( 22 nt) that control gene expressions by inhibiting the translation of mRNA to proteins. However, very little is known on the effect of altered gravity on miRNA expression. We hypothesized that the miRNA expression profile will be altered in zero gravity resulting in regulation of the gene expression and functional changes of the cells. To test this hypothesis, we cultured TK6 human lymphoblastoid cells in Synthecon s Rotary cell culture system (bioreactors) for 72 h either in the rotating (10 rpm) to model the microgravity in space or in the static condition. The cell viability was determined before and after culturing the cells in the bioreactor using both trypan blue and guava via count. Expressions of a panel of 352 human miRNA were analyzed using the miRNA PCRarray. Out of 352 miRNAs, expressions of 75 were significantly altered by a change of greater than 1.5 folds and seven miRNAs were altered by a fold change greater than 2 under the rotating culture condition. Among these seven, miR-545 and miR-517a were down regulated by 2 folds, whereas miR-150, miR-302a, miR-139-3p, miR-515-3p and miR-564 were up regulated by 2 to 8 folds. To confirm whether this altered miRNA expression correlates with gene expression and functional changes of the cells, we performed DNA Illumina Microarray Analysis and validated the related genes using q-RT PCR.

  9. FLDS: A Comprehensive dsRNA Sequencing Method for Intracellular RNA Virus Surveillance.

    Science.gov (United States)

    Urayama, Syun-Ichi; Takaki, Yoshihiro; Nunoura, Takuro

    2016-01-01

    Knowledge of the distribution and diversity of RNA viruses is still limited in spite of their possible environmental and epidemiological impacts because RNA virus-specific metagenomic methods have not yet been developed. We herein constructed an effective metagenomic method for RNA viruses by targeting long double-stranded (ds)RNA in cellular organisms, which is a hallmark of infection, or the replication of dsRNA and single-stranded (ss)RNA viruses, except for retroviruses. This novel dsRNA targeting metagenomic method is characterized by an extremely high recovery rate of viral RNA sequences, the retrieval of terminal sequences, and uniform read coverage, which has not previously been reported in other metagenomic methods targeting RNA viruses. This method revealed a previously unidentified viral RNA diversity of more than 20 complete RNA viral genomes including dsRNA and ssRNA viruses associated with an environmental diatom colony. Our approach will be a powerful tool for cataloging RNA viruses associated with organisms of interest.

  10. A MnII6MnIII6 single-strand molecular wheel with a reuleaux triangular topology: synthesis, structure, magnetism, and DFT studies.

    Science.gov (United States)

    Zartilas, Sotiris; Papatriantafyllopoulou, Constantina; Stamatatos, Theocharis C; Nastopoulos, Vassilios; Cremades, Eduard; Ruiz, Eliseo; Christou, George; Lampropoulos, Christos; Tasiopoulos, Anastasios J

    2013-10-21

    The use of the anion of 3-methyl-1,3,5-pentanetriol (mpt(3-)) in manganese carboxylate chemistry has afforded the new Mn(II/III)12 cluster [Mn(II)6Mn(III)6(mpt)6(CH3CO2)12(py)6]·3CH3CN (1·3CH3CN). Complex 1 was isolated in moderate yield by the reaction of Mn(CH3CO2)2·4H2O and H3mpt in a 2.6:1 molar ratio in a solvent mixture of acetonitrile and pyridine. The structure of 1 consists of alternating [Mn(II)2(CH3CO2)3(py)](+) and [Mn(III)2(μ-OR)2(CH3CO2)(py)](3+) dimeric units (three of each dimer), linked at each end by two alkoxo and one acetate bridges; the mpt(3-) ligands adopt the η(2):η(2):η(2):μ4 coordination mode. The overall metal topology of this new Mn12 wheel resembles a guitar plectrum, or a Reuleaux triangle. Complex 1 displays an unprecedented structural topology, being the first example of a Mn(II)6Mn(III)6 wheel constructed from alternating homovalent dimers and the only known Mn12 loop with the trigonal symmetry of a Reuleaux triangle (all other reported loops were ellipsoids). Variable-temperature, solid-state direct- and alternating-current magnetization studies were carried out on complex 1, revealing the presence of antiferromagnetic exchange interactions between the metal ions in the molecule, which lead to a spin ground-state value S = 0; the exchange coupling parameters J were calculated using density functional theory employing a hybrid B3LYP functional.

