
Sample records for single-stranded rna genome

  1. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids. (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R


    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  2. A single-stranded RNA copy of the Giardia lamblia virus double-stranded RNA genome is present in the infected Giardia lamblia.


    Furfine, E S; White, T C; Wang, A L; Wang, C C


    An isolate of Giardia lamblia infected with the double-stranded RNA virus (GLV) has two major species of RNA that are not present in an uninfected isolate. One of these species is the previously characterized double-stranded RNA genome of GLV (1). The second species of RNA appears to be a full length copy of one strand of the double-stranded RNA genome. This full length single-stranded RNA is not present in viral particles isolated from the growth medium. The cellular concentration of the sin...

  3. A G-C-rich palindromic structural motif and a stretch of single-stranded purines are required for optimal packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA. (United States)

    Jaballah, Soumeya Ali; Aktar, Suriya J; Ali, Jahabar; Phillip, Pretty Susan; Al Dhaheri, Noura Salem; Jabeen, Aayesha; Rizvi, Tahir A


    During retroviral RNA packaging, two copies of genomic RNA are preferentially packaged into the budding virus particles whereas the spliced viral RNAs and the cellular RNAs are excluded during this process. Specificity towards retroviral RNA packaging is dependent upon sequences at the 5' end of the viral genome, which at times extend into Gag sequences. It has earlier been suggested that the Mason-Pfizer monkey virus (MPMV) contains packaging sequences within the 5' untranslated region (UTR) and Gag. These studies have also suggested that the packaging determinants of MPMV that lie in the UTR are bipartite and are divided into two regions both upstream and downstream of the major splice donor. However, the precise boundaries of these discontinuous regions within the UTR and the role of the intervening sequences between these dipartite sequences towards MPMV packaging have not been investigated. Employing a combination of genetic and structural prediction analyses, we have shown that region "A", immediately downstream of the primer binding site, is composed of 50 nt, whereas region "B" is composed of the last 23 nt of UTR, and the intervening 55 nt between these two discontinuous regions do not contribute towards MPMV RNA packaging. In addition, we have identified a 14-nt G-C-rich palindromic sequence (with 100% autocomplementarity) within region A that has been predicted to fold into a structural motif and is essential for optimal MPMV RNA packaging. Furthermore, we have also identified a stretch of single-stranded purines (ssPurines) within the UTR and 8 nt of these ssPurines are duplicated in region B. The native ssPurines or its repeat in region B when predicted to refold as ssPurines has been shown to be essential for RNA packaging, possibly functioning as a potential nucleocapsid binding site. Findings from this study should enhance our understanding of the steps involved in MPMV replication including RNA encapsidation process. Copyright (c) 2010 Elsevier Ltd

  4. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.


    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  5. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth


    . We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices......Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells...

  6. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  7. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can


    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  8. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism. (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol


    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  9. Role of electrostatics in the assembly pathway of a single-stranded RNA virus. (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M


    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  10. Selective binding and reverse transcription inhibition of single-strand poly(A) RNA by metal TMPyP complexes. (United States)

    Zhou, Zhu-Xin; Gao, Feng; Chen, Xing; Tian, Xiang-Jing; Ji, Liang-Nian


    Ni-, Cu-, and Zn-TMPyP are capable of binding to single-strand poly(A) RNA with high preference and affinity and inhibiting the reverse transcription of RNA by both M-MuLV and HIV-1 reverse transcriptase. With 10 nM azidothymidine, the IC50 value of M-TMPyP could be lowered to 10(-1) μM order.

  11. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses. (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn


    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  12. Highly stable triple helix formation by homopyrimidine (l)-acyclic threoninol nucleic acids with single stranded DNA and RNA

    DEFF Research Database (Denmark)

    Kumar, Vipin; Kesavan, Venkitasamy; Gothelf, Kurt Vesterager


    Acyclic (l)-threoninol nucleic acid (aTNA) containing thymine, cytosine and adenine nucleobases were synthesized and shown to form surprisingly stable triplexes with complementary single stranded homopurine DNA or RNA targets. The triplex structures consist of two (l)-aTNA strands and one DNA...... or RNA, and these triplexes are significantly stronger than the corresponding DNA or RNA duplexes as shown in competition experiments. As a unique property the (l)-aTNAs exclusively form triplex structures with DNA and RNA and no duplex structures are observed by gel electrophoresis. The results were...... compared to the known enantiomer (d)-aTNA, which forms much weaker triplexes depending upon temperature and time. It was demonstrated that (l)-aTNA triplexes are able to stop primer extension on a DNA template, showing the potential of (l)-aTNA for antisense applications....

  13. Characterization of a Novel Megabirnavirus from Sclerotinia sclerotiorum Reveals Horizontal Gene Transfer from Single-Stranded RNA Virus to Double-Stranded RNA Virus. (United States)

    Wang, Minghong; Wang, Yong; Sun, Xiangzhong; Cheng, Jiasen; Fu, Yanping; Liu, Huiquan; Jiang, Daohong; Ghabrial, Said A; Xie, Jiatao


    Mycoviruses have been detected in all major groups of filamentous fungi, and their study represents an important branch of virology. Here, we characterized a novel double-stranded RNA (dsRNA) mycovirus, Sclerotinia sclerotiorum megabirnavirus 1 (SsMBV1), in an apparently hypovirulent strain (SX466) of Sclerotinia sclerotiorum. Two similarly sized dsRNA segments (L1- and L2-dsRNA), the genome of SsMBV1, are packaged in rigid spherical particles purified from strain SX466. The full-length cDNA sequence of L1-dsRNA/SsMBV1 comprises two large open reading frames (ORF1 and ORF2), which encode a putative coat protein and an RNA-dependent RNA polymerase (RdRp), respectively. Phylogenetic analysis of the RdRp domain clearly indicates that SsMBV1 is related to Rosellinia necatrix megabirnavirus 1 (RnMBV1). L2-dsRNA/SsMBV1 comprises two nonoverlapping ORFs (ORFA and ORFB) encoding two hypothetical proteins with unknown functions. The 5'-terminal regions of L1- and L2-dsRNA/SsMBV1 share strictly conserved sequences and form stable stem-loop structures. Although L2-dsRNA/SsMBV1 is dispensable for replication, genome packaging, and pathogenicity of SsMBV1, it enhances transcript accumulation of L1-dsRNA/SsMBV1 and stability of virus-like particles (VLPs). Interestingly, a conserved papain-like protease domain similar to a multifunctional protein (p29) of Cryphonectria hypovirus 1 was detected in the ORFA-encoded protein of L2-dsRNA/SsMBV1. Phylogenetic analysis based on the protease domain suggests that horizontal gene transfer may have occurred from a single-stranded RNA (ssRNA) virus (hypovirus) to a dsRNA virus, SsMBV1. Our results reveal that SsMBV1 has a slight impact on the fundamental biological characteristics of its host regardless of the presence or absence of L2-dsRNA/SsMBV1. Mycoviruses are widespread in all major fungal groups, and they possess diverse genomes of mostly ssRNA and dsRNA and, recently, circular ssDNA. Here, we have characterized a novel dsRNA virus

  14. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes


    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar


    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  15. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.


    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  16. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo


    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  17. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin. (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo


    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecule, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G • U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G • U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  18. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana


    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  19. Capillary electrophoresis ribosomal RNA single-stranded conformation polymorphism: a new approach for characterization of low-diversity microbial communities. (United States)

    Nai, Yi H; Zemb, Oliver; Gutierrez-Zamora, Maria-Luisa; Manefield, Mike; Powell, Shane M; Breadmore, Michael C


    Capillary electrophoresis (CE) has been the principle system for nucleic acid analysis since the early 1990s due to its inherent advantages such as fast analysis time, high resolution and efficiency, minimal sample requirement, high detection sensitivity, and automation. In the past few decades, microbial community fingerprinting methods such as terminal restriction fragment length polymorphism and single-stranded conformation polymorphism (SSCP) have migrated to CE to utilize its advantages over conventional slab gel electrophoresis. Recently, a gel-based direct rRNA fingerprint method was demonstrated. Different from other existing microbial community characterization approaches, this novel approach is polymerase chain reaction free and capable of providing information on the relative abundance of rRNA from individual phylotypes in low-diversity samples. As a gel-based method, it has a long analysis time and relatively large reagent and sample requirements. Here, we addressed these limitations by transferring the RNA fingerprint approach to the CE platform. Analysis time significantly improved from 24 h to 60 min, and the use of a fluorescently labeled hybridization probe as the detection strategy decreased the sample requirement by ten-fold. The combination of fast analysis time, low sample requirement, and sensitive fluorescence detection makes CE-RNA-SSCP an appealing new approach for characterizing low-diversity microbial communities.

  20. Role of Electrostatics in the assembly pathway of a single-stranded RNA virus

    NARCIS (Netherlands)

    Garmann, R.F.; Comas-Garcia, M.; Koay, M.S.T.; Cornelissen, Jeroen Johannes Lambertus Maria; Knobler, C.M.; Gelbart, W.M.


    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318–3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of

  1. Toxin MqsR Cleaves Single-Stranded mRNA with Various 5 Ends (United States)


    decreases persisence about 2400- fold (Harrison et al. 2009). Another type II TA toxin, MazF, induces growth arrest that results in up to a 700- fold...Life Technologies, Waltham, MA). In brief, 25 pmol of RNA was first treated with 0.1 U of calf intestine alkaline phosphatase (CIP, 0.1 U/μL) for 1...MqsR/MqsA regulate toxin CspD. Environ. Microbiol. 12:1105–1121. Kwan, B. W., J. A. Valenta, M. J. Benedik, and T. K. Wood. 2013. Arrested protein

  2. Genomic analysis of Pseudomonas putida phage tf with localized single-strand DNA interruptions.

    Directory of Open Access Journals (Sweden)

    Anatoly S Glukhov

    Full Text Available The complete sequence of the 46,267 bp genome of the lytic bacteriophage tf specific to Pseudomonas putida PpG1 has been determined. The phage genome has two sets of convergently transcribed genes and 186 bp long direct terminal repeats. The overall genomic architecture of the tf phage is similar to that of the previously described Pseudomonas aeruginosa phages PaP3, LUZ24 and phiMR299-2, and 39 out of the 72 products of predicted tf open reading frames have orthologs in these phages. Accordingly, tf was classified as belonging to the LUZ24-like bacteriophage group. However, taking into account very low homology levels between tf DNA and that of the other phages, tf should be considered as an evolutionary divergent member of the group. Two distinguishing features not reported for other members of the group were found in the tf genome. Firstly, a unique end structure--a blunt right end and a 4-nucleotide 3'-protruding left end--was observed. Secondly, 14 single-chain interruptions (nicks were found in the top strand of the tf DNA. All nicks were mapped within a consensus sequence 5'-TACT/RTGMC-3'. Two nicks were analyzed in detail and were shown to be present in more than 90% of the phage population. Although localized nicks were previously found only in the DNA of T5-like and phiKMV-like phages, it seems increasingly likely that this enigmatic structural feature is common to various other bacteriophages.

  3. Data mining cDNAs reveals three new single stranded RNA viruses in Nasonia (Hymenopetera:Pteromalidae) (United States)

    Hymenopteran viruses may provide insights into colony collapse disorder in honey bees and other insect species. Three novel small RNA viruses were discovered during the genomics effort for the beneficial parasitoid of flies in the genus Nasonia (Hymenoptera). Genomics provides a great deal of inform...

  4. Characterization of a novel single-stranded RNA virus, closely related to fusariviruses, infecting the plant pathogenic fungus Alternaria brassicicola. (United States)

    Zhong, Jie; Shang, Hong Hong; Zhu, Chuan Xia; Zhu, Jun Zi; Zhu, Hong Jian; Hu, Yan; Gao, Bi Da


    The alternaria blackspot of rapeseed is one of the most prominent diseases of rapeseed. It is caused by three species of the genus Alternaria: Alternaria brassicicola, Alternaria brassicae, and Alternaria raphanin. Here we report a novel positive-sense RNA virus from an A. brassicicola strain 817-14. The virus has a 6639 nucleotide (nt) long genome, excluding a poly (A)-tail, and was predicted to contain three putative open reading frames (ORF1, ORF2, and ORF3). The large ORF1 encoded a 174-kDa polyprotein (composed of 1522 amino acid residues) containing a conserved RNA-dependent RNA polymerase (RdRp) domain and a helicase domain. The other two smaller ORFs encoded polypeptides with unknown function. Homology search and phylogenetic analysis, based on the RdRp and helicase domains, suggest that this virus is related to and grouped with Sclerotinia sclerotiorum fusarivirus 1 (SsFV1), Rosellinia necatrix fusarivirus 1 (RnFV1), Fusarium graminearum virus-DK21 (FgV1), and Penicillium roqueforti RNA mycovirus 1 (PrRV1), all of which belong to a newly proposed family Fusariviridae. For this study, we designed the virus as "Alternaria brassicicola fusarivirus 1" (AbFV1). Virus elimination revealed that AbFV1 has no conspicuous impact on the biological properties of its host. Copyright © 2016. Published by Elsevier B.V.

  5. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples. (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J


    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  6. Oxidized base damage and single-strand break repair in mammalian genomes: role of disordered regions and posttranslational modifications in early enzymes. (United States)

    Hegde, Muralidhar L; Izumi, Tadahide; Mitra, Sankar


    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic endonuclease 1 (APE1), form complexes with downstream repair (and other noncanonical) proteins via pairwise interactions. Furthermore, a unique feature of mammalian early BER/SSBR enzymes is the presence of a disordered terminal extension that is absent in their Escherichia coli prototypes. These nonconserved segments usually contain organelle-targeting signals, common interaction interfaces, and sites of posttranslational modifications that may be involved in regulating their repair function including lesion scanning. Finally, the linkage of BER/SSBR deficiency to cancer, aging, and human neurodegenerative diseases, and therapeutic targeting of BER/SSBR are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Activation of 2'-5' oligoadenylate synthetase by single-stranded and double-stranded RNA aptamers

    DEFF Research Database (Denmark)

    Hartmann, R; Norby, P L; Martensen, P M


    A number of small RNA molecules that are high affinity ligands for the 46-kDa form of human 2'-5' oligoadenylate synthetase have been identified by the SELEX method. Surface plasmon resonance analysis indicates that these RNAs bind to the enzyme with dissociation constants in the nanomolar range....... Competition experiments indicate that the binding site for the small RNAs on the 2'-5' oligoadenylate synthetase molecule at least partially overlaps that for the synthetic double-stranded RNA, poly(I).poly(C). Several of the RNAs function as potent activators of 2'-5' oligoadenylate synthetase in vitro......-stranded RNA, can also be activated by RNA ligands with little secondary structure. Since 2'-5' oligoadenylate synthetase possesses no homology to other known RNA-binding proteins, the development of small specific ligands by SELEX should facilitate studies of RNA-protein interactions and may reveal novel...

  8. RNA binding to APOBEC3G induces the disassembly of functional deaminase complexes by displacing single-stranded DNA substrates (United States)

    Polevoda, Bogdan; McDougall, William M.; Tun, Bradley N.; Cheung, Michael; Salter, Jason D.; Friedman, Alan E.; Smith, Harold C.


    APOBEC3G (A3G) DNA deaminase activity requires a holoenzyme complex whose assembly on nascent viral reverse transcripts initiates with A3G dimers binding to ssDNA followed by formation of higher-order A3G homo oligomers. Catalytic activity is inhibited when A3G binds to RNA. Our prior studies suggested that RNA inhibited A3G binding to ssDNA. In this report, near equilibrium binding and gel shift analyses showed that A3G assembly and disassembly on ssDNA was an ordered process involving A3G dimers and multimers thereof. Although, fluorescence anisotropy showed that A3G had similar nanomolar affinity for RNA and ssDNA, RNA stochastically dissociated A3G dimers and higher-order oligomers from ssDNA, suggesting a different modality for RNA binding. Mass spectrometry mapping of A3G peptides cross-linked to nucleic acid suggested ssDNA only bound to three peptides, amino acids (aa) 181–194 in the N-terminus and aa 314–320 and 345–374 in the C-terminus that were part of a continuous exposed surface. RNA bound to these peptides and uniquely associated with three additional peptides in the N- terminus, aa 15–29, 41–52 and 83–99, that formed a continuous surface area adjacent to the ssDNA binding surface. The data predict a mechanistic model of RNA inhibition of ssDNA binding to A3G in which competitive and allosteric interactions determine RNA-bound versus ssDNA-bound conformational states. PMID:26424853

  9. Cuprolinic Blue: a specific dye for single-stranded RNA in the presence of magnesium chloride. I. Fundamental aspects

    NARCIS (Netherlands)

    Tas, J.; MENDELSON, D.; NOORDEN, C. J. F.


    Qualitative and quantitative aspects of the cationic dye Cuprolinic Blue were investigated with model films of polyacrylamide gel in which RNA, DNA and other biological polyanionic compounds had been incorporated. In the presence of 1 M MgCl2, Curpolinic Blue was found to bind specifically to

  10. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes. (United States)

    Pietilä, Maija K; Roine, Elina; Sencilo, Ana; Bamford, Dennis H; Oksanen, Hanna M


    Viruses infecting archaea show a variety of virion morphotypes, and they are currently classified into more than ten viral families or corresponding groups. A pleomorphic virus morphotype is very common among haloarchaeal viruses, and to date, several such viruses have been isolated. Here, we propose the classification of eight such viruses and formation of a new family, Pleolipoviridae (from the Greek pleo for more or many and lipos for lipid), containing three genera, Alpha-, Beta-, and Gammapleolipovirus. The proposal is currently under review by the International Committee on Taxonomy of Viruses (ICTV). The members of the proposed family Pleolipoviridae infect halophilic archaea and are nonlytic. They share structural and genomic features and differ from any other classified virus. The virion of pleolipoviruses is composed of a pleomorphic membrane vesicle enclosing the genome. All pleolipoviruses have two major structural protein species, internal membrane and spike proteins. Although the genomes of the pleolipoviruses are single- or double-stranded, linear or circular DNA molecules, they share the same genome organization and gene synteny and show significant similarity at the amino acid level. The canonical features common to all members of the proposed family Pleolipoviridae show that they are closely related and thus form a new viral family.

  11. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase. (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias


    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. A novel single-stranded RNA virus isolated from a phytopathogenic filamentous fungus, Rosellinia necatrix, with similarity to hypo-like viruses

    Directory of Open Access Journals (Sweden)

    Rui eZhang


    Full Text Available Here we report a biological and molecular characterization of a novel positive-sense RNA virus isolated from a field isolate (NW10 of a filamentous phytopathogenic fungus, the white root rot fungus that is designated as Rosellinia necatrix fusarivirus 1 (RnFV1. A recently developed technology using zinc ions allowed us to transfer RnFV1 to two mycelially incompatible Rosellinia necatrix strains. A biological comparison of the virus-free and -recipient isogenic fungal strains suggested that RnFV1 infects latently and thus has no potential as a virocontrol agent. The virus has an undivided positive-sense RNA genome of 6286 nucleotides excluding a poly (A tail. The genome possesses two non-overlapping open reading frames (ORFs: a large ORF1 that encodes polypeptides with RNA replication functions and a smaller ORF2 that encodes polypeptides of unknown function. A lack of coat protein genes was suggested by the failure of virus particles from infected mycelia. No evidence was obtained by Northern analysis or classical 5'-RACE for the presence of subgenomic RNA for the downstream ORF. Sequence similarities were found in amino-acid sequence between RnFV1 putative proteins and counterparts of a previously reported mycovirus, Fusarium graminearum virus 1 (FgV1. Interestingly, several related sequences were detected by BLAST searches of independent transcriptome assembly databases one of which probably represents an entire virus genome. Phylogenetic analysis based on the conserved RNA-dependent RNA polymerase showed that RnFV1, FgV1, and these similar sequences are grouped in a cluster distinct from distantly related hypoviruses. It is proposed that a new taxonomic family termed Fusariviridae be created to include RnFV1and FgV1.

  13. Isolation and characterization of Nylanderia fulva virus 1, a positive-sense, single-stranded RNA virus infecting the tawny crazy ant, Nylanderia fulva

    Energy Technology Data Exchange (ETDEWEB)

    Valles, Steven M., E-mail: [Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, 1600 SW 23rd Drive, Gainesville, FL 32608 (United States); Oi, David H.; Becnel, James J. [Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, 1600 SW 23rd Drive, Gainesville, FL 32608 (United States); Wetterer, James K. [Wilkes Honors College, Florida Atlantic University, 5353 Parkside Drive, Jupiter, FL 33458 (United States); LaPolla, John S. [Department of Biological Sciences, Towson University, 8000 York Road, Towson, MD 21252 (United States); Firth, Andrew E. [Department of Pathology, University of Cambridge, Cambridge CB2 1QP (United Kingdom)


    We report the discovery of Nylanderia fulva virus 1 (NfV-1), the first virus identified and characterized from the ant, Nylanderia fulva. The NfV-1 genome (GenBank accession KX024775) is 10,881 nucleotides in length, encoding one large open reading frame (ORF). Helicase, protease, RNA-dependent RNA polymerase, and jelly-roll capsid protein domains were recognized within the polyprotein. Phylogenetic analysis placed NfV-1 in an unclassified clade of viruses. Electron microscopic examination of negatively stained samples revealed particles with icosahedral symmetry with a diameter of 28.7±1.1 nm. The virus was detected by RT-PCR in larval, pupal, worker and queen developmental stages. However, the replicative strand of NfV-1 was only detected in larvae. Vertical transmission did not appear to occur, but horizontal transmission was facile. The inter-colonial field prevalence of NfV-1 was 52±35% with some local infections reaching 100%. NfV-1 was not detected in limited samples of other Nylanderia species or closely related ant species. - Highlights: • A new positive-strand RNA virus was discovered in the ant, Nylanderia fulva. • The Nylanderia fulva virus 1 genome was comprised of 10,881 nucleotides. • NfV-1 was detected in larval, pupal, queen and worker ants, but not eggs. • Replication of NfV-1 appeared to be limited to the larval stage.

  14. Site-specific binding of viral plus single-stranded RNA to replicase-containing open virus-like particles of yeast.


    Esteban, R; Fujimura, T; Wickner, R B


    X double-stranded RNA is a deletion mutant of L-A double-stranded RNA and is encapsidated in viral particles by the L-A-encoded major coat protein. X double-stranded RNA has all the cis sites necessary to be transcribed, encapsidated, and replicated. We have cloned X double-stranded RNA and sequenced it. The complete X double-stranded RNA sequence deduced indicates that the first 25 bases of the X plus-strand 5' end originated from the 5' end of the L-A plus strand and that most, if not all, ...

  15. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.


    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  16. Ro60-associated single-stranded RNA links inflammation with fetal cardiac fibrosis via ligation of TLRs: a novel pathway to autoimmune-associated heart block. (United States)

    Clancy, Robert M; Alvarez, David; Komissarova, Elena; Barrat, Franck J; Swartz, Jordan; Buyon, Jill P


    Activation of TLR by ssRNA after FcgammaR-mediated phagocytosis of immune complexes (IC) may be relevant in autoimmune-associated congenital heart block (CHB) where the obligate factor is a maternal anti-SSA/Ro Ab and the fetal factors, protein/RNA on an apoptotic cardiocyte and infiltrating macrophages. This study addressed the hypothesis that Ro60-associated ssRNAs link macrophage activation to fibrosis via TLR engagement. Both macrophage transfection with noncoding ssRNA that bind Ro60 and an IC generated by incubation of Ro60-ssRNA with an IgG fraction from a CHB mother or affinity purified anti-Ro60 significantly increased TNF-alpha secretion, an effect not observed using control RNAs or normal IgG. Dependence on TLR was supported by the significant inhibition of TNF-alpha release by IRS661 and chloroquine. The requirement for FcgammaRIIIa-mediated delivery was provided by inhibition with an anti-CD16a Ab. Fibrosis markers were noticeably increased in fetal cardiac fibroblasts after incubation with supernatants generated from macrophages transfected with ssRNA or incubated with the IC. Supernatants generated from macrophages with ssRNA in the presence of IRS661 or chloroquine did not cause fibrosis. In a CHB heart, but not a healthy heart, TLR7 immunostaining was localized to a region near the atrioventricular groove at a site enriched in mononuclear cells and fibrosis. These data support a novel injury model in CHB, whereby endogenous ligand, Ro60-associated ssRNA, forges a nexus between TLR ligation and fibrosis instigated by binding of anti-Ro Abs to the target protein likely accessible via apoptosis.

  17. Design and Assessment of a Real Time Reverse Transcription-PCR Method to Genotype Single-Stranded RNA Male-Specific Coliphages (Family Leviviridae). (United States)

    A real-time, reverse transcription-PCR (RT-qPCR) assay was developed to differentiate the four genogroups of male-specific ssRNA coliphages (FRNA) (family Leviviridae). As FRNA display a trend of source-specificity (human sewage or animal waste) at the genogroup level, this assa...

  18. Genomic sequences of two novel Levivirus single-stranded RNA coliphages (family Leviviridae): Evidence for recombination in environmental strains (United States)

    Bacteriophages are likely the most abundant entities in the aquatic environment, yet knowledge of their ecology is limited. During a fecal source-tracking study, two genetically novel Leviviridae strains were discovered. Although the novel strains were isolated from coastal wat...

  19. Programmable autonomous synthesis of single-stranded DNA (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng


    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  20. Comparative RNA genomics

    DEFF Research Database (Denmark)

    Backofen, Rolf; Gorodkin, Jan; Hofacker, Ivo L.


    small RNAs is their reliance of conserved secondary structures. Large scale sequencing projects, on the other hand, have profoundly changed our understanding of eukaryotic genomes. Pervasively transcribed, they give rise to a plethora of large and evolutionarily extremely flexible noncoding RNAs...... that exert a vastly diverse array of molecule functions. In this chapter we provide a—necessarily incomplete—overview of the current state of comparative analysis of noncoding RNAs, emphasizing computational approaches as a means to gain a global picture of the modern RNA world....

  1. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.


    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  2. An Internal Ribosome Entry Site Directs Translation of the 39-Gene from Pelargonium Flower Break Virus Genomic RNA: Implications for Infectivity


    Fernandez Miragall, Olga; HERNANDEZ FORT, CARMEN


    [EN] Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 59-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 39-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 59-proximal from subgenomic RNAs. However, in one...

  3. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)


    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  4. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W


    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  5. The family Rhabdoviridae: Mono- and bipartite negative-sense RNA viruses with diverse genome organization and common evolutionary origins (United States)

    Dietzgen, Ralf G.; Kondo, Hideki; Goodin, Michael M.; Kurath, Gael; Vasilakis, Nikos


    The family Rhabdoviridae consists of mostly enveloped, bullet-shaped or bacilliform viruses with a negative-sense, single-stranded RNA genome that infect vertebrates, invertebrates or plants. This ecological diversity is reflected by the diversity and complexity of their genomes. Five canonical structural protein genes are conserved in all rhabdoviruses, but may be overprinted, overlapped or interspersed with several novel and diverse accessory genes. This review gives an overview of the characteristics and diversity of rhabdoviruses, their taxonomic classification, replication mechanism, properties of classical rhabdoviruses such as rabies virus and rhabdoviruses with complex genomes, rhabdoviruses infecting aquatic species, and plant rhabdoviruses with both mono- and bipartite genomes.

  6. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity. (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L


    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity* (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.


    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  8. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae. (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E


    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  9. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket. (United States)

    Pham, Hanh T; Bergoin, Max; Tijssen, Peter


    The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  10. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket


    Pham, Hanh T.; Bergoin, Max; Tijssen, Peter


    International audience; The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  11. Structure-Based Alignment and Consensus Secondary Structures for Three HIV-Related RNA Genomes. (United States)

    Lavender, Christopher A; Gorelick, Robert J; Weeks, Kevin M


    HIV and related primate lentiviruses possess single-stranded RNA genomes. Multiple regions of these genomes participate in critical steps in the viral replication cycle, and the functions of many RNA elements are dependent on the formation of defined structures. The structures of these elements are still not fully understood, and additional functional elements likely exist that have not been identified. In this work, we compared three full-length HIV-related viral genomes: HIV-1NL4-3, SIVcpz, and SIVmac (the latter two strains are progenitors for all HIV-1 and HIV-2 strains, respectively). Model-free RNA structure comparisons were performed using whole-genome structure information experimentally derived from nucleotide-resolution SHAPE reactivities. Consensus secondary structures were constructed for strongly correlated regions by taking into account both SHAPE probing structural data and nucleotide covariation information from structure-based alignments. In these consensus models, all known functional RNA elements were recapitulated with high accuracy. In addition, we identified multiple previously unannotated structural elements in the HIV-1 genome likely to function in translation, splicing and other replication cycle processes; these are compelling targets for future functional analyses. The structure-informed alignment strategy developed here will be broadly useful for efficient RNA motif discovery.