  11. Engineering BspQI nicking enzymes and application of N.BspQI in DNA labeling and production of single-strand DNA.

    Science.gov (United States)

    Zhang, Penghua; Too, Priscilla Hiu-Mei; Samuelson, James C; Chan, Siu-Hong; Vincze, Tamas; Doucette, Stephanie; Bäckström, Stefan; Potamousis, Konstantinos D; Schramm, Timothy M; Forrest, Dan; Schwartz, David C; Xu, Shuang-yong

    2010-02-01

    BspQI is a thermostable Type IIS restriction endonuclease (REase) with the recognition sequence 5'GCTCTTC N1/N4 3'. Here we report the cloning and expression of the bspQIR gene for the BspQI restriction enzyme in Escherichia coli. Alanine scanning of the BspQI charged residues identified a number of DNA nicking variants. After sampling combinations of different amino acid substitutions, an Nt.BspQI triple mutant (E172A/E248A/E255K) was constructed with predominantly top-strand DNA nicking activity. Furthermore, a triple mutant of BspQI (Nb.BspQI, N235A/K331A/R428A) was engineered to create a bottom-strand nicking enzyme. In addition, we demonstrated the application of Nt.BspQI in optical mapping of single DNA molecules. Nt or Nb.BspQI-nicked dsDNA can be further digested by E. coli exonuclease III to create ssDNA for downstream applications. BspQI contains two potential catalytic sites: a top-strand catalytic site (Ct) with a D-H-N-K motif found in the HNH endonuclease family and a bottom-strand catalytic site (Cb) with three scattered Glu residues. BlastP analysis of proteins in GenBank indicated a putative restriction enzyme with significant amino acid sequence identity to BspQI from the sequenced bacterial genome Croceibacter atlanticus HTCC2559. This restriction gene was amplified by PCR and cloned into a T7 expression vector. Restriction mapping and run-off DNA sequencing of digested products from the partially purified enzyme indicated that it is an EarI isoschizomer with 6-bp recognition, which we named CatHI (CTCTTC N1/N4).

  12. Electronic transport in single-helical protein molecules: Effects of multiple charge conduction pathways and helical symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Kundu, Sourav, E-mail: sourav.kunduphy@gmail.com; Karmakar, S.N.

    2016-07-15

    We propose a tight-binding model to investigate electronic transport properties of single helical protein molecules incorporating both the helical symmetry and the possibility of multiple charge transfer pathways. Our study reveals that due to existence of both the multiple charge transfer pathways and helical symmetry, the transport properties are quite rigid under influence of environmental fluctuations which indicates that these biomolecules can serve as better alternatives in nanoelectronic devices than its other biological counterparts e.g., single-stranded DNA.

  13. Structure of an Rrp6-RNA exosome complex bound to poly(A) RNA

    Energy Technology Data Exchange (ETDEWEB)

    Wasmuth, Elizabeth V.; Januszyk, Kurt; Lima, Christopher D. [MSKCC

    2014-08-20

    The eukaryotic RNA exosome processes and degrades RNA by directing substrates to the distributive or processive 3' to 5' exoribonuclease activities of Rrp6 or Rrp44, respectively. The non-catalytic nine-subunit exosome core (Exo9) features a prominent central channel. Although RNA can pass through the channel to engage Rrp44, it is not clear how RNA is directed to Rrp6 or whether Rrp6 uses the central channel. Here we report a 3.3 Å crystal structure of a ten-subunit RNA exosome complex from Saccharomyces cerevisiae composed of the Exo9 core and Rrp6 bound to single-stranded poly(A) RNA. The Rrp6 catalytic domain rests on top of the Exo9 S1/KH ring above the central channel, the RNA 3' end is anchored in the Rrp6 active site, and the remaining RNA traverses the S1/KH ring in an opposite orientation to that observed in a structure of a Rrp44-containing exosome complex. Solution studies with human and yeast RNA exosome complexes suggest that the RNA path to Rrp6 is conserved and dependent on the integrity of the S1/KH ring. Although path selection to Rrp6 or Rrp44 is stochastic in vitro, the fate of a particular RNA may be determined in vivo by the manner in which cofactors present RNA to the RNA exosome.

  14. A rapid, ratiometric, enzyme-free, and sensitive single-step miRNA detection using three-way junction based FRET probes

    Science.gov (United States)

    Luo, Qingying; Liu, Lin; Yang, Cai; Yuan, Jing; Feng, Hongtao; Chen, Yan; Zhao, Peng; Yu, Zhiqiang; Jin, Zongwen

    2018-03-01

    MicroRNAs (miRNAs) are single stranded endogenous molecules composed of only 18-24 nucleotides which are critical for gene expression regulating the translation of messenger RNAs. Conventional methods based on enzyme-assisted nucleic acid amplification techniques have many problems, such as easy contamination, high cost, susceptibility to false amplification, and tendency to have sequence mismatches. Here we report a rapid, ratiometric, enzyme-free, sensitive, and highly selective single-step miRNA detection using three-way junction assembled (or self-assembled) FRET probes. The developed strategy can be operated within the linear range from subnanomolar to hundred nanomolar concentrations of miRNAs. In comparison with the traditional approaches, our method showed high sensitivity for the miRNA detection and extreme selectivity for the efficient discrimination of single-base mismatches. The results reveal that the strategy paved a new avenue for the design of novel highly specific probes applicable in diagnostics and potentially in microscopic imaging of miRNAs in real biological environments.

  15. Single Molecule Atomic Force Microscopy Studies of Photosensitized Singlet Oxygen Behavior on a DNA Origami Template

    DEFF Research Database (Denmark)