  12. In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides

    International Nuclear Information System (INIS)

    Oppenheim, Amos B.; Rattray, Alison J.; Bubunenko, Mikhail; Thomason, Lynn C.; Court, Donald L.


    We demonstrate that the bacteriophage λ Red functions efficiently recombine linear DNA or single-strand oligonucleotides (ss-oligos) into bacteriophage λ to create specific changes in the viral genome. Point mutations, deletions, and gene replacements have been created. While recombineering with oligonucleotides, we encountered other mutations accompanying the desired point mutational change. DNA sequence analysis suggests that these unwanted mutations are mainly frameshift deletions introduced during oligonucleotide synthesis

  13. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)


    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  14. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications (United States)

    Hong, Ka Lok


    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  15. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  16. Viral uncoating is directional: exit of the genomic RNA in a common cold virus starts with the poly-(A tail at the 3'-end.

    Directory of Open Access Journals (Sweden)

    Shushan Harutyunyan

    Full Text Available Upon infection, many RNA viruses reorganize their capsid for release of the genome into the host cell cytosol for replication. Often, this process is triggered by receptor binding and/or by the acidic environment in endosomes. In the genus Enterovirus, which includes more than 150 human rhinovirus (HRV serotypes causing the common cold, there is persuasive evidence that the viral RNA exits single-stranded through channels formed in the protein shell. We have determined the time-dependent emergence of the RNA ends from HRV2 on incubation of virions at 56°C using hybridization with specific oligonucleotides and detection by fluorescence correlation spectroscopy. We report that psoralen UV crosslinking prevents complete RNA release, allowing for identification of the sequences remaining inside the capsid. We also present the structure of uncoating intermediates in which parts of the RNA are condensed and take the form of a rod that is directed roughly towards a two-fold icosahedral axis, the presumed RNA exit point. Taken together, in contrast to schemes frequently depicted in textbooks and reviews, our findings demonstrate that exit of the RNA starts from the 3'-end. This suggests that packaging also occurs in an ordered manner resulting in the 3'-poly-(A tail becoming located close to a position of pore formation during conversion of the virion into a subviral particle. This directional genome release may be common to many icosahedral non-enveloped single-stranded RNA viruses.

  17. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana. (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L


    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  18. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)


    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  19. Suppressors of RNA silencing encoded by tomato leaf curl ...

    Indian Academy of Sciences (India)


    Jan 6, 2013 ... step in the RNA-silencing pathway that occurs after siRNA production (Zrachya et al. 2007). Geminiviruses (family Geminiviridae) are a diverse group of plant viruses with circular single-stranded DNA genomes that are composed of one or two components of 2700–. 3000 bp length which are encapsidated ...

  20. Improved single-strand DNA sizing accuracy in capillary electrophoresis.


    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B


    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  1. Visualizing the global secondary structure of a viral RNA genome with cryo-electron microscopy. (United States)

    Garmann, Rees F; Gopal, Ajaykumar; Athavale, Shreyas S; Knobler, Charles M; Gelbart, William M; Harvey, Stephen C


    The lifecycle, and therefore the virulence, of single-stranded (ss)-RNA viruses is regulated not only by their particular protein gene products, but also by the secondary and tertiary structure of their genomes. The secondary structure of the entire genomic RNA of satellite tobacco mosaic virus (STMV) was recently determined by selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE). The SHAPE analysis suggested a single highly extended secondary structure with much less branching than occurs in the ensemble of structures predicted by purely thermodynamic algorithms. Here we examine the solution-equilibrated STMV genome by direct visualization with cryo-electron microscopy (cryo-EM), using an RNA of similar length transcribed from the yeast genome as a control. The cryo-EM data reveal an ensemble of branching patterns that are collectively consistent with the SHAPE-derived secondary structure model. Thus, our results both elucidate the statistical nature of the secondary structure of large ss-RNAs and give visual support for modern RNA structure determination methods. Additionally, this work introduces cryo-EM as a means to distinguish between competing secondary structure models if the models differ significantly in terms of the number and/or length of branches. Furthermore, with the latest advances in cryo-EM technology, we suggest the possibility of developing methods that incorporate restraints from cryo-EM into the next generation of algorithms for the determination of RNA secondary and tertiary structures. © 2015 Garmann et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  2. How RNA viruses maintain their genome integrity. (United States)

    Barr, John N; Fearns, Rachel


    RNA genomes are vulnerable to corruption by a range of activities, including inaccurate replication by the error-prone replicase, damage from environmental factors, and attack by nucleases and other RNA-modifying enzymes that comprise the cellular intrinsic or innate immune response. Damage to coding regions and loss of critical cis-acting signals inevitably impair genome fitness; as a consequence, RNA viruses have evolved a variety of mechanisms to protect their genome integrity. These include mechanisms to promote replicase fidelity, recombination activities that allow exchange of sequences between different RNA templates, and mechanisms to repair the genome termini. In this article, we review examples of these processes from a range of RNA viruses to showcase the diverse approaches that viruses have evolved to maintain their genome sequence integrity, focusing first on mechanisms that viruses use to protect their entire genome, and then concentrating on mechanisms that allow protection of the genome termini, which are especially vulnerable. In addition, we discuss examples in which it might be beneficial for a virus to 'lose' its genomic termini and reduce its replication efficiency.

  3. A novel virus genome discovered in an extreme environment suggests recombination between unrelated groups of RNA and DNA viruses (United States)


    Background Viruses are known to be the most abundant organisms on earth, yet little is known about their collective origin and evolutionary history. With exceptionally high rates of genetic mutation and mosaicism, it is not currently possible to resolve deep evolutionary histories of the known major virus groups. Metagenomics offers a potential means of establishing a more comprehensive view of viral evolution as vast amounts of new sequence data becomes available for comparative analysis. Results Bioinformatic analysis of viral metagenomic sequences derived from a hot, acidic lake revealed a circular, putatively single-stranded DNA virus encoding a major capsid protein similar to those found only in single-stranded RNA viruses. The presence and circular configuration of the complete virus genome was confirmed by inverse PCR amplification from native DNA extracted from lake sediment. The virus genome appears to be the result of a RNA-DNA recombination event between two ostensibly unrelated virus groups. Environmental sequence databases were examined for homologous genes arranged in similar configurations and three similar putative virus genomes from marine environments were identified. This result indicates the existence of a widespread but previously undetected group of viruses. Conclusions This unique viral genome carries implications for theories of virus emergence and evolution, as no mechanism for interviral RNA-DNA recombination has yet been identified, and only scant evidence exists that genetic exchange occurs between such distinct virus lineages. Reviewers This article was reviewed by EK, MK (nominated by PF) and AM. For the full reviews, please go to the Reviewers' comments section. PMID:22515485

  4. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries. (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan


    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  5. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata). (United States)

    Jackson, Elliot W; Bistolas, Kalia S I; Button, Jason B; Hewson, Ian


    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates.

  6. Structure-function relationship of viral cis-acting RNA elements : the role of the OriI and OriR in enterovirus replication

    NARCIS (Netherlands)

    Ooij, Martinus Johannes Maria van


    The genus Enterovirus belongs to Picornaviridae, a family of small, non-enveloped, lytic RNA viruses. They contain a single-stranded RNA genome of positive polarity of approximately 7,500 nucleotides. A viral protein VPg is specifically linked to the 5'terminus of the viral RNA. IRES-mediated

  7. The Adsorption of Short Single-Stranded DNA Oligomers on Mineral Surfaces (United States)

    Kopstein, M.; Sverjensky, D. A.; Hazen, R. M.; Cleaves, H. J.


    Previous studies have described feasible pathways for the synthesis of simple organic building blocks such as formaldehyde and hydrogen cyanide, and their reaction to form more complex biomolecules such as nucleotide bases, amino acids and sugars (Miller and Orgel 1974, Miller and Cleaves 2006). However, the polymerization of monomers into a useful genetic material remains problematic (Orgel 2004). Organic building blocks were unlikely to polymerize from very dilute aqueous solution in the primitive oceans. Mineral surface adsorption has been suggested as a possible mechanism for concentrating the necessary building blocks (Bernal 1951). This study focused on the adsorption behavior of single-stranded DNA homo-oligomers of adenine and thymine (including the monomers, dimers, tetramers, hexamers, octomers, and decamers) with five different mineral surfaces (pyrite, rutile, hematite, olivine and calcite). Adsorption was studied in 0.1 M pH 8.1 KHCO3 with0.05 M NaCl as background electrolyte. Solutions were mixed for 24 hours at room temperature, centrifuged and the supernatants analyzed by UV/visible spectrophotometry. Equilibrium solution concentrations were measured and used to determine the number of moles adsorbed per square meter. Langmuir isotherms were constructed using the experimental data. It was found that adenine-containing molecules tend to bind much more strongly than thymine-containing molecules. It was also found that the number of moles adsorbed at saturation tends to fall with increasing chain length, while adsorption affinity tends to rise. Oligomer length appears to affect adsorption more than the mineral type. These results may have implications for the primordial organization of the first nucleic acid molecules as the persistence of extra-cellular nucleic acids in the environment. References Bernal, J. D. (1951) The Physical Basis of Life (Routledge, London). Miller S.L. and Cleaves, H.J. (2006) Prebiotic chemistry on the primitive Earth. In

  8. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.


    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  9. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux


    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  10. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface. (United States)

    Akbari, Fahimeh; Foroutan, Masumeh


    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  11. Elastic properties of alternative versus single-stranded leveling archwires. (United States)

    Rucker, Brian K; Kusy, Robert P


    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  12. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.


    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  13. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.


    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  14. From "Cellular" RNA to "Smart" RNA: Multiple Roles of RNA in Genome Stability and Beyond. (United States)

    Michelini, Flavia; Jalihal, Ameya P; Francia, Sofia; Meers, Chance; Neeb, Zachary T; Rossiello, Francesca; Gioia, Ubaldo; Aguado, Julio; Jones-Weinert, Corey; Luke, Brian; Biamonti, Giuseppe; Nowacki, Mariusz; Storici, Francesca; Carninci, Piero; Walter, Nils G; Fagagna, Fabrizio d'Adda di


    Coding for proteins has been considered the main function of RNA since the "central dogma" of biology was proposed. The discovery of noncoding transcripts shed light on additional roles of RNA, ranging from the support of polypeptide synthesis, to the assembly of subnuclear structures, to gene expression modulation. Cellular RNA has therefore been recognized as a central player in often unanticipated biological processes, including genomic stability. This ever-expanding list of functions inspired us to think of RNA as a "smart" phone, which has replaced the older obsolete "cellular" phone. In this review, we summarize the last two decades of advances in research on the interface between RNA biology and genome stability. We start with an account of the emergence of noncoding RNA, and then we discuss the involvement of RNA in DNA damage signaling and repair, telomere maintenance, and genomic rearrangements. We continue with the depiction of single-molecule RNA detection techniques, and we conclude by illustrating the possibilities of RNA modulation in hopes of creating or improving new therapies. The widespread biological functions of RNA have made this molecule a reoccurring theme in basic and translational research, warranting it the transcendence from classically studied "cellular" RNA to "smart" RNA.

  15. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA. (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee


    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  16. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.


    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  17. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)


    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  18. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela


    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  19. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong


    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  20. Inhibition of CRISPR/Cas9-Mediated Genome Engineering by a Type I Interferon-Induced Reduction in Guide RNA Expression. (United States)

    Machitani, Mitsuhiro; Sakurai, Fuminori; Wakabayashi, Keisaku; Nakatani, Kosuke; Takayama, Kazuo; Tachibana, Masashi; Mizuguchi, Hiroyuki


    Clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9-mediated genome engineering technology is a powerful tool for generation of cells and animals with engineered mutations in their genomes. In order to introduce the CRISPR/Cas9 system into target cells, nonviral and viral vectors are often used; however, such vectors trigger innate immune responses associated with production of type I interferons (IFNs). We have recently demonstrated that type I IFNs inhibit short-hairpin RNA-mediated gene silencing, which led us to hypothesize that type I IFNs may also inhibit CRISPR/Cas9-mediated genome mutagenesis. Here we investigated this hypothesis. A single-strand annealing assay using a reporter plasmid demonstrated that CRISPR/Cas9-mediated cleavage efficiencies of the target double-stranded DNA were significantly reduced by IFNα. A mismatch recognition nuclease-dependent genotyping assay also demonstrated that IFNα reduced insertion or deletion (indel) mutation levels by approximately half. Treatment with IFNα did not alter Cas9 protein expression levels, whereas the copy numbers of guide RNA (gRNA) were significantly reduced by IFNα stimulation. These results indicate that type I IFNs significantly reduce gRNA expression levels following introduction of the CRISPR/Cas9 system in the cells, leading to a reduction in the efficiencies of CRISPR/Cas9-mediated genome mutagenesis. Our findings provide important clues for the achievement of efficient genome engineering using the CRISPR/Cas9 system.

  1. Genetic evidence for single-strand lesions initiating Nbs1-dependent homologous recombination in diversification of Ig v in chicken B lymphocytes.

    Directory of Open Access Journals (Sweden)

    Makoto Nakahara


    Full Text Available Homologous recombination (HR is initiated by DNA double-strand breaks (DSB. However, it remains unclear whether single-strand lesions also initiate HR in genomic DNA. Chicken B lymphocytes diversify their Immunoglobulin (Ig V genes through HR (Ig gene conversion and non-templated hypermutation. Both types of Ig V diversification are initiated by AID-dependent abasic-site formation. Abasic sites stall replication, resulting in the formation of single-stranded gaps. These gaps can be filled by error-prone DNA polymerases, resulting in hypermutation. However, it is unclear whether these single-strand gaps can also initiate Ig gene conversion without being first converted to DSBs. The Mre11-Rad50-Nbs1 (MRN complex, which produces 3' single-strand overhangs, promotes the initiation of DSB-induced HR in yeast. We show that a DT40 line expressing only a truncated form of Nbs1 (Nbs1(p70 exhibits defective HR-dependent DSB repair, and a significant reduction in the rate--though not the fidelity--of Ig gene conversion. Interestingly, this defective gene conversion was restored to wild type levels by overproduction of Escherichia coli SbcB, a 3' to 5' single-strand-specific exonuclease, without affecting DSB repair. Conversely, overexpression of chicken Exo1 increased the efficiency of DSB-induced gene-targeting more than 10-fold, with no effect on Ig gene conversion. These results suggest that Ig gene conversion may be initiated by single-strand gaps rather than by DSBs, and, like SbcB, the MRN complex in DT40 may convert AID-induced lesions into single-strand gaps suitable for triggering HR. In summary, Ig gene conversion and hypermutation may share a common substrate-single-stranded gaps. Genetic analysis of the two types of Ig V diversification in DT40 provides a unique opportunity to gain insight into the molecular mechanisms underlying the filling of gaps that arise as a consequence of replication blocks at abasic sites, by HR and error

  2. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  3. Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages. (United States)

    Kodaira, K; Godson, N G; Taketo, A


    The minus origins for complementary strand DNA synthesis (-ori) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, phi K, alpha 3, and St-1 closely resemble each other in DNA structure and contain two potential secondary hairpin loops (I and II) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the -ori regions of phi K and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the phi K mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several phi K and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway.

  4. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder


    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  5. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.


    Barany, F; Boeke, J D


    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  6. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos


    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  7. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.


    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  8. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska


    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  9. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks. (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P


    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  10. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample. (United States)

    Cui, Lunbiao; Wu, Binyao; Zhu, Xiaojuan; Guo, Xiling; Ge, Yiyue; Zhao, Kangchen; Qi, Xian; Shi, Zhiyang; Zhu, Fengcai; Sun, Lixin; Zhou, Minghao


    Metagenomic analysis through high-throughput sequencing is a tool for detecting both known and novel viruses. Using this technique, a novel circular single-stranded DNA (ssDNA) virus genome was discovered in respiratory secretions from a febrile traveler. The virus, named human respiratory-associated PSCV-5-like virus (HRAPLV), has a genome comprising 3,018 bases, with two major putative ORFs inversely encoding capsid (Cap) and replicase (Rep) protein and separated by two intergenic regions. One stem-loop structure was predicted in the larger intergenic region (LIR). The predicted amino acid sequences of the Cap and Rep proteins of HRAPLV showed highest identity to those of porcine stool-associated circular virus 5 isolate CP3 (PoSCV 5) (53.0% and 48.9%, respectively). The host tropism of the virus is unknown, and further study is warranted to determine whether this novel virus is associated with human disease.

  11. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism. (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol


    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  12. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism. (United States)

    Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong


    A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.

  13. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  14. Approaching TERRA Firma: Genomic Functions of Telomeric Noncoding RNA. (United States)

    Roake, Caitlin M; Artandi, Steven E


    Functions of the telomeric repeat-containing RNA (TERRA), the long noncoding RNA (lncRNA) transcribed from telomeres, have eluded researchers. In this issue of Cell, Graf el al. and Chu et al. uncover new regulatory roles for TERRA at the telomere and at distant genomic sites. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Paramyxovirus RNA synthesis, mRNA editing, and genome hexamer phase: A review. (United States)

    Kolakofsky, Daniel


    The recent flurry of high resolution structures of Negative Strand RNA Virus RNA-dependent RNA polymerases has rekindled interest in the manner in which these polymerases, and in particular those of the nonsegmented viruses, recognize the RNA sequences that control mRNA synthesis and genome replication. In the light of these polymerase structures, we re-examine some unusual aspects of the Paramyxoviridae, namely bipartite replication promoters and mRNA editing, and the manner in which these properties are governed by genome hexamer phase. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control. (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A


    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi


    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  18. Distinct circular single-stranded DNA viruses exist in different soil types. (United States)

    Reavy, Brian; Swanson, Maud M; Cock, Peter J A; Dawson, Lorna; Freitag, Thomas E; Singh, Brajesh K; Torrance, Lesley; Mushegian, Arcady R; Taliansky, Michael


    The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  19. A high throughput system for the preparation of single stranded templates grown in microculture. (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M


    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  20. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)


    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  1. Complex shapes self-assembled from single-stranded DNA tiles. (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng


    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  2. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.


    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  3. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.


    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  4. Visualization of RNA structure models within the Integrative Genomics Viewer. (United States)

    Busan, Steven; Weeks, Kevin M


    Analyses of the interrelationships between RNA structure and function are increasingly important components of genomic studies. The SHAPE-MaP strategy enables accurate RNA structure probing and realistic structure modeling of kilobase-length noncoding RNAs and mRNAs. Existing tools for visualizing RNA structure models are not suitable for efficient analysis of long, structurally heterogeneous RNAs. In addition, structure models are often advantageously interpreted in the context of other experimental data and gene annotation information, for which few tools currently exist. We have developed a module within the widely used and well supported open-source Integrative Genomics Viewer (IGV) that allows visualization of SHAPE and other chemical probing data, including raw reactivities, data-driven structural entropies, and data-constrained base-pair secondary structure models, in context with linear genomic data tracks. We illustrate the usefulness of visualizing RNA structure in the IGV by exploring structure models for a large viral RNA genome, comparing bacterial mRNA structure in cells with its structure under cell- and protein-free conditions, and comparing a noncoding RNA structure modeled using SHAPE data with a base-pairing model inferred through sequence covariation analysis. © 2017 Busan and Weeks; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  5. Shift in genomic RNA patterns of human rotaviruses isolated from ...

    African Journals Online (AJOL)

    Rotalvirus-positive specimens from 322 infants and young children submitted to private patl1ology laboratories were analysed by polyacrylamide-gel electrophoresis of the viral RNA. A predominance of long RNA profiles occurred and a temporal shift in the genomic patterns was identified. An epidemic of the classic shorter ...

  6. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der


    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  7. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.


    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit...

  8. Ion assisted structural collapse of a single stranded DNA: A molecular dynamics approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Soumadwip; Dixit, Himanshu; Chakrabarti, Rajarshi, E-mail:


    Highlights: • The dynamics of a single-stranded DNA in presence of different concentrations of Mg{sup 2+} is investigated. • The initial DNA chain collapse is characterized by the formation of non-sequentially stacked base pairs. • The DNA chain re-swells at high concentrations of Mg{sup 2+} as a consequence of overcharging. - Abstract: The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counterions. It is well known that the structural collapse of DNA is favoured in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl{sub 2}) single stranded DNA with base sequence 5′-CGCGAATTCGCG-3′ (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  9. Dynamics of RecA filaments on single-stranded DNA

    NARCIS (Netherlands)

    Van Loenhout, M.T.J.; Van der Heijden, T.; Kanaar, R.; Wyman, C.; Dekker, C.


    RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on

  10. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder


    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  11. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP


    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  12. Effects of single-stranded DNA binding proteins on primer extension by telomerase. (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim


    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  13. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.


    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  14. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B


    by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  15. Global organization of a positive-strand RNA virus genome.

    Directory of Open Access Journals (Sweden)

    Baodong Wu

    Full Text Available The genomes of plus-strand RNA viruses contain many regulatory sequences and structures that direct different viral processes. The traditional view of these RNA elements are as local structures present in non-coding regions. However, this view is changing due to the discovery of regulatory elements in coding regions and functional long-range intra-genomic base pairing interactions. The ∼4.8 kb long RNA genome of the tombusvirus tomato bushy stunt virus (TBSV contains these types of structural features, including six different functional long-distance interactions. We hypothesized that to achieve these multiple interactions this viral genome must utilize a large-scale organizational strategy and, accordingly, we sought to assess the global conformation of the entire TBSV genome. Atomic force micrographs of the genome indicated a mostly condensed structure composed of interconnected protrusions extending from a central hub. This configuration was consistent with the genomic secondary structure model generated using high-throughput selective 2'-hydroxyl acylation analysed by primer extension (i.e. SHAPE, which predicted different sized RNA domains originating from a central region. Known RNA elements were identified in both domain and inter-domain regions, and novel structural features were predicted and functionally confirmed. Interestingly, only two of the six long-range interactions known to form were present in the structural model. However, for those interactions that did not form, complementary partner sequences were positioned relatively close to each other in the structure, suggesting that the secondary structure level of viral genome structure could provide a basic scaffold for the formation of different long-range interactions. The higher-order structural model for the TBSV RNA genome provides a snapshot of the complex framework that allows multiple functional components to operate in concert within a confined context.

  16. Genome-wide analysis of differential RNA editing in epilepsy (United States)

    Srivastava, Prashant Kumar; Bagnati, Marta; Delahaye-Duriez, Andree; Ko, Jeong-Hun; Rotival, Maxime; Langley, Sarah R.; Shkura, Kirill; Mazzuferi, Manuela; Danis, Bénédicte; van Eyll, Jonathan; Foerch, Patrik; Behmoaras, Jacques; Kaminski, Rafal M.; Petretto, Enrico; Johnson, Michael R.


    The recoding of genetic information through RNA editing contributes to proteomic diversity, but the extent and significance of RNA editing in disease is poorly understood. In particular, few studies have investigated the relationship between RNA editing and disease at a genome-wide level. Here, we developed a framework for the genome-wide detection of RNA sites that are differentially edited in disease. Using RNA-sequencing data from 100 hippocampi from mice with epilepsy (pilocarpine–temporal lobe epilepsy model) and 100 healthy control hippocampi, we identified 256 RNA sites (overlapping with 87 genes) that were significantly differentially edited between epileptic cases and controls. The degree of differential RNA editing in epileptic mice correlated with frequency of seizures, and the set of genes differentially RNA-edited between case and control mice were enriched for functional terms highly relevant to epilepsy, including “neuron projection” and “seizures.” Genes with differential RNA editing were preferentially enriched for genes with a genetic association to epilepsy. Indeed, we found that they are significantly enriched for genes that harbor nonsynonymous de novo mutations in patients with epileptic encephalopathy and for common susceptibility variants associated with generalized epilepsy. These analyses reveal a functional convergence between genes that are differentially RNA-edited in acquired symptomatic epilepsy and those that contribute risk for genetic epilepsy. Taken together, our results suggest a potential role for RNA editing in the epileptic hippocampus in the occurrence and severity of epileptic seizures. PMID:28250018

  17. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB). (United States)

    van Loon, Barbara; Samson, Leona D


    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  18. RNA 3D modules in genome-wide predictions of RNA 2D structure

    DEFF Research Database (Denmark)

    Theis, Corinna; Zirbel, Craig L; Zu Siederdissen, Christian Höner


    Recent experimental and computational progress has revealed a large potential for RNA structure in the genome. This has been driven by computational strategies that exploit multiple genomes of related organisms to identify common sequences and secondary structures. However, these computational...... approaches have two main challenges: they are computationally expensive and they have a relatively high false discovery rate (FDR). Simultaneously, RNA 3D structure analysis has revealed modules composed of non-canonical base pairs which occur in non-homologous positions, apparently by independent evolution....... These modules can, for example, occur inside structural elements which in RNA 2D predictions appear as internal loops. Hence one question is if the use of such RNA 3D information can improve the prediction accuracy of RNA secondary structure at a genome-wide level. Here, we use RNAz in combination with 3D...

  19. Characterizing and annotating the genome using RNA-seq data. (United States)

    Chen, Geng; Shi, Tieliu; Shi, Leming


    Bioinformatics methods for various RNA-seq data analyses are in fast evolution with the improvement of sequencing technologies. However, many challenges still exist in how to efficiently process the RNA-seq data to obtain accurate and comprehensive results. Here we reviewed the strategies for improving diverse transcriptomic studies and the annotation of genetic variants based on RNA-seq data. Mapping RNA-seq reads to the genome and transcriptome represent two distinct methods for quantifying the expression of genes/transcripts. Besides the known genes annotated in current databases, many novel genes/transcripts (especially those long noncoding RNAs) still can be identified on the reference genome using RNA-seq. Moreover, owing to the incompleteness of current reference genomes, some novel genes are missing from them. Genome- guided and de novo transcriptome reconstruction are two effective and complementary strategies for identifying those novel genes/transcripts on or beyond the reference genome. In addition, integrating the genes of distinct databases to conduct transcriptomics and genetics studies can improve the results of corresponding analyses.

  20. Genome rearrangement affects RNA virus adaptability on prostate cancer cells

    Directory of Open Access Journals (Sweden)

    Kendra ePesko


    Full Text Available Gene order is often highly conserved within taxonomic groups, such that organisms with rearranged genomes tend to be less fit than wildtype gene orders, and suggesting natural selection favors genome architectures that maximize fitness. But it is unclear whether rearranged genomes hinder adaptability: capacity to evolutionarily improve in a new environment. Negative-sense nonsegmented RNA viruses (order Mononegavirales have specific genome architecture: 3′ UTR – core protein genes – envelope protein genes – RNA-dependent RNA-polymerase gene – 5′ UTR. To test how genome architecture affects RNA virus evolution, we examined vesicular stomatitis virus (VSV variants with the nucleocapsid (N gene moved sequentially downstream in the genome. Because RNA polymerase stuttering in VSV replication causes greater mRNA production in upstream genes, N-gene translocation towards the 5’ end leads to stepwise decreases in N transcription, viral replication and progeny production, and also impacts the activation of type 1 interferon mediated antiviral responses. We evolved VSV gene-order variants in two prostate cancer cell lines: LNCap cells deficient in innate immune response to viral infection, and PC3 cells that mount an IFN stimulated anti-viral response to infection. We observed that gene order affects phenotypic adaptability (reproductive growth; viral suppression of immune function, especially on PC3 cells that strongly select against virus infection. Overall, populations derived from the least-fit ancestor (most-altered N position architecture adapted fastest, consistent with theory predicting populations with low initial fitness should improve faster in evolutionary time. Also, we observed correlated responses to selection, where viruses improved across both hosts, rather than suffer fitness trade-offs on unselected hosts. Whole genomics revealed multiple mutations in evolved variants, some of which were conserved across selective

  1. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud


    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  2. The formation and modification of chromatin-like structure of human parvovirus B19 regulate viral genome replication and RNA processing. (United States)

    Xu, Huanzhou; Hao, Sujuan; Zhang, Junmei; Chen, Zhen; Wang, Hanzhong; Guan, Wuxiang


    B19 virus (B19V) is a single stranded virus in the genus of Erythroparvovirus in the family of Parvoviridae. One of the limiting steps of B19V infection is the replication of viral genome which affected the alternative processing of its RNA. Minute virus of mice (MVM) and adeno-associated virus (AAV) has been reported to form chromatin-like structure within hours after infection of cells. However, the role of chromatin-like structure is unclear. In the present study, we found that B19V formed chromatin-like structure after 12h when B19V infectious clone was co-transfected with pHelper plasmid to HEK293T cells. Interestingly, the inhibitor of DNA methyl-transferase (5-Aza-2'-deoxycytidine, DAC) inhibited not only the formation of chromatin-like structure, but also the replication of the viral genomic DNA. More importantly, the splicing of the second intron at splice acceptor sites (A2-1, and A2-2) were reduced and polyadenylation at (pA)p increased when transfected HEK293T cells were treated with DAC. Our results showed that the formation and modification of chromatin-like structure are a new layer to regulate B19V gene expression and RNA processing. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.


    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  4. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ (United States)

    Gray, J.W.; Pinkel, D.


    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  5. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.


    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  6. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification


    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei


    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen...

  7. Comparative genomics of proteins involved in RNA nucleocytoplasmic export. (United States)

    Serpeloni, Mariana; Vidal, Newton M; Goldenberg, Samuel; Avila, Andréa R; Hoffmann, Federico G


    The establishment of the nuclear membrane resulted in the physical separation of transcription and translation, and presented early eukaryotes with a formidable challenge: how to shuttle RNA from the nucleus to the locus of protein synthesis. In prokaryotes, mRNA is translated as it is being synthesized, whereas in eukaryotes mRNA is synthesized and processed in the nucleus, and it is then exported to the cytoplasm. In metazoa and fungi, the different RNA species are exported from the nucleus by specialized pathways. For example, tRNA is exported by exportin-t in a RanGTP-dependent fashion. By contrast, mRNAs are associated to ribonucleoproteins (RNPs) and exported by an essential shuttling complex (TAP-p15 in human, Mex67-mtr2 in yeast) that transports them through the nuclear pore. The different RNA export pathways appear to be well conserved among members of Opisthokonta, the eukaryotic supergroup that includes Fungi and Metazoa. However, it is not known whether RNA export in the other eukaryotic supergroups follows the same export routes as in opisthokonts. Our objective was to reconstruct the evolutionary history of the different RNA export pathways across eukaryotes. To do so, we screened an array of eukaryotic genomes for the presence of homologs of the proteins involved in RNA export in Metazoa and Fungi, using human and yeast proteins as queries. Our genomic comparisons indicate that the basic components of the RanGTP-dependent RNA pathways are conserved across eukaryotes, and thus we infer that these are traceable to the last eukaryotic common ancestor (LECA). On the other hand, several of the proteins involved in RanGTP-independent mRNA export pathways are less conserved, which would suggest that they represent innovations that appeared later in the evolution of eukaryotes. Our analyses suggest that the LECA possessed the basic components of the different RNA export mechanisms found today in opisthokonts, and that these mechanisms became more specialized

  8. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis. (United States)

    Olszewski, Marcin; Mickiewicz, Małgorzata; Kur, Józef


    The thermophilic bacterium Thermoanaerobacter tengcongensis has two single-stranded DNA-binding (SSB) proteins, designated TteSSB2 and TteSSB3. In a SSB complementation assay in Escherichia coli, only TteSSB3 took over the in vivo function of EcoSSB. We have cloned the ssb genes obtained by PCR and have developed E. coli overexpression systems. The TteSSB2 and TteSSB3 consist of 153 and 150 amino acids with a calculated molecular mass of 17.29 and 16.96 kDa, respectively. They are the smallest known bacterial SSB proteins. The homology between amino acid sequences of these proteins is 40% identity and 53% similarity. They are functional as homotetramers, with each monomer encoding one single-stranded DNA binding domain (OB-fold). In fluorescence titrations with poly(dT), both proteins bind single-stranded DNA with a binding site size of about 40 nt per homotetramer. Thermostability with half-life of about 30 s at 95 degrees C makes TteSSB3 similar to the known SSB of Thermus aquaticus (TaqSSB). The TteSSB2 was fully active even after 6 h incubation at 100 degrees C. Here, we show for the first time paralogous thermostable homotetrameric SSBs, which could be an attractive alternative for known homodimeric thermostable SSB proteins in their applications for molecular biology methods and analytical purposes.

  9. Intercalation of single-strand oligonucleotides between nucleolipid anionic membranes: a neutron diffraction study. (United States)

    Milani, Silvia; Berti, Debora; Dante, Silvia; Hauss, Thomas; Baglioni, Piero


    This contribution presents a neutron diffraction investigation of anionic lamellar phases composed of mixtures of 1-palmitoyl, 2-oleoyl phosphatidyl-nucleosides (POPN, where N is either adenosine or uridine), and POPC (1-palmitoyl,2-oleoyl-phosphatidyl-choline). Their behavior is studied for two different mole ratios and in the presence of nucleic acids. The samples are formed by the evaporation of liposomal dispersions prepared in water or in solutions containing single-strand oligonucleotides. Previous small angle X-ray scattering (SAXS) experiments on the system POPA/polyU (polyuridylic acid, high degree of polymerization, synthetic ribonucleic acid) proved that the insertion and ordering of the biopolymer in the phospholipid lamellae were driven by molecular recognition. In the present study, we extend the previous investigation to single-strand monodisperse oligonucleotides (50-mers). Structural details of the membranes were obtained from the analysis of the neutron diffraction scattering length density profiles. The evidence of direct and specific interactions, driven by molecular recognition between the nucleic polar heads of the nucleolipid and the single-strand nucleic acid, is strengthened by the comparison with identically charged bilayers formed by POPG/POPC. These results contribute to the understanding of the parameters governing the interactions between nucleolipid membranes and oligonucleotides, providing a novel strategy for the design of lipid-based vehicles for nucleic acids.

  10. Stretching and controlled motion of single-stranded DNA in locally heated solid-state nanopores. (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B; Aksimentiev, Aleksei


    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4-8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA.

  11. Disruption of Specific RNA-RNA Interactions in a Double-Stranded RNA Virus Inhibits Genome Packaging and Virus Infectivity. (United States)

    Fajardo, Teodoro; Sung, Po-Yu; Roy, Polly


    Bluetongue virus (BTV) causes hemorrhagic disease in economically important livestock. The BTV genome is organized into ten discrete double-stranded RNA molecules (S1-S10) which have been suggested to follow a sequential packaging pathway from smallest to largest segment during virus capsid assembly. To substantiate and extend these studies, we have investigated the RNA sorting and packaging mechanisms with a new experimental approach using inhibitory oligonucleotides. Putative packaging signals present in the 3'untranslated regions of BTV segments were targeted by a number of nuclease resistant oligoribonucleotides (ORNs) and their effects on virus replication in cell culture were assessed. ORNs complementary to the 3' UTR of BTV RNAs significantly inhibited virus replication without affecting protein synthesis. Same ORNs were found to inhibit complex formation when added to a novel RNA-RNA interaction assay which measured the formation of supramolecular complexes between and among different RNA segments. ORNs targeting the 3'UTR of BTV segment 10, the smallest RNA segment, were shown to be the most potent and deletions or substitution mutations of the targeted sequences diminished the RNA complexes and abolished the recovery of viable viruses using reverse genetics. Cell-free capsid assembly/RNA packaging assay also confirmed that the inhibitory ORNs could interfere with RNA packaging and further substitution mutations within the putative RNA packaging sequence have identified the recognition sequence concerned. Exchange of 3'UTR between segments have further demonstrated that RNA recognition was segment specific, most likely acting as part of the secondary structure of the entire genomic segment. Our data confirm that genome packaging in this segmented dsRNA virus occurs via the formation of supramolecular complexes formed by the interaction of specific sequences located in the 3' UTRs. Additionally, the inhibition of packaging in-trans with inhibitory ORNs

  12. Influenza virus RNA polymerase: insights into the mechanisms of viral RNA synthesis (United States)

    te Velthuis, Aartjan J.W.; Fodor, Ervin


    The genome of influenza viruses consists of multiple segments of single stranded negative-sense RNA. Each of these segments is bound by the heterotrimeric viral RNA-dependent RNA polymerase and multiple copies of nucleoprotein, forming viral ribonucleoprotein (vRNP) complexes. It is in the context of these vRNPs that the viral RNA polymerase carries out transcription of viral genes and replication of the viral RNA genome. In this Review, we discuss our current knowledge of the structure of the influenza virus RNA polymerase, how it carries out transcription and replication, and how its activities are modulated by viral and host factors. Furthermore, we discuss how advances in our understanding of polymerase function could help identifying new antiviral targets. PMID:27396566

  13. Repair of ultraviolet light damage in Saccharomyces cerevisiae as studied with double- and single-stranded incoming DNAs

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, D.; Hieda, K.


    Purified double- and single-stranded DNAs of the autonomously replicating vector M13RK9-T were irradiated with ultraviolet light (UV) in vitro and introduced into competent whole cells of Saccharomyces cerevisiae. Incoming double-stranded DNA was more sensitive to UV in excision repair-deficient rad2-1 cells than in proficient repair RAD + cells, while single-stranded DNA exhibited high sensitivity in both host cells. The results indicate that in yeast there is no effective rescue of UV-incoming single-stranded DNA by excision repair or other constitutive dark repair processes

  14. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks. (United States)

    Pachkowski, Brian; Nakamura, Jun


    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  15. Structure and sequence motifs in the HIV-1 RNA genome

    NARCIS (Netherlands)

    van Bel, N.


    The untranslated leader of the HIV-1 RNA genome contains some 350 nucleotides and is highly conserved among virus isolates. Several characteristic hairpin structures that regulate important virus replication steps, such as dimerization and packaging in virion particles, are clustered in this leader.

  16. ~hift in genomic RNA patterns of human jotaviruses isolated from ...

    African Journals Online (AJOL)


    Feb 2, 1991 ... ~hift in genomic RNA patterns of human jotaviruses isolated from white children. iD South Africa. ' pI. D. STEELE summary. T/1e molecular epidemiology of rotavirus infection in white c~i1dren in Pretoria was investigated over a 2-year period. R,ohlvirus-positive specimens from 322 infants and young.

  17. Molecular Basis of Encapsidation of Hepatitis C Virus Genome. (United States)

    Shi, Guoli; Suzuki, Tetsuro


    Hepatitis C virus (HCV), a major etiologic agent of human liver diseases, is a positive-sense single-stranded RNA virus and is classified in the Flaviviridae family. Although research findings for the assembly of HCV particles are accumulating due to development of HCV cell culture system, the mechanism(s) by which the HCV genome becomes encapsidated remains largely unclear. In general, viral RNA represents only a small fraction of the RNA molecules in the cells infected with RNA viruses, but the viral genomic RNA is considered to selectively packaged into virions. It was recently demonstrated that HCV RNAs containing 3' end of the genome are selectively incorporated into virus particles during the assembly process and the 3' untranslated region functions as a cis -acting element for RNA packaging. Here, we discuss the molecular basis of RNA encapsidation of HCV and classical flaviviruses, contrast with the packaging mechanism of HIV-1.

  18. Isolation and characterization of a single-stranded DNA virus infecting the marine diatom Chaetoceros sp. strain SS628-11 isolated from western Japan.

    Directory of Open Access Journals (Sweden)

    Kei Kimura

    Full Text Available Diatoms are significant organisms for primary production in the earth's aquatic environment. Hence, their dynamics are an important focus area in current studies. Viruses are a great concern as potential factors of diatom mortality, along with other physical, chemical, and biological factors. We isolated and characterized a new diatom virus (Csp07DNAV that lyses the marine planktonic diatom Chaetoceros sp. strain SS628-11. This paper examines the physiological, morphological, and genomic characteristics of Csp07DNAV. The virus was isolated from a surface water sample that was collected at Hiroshima Bay, Japan. It was icosahedral, had a diameter of 34 nm, and accumulated in the nuclei of host cells. Rod-shaped virus particles also coexisted in the host nuclei. The latent period and burst size were estimated to be <12 h and 29 infectious units per host cell, respectively. Csp07DNAV had a closed circular single-stranded DNA genome (5,552 nucleotides, which included a double-stranded region and 3 open reading frames. The monophyly of Csp07DNAV and other Bacilladnavirus group single-stranded DNA viruses was supported by phylogenetic analysis that was based on the amino acid sequence of each virus protein. On the basis of these results, we considered Csp07DNAV to be a new member of the genus Bacilladnavirus.

  19. An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity. (United States)

    Fernández-Miragall, Olga; Hernández, Carmen


    Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES). Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

  20. An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

    Directory of Open Access Journals (Sweden)

    Olga Fernández-Miragall

    Full Text Available Pelargonium flower break virus (PFBV, genus Carmovirus has a single-stranded positive-sense genomic RNA (gRNA which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37 which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES. Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

  1. An Internal Ribosome Entry Site Directs Translation of the 3′-Gene from Pelargonium Flower Break Virus Genomic RNA: Implications for Infectivity (United States)

    Fernández-Miragall, Olga; Hernández, Carmen


    Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 5′-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3′-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5′-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3′-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES). Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread. PMID:21818349

  2. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.


    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  3. MicroRNA target finding by comparative genomics. (United States)

    Friedman, Robin C; Burge, Christopher B


    MicroRNAs (miRNAs) have been implicated in virtually every metazoan biological process, exerting a widespread impact on gene expression. MicroRNA repression is conferred by relatively short "seed match" sequences, although the degree of repression varies widely for individual target sites. The factors controlling whether, and to what extent, a target site is repressed are not fully understood. As an alternative to target prediction based on sequence alone, comparative genomics has emerged as an invaluable tool for identifying miRNA targets that are conserved by natural selection, and hence likely effective and important. Here we present a general method for quantifying conservation of miRNA seed match sites, separating it from background conservation, controlling for various biases, and predicting miRNA targets. This method is useful not only for generating predictions but also as a tool for empirically evaluating the importance of various target prediction criteria.

  4. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler


    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  5. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela


    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  6. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted


    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  7. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams


    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  8. The Conserved RNA Exonuclease Rexo5 Is Required for 3′ End Maturation of 28S rRNA, 5S rRNA, and snoRNAs

    Directory of Open Access Journals (Sweden)

    Stefanie Gerstberger


    Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.

  9. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles. (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng


    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  10. The impact of base stacking on the conformations and electrostatics of single-stranded DNA. (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois


    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora. (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E


    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  12. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification. (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei


    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  13. Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library.

    Directory of Open Access Journals (Sweden)

    Sumate Pengpumkiat

    Full Text Available Chemical synthesis of oligonucleotides is a widely used tool in the field of biochemistry. Several methods for gene synthesis have been introduced in the growing area of genomics. In this paper, a novel method of constructing dsDNA is proposed. Short (28-mer oligo fragments from a library were assembled through successive annealing and ligation processes, followed by PCR. First, two oligo fragments annealed to form a dsDNA molecule. The double-stranded oligo was immobilized onto magnetic beads (solid support via streptavidin-biotin binding. Next, single-stranded oligo fragments were added successively through ligation to form the complete DNA molecule. The synthesized DNA was amplified through PCR and gel electrophoresis was used to characterize the product. Sanger sequencing showed that more than 97% of the nucleotides matched the expected sequence. Extending the length of the DNA molecule by adding single-stranded oligonucleotides from a basis set (library via ligation enables a more convenient and rapid mechanism for the design and synthesis of oligonucleotides on the go. Coupled with an automated dispensing system and libraries of short oligo fragments, this novel DNA synthesis method would offer an efficient and cost-effective method for producing dsDNA.

  14. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast. (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A


    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  15. Telomeric repeat-containing RNA TERRA: a noncoding RNA connecting telomere biology to genome integrity. (United States)

    Cusanelli, Emilio; Chartrand, Pascal


    Telomeres are dynamic nucleoprotein structures that protect the ends of chromosomes from degradation and activation of DNA damage response. For this reason, telomeres are essential to genome integrity. Chromosome ends are enriched in heterochromatic marks and proper organization of telomeric chromatin is important to telomere stability. Despite their heterochromatic state, telomeres are transcribed giving rise to long noncoding RNAs (lncRNA) called TERRA (telomeric repeat-containing RNA). TERRA molecules play critical roles in telomere biology, including regulation of telomerase activity and heterochromatin formation at chromosome ends. Emerging evidence indicate that TERRA transcripts form DNA-RNA hybrids at chromosome ends which can promote homologous recombination among telomeres, delaying cellular senescence and sustaining genome instability. Intriguingly, TERRA RNA-telomeric DNA hybrids are involved in telomere length homeostasis of telomerase-negative cancer cells. Furthermore, TERRA transcripts play a role in the DNA damage response (DDR) triggered by dysfunctional telomeres. We discuss here recent developments on TERRA's role in telomere biology and genome integrity, and its implication in cancer.

  16. Infectious Bursal disease virus: ribonucleoprotein complexes of a double-stranded RNA virus. (United States)

    Luque, Daniel; Saugar, Irene; Rejas, María Teresa; Carrascosa, José L; Rodríguez, José F; Castón, José R


    Genome-binding proteins with scaffolding and/or regulatory functions are common in living organisms and include histones in eukaryotic cells, histone-like proteins in some double-stranded DNA (dsDNA) viruses, and the nucleocapsid proteins of single-stranded RNA viruses. dsRNA viruses nevertheless lack these ribonucleoprotein (RNP) complexes and are characterized by sharing an icosahedral T=2 core involved in the metabolism and insulation of the dsRNA genome. The birnaviruses, with a bipartite dsRNA genome, constitute a well-established exception and have a single-shelled T=13 capsid only. Moreover, as in many negative single-stranded RNA viruses, the genomic dsRNA is bound to a nucleocapsid protein (VP3) and the RNA-dependent RNA polymerase (VPg). We used electron microscopy and functional analysis to characterize these RNP complexes of infectious bursal disease virus, the best characterized member of the Birnaviridae family. Mild disruption of viral particles revealed that VP3, the most abundant core protein, present at approximately 450 copies per virion, is found in filamentous material tightly associated with the dsRNA. We developed a method to purify RNP and VPg-dsRNA complexes. Analysis of these complexes showed that they are linear molecules containing a constant amount of protein. Sensitivity assays to nucleases indicated that VP3 renders the genomic dsRNA less accessible for RNase III without introducing genome compaction. Additionally, we found that these RNP complexes are functionally competent for RNA synthesis in a capsid-independent manner, in contrast to most dsRNA viruses.

  17. Empirical model for matching spectrophotometric reflectance of yarn windings and multispectral imaging reflectance of single strands of yarns. (United States)

    Luo, Lin; Shen, Hui-Liang; Shao, Si-Jie; Xin, John


    The state-of-the-art multispectral imaging system can directly acquire the reflectance of a single strand of yarn that is impossible for traditional spectrophotometers. Instead, the spectrophotometric reflectance of a yarn winding, which is constituted by yarns wound on a background card, is regarded as the yarn reflectance in textile. While multispectral imaging systems and spectrophotometers can be separately used to acquire the reflectance of a single strand of yarn and corresponding yarn winding, the quantitative relationship between them is not yet known. In this paper, the relationship is established based on models that describe the spectral response of a spectrophotometer to a yarn winding and that of a multispectral imaging system to a single strand of yarn. The reflectance matching function from a single strand of yarn to corresponding yarn winding is derived to be a second degree polynomial function, which coefficients are the solutions of a constrained nonlinear optimization problem. Experiments on 100 pairs of samples show that the proposed approach can reduce the color difference between yarn windings and single strands of yarns from 2.449 to 1.082 CIEDE2000 units. The coefficients of the optimal reflection matching function imply that the reflectance of a yarn winding measured by a spectrophotometer consists of not only the intrinsic reflectance of yarn but also the nonignorable interreflection component between yarns.

  18. Localization of specific sequences and DNA single-strand breaks in individual UV-A-irradiated human lymphocytes by COMET FISH (United States)

    Bock, Claudia; Rapp, Alexander; Dittmar, Heike; Monajembashi, Shamci; Greulich, Karl-Otto


    The COMET assay, a single cell electrophoresis technique which allows to separate electrophoretically fractionated DNA according to size has been combined with fluorescence in situ hybridization (FISH) which allows to localize specific genes or gene regions. This combination (COMET FISH) allows the detection of DNA single strand breaks in specific regions of the genome of human lymphocytes at the single cell level. Various types of DNA probes, e.g. centromere-, (alpha) - satellite-, telomere-, whole chromosome-, single copy- and region specific DNA probes have been used to investigate whether the UV-A induced DNA single strand breaks are distributed randomly all over the human genome or induced at specific sites ('hot spots'). In the investigated human peripheral blood lymphocytes all but one centromere reveal low sensitivity for UV-A irradiation (500 kJ/m2), while telomeres are randomly distributed over COMET heads and tails. The human chromosome 1 is fractionated by irradiation, but remains in the COMET head, indicating an only moderate degree of fractionation. Among three tested single copy probes, c- myc, p53 and p58, the p53 gene located on chromosome 17p13.1 and the p58 gene (1p36) appear to be located in UV-A stable regions of the human genome in 95% of 65 investigated lymphocytes. In contrast, the c-myc proto-oncogene (8q24) is found in the COMET tail in 90% of the 27 investigated lymphocytes and thus appears to be more sensitive to UV-A irradiation.

  19. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.


    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  20. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan


    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  1. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik


    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  2. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.


    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  3. Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Gust, I.D.; Feinstone, S.M.; Purcell, R.H.; Alter, H.J.


    A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

  4. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.


    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  5. N. meningitidis 1681 is a member of the FinO family of RNA chaperones.

    Energy Technology Data Exchange (ETDEWEB)

    Chaulk, S.; Lu, J.; Tan, K.; Arthur, D.; Edwards, R.; Frost, L.; Joachimiak, A.; Glover, J. (Biosciences Division); (Univ. of Alberta)


    The conjugative transfer of F-like plasmids between bacteria is regulated by the plasmid-encoded RNA chaperone, FinO, which facilitates sense - antisense RNA interactions to regulate plasmid gene expression. FinO was thought to adopt a unique structure, however many putative homologs have been identified in microbial genomes and are considered members of the FinO-conjugation-repressor superfamily. We were interested in determining whether other members were also able to bind RNA and promote duplex formation, suggesting that this motif does indeed identify a putative RNA chaperone. We determined the crystal structure of the N. meningitidis MC58 protein NMB1681. It revealed striking similarity to FinO, with a conserved fold and a large, positively charged surface that could function in RNA interactions. Using assays developed to study FinO-FinP sRNA interactions, NMB1681, like FinO, bound tightly to FinP RNA stem-loops with short 5-foot and 3-foot single-stranded tails but not to ssRNA. It also was able to catalyze strand exchange between an RNA duplex and a complementary single-strand, and facilitated duplexing between complementary RNA hairpins. Finally, NMB1681 was able to rescue a finO deficiency and repress F plasmid conjugation. This study strongly suggests that NMB1681 is a FinO-like RNA chaperone that likely regulates gene expression through RNA-based mechanisms in N. meningitidis.

  6. Computational tools for genome-wide miRNA prediction and study

    KAUST Repository

    Malas, T.B.


    MicroRNAs (miRNAs) are single-stranded non-coding RNA susually of 22 nucleotidesin length that play an important post-transcriptional regulation role in many organisms. MicroRNAs bind a seed sequence to the 3-untranslated region (UTR) region of the target messenger RNA (mRNA), inducing degradation or inhibition of translation and resulting in a reduction in the protein level. This regulatory mechanism is central to many biological processes and perturbation could lead to diseases such as cancer. Given the biological importance, of miRNAs, there is a great need to identify and study their targets and functions. However, miRNAs are very difficult to clone in the lab and this has hindered the identification of novel miRNAs. Next-generation sequencing coupled with new computational tools has recently evolved to help researchers efficiently identify large numbers of novel miRNAs. In this review, we describe recent miRNA prediction tools and discuss their priorities, advantages and disadvantages. Malas and Ravasi.

  7. Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.

    Directory of Open Access Journals (Sweden)

    Kiran Zahid


    Full Text Available Satellite RNAs (satRNAs are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS transgene fused with a Cucumber mosaic virus (CMV Y satellite RNA (Y-Sat sequence (35S-GUS:Sat was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

  8. Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA. (United States)

    Zahid, Kiran; Zhao, Jian-Hua; Smith, Neil A; Schumann, Ulrike; Fang, Yuan-Yuan; Dennis, Elizabeth S; Zhang, Ren; Guo, Hui-Shan; Wang, Ming-Bo


    Satellite RNAs (satRNAs) are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS) transgene fused with a Cucumber mosaic virus (CMV) Y satellite RNA (Y-Sat) sequence (35S-GUS:Sat) was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM) to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

  9. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA. (United States)

    Rogers, Cody M; Bochman, Matthew L


    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.


    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  11. Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1

    DEFF Research Database (Denmark)

    Yang, Jay; Bachrati, Csanad Z; Ou, Jiongwen


    -passage mechanism. We generated single-stranded catenanes that resemble the proposed dissolution intermediate recognized by human topoisomerase IIIalpha. We demonstrate that human topoisomerase IIIalpha is a single-stranded DNA decatenase that is specifically stimulated by the BLM-RMI1 pair. In addition, RMI1......Human topoisomerase IIIalpha is a type IA DNA topoisomerase that functions with BLM and RMI1 to resolve DNA replication and recombination intermediates. BLM, human topoisomerase IIIalpha, and RMI1 catalyze the dissolution of double Holliday junctions into noncrossover products via a strand...

  12. Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome (United States)

    Lu, Rui; Folimonov, Alexey; Shintaku, Michael; Li, Wan-Xiang; Falk, Bryce W.; Dawson, William O.; Ding, Shou-Wei


    Viral infection in both plant and invertebrate hosts requires a virus-encoded function to block the RNA silencing antiviral defense. Here, we report the identification and characterization of three distinct suppressors of RNA silencing encoded by the 20-kb plus-strand RNA genome of citrus tristeza virus (CTV). When introduced by genetic crosses into plants carrying a silencing transgene, both p20 and p23, but not coat protein (CP), restored expression of the transgene. Although none of the CTV proteins prevented DNA methylation of the transgene, export of the silencing signal (capable of mediating intercellular silencing spread) was detected only from the F1 plants expressing p23 and not from the CP- or p20-expressing F1 plants, demonstrating suppression of intercellular silencing by CP and p20 but not by p23. Thus, intracellular and intercellular silencing are each targeted by a CTV protein, whereas the third, p20, inhibits silencing at both levels. Notably, CP suppresses intercellular silencing without interfering with intracellular silencing. The novel property of CP suggests a mechanism distinct to p20 and all of the other viral suppressors known to interfere with intercellular silencing and that this class of viral suppressors may not be consistently identified by Agrobacterium coinfiltration because it also induces RNA silencing against the infiltrated suppressor transgene. Our analyses reveal a sophisticated viral counter-defense strategy that targets the silencing antiviral pathway at multiple steps and may be essential for protecting CTV with such a large RNA genome from antiviral silencing in the perennial tree host. RNA interference | citrus tristeza virus | virus synergy | antiviral immunity

  13. Heterochromatin Reorganization during Early Mouse Development Requires a Single-Stranded Noncoding Transcript

    Directory of Open Access Journals (Sweden)

    Miguel Casanova


    Full Text Available The equalization of pericentric heterochromatin from distinct parental origins following fertilization is essential for genome function and development. The recent implication of noncoding transcripts in this process raises questions regarding the connection between RNA and the nuclear organization of distinct chromatin environments. Our study addresses the interrelationship between replication and transcription of the two parental pericentric heterochromatin (PHC domains and their reorganization during early embryonic development. We demonstrate that the replication of PHC is dispensable for its clustering at the late two-cell stage. In contrast, using parthenogenetic embryos, we show that pericentric transcripts are essential for this reorganization independent of the chromatin marks associated with the PHC domains. Finally, our discovery that only reverse pericentric transcripts are required for both the nuclear reorganization of PHC and development beyond the two-cell stage challenges current views on heterochromatin organization.

  14. Cascade: an RNA-seq visualization tool for cancer genomics. (United States)

    Shifman, Aaron R; Johnson, Radia M; Wilhelm, Brian T


    Cancer genomics projects are producing ever-increasing amounts of rich and diverse data from patient samples. The ability to easily visualize this data in an integrated an intuitive way is currently limited by the current software available. As a result, users typically must use several different tools to view the different data types for their cohort, making it difficult to have a simple unified view of their data. Here we present Cascade, a novel web based tool for the intuitive 3D visualization of RNA-seq data from cancer genomics experiments. The Cascade viewer allows multiple data types (e.g. mutation, gene expression, alternative splicing frequency) to be simultaneously displayed, allowing a simplified view of the data in a way that is tuneable based on user specified parameters. The main webpage of Cascade provides a primary view of user data which is overlaid onto known biological pathways that are either predefined or added by users. A space-saving menu for data selection and parameter adjustment allows users to access an underlying MySQL database and customize the features presented in the main view. There is currently a pressing need for new software tools to allow researchers to easily explore large cancer genomics datasets and generate hypotheses. Cascade represents a simple yet intuitive interface for data visualization that is both scalable and customizable.

  15. Simple genomes, complex interactions: Epistasis in RNA virus (United States)

    Elena, Santiago F.; Solé, Ricard V.; Sardanyés, Josep


    Owed to their reduced size and low number of proteins encoded, RNA viruses and other subviral pathogens are often considered as being genetically too simple. However, this structural simplicity also creates the necessity for viral RNA sequences to encode for more than one protein and for proteins to carry out multiple functions, all together resulting in complex patterns of genetic interactions. In this work we will first review the experimental studies revealing that the architecture of viral genomes is dominated by antagonistic interactions among loci. Second, we will also review mathematical models and provide a description of computational tools for the study of RNA virus dynamics and evolution. As an application of these tools, we will finish this review article by analyzing a stochastic bit-string model of in silico virus replication. This model analyzes the interplay between epistasis and the mode of replication on determining the population load of deleterious mutations. The model suggests that, for a given mutation rate, the deleterious mutational load is always larger when epistasis is predominantly antagonistic than when synergism is the rule. However, the magnitude of this effect is larger if replication occurs geometrically than if it proceeds linearly.

  16. Enhancement of single guide RNA transcription for efficient CRISPR/Cas-based genomic engineering. (United States)

    Ui-Tei, Kumiko; Maruyama, Shohei; Nakano, Yuko


    Genomic engineering using clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) protein is a promising approach for targeting the genomic DNA of virtually any organism in a sequence-specific manner. Recent remarkable advances in CRISPR/Cas technology have made it a feasible system for use in therapeutic applications and biotechnology. In the CRISPR/Cas system, a guide RNA (gRNA), interacting with the Cas protein, recognizes a genomic region with sequence complementarity, and the double-stranded DNA at the target site is cleaved by the Cas protein. A widely used gRNA is an RNA polymerase III (pol III)-driven single gRNA (sgRNA), which is produced by artificial fusion of CRISPR RNA (crRNA) and trans-activation crRNA (tracrRNA). However, we identified a TTTT stretch, known as a termination signal of RNA pol III, in the scaffold region of the sgRNA. Here, we revealed that sgRNA carrying a TTTT stretch reduces the efficiency of sgRNA transcription due to premature transcriptional termination, and decreases the efficiency of genome editing. Unexpectedly, it was also shown that the premature terminated sgRNA may have an adverse effect of inducing RNA interference. Such disadvantageous effects were avoided by substituting one base in the TTTT stretch.

  17. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.


    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  18. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.


    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  19. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak


    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  20. Substrate-assisted 2D DNA lattices and algorithmic lattices from single-stranded tiles. (United States)

    Kim, Junghoon; Ha, Tai Hwan; Park, Sung Ha


    We present a simple route to circumvent kinetic traps which affect many types of DNA nanostructures in their self-assembly process. Using this method, a new 2D DNA lattice made up of short, single-stranded tile (SST) motifs was created. Previously, the growth of SST DNA assemblies was restricted to 1D (tubes and ribbons) or finite-sized 2D (molecular canvases). By utilizing the substrate-assisted growth method, sets of SSTs were designed as unit cells to self-assemble into periodic and aperiodic 2D lattices which continuously grow both along and orthogonal to the helical axis. Notably, large-scale (∼1 μm(2)) fully periodic 2D lattices were fabricated using a minimum of just 2 strand species. Furthermore, the ability to create 2D lattices from a few motifs enables certain rules to be encoded into these SSTs to carry out algorithmic self-assembly. A set of these motifs was designed to execute simple 1-input 1-output COPY and NOT algorithms, the space-time manifestations which were aperiodic 2D algorithmic SST lattices. The methodology presented here can be straightforwardly applied to other motifs which fall into this type of kinetic trap to create novel DNA crystals.

  1. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.


    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  2. Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems. (United States)

    Musumeci, Domenica; Rozza, Lucia; Merlino, Antonello; Paduano, Luigi; Marzo, Tiziano; Massai, Lara; Messori, Luigi; Montesarchio, Daniela


    The interaction of the anticancer Ru(iii) complex AziRu - in comparison with its analogue NAMI-A, currently in advanced clinical trials as an antimetastatic agent - with DNA model systems, both single stranded and duplex oligonucleotides, was investigated using a combined approach, including absorption UV-vis spectroscopy, circular dichroism (CD) and electrospray mass spectrometry (ESI-MS) techniques. UV-vis absorption spectra of the Ru complexes were recorded at different times in a pseudo-physiological solution, to monitor the ligand exchange processes in the absence and in the presence of the examined oligonucleotides. CD experiments provided information on the overall conformational changes of the DNA model systems induced by these metal complexes. UV- and CD-monitored thermal denaturation studies were performed to analyse the effects of AziRu and NAMI-A on the stability of the duplex structures. ESI-MS experiments, carried out on the oligonucleotide/metal complex mixtures under investigation, allowed us to detect the formation of stable adducts between the guanine-containing oligomers and the ruthenium complexes. These data unambiguously demonstrate that both AziRu and NAMI-A can interact with the DNA model systems. Although very similar in their structures, the two metal compounds manifest a markedly different reactivity with the examined sequences, respectively, with either a naked Ru(3+) ion or a Ru(Im)(3+) (Im = imidazole) fragment being incorporated into the oligonucleotide structure via stable linkages.

  3. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop. (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S


    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  4. Biophysical characterization of the association of histones with single-stranded DNA. (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier


    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong


    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  6. Effect of Conformational Entropy on the Nanomechanics of Microcantilever-Based Single-Stranded DNA Sensors

    Directory of Open Access Journals (Sweden)

    Zou-Qing Tan


    Full Text Available An entropy-controlled bending mechanism is presented to study the nanomechanics of microcantilever-based single-stranded DNA (ssDNA sensors. First; the conformational free energy of the ssDNA layer is given with an improved scaling theory of thermal blobs considering the curvature effect; and the mechanical energy of the non-biological layer is described by Zhang’s two-variable method for laminated beams. Then; an analytical model for static deflections of ssDNA microcantilevers is formulated by the principle of minimum energy. The comparisons of deflections predicted by the proposed model; Utz–Begley’s model and Hagan’s model are also examined. Numerical results show that the conformational entropy effect on microcantilever deflections cannot be ignored; especially at the conditions of high packing density or long chain systems; and the variation of deflection predicted by the proposed analytical model not only accords with that observed in the related experiments qualitatively; but also appears quantitatively closer to the experimental values than that by the preexisting models. In order to improve the sensitivity of static-mode biosensors; it should be as small as possible to reduce the substrate stiffness.

  7. In vitro selection and characterization of single stranded DNA aptamers for luteolin: A possible recognition tool. (United States)

    Tuma Sabah, Jinan; Zulkifli, Razauden Mohamed; Shahir, Shafinaz; Ahmed, Farediah; Abdul Kadir, Mohammed Rafiq; Zakaria, Zarita


    Distinctive bioactivities possessed by luteolin (3', 4', 5, 7-tetrahydroxy-flavone) are advantageous for sundry practical applications. This paper reports the in vitro selection and characterization of single stranded-DNA (ssDNA) aptamers, specific for luteolin (LUT). 76-mer library containing 1015 randomized ssDNA were screened via systematic evolution of ligands by exponential enrichment (SELEX). The recovered ssDNA pool from the 8th round was amplified with unlabeled primers and cloned into PSTBlue-1 vector prior to sequencing. 22 of LUT-binding aptamer variants were further classified into one of the seven groups based on their N40 random sequence regions, wherein one representative from each group was characterized. The dissociation constant of aptamers designated as LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively with high binding affinity towards LUT. Prediction analysis of the secondary structure suggested discrete features with typical loop and stem motifs. Furthermore, LUT#3 displayed higher specificity with insignificant binding toward kaempferol and quercetin despite its structural and functional similarity compared to LUT#28 and LUT#20. Further LUT#3 can detect free luteolin within 0.2-1 mM in solution. It was suggested that LUT#3 aptamer were the most suitable for LUT recognition tool at laboratory scale based on the condition tested. Copyright © 2018. Published by Elsevier Inc.

  8. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.


    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  9. A brief review of microRNA and its role in PRRSV infection and replication

    Directory of Open Access Journals (Sweden)

    Xuekun GUO,Wenhai FENG


    Full Text Available Porcine reproductive and respiratory syndrome virus (PRRSV, a single-stranded RNA virus, mainly infects cells of monocyte/macrophage lineage. Recently, host microRNAs were shown to be capable of modulating PRRSV infection and replication by multiple ways such as targeting viral genomic RNA, targeting viral receptor and inducing antiviral response. MicroRNAs are small RNAs and have emerged as important regulators of virus-host cell interactions. In this review, we discuss the identified functions of host microRNAs in relation to PRRSV infection and propose that cellular microRNAs may have a substantial effect on cell or tissue tropism of PRRSV.

  10. Genome-wide identification and characterization of tRNA-derived RNA fragments in land plants. (United States)

    Alves, Cristiane S; Vicentini, Renato; Duarte, Gustavo T; Pinoti, Vitor F; Vincentz, Michel; Nogueira, Fabio T S


    The manuscript by Alves et al. entitled "Genome-wide identification and characterization of tRNA-derived RNA fragments in land plants" describes the identification and characterization of tRNAderived sRNA fragments in plants. By combining bioinformatic analysis and genetic and molecular approaches, we show that tRF biogenesis does not rely on canonical microRNA/siRNA processing machinery (i.e., independent of DICER-LIKE proteins). Moreover, we provide evidences that the Arabidopsis S-like Ribonuclease 1 (RNS1) might be involved in the biogenesis of tRFs. Detailed analyses showed that plant tRFs are sorted into different types of ARGONAUTE proteins and that they have potential target candidate genes. Our work advances the understanding of the tRF biology in plants by providing evidences that plant and animal tRFs shared common features and raising the hypothesis that an interplay between tRFs and other sRNAs might be important to fine-tune gene expression and protein biosynthesis in plant cells. Small RNA (sRNA) fragments derived from tRNAs (3'-loop, 5'-loop, anti-codon loop), named tRFs, have been reported in several organisms, including humans and plants. Although they may interfere with gene expression, their biogenesis and biological functions in plants remain poorly understood. Here, we capitalized on small RNA sequencing data from distinct species such as Arabidopsis thaliana, Oryza sativa, and Physcomitrella patens to examine the diversity of plant tRFs and provide insight into their properties. In silico analyzes of 19 to 25-nt tRFs derived from 5' (tRF-5s) and 3'CCA (tRF-3s) tRNA loops in these three evolutionary distant species showed that they are conserved and their abundance did not correlate with the number of genomic copies of the parental tRNAs. Moreover, tRF-5 is the most abundant variant in all three species. In silico and in vivo expression analyses unraveled differential accumulation of tRFs in Arabidopsis tissues/organs, suggesting that they are

  11. Nucleotide composition of the Zika virus RNA genome and its codon usage

    NARCIS (Netherlands)

    van Hemert, Formijn; Berkhout, Ben


    RNA viruses have genomes with a distinct nucleotide composition and codon usage. We present the global characteristics of the RNA genome of Zika virus (ZIKV), an emerging pathogen within the Flavivirus genus. ZIKV was first isolated in 1947 in Uganda, caused a widespread epidemic in South and

  12. Structure-function studies of nucleocytoplasmic transport of retroviral genomic RNA by mRNA export factor TAP (United States)

    Teplova, Marianna; Wohlbold, Lara; Khin, Nyan W.; Izaurralde, Elisa; Patel, Dinshaw J.


    Messenger RNA export is mediated by the TAP-p15 heterodimer, which belongs to the family of NTF2-like export receptors. TAP-p15 heterodimers also bind to the constitutive transport element (CTE) present in simian type D retroviral RNAs, and mediate export of viral unspliced RNAs to the host cytoplasm. We have solved the crystal structure of the RNA recognition and leucine-rich repeat motifs of TAP bound to one symmetrical-half of CTE RNA. L-shaped conformations of protein and RNA are involved in a mutual molecular embrace on complex formation. We have monitored the impact of structure-guided mutations on binding affinities in vitro and transport assays in vivo. Our studies define the principles by which CTE RNA subverts the mRNA export receptor TAP, thereby facilitating nuclear export of viral genomic RNAs, and more generally, provide insights on cargo RNA recognition by mRNA export receptors. PMID:21822283

  13. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy


    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  14. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray. (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino


    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  15. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino


    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  16. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system. (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus


    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  17. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.


    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  18. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.


    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  19. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding. (United States)

    Richardson, Tomas T; Harran, Omar; Murray, Heath


    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

  20. RNA-CODE: a noncoding RNA classification tool for short reads in NGS data lacking reference genomes.

    Directory of Open Access Journals (Sweden)

    Cheng Yuan

    Full Text Available The number of transcriptomic sequencing projects of various non-model organisms is still accumulating rapidly. As non-coding RNAs (ncRNAs are highly abundant in living organism and play important roles in many biological processes, identifying fragmentary members of ncRNAs in small RNA-seq data is an important step in post-NGS analysis. However, the state-of-the-art ncRNA search tools are not optimized for next-generation sequencing (NGS data, especially for very short reads. In this work, we propose and implement a comprehensive ncRNA classification tool (RNA-CODE for very short reads. RNA-CODE is specifically designed for ncRNA identification in NGS data that lack quality reference genomes. Given a set of short reads, our tool classifies the reads into different types of ncRNA families. The classification results can be used to quantify the expression levels of different types of ncRNAs in RNA-seq data and ncRNA composition profiles in metagenomic data, respectively. The experimental results of applying RNA-CODE to RNA-seq of Arabidopsis and a metagenomic data set sampled from human guts demonstrate that RNA-CODE competes favorably in both sensitivity and specificity with other tools. The source codes of RNA-CODE can be downloaded at

  1. Compactness of viral genomes: effect of disperse and localized random mutations (United States)

    Lošdorfer Božič, Anže; Micheletti, Cristian; Podgornik, Rudolf; Tubiana, Luca


    Genomes of single-stranded RNA viruses have evolved to optimize several concurrent properties. One of them is the architecture of their genomic folds, which must not only feature precise structural elements at specific positions, but also allow for overall spatial compactness. The latter was shown to be disrupted by random synonymous mutations, a disruption which can consequently negatively affect genome encapsidation. In this study, we use three mutation schemes with different degrees of locality to mutate the genomes of phage MS2 and Brome Mosaic virus in order to understand the observed sensitivity of the global compactness of their folds. We find that mutating local stretches of their genomes’ sequence or structure is less disruptive to their compactness compared to inducing randomly-distributed mutations. Our findings are indicative of a mechanism for the conservation of compactness acting on a global scale of the genomes, and have several implications for understanding the interplay between local and global architecture of viral RNA genomes.

  2. Sequence composition similarities with the 7SL RNA are highly predictive of functional genomic features


    Paquet, Yanick; Anderson, Alan


    Transposable elements derived from the 7SL RNA gene, such as Alu elements in primates, have had remarkable success in several mammalian lineages. The results presented here show a broad spectrum of functions for genomic segments that display sequence composition similarities with the 7SL RNA gene. Using thoroughly documented loci, we report that DNaseI-hypersensitive sites can be singled out in large genomic sequences by an assessment of sequence composition similarities with the 7SL RNA gene...

  3. FLDS: A Comprehensive dsRNA Sequencing Method for Intracellular RNA Virus Surveillance. (United States)

    Urayama, Syun-Ichi; Takaki, Yoshihiro; Nunoura, Takuro


    Knowledge of the distribution and diversity of RNA viruses is still limited in spite of their possible environmental and epidemiological impacts because RNA virus-specific metagenomic methods have not yet been developed. We herein constructed an effective metagenomic method for RNA viruses by targeting long double-stranded (ds)RNA in cellular organisms, which is a hallmark of infection, or the replication of dsRNA and single-stranded (ss)RNA viruses, except for retroviruses. This novel dsRNA targeting metagenomic method is characterized by an extremely high recovery rate of viral RNA sequences, the retrieval of terminal sequences, and uniform read coverage, which has not previously been reported in other metagenomic methods targeting RNA viruses. This method revealed a previously unidentified viral RNA diversity of more than 20 complete RNA viral genomes including dsRNA and ssRNA viruses associated with an environmental diatom colony. Our approach will be a powerful tool for cataloging RNA viruses associated with organisms of interest.

  4. Electrical conduction and photoresponses of gamma-ray-irradiated single-stranded DNA/single-walled carbon nanotube composite systems

    Energy Technology Data Exchange (ETDEWEB)

    Hong, W.; Lee, E.M.; Kim, D.W.; Lee, Cheol Eui, E-mail:


    Highlights: •Effects of gamma-ray irradiation on single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. •Barrier for thermally activated conduction in the composite systems modified by the gamma-ray irradiation. •Photoresponses reveal photoexcitation and oxygen photodesorption modified by gamma-ray irradiation. -- Abstract: Effects of gamma-ray irradiation on the electrical conductivity and photoresponse have been studied for single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. The temperature-dependent electrical conductivity of the ssDNA/SWNT composite films, well described by a fluctuation-induced tunneling model, indicated modification of the barrier for thermally activated conduction by the gamma-ray irradiation. Besides, the photoresponse measurements indicated modified photoexcited charge carrier generation and oxygen photodesorption in the composite systems due to the gamma-ray irradiation.

  5. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.


    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  6. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals (United States)


    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  7. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.


    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  8. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.


    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  9. Exploration of sequence space as the basis of viral RNA genome segmentation. (United States)

    Moreno, Elena; Ojosnegros, Samuel; García-Arriaza, Juan; Escarmís, Cristina; Domingo, Esteban; Perales, Celia


    The mechanisms of viral RNA genome segmentation are unknown. On extensive passage of foot-and-mouth disease virus in baby hamster kidney-21 cells, the virus accumulated multiple point mutations and underwent a transition akin to genome segmentation. The standard single RNA genome molecule was replaced by genomes harboring internal in-frame deletions affecting the L- or capsid-coding region. These genomes were infectious and killed cells by complementation. Here we show that the point mutations in the nonstructural protein-coding region (P2, P3) that accumulated in the standard genome before segmentation increased the relative fitness of the segmented version relative to the standard genome. Fitness increase was documented by intracellular expression of virus-coded proteins and infectious progeny production by RNAs with the internal deletions placed in the sequence context of the parental and evolved genome. The complementation activity involved several viral proteins, one of them being the leader proteinase L. Thus, a history of genetic drift with accumulation of point mutations was needed to allow a major variation in the structure of a viral genome. Thus, exploration of sequence space by a viral genome (in this case an unsegmented RNA) can reach a point of the space in which a totally different genome structure (in this case, a segmented RNA) is favored over the form that performed the exploration.

  10. Diversity of human tRNA genes from the 1000-genomes project. (United States)

    Parisien, Marc; Wang, Xiaoyun; Pan, Tao


    The sequence diversity of individual human genomes has been extensively analyzed for variations and phenotypic implications for mRNA, miRNA, and long non-coding RNA genes. TRNA (tRNA) also exhibits large sequence diversity in the human genome, but tRNA gene sequence variation and potential functional implications in individual human genomes have not been investigated. Here we capitalize on the sequencing data from the 1000-genomes project to examine the diversity of tRNA genes in the human population. Previous analysis of the reference human genome indicated an unexpected large number of diverse tRNA genes beyond the necessity of translation, suggesting that some tRNA transcripts may perform non-canonical functions. We found 24 new tRNA sequences in>1% and 76 new tRNA sequences in>0.2% of all individuals, indicating that tRNA genes are also subject to evolutionary changes in the human population. Unexpectedly, two abundant new tRNA genes contain base-pair mismatches in the anticodon stem. We experimentally determined that these two new tRNAs have altered structures in vitro; however, one new tRNA is not aminoacylated but extremely stable in HeLa cells, suggesting that this new tRNA can be used for non-canonical function. Our results show that at the scale of human population, tRNA genes are more diverse than conventionally understood, and some new tRNAs may perform non-canonical, extra-translational functions that may be linked to human health and disease.

  11. Synthetic CRISPR RNA-Cas9-guided genome editing in human cells. (United States)

    Rahdar, Meghdad; McMahon, Moira A; Prakash, Thazha P; Swayze, Eric E; Bennett, C Frank; Cleveland, Don W


    Genome editing with the clustered, regularly interspaced, short palindromic repeats (CRISPR)-Cas9 nuclease system is a powerful technology for manipulating genomes, including introduction of gene disruptions or corrections. Here we develop a chemically modified, 29-nucleotide synthetic CRISPR RNA (scrRNA), which in combination with unmodified transactivating crRNA (tracrRNA) is shown to functionally replace the natural guide RNA in the CRISPR-Cas9 nuclease system and to mediate efficient genome editing in human cells. Incorporation of rational chemical modifications known to protect against nuclease digestion and stabilize RNA-RNA interactions in the tracrRNA hybridization region of CRISPR RNA (crRNA) yields a scrRNA with enhanced activity compared with the unmodified crRNA and comparable gene disruption activity to the previously published single guide RNA. Taken together, these findings provide a platform for therapeutic applications, especially for nervous system disease, using successive application of cell-permeable, synthetic CRISPR RNAs to activate and then silence Cas9 nuclease activity.

  12. The Genomic Landscape and Clinical Relevance of A-to-I RNA Editing in Human Cancers | Office of Cancer Genomics (United States)

    Adenosine-to-inosine (A-to-I) RNA editing is a widespread post-transcriptional mechanism, but its genomic landscape and clinical relevance in cancer have not been investigated systematically. We characterized the global A-to-I RNA editing profiles of 6,236 patient samples of 17 cancer types from The Cancer Genome Atlas and revealed a striking diversity of altered RNA-editing patterns in tumors relative to normal tissues. We identified an appreciable number of clinically relevant editing events, many of which are in noncoding regions.

  13. Structure of the Leanyer orthobunyavirus nucleoprotein-RNA complex reveals unique architecture for RNA encapsidation. (United States)

    Niu, Fengfeng; Shaw, Neil; Wang, Yao E; Jiao, Lianying; Ding, Wei; Li, Xiaomin; Zhu, Ping; Upur, Halmurat; Ouyang, Songying; Cheng, Genhong; Liu, Zhi-Jie


    Negative-stranded RNA viruses cover their genome with nucleoprotein (N) to protect it from the human innate immune system. Abrogation of the function of N offers a unique opportunity to combat the spread of the viruses. Here, we describe a unique fold of N from Leanyer virus (LEAV, Orthobunyavirus genus, Bunyaviridae family) in complex with single-stranded RNA refined to 2.78 Å resolution as well as a 2.68 Å resolution structure of LEAV N-ssDNA complex. LEAV N is made up of an N- and a C-terminal lobe, with the RNA binding site located at the junction of these lobes. The LEAV N tetramer binds a 44-nucleotide-long single-stranded RNA chain. Hence, oligomerization of N is essential for encapsidation of the entire genome and is accomplished by using extensions at the N and C terminus. Molecular details of the oligomerization of N are illustrated in the structure where a circular ring-like tertiary assembly of a tetramer of LEAV N is observed tethering the RNA in a positively charged cavity running along the inner edge. Hydrogen bonds between N and the C2 hydroxyl group of ribose sugar explain the specificity of LEAV N for RNA over DNA. In addition, base-specific hydrogen bonds suggest that some regions of RNA bind N more tightly than others. Hinge movements around F20 and V125 assist in the reversal of capsidation during transcription and replication of the virus. Electron microscopic images of the ribonucleoprotein complexes of LEAV N reveal a filamentous assembly similar to those found in phleboviruses.

  14. Divergence of RNA polymerase α subunits in angiosperm plastid genomes is mediated by genomic rearrangement (United States)

    Blazier, J. Chris; Ruhlman, Tracey A.; Weng, Mao-Lun; Rehman, Sumaiyah K.; Sabir, Jamal S. M.; Jansen, Robert K.


    Genes for the plastid-encoded RNA polymerase (PEP) persist in the plastid genomes of all photosynthetic angiosperms. However, three unrelated lineages (Annonaceae, Passifloraceae and Geraniaceae) have been identified with unusually divergent open reading frames (ORFs) in the conserved region of rpoA, the gene encoding the PEP α subunit. We used sequence-based approaches to evaluate whether these genes retain function. Both gene sequences and complete plastid genome sequences were assembled and analyzed from each of the three angiosperm families. Multiple lines of evidence indicated that the rpoA sequences are likely functional despite retaining as low as 30% nucleotide sequence identity with rpoA genes from outgroups in the same angiosperm order. The ratio of non-synonymous to synonymous substitutions indicated that these genes are under purifying selection, and bioinformatic prediction of conserved domains indicated that functional domains are preserved. One of the lineages (Pelargonium, Geraniaceae) contains species with multiple rpoA-like ORFs that show evidence of ongoing inter-paralog gene conversion. The plastid genomes containing these divergent rpoA genes have experienced extensive structural rearrangement, including large expansions of the inverted repeat. We propose that illegitimate recombination, not positive selection, has driven the divergence of rpoA. PMID:27087667

  15. The Antiviral and Cancer Genomic DNA Deaminase APOBEC3H Is Regulated by an RNA-Mediated Dimerization Mechanism. (United States)

    Shaban, Nadine M; Shi, Ke; Lauer, Kate V; Carpenter, Michael A; Richards, Christopher M; Salamango, Daniel; Wang, Jiayi; Lopresti, Michael W; Banerjee, Surajit; Levin-Klein, Rena; Brown, William L; Aihara, Hideki; Harris, Reuben S


    Human APOBEC3H and homologous single-stranded DNA cytosine deaminases are unique to mammals. These DNA-editing enzymes function in innate immunity by restricting the replication of viruses and transposons. APOBEC3H also contributes to cancer mutagenesis. Here, we address the fundamental nature of RNA in regulating human APOBEC3H activities. APOBEC3H co-purifies with RNA as an inactive protein, and RNase A treatment enables strong DNA deaminase activity. RNA-binding-defective mutants demonstrate clear separation of function by becoming DNA hypermutators. Biochemical and crystallographic data demonstrate a mechanism in which double-stranded RNA mediates enzyme dimerization. Additionally, APOBEC3H separation-of-function mutants show that RNA binding is required for cytoplasmic localization, packaging into HIV-1 particles, and antiviral activity. Overall, these results support a model in which structured RNA negatively regulates the potentially harmful DNA deamination activity of APOBEC3H while, at the same time, positively regulating its antiviral activity. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Engineering CRISPR/Cpf1 with tRNA promotes genome editing capability in mammalian systems. (United States)

    Wu, Han; Liu, Qishuai; Shi, Hui; Xie, Jingke; Zhang, Quanjun; Ouyang, Zhen; Li, Nan; Yang, Yi; Liu, Zhaoming; Zhao, Yu; Lai, Chengdan; Ruan, Degong; Peng, Jiangyun; Ge, Weikai; Chen, Fangbing; Fan, Nana; Jin, Qin; Liang, Yanhui; Lan, Ting; Yang, Xiaoyu; Wang, Xiaoshan; Lei, Zhiyong; Doevendans, Pieter A; Sluijter, Joost P G; Wang, Kepin; Li, Xiaoping; Lai, Liangxue


    CRISPR/Cpf1 features a number of properties that are distinct from CRISPR/Cas9 and provides an excellent alternative to Cas9 for genome editing. To date, genome engineering by CRISPR/Cpf1 has been reported only in human cells and mouse embryos of mammalian systems and its efficiency is ultimately lower than that of Cas9 proteins from Streptococcus pyogenes. The application of CRISPR/Cpf1 for targeted mutagenesis in other animal models has not been successfully verified. In this study, we designed and optimized a guide RNA (gRNA) transcription system by inserting a transfer RNA precursor (pre-tRNA) sequence downstream of the gRNA for Cpf1, protecting gRNA from immediate digestion by 3'-to-5' exonucleases. Using this new gRNA tRNA system, genome editing, including indels, large fragment deletion and precise point mutation, was induced in mammalian systems, showing significantly higher efficiency than the original Cpf1-gRNA system. With this system, gene-modified rabbits and pigs were generated by embryo injection or somatic cell nuclear transfer (SCNT) with an efficiency comparable to that of the Cas9 gRNA system. These results demonstrated that this refined gRNA tRNA system can boost the targeting capability of CRISPR/Cpf1 toolkits.

  17. Simultaneous isolation of high-quality DNA, RNA, miRNA and proteins from tissues for genomic applications. (United States)

    Peña-Llopis, Samuel; Brugarolas, James


    Genomic technologies have revolutionized our understanding of complex Mendelian diseases and cancer. Solid tumors present several challenges for genomic analyses, such as tumor heterogeneity and tumor contamination with surrounding stroma and infiltrating lymphocytes. We developed a protocol to (i) select tissues of high cellular purity on the basis of histological analyses of immediately flanking sections and (ii) simultaneously extract genomic DNA (gDNA), mRNA, noncoding RNA (ncRNA; enriched in miRNA) and protein from the same tissues. After tissue selection, about 12-16 extractions of DNA, RNA or protein can be obtained per day. Compared with other similar approaches, this fast and reliable methodology allowed us to identify mutations in tumors with remarkable sensitivity and to perform integrative analyses of whole-genome and exome data sets, DNA copy numbers (by single-nucleotide polymorphism (SNP) arrays), gene expression data (by transcriptome profiling and quantitative PCR (qPCR)) and protein levels (by western blotting and immunohistochemical analysis) from the same samples. Although we focused on renal cell carcinoma, this protocol may be adapted with minor changes to any human or animal tissue to obtain high-quality and high-yield nucleic acids and proteins.

  18. The RNA synthesis machinery of negative-stranded RNA viruses

    Energy Technology Data Exchange (ETDEWEB)

    Ortín, Juan, E-mail: [Department of Molecular and Cellular Biology, Centro Nacional de Biotecnología (CSIC) and CIBER de Enfermedades Respiratorias (ISCIII), Madrid (Spain); Martín-Benito, Jaime, E-mail: [Department of Macromolecular Structures, Centro Nacional de Biotecnología (CSIC), Madrid (Spain)


    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure of their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes.

  19. The RNA synthesis machinery of negative-stranded RNA viruses

    International Nuclear Information System (INIS)

    Ortín, Juan; Martín-Benito, Jaime


    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure of their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes

  20. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms. (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A


    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Comparison of various methods of detection of different forms of dengue virus type 2 RNA in cultured cells

    International Nuclear Information System (INIS)

    Liu, H.S.; Lin, Y.L.; Chen, C.C.


    In this report, the sensitivity of various methods of detection of dengue virus type 2 (DEN-2) sense, antisense, replicative intermediate (RI) and replicative form (RF) RNAs in infected mosquito Aedes pseudoscutellaris AP-61 and mammalian baby hamster kidney BHK-21 cells is compared. LiCl precipitation was used for separation of viral RF RNA from RI RNA. Our results show that reverse transcription-polymerase chain reaction (RT-PCR) followed by Southern blot analysis and slot blot hybridisation of LiCl-fractionated RNA were the most sensitive methods of detection of viral RNA and determination of its single-stranded form. Northern blot analysis was the least sensitive method of detection of any form of viral RNA. U sing slot blot hybridisation of LiCl-precipitated RNA, viral RI RNA containing de novo synthesised negative strand viral RNA was first detected 30 min after virus inoculation in both cell lines. This is the earliest time of detection of DEN viral RNA synthesis in host cells so far reported. However, RF RNA could not be detected until 24 hrs post infection (p.i.) in AP-61 and 2 days p.i. in BHK-21 cells, respectively. The sequential order of individual forms of viral RNA detected in the infected cells was RI, RF and genomic RNAs. Viral RNA was detected in AP-61 cells always earlier than in BHK-21 cells. Moreover, the level of viral RNA in AP-61 cells was higher than that in BHK-21 cells, suggesting that the virus replicated more actively in AP-61 cells. In conclusion, the LiCl separation of viral RNA followed by slot blot hybridisation was found to be the most sensitive and reliable method of detection of DEN virus RI, RF and genomic RNAs in the infected cells. Moreover, this method can be applied to determine the replication status of any single-stranded RNA virus in the host. (authors)

  2. Mammalian RNA polymerase II core promoters: insights from genome-wide studies

    DEFF Research Database (Denmark)

    Sandelin, Albin; Carninci, Piero; Lenhard, Boris


    The identification and characterization of mammalian core promoters and transcription start sites is a prerequisite to understanding how RNA polymerase II transcription is controlled. New experimental technologies have enabled genome-wide discovery and characterization of core promoters, revealin...

  3. RNA structural constraints in the evolution of the influenza A virus genome NP segment

    NARCIS (Netherlands)

    A.P. Gultyaev (Alexander); A. Tsyganov-Bodounov (Anton); M.I. Spronken (Monique); S. Van Der Kooij (Sander); R.A.M. Fouchier (Ron); R.C.L. Olsthoorn (René)


    textabstractConserved RNA secondary structures were predicted in the nucleoprotein (NP) segment of the influenza A virus genome using comparative sequence and structure analysis. A number of structural elements exhibiting nucleotide covariations were identified over the whole segment length,

  4. NOVOMIR: De Novo Prediction of MicroRNA-Coding Regions in a Single Plant-Genome (United States)

    Teune, Jan-Hendrik; Steger, Gerhard


    MicroRNAs (miRNA) are small regulatory, noncoding RNA molecules that are transcribed as primary miRNAs (pri-miRNA) from eukaryotic genomes. At least in plants, their regulatory activity is mediated through base-pairing with protein-coding messenger RNAs (mRNA) followed by mRNA degradation or translation repression. We describe NOVOMIR, a program for the identification of miRNA genes in plant genomes. It uses a series of filter steps and a statistical model to discriminate a pre-miRNA from other RNAs and does rely neither on prior knowledge of a miRNA target nor on comparative genomics. The sensitivity and specificity of NOVOMIR for detection of premiRNAs from Arabidopsis thaliana is ~0.83 and ~0.99, respectively. Plant pre-miRNAs are more heterogeneous with respect to size and structure than animal pre-miRNAs. Despite these difficulties, NOVOMIR is well suited to perform searches for pre-miRNAs on a genomic scale. NOVOMIR is written in Perl and relies on two additional, free programs for prediction of RNA secondary structure (RNALFOLD, RNASHAPES). PMID:20871826

  5. SearchSmallRNA: a graphical interface tool for the assemblage of viral genomes using small RNA libraries data. (United States)

    de Andrade, Roberto R S; Vaslin, Maite F S


    Next-generation parallel sequencing (NGS) allows the identification of viral pathogens by sequencing the small RNAs of infected hosts. Thus, viral genomes may be assembled from host immune response products without prior virus enrichment, amplification or purification. However, mapping of the vast information obtained presents a bioinformatics challenge. In order to by pass the need of line command and basic bioinformatics knowledge, we develop a mapping software with a graphical interface to the assemblage of viral genomes from small RNA dataset obtained by NGS. SearchSmallRNA was developed in JAVA language version 7 using NetBeans IDE 7.1 software. The program also allows the analysis of the viral small interfering RNAs (vsRNAs) profile; providing an overview of the size distribution and other features of the vsRNAs produced in infected cells. The program performs comparisons between each read sequenced present in a library and a chosen reference genome. Reads showing Hamming distances smaller or equal to an allowed mismatched will be selected as positives and used to the assemblage of a long nucleotide genome sequence. In order to validate the software, distinct analysis using NGS dataset obtained from HIV and two plant viruses were used to reconstruct viral whole genomes. SearchSmallRNA program was able to reconstructed viral genomes using NGS of small RNA dataset with high degree of reliability so it will be a valuable tool for viruses sequencing and discovery. It is accessible and free to all research communities and has the advantage to have an easy-to-use graphical interface. SearchSmallRNA was written in Java and is freely available at

  6. Interactions Between HIV-1 Gag and Viral RNA Genome Enhance Virion Assembly

    DEFF Research Database (Denmark)

    Dilley, Kari A; Nikolaitchik, Olga A; Galli, Andrea


    Most HIV-1 virions contain two copies of full-length viral RNA, indicating that genome packaging is efficient and tightly regulated. However, the structural protein Gag is the only component required for the assembly of noninfectious virus-like particles and the viral RNA is dispensable...... in this process. The mechanism that allows HIV-1 to achieve such high efficiency of genome packaging when a packageable viral RNA is not required for virus assembly is currently unknown. In this report, we examined the role of HIV-1 RNA in virus assembly and found that packageable HIV-1 RNA enhances particle...... into each nascent virion. These studies shed light on the mechanism by which HIV-1 achieves efficient genome packaging during virus assembly.IMPORTANCE Retrovirus assembly is a well-choreographed event, during which many viral and cellular components come together to generate infectious virions. The viral...

  7. CID-miRNA: A web server for prediction of novel miRNA precursors in human genome

    International Nuclear Information System (INIS)

    Tyagi, Sonika; Vaz, Candida; Gupta, Vipin; Bhatia, Rohit; Maheshwari, Sachin; Srinivasan, Ashwin; Bhattacharya, Alok


    microRNAs (miRNA) are a class of non-protein coding functional RNAs that are thought to regulate expression of target genes by direct interaction with mRNAs. miRNAs have been identified through both experimental and computational methods in a variety of eukaryotic organisms. Though these approaches have been partially successful, there is a need to develop more tools for detection of these RNAs as they are also thought to be present in abundance in many genomes. In this report we describe a tool and a web server, named CID-miRNA, for identification of miRNA precursors in a given DNA sequence, utilising secondary structure-based filtering systems and an algorithm based on stochastic context free grammar trained on human miRNAs. CID-miRNA analyses a given sequence using a web interface, for presence of putative miRNA precursors and the generated output lists all the potential regions that can form miRNA-like structures. It can also scan large genomic sequences for the presence of potential miRNA precursors in its stand-alone form. The web server can be accessed at (

  8. In situ structures of the segmented genome and RNA polymerase complex inside a dsRNA virus (United States)

    Zhang, Xing; Ding, Ke; Yu, Xuekui; Chang, Winston; Sun, Jingchen; Hong Zhou, Z.


    Viruses in the Reoviridae, like the triple-shelled human rotavirus and the single-shelled insect cytoplasmic polyhedrosis virus (CPV), all package a genome of segmented double-stranded RNAs (dsRNAs) inside the viral capsid and carry out endogenous messenger RNA synthesis through a transcriptional enzyme complex (TEC). By direct electron-counting cryoelectron microscopy and asymmetric reconstruction, we have determined the organization of the dsRNA genome inside quiescent CPV (q-CPV) and the in situ atomic structures of TEC within CPV in both quiescent and transcribing (t-CPV) states. We show that the ten segmented dsRNAs in CPV are organized with ten TECs in a specific, non-symmetric manner, with each dsRNA segment attached directly to a TEC. The TEC consists of two extensively interacting subunits: an RNA-dependent RNA polymerase (RdRP) and an NTPase VP4. We find that the bracelet domain of RdRP undergoes marked conformational change when q-CPV is converted to t-CPV, leading to formation of the RNA template entry channel and access to the polymerase active site. An amino-terminal helix from each of two subunits of the capsid shell protein (CSP) interacts with VP4 and RdRP. These findings establish the link between sensing of environmental cues by the external proteins and activation of endogenous RNA transcription by the TEC inside the virus.

  9. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide


    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  10. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity. (United States)

    Monnet, Jordan; Kozelka, Jiří


    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Clonal origin of multiple lung cancers: K-ras and p53 mutations determined by nonradioisotopic single-strand conformation polymorphism analysis. (United States)

    Lau, D H; Yang, B; Hu, R; Benfield, J R


    Disease stage is the most important factor in determining prognosis and treatment of lung cancer. Staging of lung cancer is complicated by presentation of multiple pulmonary malignant lesions with a similar histology. It is a dilemma to decide if these lesions are synchronous primaries arising from different malignant clones or metastases from a single clone. Lung cancer is associated with multiple genetic abnormalities including mutations of K-ras and p53, which are believed to occur prior to onset of metastasis. To determine the clonal origin of multiple pulmonary malginant nodules, we analyzed point-mutations of K-ras and p53 by microdissection, polymerase chain reactions (PCR), nonradioisotopic single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. Each pulmonary lesion was microdissected from paraffin slides. Genomic DNA was amplified by two sequential PCRs followed by electrophoresis in a minigel and silver staining. Deoxyribonucleic acid sequencing was performed if necessary to confirm a mutation found upon SSCP analysis. Applying this molecular approach, we were able to differentiate the clonal origins of multiple malignant nodules of the lung as exemplified by the two cases presented.

  12. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris


    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA-binding pro......Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...... leads to enhanced cooperative binding to DNA.Conclusions: Our findings contribute to the emerging picture that bacterial proteins, exemplified here by SsbA, undergo phosphorylation at multiple residues. This results in a complex regulation of cellular functions, and suggests that the complexity...

  13. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD


    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  14. Development of an Interaction Assay between Single-Stranded Nucleic Acids Trapped with Silica Particles and Fluorescent Compounds

    Directory of Open Access Journals (Sweden)

    R. Maeda


    Full Text Available Biopolymers are easily denatured by heating, a change in pH or chemical substances when they are immobilized on a substrate. To prevent denaturation of biopolymers, we developed a method to trap a polynucleotide on a substrate by hydrogen bonding using silica particles with surfaces modified by aminoalkyl chains ([A-AM silane]/SiO2. [A-AM silane]/SiO2 was synthesized by silane coupling reaction of N-2-(aminoethyl-3-aminopropyltrimethoxysilane (A-AM silane with SiO2 particles with a diameter of 5 μm at 100 °C for 20 min. The surface chemical structure of [A-AM silane]/SiO2 was characterized by Fourier transform infrared spectroscopy and molecular orbital calculations. The surface of the silica particles was modified with A-AM silane and primary amine groups were formed. [A-AM silane]/SiO2 was trapped with single-stranded nucleic acids [(Poly-X; X = A (adenine, G (guanine and C (cytosine] in PBS solution at 37 °C for 1 h. The single-stranded nucleic acids were trapped on the surface of the [A-AM silane]/SiO2 by hydrogen bonding to form conjugated materials. The resulting complexes were further conjugated by derivatives of acridine orange (AO as fluorescent labels under the same conditions to form [AO:Poly-X:A-AM silane]/SiO2 complexes. Changes in the fluorescence intensity of these complexes originating from interactions between the single-stranded nucleic acid and aromatic compounds were also evaluated. The change in intensity displayed the order [AO: Poly-G: A-AM silane]/SiO2 > [AO:Poly-A:A-AM silane]/SiO2 >> [AO:Poly-C:A-AM silane]/SiO2. This suggests that the single-stranded nucleic acids conjugated with aminoalkyl chains on the surfaces of SiO2 particles and the change in fluorescence intensity reflected the molecular interaction between AO and the nucleic-acid base in a polynucleotide.

  15. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio


    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  16. Simultaneous identification of seven foodborne pathogens and Escherichia coli (pathogenic and nonpathogenic) using capillary electrophoresis-based single-strand conformation polymorphism coupled with multiplex PCR. (United States)

    Oh, Mi-Hwa; Paek, Se-Hee; Shin, Gi Won; Kim, Hae-Yeong; Jung, Gyoo Yeol; Oh, Sangsuk


    The objective of this study was to develop a novel technique for parallel analysis of eight important foodborne microbes using capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) coupled with multiplex PCR. Specific primers for multiplex PCR amplification of the 16S rRNA gene were designed, corresponding to eight species of bacteria, including Escherichia coli, Clostridium perfringens, Campylobacter jejuni, Salmonella enterica, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Bacillus cereus, for the species-specific identification and optimal separation of their PCR products in subsequent analysis by CE-SSCP. Multiplex PCR conditions including annealing temperature, extension time, the number of PCR cycles, and primer concentrations were then optimized for simultaneous detection of all target foodborne bacteria. The diagnostic system using CE-SSCP combined with multiplex PCR developed here can be used for rapid investigation of causative agents of foodborne illness. The simplicity and high sensitivity of the method may lead to improved management of safety and illness related to food.

  17. RNA Elements in Open Reading Frames of the Bluetongue Virus Genome Are Essential for Virus Replication

    NARCIS (Netherlands)

    Feenstra, F.; Gennip, van H.G.P.; Water, van de S.G.P.; Rijn, van P.A.


    Members of the Reoviridae family are non-enveloped multi-layered viruses with a double stranded RNA genome consisting of 9 to 12 genome segments. Bluetongue virus is the prototype orbivirus (family Reoviridae, genus Orbivirus), causing disease in ruminants, and is spread by Culicoides biting midges.

  18. Full-length RNA structure prediction of the HIV-1 genome reveals a conserved core domain

    DEFF Research Database (Denmark)

    Sükösd, Zsuzsanna; Andersen, Ebbe Sloth; Seemann, Ernst Stefan


    of the HIV-1 genome is highly variable in most regions, with a limited number of stable and conserved RNA secondary structures. Most interesting, a set of long distance interactions form a core organizing structure (COS) that organize the genome into three major structural domains. Despite overlapping...

  19. Functional genome-wide siRNA screen identifies KIAA0586 as mutated in Joubert syndrome

    NARCIS (Netherlands)

    Roosing, S.; Hofree, M.; Kim, S.; Scott, E.; Copeland, B.; Romani, M.; Silhavy, J.L.; Rosti, R.O.; Schroth, J.; Mazza, T.; Miccinilli, E.; Zaki, M.S.; Swoboda, K.J.; Milisa-Drautz, J.; Dobyns, W.B.; Mikati, M.A.; Incecik, F.; Azam, M.; Borgatti, R.; Romaniello, R.; Boustany, R.M.; Clericuzio, C.L.; D'Arrigo, S.; Stromme, P.; Boltshauser, E.; Stanzial, F.; Mirabelli-Badenier, M.; Moroni, I.; Bertini, E.; Emma, F.; Steinlin, M.; Hildebrandt, F.; Johnson, C.A.; Freilinger, M.; Vaux, K.K.; Gabriel, S.B.; Aza-Blanc, P.; Heynen-Genel, S.; Ideker, T.; Dynlacht, B.D.; Lee, J.E.; Valente, E.M.; Kim, J.; Gleeson, J.G.


    Defective primary ciliogenesis or cilium stability forms the basis of human ciliopathies, including Joubert syndrome (JS), with defective cerebellar vermis development. We performed a high-content genome-wide small interfering RNA (siRNA) screen to identify genes regulating ciliogenesis as

  20. Interactions Between HIV-1 Gag and Viral RNA Genome Enhance Virion Assembly

    DEFF Research Database (Denmark)

    Dilley, Kari A; Nikolaitchik, Olga A; Galli, Andrea


    Most HIV-1 virions contain two copies of full-length viral RNA, indicating that genome packaging is efficient and tightly regulated. However, the structural protein Gag is the only component required for the assembly of noninfectious virus-like particles and the viral RNA is dispensable in this p...

  1. HIV-1 genomic RNA diversification following sexual and parenteral virus transmission

    NARCIS (Netherlands)

    Wolfs, T. F.; Zwart, G.; Bakker, M.; Goudsmit, J.


    Human immunodeficiency virus type 1 (HIV-1) genomic RNA variation was studied in seven presumed donor-recipient pairs directly following sexual (6/7) or parenteral (1/7) transmission. The first RNA-positive serum sample of each recipient and the serum sample of the virus transmitter, identified by

  2. Unprecedented genomic diversity of RNA viruses in arthropods reveals the ancestry of negative-sense RNA viruses (United States)

    Li, Ci-Xiu; Shi, Mang; Tian, Jun-Hua; Lin, Xian-Dan; Kang, Yan-Jun; Chen, Liang-Jun; Qin, Xin-Cheng; Xu, Jianguo; Holmes, Edward C; Zhang, Yong-Zhen


    Although arthropods are important viral vectors, the biodiversity of arthropod viruses, as well as the role that arthropods have played in viral origins and evolution, is unclear. Through RNA sequencing of 70 arthropod species we discovered 112 novel viruses that appear to be ancestral to much of the documented genetic diversity of negative-sense RNA viruses, a number of which are also present as endogenous genomic copies. With this greatly enriched diversity we revealed that arthropods contain viruses that fall basal to major virus groups, including the vertebrate-specific arenaviruses, filoviruses, hantaviruses, influenza viruses, lyssaviruses, and paramyxoviruses. We similarly documented a remarkable diversity of genome structures in arthropod viruses, including a putative circular form, that sheds new light on the evolution of genome organization. Hence, arthropods are a major reservoir of viral genetic diversity and have likely been central to viral evolution. DOI: PMID:25633976

  3. Unprecedented genomic diversity of RNA viruses in arthropods reveals the ancestry of negative-sense RNA viruses. (United States)

    Li, Ci-Xiu; Shi, Mang; Tian, Jun-Hua; Lin, Xian-Dan; Kang, Yan-Jun; Chen, Liang-Jun; Qin, Xin-Cheng; Xu, Jianguo; Holmes, Edward C; Zhang, Yong-Zhen


    Although arthropods are important viral vectors, the biodiversity of arthropod viruses, as well as the role that arthropods have played in viral origins and evolution, is unclear. Through RNA sequencing of 70 arthropod species we discovered 112 novel viruses that appear to be ancestral to much of the documented genetic diversity of negative-sense RNA viruses, a number of which are also present as endogenous genomic copies. With this greatly enriched diversity we revealed that arthropods contain viruses that fall basal to major virus groups, including the vertebrate-specific arenaviruses, filoviruses, hantaviruses, influenza viruses, lyssaviruses, and paramyxoviruses. We similarly documented a remarkable diversity of genome structures in arthropod viruses, including a putative circular form, that sheds new light on the evolution of genome organization. Hence, arthropods are a major reservoir of viral genetic diversity and have likely been central to viral evolution.

  4. Spidey: a tool for mRNA-to-genomic alignments. (United States)

    Wheelan, S J; Church, D M; Ostell, J M


    We have developed a computer program that aligns spliced sequences to genomic sequences, using local alignment algorithms and heuristics to put together a global spliced alignment. Spidey can produce reliable alignments quickly, even when confronted with noise from alternative splicing, polymorphisms, sequencing errors, or evolutionary divergence. We show how Spidey was used to align reference sequences to known genomic sequences and then to the draft human genome, to align mRNAs to gene clusters, and to align mouse mRNAs to human genomic sequence. We compared Spidey to two other spliced alignment programs; Spidey generally performed quite well in a very reasonable amount of time.

  5. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine


    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA)...

  6. In vivo studies of genomic packaging in the dsRNA bacteriophage Φ8

    Directory of Open Access Journals (Sweden)

    Mindich Leonard


    Full Text Available Abstract Background Φ8 is a bacteriophage containing a genome of three segments of double-stranded RNA inside a polyhedral capsid enveloped in a lipid-containing membrane. Plus strand RNA binds and is packaged by empty procapsids. Whereas Φ6, another member of the Cystoviridae, shows high stringency, serial dependence and precision in its genomic packaging in vitro and in vivo, Φ8 packaging is more flexible. Unique sequences (pac near the 5' ends of plus strands are necessary and sufficient for Φ6 genomic packaging and the RNA binding sites are located on P1, the major structural protein of the procapsid. Results In this paper the boundaries of the Φ8 pac sequences have been explored by testing the in vivo packaging efficacy of transcripts containing deletions or changes in the RNA sequences. The pac sequences have been localized to the 5' untranslated regions of the viral transcripts. Major changes in the pac sequences are either tolerated or ameliorated by suppressor mutations in the RNA sequence. Changes in the genomic packaging program can be established as a result of mutations in P1, the major structural protein of the procapsid and the determinant of RNA binding specificity. Conclusion Although Φ8 is distantly related to bacteriophage Φ6, and does not show sequence similarity, it has a similar genomic packaging program. This program, however, is less stringent than that of Φ6.

  7. Characterization of the single-stranded DNA binding protein pV(VGJΦ) of VGJΦ phage from Vibrio cholerae. (United States)

    Falero, Alina; Caballero, Andy; Trigueros, Sonia; Pérez, Celso; Campos, Javier; Marrero, Karen; Fando, Rafael


    pV(VGJΦ), a single-stranded DNA binding protein of the vibriophage VGJΦ was subject to biochemical analysis. Here, we show that this protein has a general affinity for single-stranded DNA (ssDNA) as documented by Electrophoretic Mobility Shift Assay (EMSA). The apparent molecular weight of the monomer is about 12.7kDa as measured by HPLC-SEC. Moreover, isoelectrofocusing showed an isoelectric point for pV(VGJΦ) of 6.82 pH units. Size exclusion chromatography in 150mM NaCl, 50mM sodium phosphate buffer, pH 7.0 revealed a major protein species of 27.0kDa, suggesting homodimeric protein architecture. Furthermore, pV(VGJΦ) binds ssDNA at extreme temperatures and the complex was stable after extended incubation times. Upon frozen storage at -20°C for a year the protein retained its integrity, biological activity and oligomericity. On the other hand, bioinformatics analysis predicted that pV(VGJΦ) protein has a disordered C-terminal, which might be involved in its functional activity. All the aforementioned features make pV(VGJΦ) interesting for biotechnological applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles. (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng


    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  9. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.


    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  10. Structural basis of genomic RNA (gRNA) dimerization and packaging determinants of mouse mammary tumor virus (MMTV). (United States)

    Aktar, Suriya J; Vivet-Boudou, Valérie; Ali, Lizna M; Jabeen, Ayesha; Kalloush, Rawan M; Richer, Delphine; Mustafa, Farah; Marquet, Roland; Rizvi, Tahir A


    One of the hallmarks of retroviral life cycle is the efficient and specific packaging of two copies of retroviral gRNA in the form of a non-covalent RNA dimer by the assembling virions. It is becoming increasingly clear that the process of dimerization is closely linked with gRNA packaging, and in some retroviruses, the latter depends on the former. Earlier mutational analysis of the 5' end of the MMTV genome indicated that MMTV gRNA packaging determinants comprise sequences both within the 5' untranslated region (5' UTR) and the beginning of gag. The RNA secondary structure of MMTV gRNA packaging sequences was elucidated employing selective 2'hydroxyl acylation analyzed by primer extension (SHAPE). SHAPE analyses revealed the presence of a U5/Gag long-range interaction (U5/Gag LRI), not predicted by minimum free-energy structure predictions that potentially stabilizes the global structure of this region. Structure conservation along with base-pair covariations between different strains of MMTV further supported the SHAPE-validated model. The 5' region of the MMTV gRNA contains multiple palindromic (pal) sequences that could initiate intermolecular interaction during RNA dimerization. In vitro RNA dimerization, SHAPE analysis, and structure prediction approaches on a series of pal mutants revealed that MMTV RNA utilizes a palindromic point of contact to initiate intermolecular interactions between two gRNAs, leading to dimerization. This contact point resides within pal II (5' CGGCCG 3') at the 5' UTR and contains a canonical "GC" dyad and therefore likely constitutes the MMTV RNA dimerization initiation site (DIS). Further analyses of these pal mutants employing in vivo genetic approaches indicate that pal II, as well as pal sequences located in the primer binding site (PBS) are both required for efficient MMTV gRNA packaging. Employing structural prediction, biochemical, and genetic approaches, we show that pal II functions as a primary point of contact between

  11. Extraction of ribosomal RNA and genomic DNA from soil for studying the diversity of the indigenous bacterial community

    NARCIS (Netherlands)

    Duarte, G.F.; Rosado, A.S.; Keijzer-Wolters, A.C.; Elsas, van J.D.


    A method for the indirect (cell extraction followed by nucleic acid extraction) isolation of bacterial ribosomal RNA (rRNA) and genomic DNA from soil was developed. The protocol allowed for the rapid parallel extraction of genomic DNA as well as small and large ribosomal subunit RNA from four soils

  12. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)


    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  13. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee


    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  14. MotifMap-RNA: a genome-wide map of RBP binding sites. (United States)

    Liu, Yu; Sun, Sha; Bredy, Timothy; Wood, Marcelo; Spitale, Robert C; Baldi, Pierre


    RNA plays a critical role in gene expression and its regulation. RNA binding proteins (RBPs), in turn, are important regulators of RNA. Thanks to the availability of large scale data for RBP binding motifs and in vivo binding sites results in the form of eCLIP experiments, it is now possible to computationally predict RBP binding sites across the whole genome. We describe MotifMap-RNA, an extension of MotifMap which predicts binding sites for RBP motifs across human and mouse genomes and allows large scale querying of predicted binding sites. The data and corresponding web server are available from: as part of the MotifMap web portal. or Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail:

  15. Probing RNA-protein networks: biochemistry meets genomics. (United States)

    Campbell, Zachary T; Wickens, Marvin


    RNA-protein interactions are pervasive. The specificity of these interactions dictates which RNAs are controlled by what protein. Here we describe a class of revolutionary new methods that enable global views of RNA-binding specificity in vitro, for both single proteins and multiprotein complexes. These methods provide insight into central issues in RNA regulation in living cells, including understanding the balance between free and bound components, the basis for exclusion of binding sites, detection of binding events in the absence of discernible regulatory elements, and new approaches to targeting endogenous transcripts by design. Comparisons of in vitro and in vivo binding provide a foundation for comprehensive understanding of the biochemistry of protein-mediated RNA regulatory networks. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. In silico miRNA prediction in metazoan genomes: balancing between sensitivity and specificity

    Directory of Open Access Journals (Sweden)

    Fiers Mark WJE


    Full Text Available Abstract Background MicroRNAs (miRNAs, short ~21-nucleotide RNA molecules, play an important role in post-transcriptional regulation of gene expression. The number of known miRNA hairpins registered in the miRBase database is rapidly increasing, but recent reports suggest that many miRNAs with restricted temporal or tissue-specific expression remain undiscovered. Various strategies for in silico miRNA identification have been proposed to facilitate miRNA discovery. Notably support vector machine (SVM methods have recently gained popularity. However, a drawback of these methods is that they do not provide insight into the biological properties of miRNA sequences. Results We here propose a new strategy for miRNA hairpin prediction in which the likelihood that a genomic hairpin is a true miRNA hairpin is evaluated based on statistical distributions of observed biological variation of properties (descriptors of known miRNA hairpins. These distributions are transformed into a single and continuous outcome classifier called the L score. Using a dataset of known miRNA hairpins from the miRBase database and an exhaustive set of genomic hairpins identified in the genome of Caenorhabditis elegans, a subset of 18 most informative descriptors was selected after detailed analysis of correlation among and discriminative power of individual descriptors. We show that the majority of previously identified miRNA hairpins have high L scores, that the method outperforms miRNA prediction by threshold filtering and that it is more transparent than SVM classifiers. Conclusion The L score is applicable as a prediction classifier with high sensitivity for novel miRNA hairpins. The L-score approach can be used to rank and select interesting miRNA hairpin candidates for downstream experimental analysis when coupled to a genome-wide set of in silico-identified hairpins or to facilitate the analysis of large sets of putative miRNA hairpin loci obtained in deep

  17. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail:; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki


    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  18. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  19. RADX interacts with single-stranded DNA to promote replication fork stability

    DEFF Research Database (Denmark)

    Schubert, Lisa; Ho, Teresa; Hoffmann, Saskia


    has an essential genome maintenance role, protecting ssDNA regions from nucleolytic degradation and providing a recruitment platform for proteins involved in responses to replication stress and DNA damage. Here, we identify the uncharacterized protein RADX (CXorf57) as an ssDNA-binding factor in human...... cells. RADX binds ssDNA via an N-terminal OB fold cluster, which mediates its recruitment to sites of replication stress. Deregulation of RADX expression and ssDNA binding leads to enhanced replication fork stalling and degradation, and we provide evidence that a balanced interplay between RADX and RPA...

  20. Small RNA pathways and diversity in model legumes: lessons from genomics.

    Directory of Open Access Journals (Sweden)

    Pilar eBustos-Sanmamed


    Full Text Available Small non coding RNAs (smRNA participate in the regulation of development, cell differentiation, adaptation to environmental constraints and defense responses in plants. They negatively regulate gene expression by degrading specific mRNA targets, repressing their translation or modifying chromatin conformation through homologous interaction with target loci. MicroRNAs (miRNA and short-interfering RNAs (siRNA are generated from long double stranded RNA (dsRNA that are cleaved into 20- to 24-nucleotide dsRNAs by RNase III proteins called DICERs (DCL. One strand of the duplex is then loaded onto effective complexes containing different ARGONAUTE (AGO proteins. In this review, we explored smRNA diversity in model legumes and compiled available data from miRBAse, the miRNA database, and from 22 reports of smRNA deep sequencing or miRNA identification genome-wide in Medicago truncatula, Glycine max and Lotus japonicus. In addition to conserved miRNAs present in other plant species, 229, 179 and 35 novel miRNA families were identified respectively in these 3 legumes, among which several seems legume-specific. New potential functions of several miRNAs in the legume-specific nodulation process are discussed. Furthermore, a new category of siRNA, the phased siRNAs, which seems to mainly regulate disease-resistance genes, was recently discovered in legumes. Despite that the genome sequence of model legumes are not yet fully completed, further analysis was performed by database mining of gene families and protein characteristics of DCLs and AGOs in these genomes. Although most components of the smRNA pathways are conserved, identifiable homologs of key smRNA players from non-legumes could not yet be detected in M. truncatula available genomic and expressed sequence databases. In addition, an important gene diversification was observed in the three legumes. Functional significance of these variant isoforms may reflect peculiarities of smRNA biogenesis in

  1. Production and processing of siRNA precursor transcripts from the highly repetitive maize genome.

    Directory of Open Access Journals (Sweden)

    Christopher J Hale


    Full Text Available Mutations affecting the maintenance of heritable epigenetic states in maize identify multiple RNA-directed DNA methylation (RdDM factors including RMR1, a novel member of a plant-specific clade of Snf2-related proteins. Here we show that RMR1 is necessary for the accumulation of a majority of 24 nt small RNAs, including those derived from Long-Terminal Repeat (LTR retrotransposons, the most common repetitive feature in the maize genome. A genetic analysis of DNA transposon repression indicates that RMR1 acts upstream of the RNA-dependent RNA polymerase, RDR2 (MOP1. Surprisingly, we show that non-polyadenylated transcripts from a sampling of LTR retrotransposons are lost in both rmr1 and rdr2 mutants. In contrast, plants deficient for RNA Polymerase IV (Pol IV function show an increase in polyadenylated LTR RNA transcripts. These findings support a model in which Pol IV functions independently of the small RNA accumulation facilitated by RMR1 and RDR2 and support that a loss of Pol IV leads to RNA Polymerase II-based transcription. Additionally, the lack of changes in general genome homeostasis in rmr1 mutants, despite the global loss of 24 nt small RNAs, challenges the perceived roles of siRNAs in maintaining functional heterochromatin in the genomes of outcrossing grass species.

  2. Simple Genome Editing of Rodent Intact Embryos by Electroporation.

    Directory of Open Access Journals (Sweden)

    Takehito Kaneko

    Full Text Available The clustered regularly interspaced short palindromic repeat (CRISPR/CRISPR-associated (Cas system is a powerful tool for genome editing in animals. Recently, new technology has been developed to genetically modify animals without using highly skilled techniques, such as pronuclear microinjection of endonucleases. Technique for animal knockout system by electroporation (TAKE method is a simple and effective technology that produces knockout rats by introducing endonuclease mRNAs into intact embryos using electroporation. Using TAKE method and CRISPR/Cas system, the present study successfully produced knockout and knock-in mice and rats. The mice and rats derived from embryos electroporated with Cas9 mRNA, gRNA and single-stranded oligodeoxynucleotide (ssODN comprised the edited targeted gene as a knockout (67% of mice and 88% of rats or knock-in (both 33%. The TAKE method could be widely used as a powerful tool to produce genetically modified animals by genome editing.

  3. Mismatched single stranded antisense oligonucleotides can induce efficient dystrophin splice switching

    Directory of Open Access Journals (Sweden)

    Kole Ryszard


    Full Text Available Abstract Background Antisense oligomer induced exon skipping aims to reduce the severity of Duchenne muscular dystrophy by redirecting splicing during pre-RNA processing such that the causative mutation is by-passed and a shorter but partially functional Becker muscular dystrophy-like dystrophin isoform is produced. Normal exons are generally targeted to restore the dystrophin reading frame however, an appreciable subset of dystrophin mutations are intra-exonic and therefore have the potential to compromise oligomer efficiency, necessitating personalised oligomer design for some patients. Although antisense oligomers are easily personalised, it remains unclear whether all patient polymorphisms within antisense oligomer target sequences will require the costly process of producing and validating patient specific compounds. Methods Here we report preclinical testing of a panel of splice switching antisense oligomers, designed to excise exon 25 from the dystrophin transcript, in normal and dystrophic patient cells. These patient cells harbour a single base insertion in exon 25 that lies within the target sequence of an oligomer shown to be effective at removing exon 25. Results It was anticipated that such a mutation would compromise oligomer binding and efficiency. However, we show that, despite the mismatch an oligomer, designed and optimised to excise exon 25 from the normal dystrophin mRNA, removes the mutated exon 25 more efficiently than the mutation-specific oligomer. Conclusion This raises the possibility that mismatched AOs could still be therapeutically applicable in some cases, negating the necessity to produce patient-specific compounds.

  4. Analysis Of Transcriptomes In A Porcine Tissue Collection Using RNA-Seq And Genome Assembly 10

    DEFF Research Database (Denmark)

    Hornshøj, Henrik; Thomsen, Bo; Hedegaard, Jakob


    short read alignment software we mapped the reads to the genome assembly 10. We extracted contig sequences of gene transcripts using the Cufflinks software. Based on this information we identified expressed genes that are present in the genome assembly. The portion of these genes being previously known...... was roughly estimated by sequence comparison to known genes. Similarly, we searched for genes that are expressed in the tissues but not present in the genome assembly by aligning the non-genome-mapped reads to known gene transcripts. For the genes predicted to have alternative transcript variants by Cufflinks......The release of Sus scrofa genome assembly 10 supports improvement of the pig genome annotation and in depth transcriptome analyses using next-generation sequencing technologies. In this study we analyze RNA-seq reads from a tissue collection, including 10 separate tissues from Duroc boars and 10...

  5. Polycistronic tRNA and CRISPR guide-RNA enables highly efficient multiplexed genome engineering in human cells. (United States)

    Dong, Fengping; Xie, Kabin; Chen, Yueying; Yang, Yinong; Mao, Yingwei


    CRISPR/Cas9 has been widely used for genomic editing in many organisms. Many human diseases are caused by multiple mutations. The CRISPR/Cas9 system provides a potential tool to introduce multiple mutations in a genome. To mimic complicated genomic variants in human diseases, such as multiple gene deletions or mutations, two or more small guide RNAs (sgRNAs) need to be introduced all together. This can be achieved by separate Pol III promoters in a construct. However, limited enzyme sites and increased insertion size lower the efficiency to make a construct. Here, we report a strategy to quickly assembly multiple sgRNAs in one construct using a polycistronic-tRNA-gRNA (PTG) strategy. Taking advantage of the endogenous tRNA processing system in mammalian cells, we efficiently express multiple sgRNAs driven using only one Pol III promoter. Using an all-in-one construct carrying PTG, we disrupt the deacetylase domain in multiple histone deacetylases (HDACs) in human cells simultaneously. We demonstrate that multiple HDAC deletions significantly affect the activation of the Wnt-signaling pathway. Thus, this method enables to efficiently target multiple genes and provide a useful tool to establish mutated cells mimicking human diseases. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. New families of human regulatory RNA structures identified by comparative analysis of vertebrate genomes

    DEFF Research Database (Denmark)

    Parker, Brian John; Moltke, Ida; Roth, Adam


    a comparative method, EvoFam, for genome-wide identification of families of regulatory RNA structures, based on primary sequence and secondary structure similarity. We apply EvoFam to a 41-way genomic vertebrate alignment. Genome-wide, we identify 220 human, high-confidence families outside protein...... identify tens of new families supported by strong evolutionary evidence and other statistical evidence, such as GO term enrichments. For some of these, detailed analysis has led to the formulation of specific functional hypotheses. Examples include two hypothesized auto-regulatory feedback mechanisms: one...... involving six long hairpins in the 3'-UTR of MAT2A, a key metabolic gene that produces the primary human methyl donor S-adenosylmethionine; the other involving a tRNA-like structure in the intron of the tRNA maturation gene POP1. We experimentally validate the predicted MAT2A structures. Finally, we...

  7. Bioinformatical approaches to RNA structure prediction & Sequencing of an ancient human genome

    DEFF Research Database (Denmark)

    Lindgreen, Stinus

    tools that exist. The second part has been focused on the mapping and genotyping of ancient genomic DNA. The development of next generation sequencing technologies combined with the use of ancient DNA material present the researchers with some special challenges in the analyses. This work resulted...... in the publication of the first genome of an ancient human individual, where close to the theoretical maximum of the genome sequence was recovered with high confidence. Part of the project was the development of the program SNPest for genotyping and SNP calling that models various sources of error and predicts...... in families of related RNA sequences. Also, the program MASTR was developed to perform simultaneous alignment of multiple RNA sequences and prediction of a common secondary structure. The webserver WAR was developed to make it easy for non-computer savy researchers to use the many RNA structure prediction...

  8. On the importance of the primer activation signal for initiation of tRNA(lys3)-primed reverse transcription of the HIV-1 RNA genome

    NARCIS (Netherlands)

    Huthoff, Hendrik; Bugala, Katarzyna; Barciszewski, Jan; Berkhout, Ben


    Initiation of reverse transcription is a complex and regulated process in all retroviruses. Several base pairing interactions have been proposed to occur between the HIV-1 RNA genome and the specific tRNA(lys3) primer. The tRNA primer can form up to 21 bp with the primer binding site (PBS), and an

  9. Integration of maternal genome into the neonate genome through breast milk mRNA transcripts and reverse transcriptase

    Directory of Open Access Journals (Sweden)

    Irmak M


    Full Text Available Abstract Human milk samples contain microvesicles similar to the retroviruses. These microvesicles contain mRNA transcripts and possess reverse transcriptase activity. They contain about 14,000 transcripts representing the milk transcriptome. Microvesicles are also enriched with proteins related to “caveolar-mediated endocytosis signaling” pathway. It has recently been reported that microvesicles could be transferred to other cells by endocytosis and their RNA content can be translated and be functional in their new location. A significant percentage of the mammalian genome appears to be the product of reverse transcription, containing sequences whose characteristics point to RNA as a template precursor. These are mobile elements that move by way of transposition and are called retrotransposons. We thought that retrotransposons may stem from about 14,000 transcriptome of breast milk microvesicles, and reviewed the literature. The enhanced acceptance of maternal allografts in children who were breast-fed and tolerance to the maternal MHC antigens after breastfeeding may stem from RNAs of the breast milk microvesicles that can be taken up by the breastfed infant and receiving maternal genomic information. We conclude that milk microvesicles may transfer genetic signals from mother to neonate during breastfeeding. Moreover, transfer of wild type RNA from a healthy wet-nurse to the suckling neonate through the milk microvesicles and its subsequent reverse transcription and integration into the neonate genome could result in permanent correction of the clinical manifestations in genetic diseases.

  10. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Vrushali S. [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Gokhale, Suresh P.; Patil, Kashinath R. [Physical and Material Chemistry Division, National Chemical Laboratory, Pune (India); Haram, Santosh K., E-mail: haram@chem.unipune.ernet.i [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)


    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 +- 2 mum and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, alpha-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k{sup 0}) and electron transfer coefficient (alpha) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  11. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    International Nuclear Information System (INIS)

    Joshi, Vrushali S.; Gokhale, Suresh P.; Patil, Kashinath R.; Haram, Santosh K.


    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 ± 2 μm and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, α-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k 0 ) and electron transfer coefficient (α) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  12. Quenching of Single-Walled Carbon Nanotube Fluorescence by Dissolved Oxygen Reveals Selective Single-Stranded DNA Affinities. (United States)

    Zheng, Yu; Bachilo, Sergei M; Weisman, R Bruce


    The selective interactions between short oligomers of single-stranded DNA (ssDNA) and specific structures of single-walled carbon nanotubes have been exploited in powerful methods for nanotube sorting. We report here that nanotubes coated with ssDNA also display selective interactions through the selective quenching of nanotube fluorescence by dissolved oxygen. In aqueous solutions equilibrated under 1 atm of O 2 , emission intensity from semiconducting nanotubes is reduced by between 9 and 40%, varying with the combination of ssDNA sequence and nanotube structure. This quenching reverses promptly and completely on the removal of dissolved O 2 and may be due to physisorption on nanotube surfaces. Fluorescence quenching offers a simple, nondestructive approach for studying the structure-selective interactions of ssDNA with single-walled carbon nanotubes and identifying recognition sequences.

  13. Surface treatment on amorphous InGaZnO4 thin film for single-stranded DNA biosensing (United States)

    Sun, Dali; Matsui, Hiroaki; Wu, Chun-Nan; Tabata, Hitoshi


    Amorphous InGaZnO4 (aIGZO) has been widely used as a transparent semiconductor. However, no research has been found yet applying aIGZO to biosensing. This paper examined the single strand DNA (ssDNA) immobilization on aIGZO by absorption with a comparison to ITO, which is the first step for many biosensing schemas. The DNA quantification by florescence intensity shows that the absorption capacity of aIGZO film to ssDNA is 6.7 times greater than that of ITO. XPS and contact angle analysis proved the high DNA absorption affinity on aIGZO film is related to its high effectiveness to OH- attachment. A feasible method to immobilized ssDNA on aIGZO thin film is evaluated in this paper, and consequently, enables a possible approach to apply aIGZO in biosensing.

  14. [Determination of genomic and replicative RNA of hepatitis C virus in patients treated with interferon]. (United States)

    Zeilicoff, R; Ameigeiras, B; Ojeda, E; Isla Rodríguez, R; Grünbaum, S; Genero, M; Cappelletti, C; Tielli, G; Roatta, R; Koch, O


    We have investigated the presence of genomic and replicative RNA strands of hepatitis C virus in liver and serum. Eleven patients with proven chronic hepatitis C, received Interferon a2a 4,5 MU, three times a week during six months. RT-PCR was used with sense primer to detect the replicative strand and an antisense primer to identify genomic strand. Before treatment, genomic strands were present in liver and serum of all patients. Replicative strands were present in liver and serum in five and six cases, respectively. Seven out of eleven responded to treatment. In responders, genomic strands were absent in liver of 3 cases (43%) and replicative strands in liver of 4 (57%). In plasma genomic and replicative strands were absent in 5 (71%) and 7 (100%), respectively. In all non responders, genomic strands in liver and plasma remained present. Replicative strands in liver and plasma were present in 100% and 25%, respectively. Knodell score improved in 5 out of 7 responders and remained unchanged in 3 out of 4 non responders. In 2 out of 4 responders with genomic and replicative strands in liver, Knodell score remained unchanged or worse. In all non responders, genomic and replicative strands in liver were present and Knodell score remained unchanged or worse. Genomic and replicative strands in plasma tended to be negative after treatment in responders. Genomic strands in plasma remained present in non responders. Conversely, genomic and replicative strands in liver were present in all non responders. It seems to exist a relationship between genomic and replicative strands in liver and the same or worse Knodell score. After a follow up, it will be possible to determined whether responders who still present viral RNA in liver would be prone to a relapse.

  15. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana. (United States)

    Olszewski, Marcin; Grot, Anna; Wojciechowski, Marek; Nowak, Marta; Mickiewicz, Małgorzata; Kur, Józef


    In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. We report the characterization of single-stranded DNA binding proteins (SSBs) from the thermophilic bacteria Thermotoga maritima (TmaSSB) and Thermotoga neapolitana (TneSSB). They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively). They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold) in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC) the melting temperature (Tm) was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR).

  16. Charge enhancement of single-stranded DNA in negative electrospray ionization using the supercharging reagent meta-nitrobenzyl alcohol. (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B; Tabet, Jean-Claude


    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1% m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1% m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  17. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude


    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  18. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata


    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  19. Aptamer based voltammetric determination of ampicillin using a single-stranded DNA binding protein and DNA functionalized gold nanoparticles. (United States)

    Wang, Jun; Ma, Kui; Yin, Huanshun; Zhou, Yunlei; Ai, Shiyun


    An aptamer based method is described for the electrochemical determination of ampicillin. It is based on the use of DNA aptamer, DNA functionalized gold nanoparticles (DNA-AuNPs), and single-stranded DNA binding protein (ssDNA-BP). When the aptamer hybridizes with the target DNA on the AuNPs, the ssDNA-BP is captured on the electrode surface via its specific interaction with ss-DNA. This results in a decreased electrochemical signal of the redox probe Fe(CN) 6 3- which is measured best at a voltage of 0.188 mV (vs. reference electrode). In the presence of ampicillin, the formation of aptamer-ampicillin conjugate blocks the further immobilization of DNA-AuNPs and ssDNA-BP, and this leads to an increased response. The method has a linear reposne that convers the 1 pM to 5 nM ampicillin concentration range, with a 0.38 pM detection limit (at an S/N ratio of 3). The assay is selective, stable and reproducible. It was applied to the determination of ampicillin in spiked milk samples where it gave recoveries ranging from 95.5 to 105.5%. Graphical abstract Schematic of a simple and sensitive electrochemical apta-biosensor for ampicillin detection. It is based on the use of gold nanoparticles (AuNPs), DNA aptamer, DNA functionalized AuNPs (DNA-AuNPs), and single-strand DNA binding protein (SSBP).

  20. Cas9/sgRNA-based genome editing and other reverse genetic approaches for functional genomic studies in rice. (United States)

    Moin, Mazahar; Bakshi, Achala; Madhav, M S; Kirti, P B


    One of the important and direct ways of investigating the function of a gene is to characterize the phenotypic consequences associated with loss or gain-of-function of the corresponding gene. These mutagenesis strategies have been successfully deployed in Arabidopsis, and subsequently extended to crop species including rice. Researchers have made vast advancements in the area of rice genomics and functional genomics, as it is a diploid plant with a relatively smaller genome size unlike other cereals. The advent of rice genome research and the annotation of high-quality genome sequencing along with the developments in databases and computer searches have enabled the functional characterization of unknown genes in rice. Further, with the improvements in the efficiency of regeneration and transformation protocols, it has now become feasible to produce sizable mutant populations in indica rice varieties also. In this review, various mutagenesis methods, the current status of the mutant resources, limitations and strengths of insertional mutagenesis approaches and also results obtained with suitable screens for stress tolerance in rice are discussed. In addition, targeted genome editing using clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) or Cas9/single-guide RNA system and its potential applications in generating transgene-free rice plants through genome engineering as an efficient alternative to classical transgenic technology are also discussed.

  1. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes

    Czech Academy of Sciences Publication Activity Database

    Pietilä, M.K.; Roine, E.; Sencilo, Ana; Bamford, D.H.; Oksanen, H.M.


    Roč. 161, č. 1 (2016), s. 249-256 ISSN 0304-8608 R&D Projects: GA ČR(CZ) GAP302/11/ 1940 Institutional support: RVO:61388971 Keywords : VIRION ARCHITECTURE * HALOVIRUSES * SPINDLE Subject RIV: EE - Microbiology, Virology Impact factor: 2.058, year: 2016

  2. HIV-1 can escape from RNA interference by evolving an alternative structure in its RNA genome

    NARCIS (Netherlands)

    Westerhout, Ellen M.; Ooms, Marcel; Vink, Monique; Das, Atze T.; Berkhout, Ben


    HIV-1 replication can be efficiently inhibited by intracellular expression of an siRNA targeting the viral RNA. However, HIV-1 escape variants emerged after prolonged culturing. These RNAi-resistant viruses contain nucleotide substitutions or deletions in or near the targeted sequence. We observed

  3. Widespread horizontal gene transfer from double-stranded RNA viruses to eukaryotic nuclear genomes. (United States)

    Liu, Huiquan; Fu, Yanping; Jiang, Daohong; Li, Guoqing; Xie, Jiatao; Cheng, Jiasen; Peng, Youliang; Ghabrial, Said A; Yi, Xianhong


    Horizontal gene transfer commonly occurs from cells to viruses but rarely occurs from viruses to their host cells, with the exception of retroviruses and some DNA viruses. However, extensive sequence similarity searches in public genome databases for various organisms showed that the capsid protein and RNA-dependent RNA polymerase genes from totiviruses and partitiviruses have widespread homologs in the nuclear genomes of eukaryotic organisms, including plants, arthropods, fungi, nematodes, and protozoa. PCR amplification and sequencing as well as comparative evidence of junction coverage between virus and host sequences support the conclusion that these viral homologs are real and occur in eukaryotic genomes. Sequence comparison and phylogenetic analysis suggest that these genes were likely transferred horizontally from viruses to eukaryotic genomes. Furthermore, we present evidence showing that some of the transferred genes are conserved and expressed in eukaryotic organisms and suggesting that these viral genes are also functional in the recipient genomes. Our findings imply that horizontal transfer of double-stranded RNA viral genes is widespread among eukaryotes and may give rise to functionally important new genes, thus entailing that RNA viruses may play significant roles in the evolution of eukaryotes.

  4. Changes in the composition of the RNA virome mark evolutionary transitions in green plants. (United States)

    Mushegian, Arcady; Shipunov, Alexey; Elena, Santiago F


    The known plant viruses mostly infect angiosperm hosts and have RNA or small DNA genomes. The only other lineage of green plants with a relatively well-studied virome, unicellular chlorophyte algae, is mostly infected by viruses with large DNA genomes. Thus RNA viruses and small DNA viruses seem to completely displace large DNA virus genomes in late branching angiosperms. To understand better the expansion of RNA viruses in the taxonomic span between algae and angiosperms, we analyzed the transcriptomes of 66 non-angiosperm plants characterized by the 1000 Plants Genomes Project. We found homologs of virus RNA-dependent RNA polymerases in 28 non-angiosperm plant species, including algae, mosses, liverworts (Marchantiophyta), hornworts (Anthocerotophyta), lycophytes, a horsetail Equisetum, and gymnosperms. Polymerase genes in algae were most closely related to homologs from double-stranded RNA viruses leading latent or persistent lifestyles. Land plants, in addition, contained polymerases close to the homologs from single-stranded RNA viruses of angiosperms, capable of productive infection and systemic spread. For several polymerases, a cognate capsid protein was found in the same library. Another virus hallmark gene family, encoding the 30 K movement proteins, was found in lycophytes and monilophytes but not in mosses or algae. The broadened repertoire of RNA viruses suggests that colonization of land and growth in anatomical complexity in land plants coincided with the acquisition of novel sets of viruses with different strategies of infection and reproduction.

  5. Prevalent RNA recognition motif duplication in the human genome. (United States)

    Tsai, Yihsuan S; Gomez, Shawn M; Wang, Zefeng


    The sequence-specific recognition of RNA by proteins is mediated through various RNA binding domains, with the RNA recognition motif (RRM) being the most frequent and present in >50% of RNA-binding proteins (RBPs). Many RBPs contain multiple RRMs, and it is unclear how each RRM contributes to the binding specificity of the entire protein. We found that RRMs within the same RBP (i.e., sibling RRMs) tend to have significantly higher similarity than expected by chance. Sibling RRM pairs from RBPs shared by multiple species tend to have lower similarity than those found only in a single species, suggesting that multiple RRMs within the same protein might arise from domain duplication followed by divergence through random mutations. This finding is exemplified by a recent RRM domain duplication in DAZ proteins and an ancient duplication in PABP proteins. Additionally, we found that different similarities between sibling RRMs are associated with distinct functions of an RBP and that the RBPs tend to contain repetitive sequences with low complexity. Taken together, this study suggests that the number of RBPs with multiple RRMs has expanded in mammals and that the multiple sibling RRMs may recognize similar target motifs in a cooperative manner.

  6. Determinants of Genomic RNA Encapsidation in the Saccharomyces cerevisiae Long Terminal Repeat Retrotransposons Ty1 and Ty3

    Directory of Open Access Journals (Sweden)

    Katarzyna Pachulska-Wieczorek


    Full Text Available Long-terminal repeat (LTR retrotransposons are transposable genetic elements that replicate intracellularly, and can be considered progenitors of retroviruses. Ty1 and Ty3 are the most extensively characterized LTR retrotransposons whose RNA genomes provide the template for both protein translation and genomic RNA that is packaged into virus-like particles (VLPs and reverse transcribed. Genomic RNAs are not divided into separate pools of translated and packaged RNAs, therefore their trafficking and packaging into VLPs requires an equilibrium between competing events. In this review, we focus on Ty1 and Ty3 genomic RNA trafficking and packaging as essential steps of retrotransposon propagation. We summarize the existing knowledge on genomic RNA sequences and structures essential to these processes, the role of Gag proteins in repression of genomic RNA translation, delivery to VLP assembly sites, and encapsidation.

  7. Mechanism for Coordinated RNA Packaging and Genome Replication by Rotavirus Polymerase VP1

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Xiaohui; McDonald, Sarah M.; Tortorici, M. Alejandra; Tao, Yizhi Jane; Vasquez-Del Carpio, Rodrigo; Nibert, Max L.; Patton, John T.; Harrison, Stephen C. (Harvard-Med); (NIH); (CH-Boston)


    Rotavirus RNA-dependent RNA polymerase VP1 catalyzes RNA synthesis within a subviral particle. This activity depends on core shell protein VP2. A conserved sequence at the 3' end of plus-strand RNA templates is important for polymerase association and genome replication. We have determined the structure of VP1 at 2.9 {angstrom} resolution, as apoenzyme and in complex with RNA. The cage-like enzyme is similar to reovirus {lambda}3, with four tunnels leading to or from a central, catalytic cavity. A distinguishing characteristic of VP1 is specific recognition, by conserved features of the template-entry channel, of four bases, UGUG, in the conserved 3' sequence. Well-defined interactions with these bases position the RNA so that its 3' end overshoots the initiating register, producing a stable but catalytically inactive complex. We propose that specific 3' end recognition selects rotavirus RNA for packaging and that VP2 activates the autoinhibited VP1/RNA complex to coordinate packaging and genome replication.

  8. Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody: a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody. (United States)

    Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua


    Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.

  9. DHX9 suppresses RNA processing defects originating from the Alu invasion of the human genome. (United States)

    Aktaş, Tuğçe; Avşar Ilık, İbrahim; Maticzka, Daniel; Bhardwaj, Vivek; Pessoa Rodrigues, Cecilia; Mittler, Gerhard; Manke, Thomas; Backofen, Rolf; Akhtar, Asifa


    Transposable elements are viewed as 'selfish genetic elements', yet they contribute to gene regulation and genome evolution in diverse ways. More than half of the human genome consists of transposable elements. Alu elements belong to the short interspersed nuclear element (SINE) family of repetitive elements, and with over 1 million insertions they make up more than 10% of the human genome. Despite their abundance and the potential evolutionary advantages they confer, Alu elements can be mutagenic to the host as they can act as splice acceptors, inhibit translation of mRNAs and cause genomic instability. Alu elements are the main targets of the RNA-editing enzyme ADAR and the formation of Alu exons is suppressed by the nuclear ribonucleoprotein HNRNPC, but the broad effect of massive secondary structures formed by inverted-repeat Alu elements on RNA processing in the nucleus remains unknown. Here we show that DHX9, an abundant nuclear RNA helicase, binds specifically to inverted-repeat Alu elements that are transcribed as parts of genes. Loss of DHX9 leads to an increase in the number of circular-RNA-producing genes and amount of circular RNAs, translational repression of reporters containing inverted-repeat Alu elements, and transcriptional rewiring (the creation of mostly nonsensical novel connections between exons) of susceptible loci. Biochemical purifications of DHX9 identify the interferon-inducible isoform of ADAR (p150), but not the constitutively expressed ADAR isoform (p110), as an RNA-independent interaction partner. Co-depletion of ADAR and DHX9 augments the double-stranded RNA accumulation defects, leading to increased circular RNA production, revealing a functional link between these two enzymes. Our work uncovers an evolutionarily conserved function of DHX9. We propose that it acts as a nuclear RNA resolvase that neutralizes the immediate threat posed by transposon insertions and allows these elements to evolve as tools for the post

  10. Organization of the Flavivirus RNA replicase complex. (United States)

    Brand, Carolin; Bisaillon, Martin; Geiss, Brian J


    Flaviviruses, such as dengue, Japanese encephalitis, West Nile, yellow fever, and Zika viruses, are serious human pathogens that cause significant morbidity and mortality globally each year. Flaviviruses are single-stranded, positive-sense RNA viruses, and encode two multidomain proteins, NS3 and NS5, that possess all enzymatic activities required for genome replication and capping. NS3 and NS5 interact within virus-induced replication compartments to form the RNA genome replicase complex. Although the individual enzymatic activities of both proteins have been extensively studied and are well characterized, there are still gaps in our understanding of how they interact to efficiently coordinate their respective activities during positive-strand RNA synthesis and capping. Here, we discuss what is known about the structures and functions of the NS3 and NS5 proteins and propose a preliminary NS3:NS5:RNA interaction model based on a large body of literature about how the viral enzymes function, physical restraints between NS3 and NS5, as well as critical steps in the replication process. WIREs RNA 2017, 8:e1437. doi: 10.1002/wrna.1437 For further resources related to this article, please visit the WIREs website. © 2017 Wiley Periodicals, Inc.

  11. Therapeutic Effect of Novel Single-Stranded RNAi Agent Targeting Periostin in Eyes with Retinal Neovascularization

    Directory of Open Access Journals (Sweden)

    Takahito Nakama


    Full Text Available Retinal neovascularization (NV due to retinal ischemia remains one of the principal causes of vision impairment in patients with ischemic retinal diseases. We recently reported that periostin (POSTN may play a role in the development of preretinal fibrovascular membranes, but its role in retinal NV has not been determined. The purpose of this study was to examine the expression of POSTN in the ischemic retinas of a mouse model of oxygen-induced retinal NV. We also studied the function of POSTN on retinal NV using Postn KO mice and human retinal endothelial cells (HRECs in culture. In addition, we used a novel RNAi agent, NK0144, which targets POSTN to determine its effect on the development of retinal NV. Our results showed that the expression of POSTN was increased in the vascular endothelial cells, pericytes, and M2 macrophages in ischemic retinas. POSTN promoted the ischemia-induced retinal NV by Akt phosphorylation through integrin αvβ3. NK0144 had a greater inhibitory effect than canonical double-stranded siRNA on preretinal pathological NV in vivo and in vitro. These findings suggest a causal relationship between POSTN and retinal NV, and indicate a potential therapeutic role of intravitreal injection of NK0144 for retinal neovascular diseases.

  12. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian


    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  13. New variants of CRISPR RNA-guided genome editing enzymes. (United States)

    Murovec, Jana; Pirc, Žan; Yang, Bing


    CRISPR-mediated genome editing using the Streptococcus pyogenes Cas9 enzyme is revolutionizing life science by providing new, precise, facile and high-throughput tools for genetic modification by the specific targeting of double-strand breaks in the genome of hosts. Plant biotechnologists have extensively used the S. pyogenes Cas9-based system since its inception in 2013. However, there are still some limitations to its even broader usage in plants. Major restrictions, especially in agricultural biotechnology, are the currently unclear regulatory status of plants modified with CRISPR/Cas9 and the lack of suitable delivery methods for some plant species. Solutions to these limitations could come in the form of new variants of genome editing enzymes that have recently been discovered and have already proved comparable to or even better in performance than S. pyogenes CRISPR/Cas9 in terms of precision and ease of delivery in mammal cells. Although some of them have already been tested in plants, most of them are less well known in the plant science community. In this review, we describe the following new enzyme systems engineered for genome editing, transcriptional regulation and cellular imaging-C2c2 from L. shahii; Cas9 from F. novicida, S. aureus, S. thermophiles, N. meningitidis; Cpf1 from F. novicida, Acidaminococcus and Lachnospiraceae; nickase, split, enhanced and other Cas9 variants from S. pyogenes; catalytically inactive SpCas9 linked to various nuclease or gene-regulating domains-with an emphasis on their advantages in comparison with the broadly used SpCas9. In addition, we discuss new possibilities they offer in plant biotechnology. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  14. Therapeutic applications of CRISPR RNA-guided genome editing. (United States)

    Koo, Taeyoung; Kim, Jin-Soo


    The rapid development of programmable nuclease-based genome editing technologies has enabled targeted gene disruption and correction both in vitro and in vivo This revolution opens up the possibility of precise genome editing at target genomic sites to modulate gene function in animals and plants. Among several programmable nucleases, the type II clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated nuclease 9 (Cas9) system has progressed remarkably in recent years, leading to its widespread use in research, medicine and biotechnology. In particular, CRISPR-Cas9 shows highly efficient gene editing activity for therapeutic purposes in systems ranging from patient stem cells to animal models. However, the development of therapeutic approaches and delivery methods remains a great challenge for biomedical applications. Herein, we review therapeutic applications that use the CRISPR-Cas9 system and discuss the possibilities and challenges ahead. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please email:

  15. siRNA Genome Screening Approaches to Therapeutic Drug Repositioning


    Ralph A. Tripp; S. Mark Tompkins; Olivia Perwitasari; Abhijeet Bakre


    Bridging high-throughput screening (HTS) with RNA interference (RNAi) has allowed for rapid discovery of the molecular basis of many diseases, and identification of potential pathways for developing safe and effective treatments. These features have identified new host gene targets for existing drugs paving the pathway for therapeutic drug repositioning. Using RNAi to discover and help validate new drug targets has also provided a means to filter and prioritize promising therapeutics. This re...

  16. Functional genomic analysis of human mitochondrial RNA processing. (United States)

    Wolf, Ashley R; Mootha, Vamsi K


    Both strands of human mtDNA are transcribed in continuous, multigenic units that are cleaved into the mature rRNAs, tRNAs, and mRNAs required for respiratory chain biogenesis. We sought to systematically identify nuclear-encoded proteins that contribute to processing of mtRNAs within the organelle. First, we devised and validated a multiplex MitoString assay that quantitates 27 mature and precursor mtDNA transcripts. Second, we applied MitoString profiling to evaluate the impact of silencing each of 107 mitochondrial-localized, predicted RNA-binding proteins. With the resulting data set, we rediscovered the roles of recently identified RNA-processing enzymes, detected unanticipated roles of known disease genes in RNA processing, and identified new regulatory factors. We demonstrate that one such factor, FASTKD4, modulates the half-lives of a subset of mt-mRNAs and associates with mtRNAs in vivo. MitoString profiling may be useful for diagnosing and deciphering the pathogenesis of mtDNA disorders. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Functional Genomic Analysis of Human Mitochondrial RNA Processing

    Directory of Open Access Journals (Sweden)

    Ashley R. Wolf


    Full Text Available Both strands of human mtDNA are transcribed in continuous, multigenic units that are cleaved into the mature rRNAs, tRNAs, and mRNAs required for respiratory chain biogenesis. We sought to systematically identify nuclear-encoded proteins that contribute to processing of mtRNAs within the organelle. First, we devised and validated a multiplex MitoString assay that quantitates 27 mature and precursor mtDNA transcripts. Second, we applied MitoString profiling to evaluate the impact of silencing each of 107 mitochondrial-localized, predicted RNA-binding proteins. With the resulting data set, we rediscovered the roles of recently identified RNA-processing enzymes, detected unanticipated roles of known disease genes in RNA processing, and identified new regulatory factors. We demonstrate that one such factor, FASTKD4, modulates the half-lives of a subset of mt-mRNAs and associates with mtRNAs in vivo. MitoString profiling may be useful for diagnosing and deciphering the pathogenesis of mtDNA disorders.

  18. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.). (United States)

    Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W


    Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation

  19. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela


    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  20. Summarizing performance for genome scale measurement of miRNA: reference samples and metrics. (United States)

    Pine, P Scott; Lund, Steven P; Parsons, Jerod R; Vang, Lindsay K; Mahabal, Ashish A; Cinquini, Luca; Kelly, Sean C; Kincaid, Heather; Crichton, Daniel J; Spira, Avrum; Liu, Gang; Gower, Adam C; Pass, Harvey I; Goparaju, Chandra; Dubinett, Steven M; Krysan, Kostyantyn; Stass, Sanford A; Kukuruga, Debra; Van Keuren-Jensen, Kendall; Courtright-Lim, Amanda; Thompson, Karol L; Rosenzweig, Barry A; Sorbara, Lynn; Srivastava, Sudhir; Salit, Marc L


    The potential utility of microRNA as biomarkers for early detection of cancer and other diseases is being investigated with genome-scale profiling of differentially expressed microRNA. Processes for measurement assurance are critical components of genome-scale measurements. Here, we evaluated the utility of a set of total RNA samples, designed with between-sample differences in the relative abundance of miRNAs, as process controls. Three pure total human RNA samples (brain, liver, and placenta) and two different mixtures of these components were evaluated as measurement assurance control samples on multiple measurement systems at multiple sites and over multiple rounds. In silico modeling of mixtures provided benchmark values for comparison with physical mixtures. Biomarker development laboratories using next-generation sequencing (NGS) or genome-scale hybridization assays participated in the study and returned data from the samples using their routine workflows. Multiplexed and single assay reverse-transcription PCR (RT-PCR) was used to confirm in silico predicted sample differences. Data visualizations and summary metrics for genome-scale miRNA profiling assessment were developed using this dataset, and a range of performance was observed. These metrics have been incorporated into an online data analysis pipeline and provide a convenient dashboard view of results from experiments following the described design. The website also serves as a repository for the accumulation of performance values providing new participants in the project an opportunity to learn what may be achievable with similar measurement processes. The set of reference samples used in this study provides benchmark values suitable for assessing genome-scale miRNA profiling processes. Incorporation of these metrics into an online resource allows laboratories to periodically evaluate their performance and assess any changes introduced into their measurement process.

  1. Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado (United States)

    Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.


    A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV). PMID:22205720

  2. Integration of Multiple Genomic and Phenotype Data to Infer Novel miRNA-Disease Associations. (United States)

    Shi, Hongbo; Zhang, Guangde; Zhou, Meng; Cheng, Liang; Yang, Haixiu; Wang, Jing; Sun, Jie; Wang, Zhenzhen


    MicroRNAs (miRNAs) play an important role in the development and progression of human diseases. The identification of disease-associated miRNAs will be helpful for understanding the molecular mechanisms of diseases at the post-transcriptional level. Based on different types of genomic data sources, computational methods for miRNA-disease association prediction have been proposed. However, individual source of genomic data tends to be incomplete and noisy; therefore, the integration of various types of genomic data for inferring reliable miRNA-disease associations is urgently needed. In this study, we present a computational framework, CHNmiRD, for identifying miRNA-disease associations by integrating multiple genomic and phenotype data, including protein-protein interaction data, gene ontology data, experimentally verified miRNA-target relationships, disease phenotype information and known miRNA-disease connections. The performance of CHNmiRD was evaluated by experimentally verified miRNA-disease associations, which achieved an area under the ROC curve (AUC) of 0.834 for 5-fold cross-validation. In particular, CHNmiRD displayed excellent performance for diseases without any known related miRNAs. The results of case studies for three human diseases (glioblastoma, myocardial infarction and type 1 diabetes) showed that all of the top 10 ranked miRNAs having no known associations with these three diseases in existing miRNA-disease databases were directly or indirectly confirmed by our latest literature mining. All these results demonstrated the reliability and efficiency of CHNmiRD, and it is anticipated that CHNmiRD will serve as a powerful bioinformatics method for mining novel disease-related miRNAs and providing a new perspective into molecular mechanisms underlying human diseases at the post-transcriptional level. CHNmiRD is freely available at

  3. Efficient Multiple Genome Modifications Induced by the crRNAs, tracrRNA and Cas9 Protein Complex in Zebrafish (United States)

    Ohga, Rie; Ota, Satoshi; Kawahara, Atsuo


    The type II clustered regularly interspaced short palindromic repeats (CRISPR) associated with Cas9 endonuclease (CRISPR/Cas9) has become a powerful genetic tool for understanding the function of a gene of interest. In zebrafish, the injection of Cas9 mRNA and guide-RNA (gRNA), which are prepared using an in vitro transcription system, efficiently induce DNA double-strand breaks (DSBs) at the targeted genomic locus. Because gRNA was originally constructed by fusing two short RNAs CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA), we examined the effect of synthetic crRNAs and tracrRNA with Cas9 mRNA or Cas9 protein on the genome editing activity. We previously reported that the disruption of tyrosinase (tyr) by tyr-gRNA/Cas9 mRNA causes a retinal pigment defect, whereas the disruption of spns2 by spns2-gRNA1/Cas9 mRNA leads to a cardiac progenitor migration defect in zebrafish. Here, we found that the injection of spns2-crRNA1, tyr-crRNA and tracrRNA with Cas9 mRNA or Cas9 protein simultaneously caused a migration defect in cardiac progenitors and a pigment defect in retinal epithelial cells. A time course analysis demonstrated that the injection of crRNAs and tracrRNA with Cas9 protein rapidly induced genome modifications compared with the injection of crRNAs and tracrRNA with Cas9 mRNA. We further show that the crRNA-tracrRNA-Cas9 protein complex is functional for the visualization of endogenous gene expression; therefore, this is a very powerful, ready-to-use system in zebrafish. PMID:26010089

  4. Efficient Multiple Genome Modifications Induced by the crRNAs, tracrRNA and Cas9 Protein Complex in Zebrafish.

    Directory of Open Access Journals (Sweden)

    Hirohito Kotani

    Full Text Available The type II clustered regularly interspaced short palindromic repeats (CRISPR associated with Cas9 endonuclease (CRISPR/Cas9 has become a powerful genetic tool for understanding the function of a gene of interest. In zebrafish, the injection of Cas9 mRNA and guide-RNA (gRNA, which are prepared using an in vitro transcription system, efficiently induce DNA double-strand breaks (DSBs at the targeted genomic locus. Because gRNA was originally constructed by fusing two short RNAs CRISPR RNA (crRNA and trans-activating crRNA (tracrRNA, we examined the effect of synthetic crRNAs and tracrRNA with Cas9 mRNA or Cas9 protein on the genome editing activity. We previously reported that the disruption of tyrosinase (tyr by tyr-gRNA/Cas9 mRNA causes a retinal pigment defect, whereas the disruption of spns2 by spns2-gRNA1/Cas9 mRNA leads to a cardiac progenitor migration defect in zebrafish. Here, we found that the injection of spns2-crRNA1, tyr-crRNA and tracrRNA with Cas9 mRNA or Cas9 protein simultaneously caused a migration defect in cardiac progenitors and a pigment defect in retinal epithelial cells. A time course analysis demonstrated that the injection of crRNAs and tracrRNA with Cas9 protein rapidly induced genome modifications compared with the injection of crRNAs and tracrRNA with Cas9 mRNA. We further show that the crRNA-tracrRNA-Cas9 protein complex is functional for the visualization of endogenous gene expression; therefore, this is a very powerful, ready-to-use system in zebrafish.

  5. Ammonia as an In Situ Sanitizer: Influence of Virus Genome Type on Inactivation. (United States)

    Decrey, Loïc; Kazama, Shinobu; Kohn, Tamar


    Treatment of human excreta and animal manure (HEAM) is key in controlling the spread of persistent enteric pathogens, such as viruses. The extent of virus inactivation during HEAM storage and treatment appears to vary with virus genome type, although the reasons for this variability are not clear. Here, we investigated the inactivation of viruses of different genome types under conditions representative of HEAM storage or mesophilic digestion. The goals were to characterize the influence of HEAM solution conditions on inactivation and to determine the potential mechanisms involved. Specifically, eight viruses representing the four viral genome types (single-stranded RNA [ssRNA], double-stranded RNA [dsRNA], single-stranded DNA [ssDNA], and double-stranded DNA [dsDNA]) were exposed to synthetic solutions with well-controlled temperature (20 to 35°C), pH (8 to 9), and ammonia (NH3) concentrations (0 to 40 mmol liter(-1)). DNA and dsRNA viruses were considerably more resistant than ssRNA viruses, resulting in up to 1,000-fold-longer treatment times to reach a 4-log inactivation. The apparently slower inactivation of DNA viruses was rationalized by the higher stability of DNA than that of ssRNA in HEAM. Pushing the system toward harsher pH (>9) and temperature (>35°C) conditions, such as those encountered in thermophilic digestion and alkaline treatments, led to more consistent inactivation kinetics among ssRNA and other viruses. This suggests that the dependence of inactivation on genome type disappeared in favor of protein-mediated inactivation mechanisms common to all viruses. Finally, we recommend the use of MS2 as a conservative indicator to assess the inactivation of ssRNA viruses and the stable ΦX174 or dsDNA phages as indicators for persistent viruses. Viruses are among the most environmentally persistent pathogens. They can be present in high concentrations in human excreta and animal manure (HEAM). Therefore, appropriate treatment of HEAM is important

  6. Opening of the TAR hairpin in the HIV-1 genome causes aberrant RNA dimerization and packaging

    Directory of Open Access Journals (Sweden)

    Das Atze T


    Full Text Available Abstract Background The TAR hairpin is present at both the 5′ and 3′ end of the HIV-1 RNA genome. The 5′ element binds the viral Tat protein and is essential for Tat-mediated activation of transcription. We recently observed that complete TAR deletion is allowed in the context of an HIV-1 variant that does not depend on this Tat-TAR axis for transcription. Mutations that open the 5′ stem-loop structure did however affect the leader RNA conformation and resulted in a severe replication defect. In this study, we set out to analyze which step of the HIV-1 replication cycle is affected by this conformational change of the leader RNA. Results We demonstrate that opening the 5′ TAR structure through a deletion in either side of the stem region caused aberrant dimerization and reduced packaging of the unspliced viral RNA genome. In contrast, truncation of the TAR hairpin through deletions in both sides of the stem did not affect RNA dimer formation and packaging. Conclusions These results demonstrate that, although the TAR hairpin is not essential for RNA dimerization and packaging, mutations in TAR can significantly affect these processes through misfolding of the relevant RNA signals.

  7. Genome transcription/translation of segmented, negative-strand RNA viruses

    NARCIS (Netherlands)

    Geerts-Dimitriadou, C.


    The requirements for alignment of capped RNA leader sequences along the viral genome during influenza transcription initiation (“cap-snatching”) have long been an enigma. Previous work on Tomato spotted wilt virus (TSWV) transcription initiation has revealed that this virus displays a

  8. On the biased nucleotide composition of the human coronavirus RNA genome

    NARCIS (Netherlands)

    Berkhout, Ben; van Hemert, Formijn


    We investigated the nucleotide composition of the RNA genome of the six human coronaviruses. Some general coronavirus characteristics were apparent (e.g. high U, low C count), but we also detected species-specific signatures. Most strikingly, the high U and low C proportions are quite variable and

  9. De novo reconstruction of plant RNA and DNA virus genomes from viral siRNAs (United States)

    In antiviral defense, plants produce massive quantities of 21-24 nucleotide siRNAs. Here we demonstrate that the complete genomes of DNA and RNA viruses and viroids can be reconstructed by deep sequencing and de novo assembly of viral/viroid siRNAs from experimentally- and naturally-infected plants....

  10. tRNA's wobble decoding of the genome: 40 years of modification. (United States)

    Agris, Paul F; Vendeix, Franck A P; Graham, William D


    The genetic code is degenerate, in that 20 amino acids are encoded by 61 triplet codes. In 1966, Francis Crick hypothesized that the cell's limited number of tRNAs decoded the genome by recognizing more than one codon. The ambiguity of that recognition resided in the third base-pair, giving rise to the Wobble Hypothesis. Post-transcriptional modifications at tRNA's wobble position 34, especially modifications of uridine 34, enable wobble to occur. The Modified Wobble Hypothesis proposed in 1991 that specific modifications of a tRNA wobble nucleoside shape the anticodon architecture in such a manner that interactions were restricted to the complementary base plus a single wobble pairing for amino acids with twofold degenerate codons. However, chemically different modifications at position 34 would expand the ability of a tRNA to read three or even four of the fourfold degenerate codons. One foundation of Crick's Wobble Hypothesis was that a near-constant geometry of canonical base-pairing be maintained in forming all three base-pairs between the tRNA anticodon and mRNA codon on the ribosome. In accepting an aminoacyl-tRNA, the ribosome requires maintenance of a specific geometry for the anticodon-codon base-pairing. However, it is the post-transcriptional modifications at tRNA wobble position 34 and purine 37, 3'-adjacent to the anticodon, that pre-structure the anticodon domain to ensure the correct codon binding. The modifications create both the architecture and the stability needed for decoding through restraints on anticodon stereochemistry and conformational space, and through selective hydrogen bonding. A physicochemical understanding of modified nucleoside contributions to the tRNA anticodon domain architecture and its decoding of the genome has advanced RNA world evolutionary theory, the principles of RNA chemistry, and the application of this knowledge to the introduction of new amino acids to proteins.

  11. Full-length RNA structure prediction of the HIV-1 genome reveals a conserved core domain. (United States)

    Sükösd, Zsuzsanna; Andersen, Ebbe S; Seemann, Stefan E; Jensen, Mads Krogh; Hansen, Mathias; Gorodkin, Jan; Kjems, Jørgen


    A distance constrained secondary structural model of the ≈10 kb RNA genome of the HIV-1 has been predicted but higher-order structures, involving long distance interactions, are currently unknown. We present the first global RNA secondary structure model for the HIV-1 genome, which integrates both comparative structure analysis and information from experimental data in a full-length prediction without distance constraints. Besides recovering known structural elements, we predict several novel structural elements that are conserved in HIV-1 evolution. Our results also indicate that the structure of the HIV-1 genome is highly variable in most regions, with a limited number of stable and conserved RNA secondary structures. Most interesting, a set of long distance interactions form a core organizing structure (COS) that organize the genome into three major structural domains. Despite overlapping protein-coding regions the COS is supported by a particular high frequency of compensatory base changes, suggesting functional importance for this element. This new structural element potentially organizes the whole genome into three major domains protruding from a conserved core structure with potential roles in replication and evolution for the virus. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Rubella virus capsid protein modulation of viral genomic and subgenomic RNA synthesis

    International Nuclear Information System (INIS)

    Tzeng, W.-P.; Frey, Teryl K.


    The ratio of the subgenomic (SG) to genome RNA synthesized by rubella virus (RUB) replicons expressing the green fluorescent protein reporter gene (RUBrep/GFP) is substantially higher than the ratio of these species synthesized by RUB (4.3 for RUBrep/GFP vs. 1.3-1.4 for RUB). It was hypothesized that this modulation of the viral RNA synthesis was by one of the virus structural protein genes and it was found that introduction of the capsid (C) protein gene into the replicons as an in-frame fusion with GFP resulted in an increase of genomic RNA production (reducing the SG/genome RNA ratio), confirming the hypothesis and showing that the C gene was the moiety responsible for the modulation effect. The N-terminal one-third of the C gene was required for the effect of be exhibited. A similar phenomenon was not observed with the replicons of Sindbis virus, a related Alphavirus. Interestingly, modulation was not observed when RUBrep/GFP was co-transfected with either other RUBrep or plasmid constructs expressing the C gene, demonstrating that modulation could occur only when the C gene was provided in cis. Mutations that prevented translation of the C protein failed to modulate RNA synthesis, indicating that the C protein was the moiety responsible for modulation; consistent with this conclusion, modulation of RNA synthesis was maintained when synonymous codon mutations were introduced at the 5' end of the C gene that changed the C gene sequence without altering the amino acid sequence of the C protein. These results indicate that C protein translated in proximity of viral replication complexes, possibly from newly synthesized SG RNA, participate in regulating the replication of viral RNA

  13. lncRNA-screen: an interactive platform for computationally screening long non-coding RNAs in large genomics datasets. (United States)

    Gong, Yixiao; Huang, Hsuan-Ting; Liang, Yu; Trimarchi, Thomas; Aifantis, Iannis; Tsirigos, Aristotelis


    Long non-coding RNAs (lncRNAs) have emerged as a class of factors that are important for regulating development and cancer. Computational prediction of lncRNAs from ultra-deep RNA sequencing has been successful in identifying candidate lncRNAs. However, the complexity of handling and integrating different types of genomics data poses significant challenges to experimental laboratories that lack extensive genomics expertise. To address this issue, we have developed lncRNA-screen, a comprehensive pipeline for computationally screening putative lncRNA transcripts over large multimodal datasets. The main objective of this work is to facilitate the computational discovery of lncRNA candidates to be further examined by functional experiments. lncRNA-screen provides a fully automated easy-to-run pipeline which performs data download, RNA-seq alignment, assembly, quality assessment, transcript filtration, novel lncRNA identification, coding potential estimation, expression level quantification, histone mark enrichment profile integration, differential expression analysis, annotation with other type of segmented data (CNVs, SNPs, Hi-C, etc.) and visualization. Importantly, lncRNA-screen generates an interactive report summarizing all interesting lncRNA features including genome browser snapshots and lncRNA-mRNA interactions based on Hi-C data. lncRNA-screen provides a comprehensive solution for lncRNA discovery and an intuitive interactive report for identifying promising lncRNA candidates. lncRNA-screen is available as open-source software on GitHub.

  14. Thousands of corresponding human and mouse genomic regions unalignable in primary sequence contain common RNA structure

    DEFF Research Database (Denmark)

    Torarinsson, Elfar; Sawera, Milena; Havgaard, Jakob Hull


    Human and mouse genome sequences contain roughly 100,000 regions that are unalignable in primary sequence and neighbor corresponding alignable regions between both organisms. These pairs are generally assumed to be nonconserved, although the level of structural conservation between these has never...... been investigated. Owing to the limitations in computational methods, comparative genomics has been lacking the ability to compare such nonconserved sequence regions for conserved structural RNA elements. We have investigated the presence of structural RNA elements by conducting a local structural...... alignment, using FOLDALIGN, on a subset of these 100,000 corresponding regions and estimate that 1800 contain common RNA structures. Comparing our results with the recent mapping of transcribed fragments (transfrags) in human, we find that high-scoring candidates are twice as likely to be found in regions...

  15. A double-stranded RNA as the genome of a potential virus infecting Vicia faba. (United States)

    Liu, Weixia; Chen, Jishuang


    Preparations of double-stranded (ds) RNAs extracted from naturally infected Vicia faba Linn. growing in Hangzhou, Zhejiang Province, Eastern China displayed 3 dominant bands (FaR1, FaR2, and FaR3). FaR2 and FaR3 were found to be identical to the genomic dsRNAs of a recently reported Vicia cryptic virus (VCV). The positive strand of FaR1 contained two large open reading frames (ORFs), ORF1 and ORF2. The putative proteins encoded by these ORFs were found to have certain similarities to the putative capsid protein [ABO36237] and RNA-dependent RNA polymerase [ABC96788], respectively, of Tomato yellow stunt virus. Thus, FaR1 may represent the genome of a new dsRNA virus, which we have named Vicia cryptic virus M.

  16. Identification and characterization of single-stranded DNA-binding protein from the facultative psychrophilic bacteria Pseudoalteromonas haloplanktis. (United States)

    Olszewski, Marcin; Nowak, Marta; Cyranka-Czaja, Anna; Kur, Józef


    Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism such as DNA replication, repair, and recombination, and is essential for cell survival. This study reports on the ssb-like gene cloning, gene expression and characterization of a single-stranded DNA-binding protein of Pseudoalteromonas haloplanktis (PhaSSB) and is the first report of such a protein from psychrophilic microorganism. PhaSSB possesses a high sequence similarity to Escherichia coli SSB (48% identity and 57% similarity) and has the longest amino acid sequence (244 amino acid residues) of all the known bacterial SSBs with one OB-fold per monomer. An analysis of purified PhaSSB by means of chemical cross-linking experiments, sedimentation analysis and size exclusion chromatography revealed a stable tetramer in solution. Using EMSA, we characterized the stoichiometry of PhaSSB complexed with a series of ssDNA homopolymers, and the size of the binding site was determined as being approximately 35 nucleotides long. In fluorescence titrations, the occluded site size of PhaSSB on poly(dT) is 34 nucleotides per tetramer under low-salt conditions (2mM NaCl), but increases to 54-64 nucleotides at higher-salt conditions (100-300mM NaCl). This suggests that PhaSSB undergoes a transition between ssDNA binding modes, which is observed for EcoSSB. The binding properties of PhaSSB investigated using SPR technology revealed that the affinity of PhaSSB to ssDNA is typical of SSB proteins. The only difference in the binding mode of PhaSSB to ssDNA is a faster association phase, when compared to EcoSSB, though compensated by faster dissociation rate. When analyzed by differential scanning calorimetry (DSC), the melting temperature (Tm) was determined as 63 °C, which is only a few degrees lower than for EcoSSB. Copyright © 2013 Elsevier GmbH. All rights reserved.

  17. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  18. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii. (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten


    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  19. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der


    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  20. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.


    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  1. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.


    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  2. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.


    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  3. siRNA Genome Screening Approaches to Therapeutic Drug Repositioning

    Directory of Open Access Journals (Sweden)

    Ralph A. Tripp


    Full Text Available Bridging high-throughput screening (HTS with RNA interference (RNAi has allowed for rapid discovery of the molecular basis of many diseases, and identification of potential pathways for developing safe and effective treatments. These features have identified new host gene targets for existing drugs paving the pathway for therapeutic drug repositioning. Using RNAi to discover and help validate new drug targets has also provided a means to filter and prioritize promising therapeutics. This review summarizes these approaches across a spectrum of methods and targets in the host response to pathogens. Particular attention is given to the utility of drug repurposing utilizing the promiscuous nature of some drugs that affect multiple molecules or pathways, and how these biological pathways can be targeted to regulate disease outcome.

  4. Therapeutic Genome Editing and its Potential Enhancement through CRISPR Guide RNA and Cas9 Modifications. (United States)

    Batzir, Nurit Assia; Tovin, Adi; Hendel, Ayal


    Genome editing with engineered nucleases is a rapidly growing field thanks to transformative technologies that allow researchers to precisely alter genomes for numerous applications including basic research, biotechnology, and human gene therapy. The genome editing process relies on creating a site-specific DNA double-strand break (DSB) by engineered nucleases and then allowing the cell's repair machinery to repair the break such that precise changes are made to the DNA sequence. The recent development of CRISPR-Cas systems as easily accessible and programmable tools for genome editing accelerates the progress towards using genome editing as a new approach to human therapeutics. Here we review how genome editing using engineered nucleases works and how using different genome editing outcomes can be used as a tool set for treating human diseases. We then review the major challenges of therapeutic genome editing and we discuss how its potential enhancement through CRISPR guide RNA and Cas9 protein modifications could resolve some of these challenges. Copyright© of YS Medical Media ltd.

  5. A Rapid and Efficient Method for Purifying High Quality Total RNA from Peaches (Prunus persica for Functional Genomics Analyses

    Directory of Open Access Journals (Sweden)



    Full Text Available Prunus persica has been proposed as a genomic model for deciduous trees and the Rosaceae family. Optimized protocols for RNA isolation are necessary to further advance studies in this model species such that functional genomics analyses may be performed. Here we present an optimized protocol to rapidly and efficiently purify high quality total RNA from peach fruits (Prunus persica. Isolating high-quality RNA from fruit tissue is often difficult due to large quantities of polysaccharides and polyphenolic compounds that accumulate in this tissue and co-purify with the RNA. Here we demonstrate that a modified version of the method used to isolate RNA from pine trees and the woody plant Cinnamomun tenuipilum is ideal for isolating high quality RNA from the fruits of Prunus persica. This RNA may be used for many functional genomic based experiments such as RT-PCR and the construction of large-insert cDNA libraries.

  6. Stabilization of the U5-leader stem in the HIV-1 RNA genome affects initiation and elongation of reverse transcription

    NARCIS (Netherlands)

    Beerens, N.; Groot, F.; Berkhout, B.


    Reverse transcription of the Human Immunodeficiency Virus type I (HIV-1) RNA genome is primed by a cellular tRNA-lys3 molecule that binds to the primer binding site (PBS). The PBS is predicted to be part of an extended RNA structure, consisting of a small U5-PBS hairpin and a large U5-leader stem.

  7. Transmissible gastroenteritis coronavirus genome packaging signal is located at the 5' end of the genome and promotes viral RNA incorporation into virions in a replication-independent process. (United States)

    Morales, Lucia; Mateos-Gomez, Pedro A; Capiscol, Carmen; del Palacio, Lorena; Enjuanes, Luis; Sola, Isabel


    Preferential RNA packaging in coronaviruses involves the recognition of viral genomic RNA, a crucial process for viral particle morphogenesis mediated by RNA-specific sequences, known as packaging signals. An essential packaging signal component of transmissible gastroenteritis coronavirus (TGEV) has been further delimited to the first 598 nucleotides (nt) from the 5' end of its RNA genome, by using recombinant viruses transcribing subgenomic mRNA that included potential packaging signals. The integrity of the entire sequence domain was necessary because deletion of any of the five structural motifs defined within this region abrogated specific packaging of this viral RNA. One of these RNA motifs was the stem-loop SL5, a highly conserved motif in coronaviruses located at nucleotide positions 106 to 136. Partial deletion or point mutations within this motif also abrogated packaging. Using TGEV-derived defective minigenomes replicated in trans by a helper virus, we have shown that TGEV RNA packaging is a replication-independent process. Furthermore, the last 494 nt of the genomic 3' end were not essential for packaging, although this region increased packaging efficiency. TGEV RNA sequences identified as necessary for viral genome packaging were not sufficient to direct packaging of a heterologous sequence derived from the green fluorescent protein gene. These results indicated that TGEV genome packaging is a complex process involving many factors in addition to the identified RNA packaging signal. The identification of well-defined RNA motifs within the TGEV RNA genome that are essential for packaging will be useful for designing packaging-deficient biosafe coronavirus-derived vectors and providing new targets for antiviral therapies.

  8. New Structure Sheds Light on Selective HIV-1 Genomic RNA Packaging. (United States)

    Olson, Erik D; Cantara, William A; Musier-Forsyth, Karin


    Two copies of unspliced human immunodeficiency virus (HIV)-1 genomic RNA (gRNA) are preferentially selected for packaging by the group-specific antigen (Gag) polyprotein into progeny virions as a dimer during the late stages of the viral lifecycle. Elucidating the RNA features responsible for selective recognition of the full-length gRNA in the presence of an abundance of other cellular RNAs and spliced viral RNAs remains an area of intense research. The recent nuclear magnetic resonance (NMR) structure by Keane et al. [1] expands upon previous efforts to determine the conformation of the HIV-1 RNA packaging signal. The data support a secondary structure wherein sequences that constitute the major splice donor site are sequestered through base pairing, and a tertiary structure that adopts a tandem 3-way junction motif that exposes the dimerization initiation site and unpaired guanosines for specific recognition by Gag. While it remains to be established whether this structure is conserved in the context of larger RNA constructs or in the dimer, this study serves as the basis for characterizing large RNA structures using novel NMR techniques, and as a major advance toward understanding how the HIV-1 gRNA is selectively packaged.

  9. Functional analysis of multiple single-stranded DNA-binding proteins from Methanosarcina acetivorans and their effects on DNA synthesis by DNA polymerase BI. (United States)

    Robbins, Justin B; Murphy, Mary C; White, Bryan A; Mackie, Roderick I; Ha, Taekjip; Cann, Isaac K O


    Single-stranded DNA-binding proteins and their functional homologs, replication protein A, are essential components of cellular DNA replication, repair and recombination. We describe here the isolation and characterization of multiple replication protein A homologs, RPA1, RPA2, and RPA3, from the archaeon Methanosarcina acetivorans. RPA1 comprises four single-stranded DNA-binding domains, while RPA2 and RPA3 are each composed of two such domains and a zinc finger domain. Gel filtration analysis suggested that RPA1 exists as homotetramers and homodimers in solution, while RPA2 and RPA3 form only homodimers. Unlike the multiple RPA proteins found in other Archaea and eukaryotes, each of the M. acetivorans RPAs can act as a distinct single-stranded DNA-binding protein. Fluorescence resonance energy transfer and fluorescence polarization anisotropy studies revealed that the M. acetivorans RPAs bind to as few as 10 single-stranded DNA bases. However, more stable binding is achieved with single-stranded DNA of 18-23 bases, and for such substrates the estimated Kd was 3.82 +/- 0.28 nM, 173.6 +/- 105.17 nM, and 5.92 +/- 0.23 nM, for RPA1, RPA2, and RPA3, respectively. The architectures of the M. acetivorans RPAs are different from those of hitherto reported homologs. Thus, these proteins may represent novel forms of replication protein A. Most importantly, our results show that the three RPAs and their combinations highly stimulate the primer extension capacity of M. acetivorans DNA polymerase BI. Although bacterial SSB and eukaryotic RPA have been shown to stimulate DNA synthesis by their cognate DNA polymerases, our findings provide the first in vitro biochemical evidence for the conservation of this property in an archaeon.

  10. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  11. EFFECTOR OF TRANSCRIPTION2 is involved in xylem differentiation and includes a functional DNA single strand cutting domain. (United States)

    Ivanov, Rumen; Tiedemann, Jens; Czihal, Andreas; Schallau, Anna; Diep, Le Hong; Mock, Hans-Peter; Claus, Bernhard; Tewes, Annegret; Bäumlein, Helmut


    EFFECTORS OF TRANSCRIPTION2 (ET) are plant-specific regulatory proteins characterized by the presence of two to five C-terminal DNA- and Zn-binding repeats, and a highly conserved cysteine pattern. We describe the structural characterization of the three member Arabidopsis thaliana ET gene family and reveal some allelic sequence polymorphisms. A mutation analysis showed that AtET2 affects the expression of various KNAT genes involved in the maintenance of the undifferentiated state of cambial meristem cells. It also plays a role in the regulation of GA5 (gibberellin 3-beta-dioxygenase) and the cell-cycle-related GASA4. A correlation was established between AtET2 expression and the cellular differentiation state. AtET-GFP fusion proteins shuttle between the cytoplasm and nucleus, with the AtET2 product prevented from entering the nucleus in non-differentiating cells. Within the nucleus, AtET2 probably acts via a single strand cutting domain. A more general regulatory role for ET factors is proposed, governing cell differentiation in cambial meristems, a crucial process for the development of plant vascular tissues.

  12. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)


    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  13. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.


    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  14. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia


    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  15. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))


    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  16. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA. (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi


    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  17. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.


    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  18. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD


    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  19. High-throughput SHAPE analysis reveals structures in HIV-1 genomic RNA strongly conserved across distinct biological states.

    Directory of Open Access Journals (Sweden)

    Kevin A Wilkinson


    Full Text Available Replication and pathogenesis of the human immunodeficiency virus (HIV is tightly linked to the structure of its RNA genome, but genome structure in infectious virions is poorly understood. We invent high-throughput SHAPE (selective 2'-hydroxyl acylation analyzed by primer extension technology, which uses many of the same tools as DNA sequencing, to quantify RNA backbone flexibility at single-nucleotide resolution and from which robust structural information can be immediately derived. We analyze the structure of HIV-1 genomic RNA in four biologically instructive states, including the authentic viral genome inside native particles. Remarkably, given the large number of plausible local structures, the first 10% of the HIV-1 genome exists in a single, predominant conformation in all four states. We also discover that noncoding regions functioning in a regulatory role have significantly lower (p-value < 0.0001 SHAPE reactivities, and hence more structure, than do viral coding regions that function as the template for protein synthesis. By directly monitoring protein binding inside virions, we identify the RNA recognition motif for the viral nucleocapsid protein. Seven structurally homologous binding sites occur in a well-defined domain in the genome, consistent with a role in directing specific packaging of genomic RNA into nascent virions. In addition, we identify two distinct motifs that are targets for the duplex destabilizing activity of this same protein. The nucleocapsid protein destabilizes local HIV-1 RNA structure in ways likely to facilitate initial movement both of the retroviral reverse transcriptase from its tRNA primer and of the ribosome in coding regions. Each of the three nucleocapsid interaction motifs falls in a specific genome domain, indicating that local protein interactions can be organized by the long-range architecture of an RNA. High-throughput SHAPE reveals a comprehensive view of HIV-1 RNA genome structure, and further

  20. Whole genome analysis of CRISPR Cas9 sgRNA off-target homologies via an efficient computational algorithm. (United States)

    Zhou, Hong; Zhou, Michael; Li, Daisy; Manthey, Joseph; Lioutikova, Ekaterina; Wang, Hong; Zeng, Xiao


    The beauty and power of the genome editing mechanism, CRISPR Cas9 endonuclease system, lies in the fact that it is RNA-programmable such that Cas9 can be guided to any genomic loci complementary to a 20-nt RNA, single guide RNA (sgRNA), to cleave double stranded DNA, allowing the introduction of wanted mutations. Unfortunately, it has been reported repeatedly that the sgRNA can also guide Cas9 to off-target sites where the DNA sequence is homologous to sgRNA. Using human genome and Streptococcus pyogenes Cas9 (SpCas9) as an example, this article mathematically analyzed the probabilities of off-target homologies of sgRNAs and discovered that for large genome size such as human genome, potential off-target homologies are inevitable for sgRNA selection. A highly efficient computationl algorithm was developed for whole genome sgRNA design and off-target homology searches. By means of a dynamically constructed sequence-indexed database and a simplified sequence alignment method, this algorithm achieves very high efficiency while guaranteeing the identification of all existing potential off-target homologies. Via this algorithm, 1,876,775 sgRNAs were designed for the 19,153 human mRNA genes and only two sgRNAs were found to be free of off-target homology. By means of the novel and efficient sgRNA homology search algorithm introduced in this article, genome wide sgRNA design and off-target analysis were conducted and the results confirmed the mathematical analysis that for a sgRNA sequence, it is almost impossible to escape potential off-target homologies. Future innovations on the CRISPR Cas9 gene editing technology need to focus on how to eliminate the Cas9 off-target activity.

  1. A structured RNA motif is involved in correct placement of the tRNA(3)(Lys) primer onto the human immunodeficiency virus genome

    NARCIS (Netherlands)

    Beerens, N.; Klaver, B.; Berkhout, B.


    Human immunodeficiency virus type 1 (HIV-1) reverse transcription is primed by the cellular tRNA(3)(Lys) molecule that binds with its 3'-terminal 18 nucleotides to the fully complementary primer-binding site (PBS) on the viral RNA genome. Besides this complementarity, annealing of the primer may be

  2. Designed nucleases for targeted genome editing. (United States)

    Lee, Junwon; Chung, Jae-Hee; Kim, Ho Min; Kim, Dong-Wook; Kim, Hyongbum


    Targeted genome-editing technology using designed nucleases has been evolving rapidly, and its applications are widely expanding in research, medicine and biotechnology. Using this genome-modifying technology, researchers can precisely and efficiently insert, remove or change specific sequences in various cultured cells, micro-organisms, animals and plants. This genome editing is based on the generation of double-strand breaks (DSBs), repair of which modifies the genome through nonhomologous end-joining (NHEJ) or homology-directed repair (HDR). In addition, designed nickase-induced generation of single-strand breaks can also lead to precise genome editing through HDR, albeit at relatively lower efficiencies than that induced by nucleases. Three kinds of designed nucleases have been used for targeted DSB formation: zinc-finger nucleases, transcription activator-like effector nucleases, and RNA-guided engineered nucleases derived from the bacterial clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) system. A growing number of researchers are using genome-editing technologies, which have become more accessible and affordable since the discovery and adaptation of CRISPR-Cas9. Here, the repair mechanism and outcomes of DSBs are reviewed and the three types of designed nucleases are discussed with the hope that such understanding will facilitate applications to genome editing. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  3. Conserved gene clusters in bacterial genomes provide further support for the primacy of RNA (United States)

    Siefert, J. L.; Martin, K. A.; Abdi, F.; Widger, W. R.; Fox, G. E.


    Five complete bacterial genome sequences have been released to the scientific community. These include four (eu)Bacteria, Haemophilus influenzae, Mycoplasma genitalium, M. pneumoniae, and Synechocystis PCC 6803, as well as one Archaeon, Methanococcus jannaschii. Features of organization shared by these genomes are likely to have arisen very early in the history of the bacteria and thus can be expected to provide further insight into the nature of early ancestors. Results of a genome comparison of these five organisms confirm earlier observations that gene order is remarkably unpreserved. There are, nevertheless, at least 16 clusters of two or more genes whose order remains the same among the four (eu)Bacteria and these are presumed to reflect conserved elements of coordinated gene expression that require gene proximity. Eight of these gene orders are essentially conserved in the Archaea as well. Many of these clusters are known to be regulated by RNA-level mechanisms in Escherichia coli, which supports the earlier suggestion that this type of regulation of gene expression may have arisen very early. We conclude that although the last common ancestor may have had a DNA genome, it likely was preceded by progenotes with an RNA genome.

  4. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome

    Directory of Open Access Journals (Sweden)

    Dewey Colin N


    Full Text Available Abstract Background RNA-Seq is revolutionizing the way transcript abundances are measured. A key challenge in transcript quantification from RNA-Seq data is the handling of reads that map to multiple genes or isoforms. This issue is particularly important for quantification with de novo transcriptome assemblies in the absence of sequenced genomes, as it is difficult to determine which transcripts are isoforms of the same gene. A second significant issue is the design of RNA-Seq experiments, in terms of the number of reads, read length, and whether reads come from one or both ends of cDNA fragments. Results We present RSEM, an user-friendly software package for quantifying gene and isoform abundances from single-end or paired-end RNA-Seq data. RSEM outputs abundance estimates, 95% credibility intervals, and visualization files and can also simulate RNA-Seq data. In contrast to other existing tools, the software does not require a reference genome. Thus, in combination with a de novo transcriptome assembler, RSEM enables accurate transcript quantification for species without sequenced genomes. On simulated and real data sets, RSEM has superior or comparable performance to quantification methods that rely on a reference genome. Taking advantage of RSEM's ability to effectively use ambiguously-mapping reads, we show that accurate gene-level abundance estimates are best obtained with large numbers of short single-end reads. On the other hand, estimates of the relative frequencies of isoforms within single genes may be improved through the use of paired-end reads, depending on the number of possible splice forms for each gene. Conclusions RSEM is an accurate and user-friendly software tool for quantifying transcript abundances from RNA-Seq data. As it does not rely on the existence of a reference genome, it is particularly useful for quantification with de novo transcriptome assemblies. In addition, RSEM has enabled valuable guidance for cost

  5. Cloning and profiling of small RNAs from cucumber mosaic virus satellite RNA. (United States)

    Fang, Yuan-Yuan; Smith, Neil A; Zhao, Jian-Hua; Lee, Joanne R M; Guo, Hui-Shan; Wang, Ming-Bo


    RNA silencing is not only a gene regulation mechanism that is conserved in a broad range of eukaryotes but also an adaptive immune response against foreign nucleic acids including viruses in plants. A major feature of RNA silencing is the production of small RNA (sRNA) of 21-24 nucleotides (nt) in length from double-stranded (ds) or hairpin-like (hp) RNA by Dicer-like (DCL) proteins. These sRNAs guide the binding and cleavage of cognate single-stranded (ss) RNA by an RNA silencing complex. Like all plant viruses and subviral agents, replication of viral satellite RNAs (satRNAs) is associated with the accumulation of 21-24 nt viral small interfering RNA (vsiRNA) derived from the whole region of a satRNA genome in both plus and minus-strand polarities. These satRNA-derived siRNAs (satsiRNAs) have recently been shown to play an important role in the trilateral interactions among host plants, helper viruses and satRNAs. Here, we describe the cloning and profile analysis of satsiRNAs from satRNAs of Cucumber mosaic virus (CMV). We also describe a method to minimize the strand bias that often occurs during vsiRNA cloning and sequencing.

  6. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations. (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise


    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  7. CoGemiR: A comparative genomics microRNA database

    Directory of Open Access Journals (Sweden)

    Di Bernardo Diego


    Full Text Available Abstract Background MicroRNAs are small highly conserved non-coding RNAs which play an important role in regulating gene expression by binding the 3'UTR of target mRNAs. The majority of microRNAs are localized within other transcriptional units (host genes and are co-expressed with them, which strongly suggests that microRNAs and corresponding host genes use the same promoter and other expression control elements. The remaining fraction of microRNAs is intergenic and is endowed with an independent regulatory region. A number of databases have already been developed to collect information about microRNAs but none of them allow an easy exploration of microRNA genomic organization across evolution. Results CoGemiR is a publicly available microRNA-centered database whose aim is to offer an overview of the genomic organization of microRNAs and of its extent of conservation during evolution in different metazoan species. The database collects information on genomic location, conservation and expression data of both known and newly predicted microRNAs and displays the data by privileging a comparative point of view. The database also includes a microRNA prediction pipeline to annotate microRNAs in recently sequenced genomes. This information is easily accessible via web through a user-friendly query page. The CoGemiR database is available at Conclusion The knowledge of the genomic organization of microRNAs can provide useful information to understand their biology. In order to have a comparative genomics overview of microRNAs genomic organization, we developed CoGemiR. To achieve this goal, we both collected and integrated data from pre-existing databases and generated new ones, such as the identification in several species of a number of previously unannotated microRNAs. For a more effective use of this data, we developed a user-friendly web interface that simply shows how a microRNA genomic context is related in different

  8. Detecting riboSNitches with RNA folding algorithms: a genome-wide benchmark. (United States)

    Corley, Meredith; Solem, Amanda; Qu, Kun; Chang, Howard Y; Laederach, Alain


    Ribonucleic acid (RNA) secondary structure prediction continues to be a significant challenge, in particular when attempting to model sequences with less rigidly defined structures, such as messenger and non-coding RNAs. Crucial to interpreting RNA structures as they pertain to individual phenotypes is the ability to detect RNAs with large structural disparities caused by a single nucleotide variant (SNV) or riboSNitches. A recently published human genome-wide parallel analysis of RNA structure (PARS) study identified a large number of riboSNitches as well as non-riboSNitches, providing an unprecedented set of RNA sequences against which to benchmark structure prediction algorithms. Here we evaluate 11 different RNA folding algorithms' riboSNitch prediction performance on these data. We find that recent algorithms designed specifically to predict the effects of SNVs on RNA structure, in particular remuRNA, RNAsnp and SNPfold, perform best on the most rigorously validated subsets of the benchmark data. In addition, our benchmark indicates that general structure prediction algorithms (e.g. RNAfold and RNAstructure) have overall better performance if base pairing probabilities are considered rather than minimum free energy calculations. Although overall aggregate algorithmic performance on the full set of riboSNitches is relatively low, significant improvement is possible if the highest confidence predictions are evaluated independently. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Characterization of four ribosomal RNA operons in the genome of Agrobacterium tumefaciens MAFF301001. (United States)

    Bautista-Zapanta, J-ney; Suzuki, Katsunori; Yoshida, Kazuo


    The four ribosomal RNA (rrn) operons rrnA, rrnB, rrnC and were identified, sequenced completely and characterized individually rrnD in the whole genome of A tumefaciens MAFF301001. These rrn operons were located in the two topologically different chromosomal DNAs; rrnA and rrnD in the linear chromosome and rrnB and rrnC in the circular chromosome. Each operon coded for three ribosomal RNA subunit genes; 16S, 23S and 5S rRNA. The 16S-23S internal transcribed spacers (ITS) of the four rrn operons contain genes for tRNA-Ile and tRNA-Ala and tRNA-Met downstream of 5S rDNA gene while the intergenic spacer between 23S rDNA and 5S rDNA lacked tRNA genes. Sequence alignment of 23S rRNAs of A. tumefaciens MAFF301001 and C58 strains showed unrelated sequences near the 5' end region suggesting the presence of intervening sequence (IVS). Primer extension analyses revealed that the primary transcription products for 16S and 23S rRNAs are 1497 and 2877 bases long, respectively.

  10. Genome-Wide Analysis of miRNA targets in Brachypodium and Biomass Energy Crops

    Energy Technology Data Exchange (ETDEWEB)

    Green, Pamela J. [Univ. of Delaware, Newark, DE (United States)


    MicroRNAs (miRNAs) contribute to the control of numerous biological processes through the regulation of specific target mRNAs. Although the identities of these targets are essential to elucidate miRNA function, the targets are much more difficult to identify than the small RNAs themselves. Before this work, we pioneered the genome-wide identification of the targets of Arabidopsis miRNAs using an approach called PARE (German et al., Nature Biotech. 2008; Nature Protocols, 2009). Under this project, we applied PARE to Brachypodium distachyon (Brachypodium), a model plant in the Poaceae family, which includes the major food grain and bioenergy crops. Through in-depth global analysis and examination of specific examples, this research greatly expanded our knowledge of miRNAs and target RNAs of Brachypodium. New regulation in response to environmental stress or tissue type was found, and many new miRNAs were discovered. More than 260 targets of new and known miRNAs with PARE sequences at the precise sites of miRNA-guided cleavage were identified and characterized. Combining PARE data with the small RNA data also identified the miRNAs responsible for initiating approximately 500 phased loci, including one of the novel miRNAs. PARE analysis also revealed that differentially expressed miRNAs in the same family guide specific target RNA cleavage in a correspondingly tissue-preferential manner. The project included generation of small RNA and PARE resources for bioenergy crops, to facilitate ongoing discovery of conserved miRNA-target RNA regulation. By associating specific miRNA-target RNA pairs with known physiological functions, the research provides insights about gene regulation in different tissues and in response to environmental stress. This, and release of new PARE and small RNA data sets should contribute basic knowledge to enhance breeding and may suggest new strategies for improvement of biomass energy crops.

  11. Fast and accurate search for non-coding RNA pseudoknot structures in genomes. (United States)

    Huang, Zhibin; Wu, Yong; Robertson, Joseph; Feng, Liang; Malmberg, Russell L; Cai, Liming


    Searching genomes for non-coding RNAs (ncRNAs) by their secondary structure has become an important goal for bioinformatics. For pseudoknot-free structures, ncRNA search can be effective based on the covariance model and CYK-type dynamic programming. However, the computational difficulty in aligning an RNA sequence to a pseudoknot has prohibited fast and accurate search of arbitrary RNA structures. Our previous work introduced a graph model for RNA pseudoknots and proposed to solve the structure-sequence alignment by graph optimization. Given k candidate regions in the target sequence for each of the n stems in the structure, we could compute a best alignment in time O(k(t)n) based upon a tree width t decomposition of the structure graph. However, to implement this method to programs that can routinely perform fast yet accurate RNA pseudoknot searches, we need novel heuristics to ensure that, without degrading the accuracy, only a small number of stem candidates need to be examined and a tree decomposition of a small tree width can always be found for the structure graph. The current work builds on the previous one with newly developed preprocessing algorithms to reduce the values for parameters k and t and to implement the search method into a practical program, called RNATOPS, for RNA pseudoknot search. In particular, we introduce techniques, based on probabilistic profiling and distance penalty functions, which can identify for every stem just a small number k (e.g. k algorithm that can yield tree decomposition of small tree width t (e.g. t search prokaryotic and eukaryotic genomes for specific RNA structures of medium to large sizes, including pseudoknots, with high sensitivity and high specificity, and in a reasonable amount of time.

  12. Single-cell RNA-sequencing: The future of genome biology is now. (United States)

    Picelli, Simone


    Genome-wide single-cell analysis represents the ultimate frontier of genomics research. In particular, single-cell RNA-sequencing (scRNA-seq) studies have been boosted in the last few years by an explosion of new technologies enabling the study of the transcriptomic landscape of thousands of single cells in complex multicellular organisms. More sensitive and automated methods are being continuously developed and promise to deliver better data quality and higher throughput with less hands-on time. The outstanding amount of knowledge that is going to be gained from present and future studies will have a profound impact in many aspects of our society, from the introduction of truly tailored cancer treatments, to a better understanding of antibiotic resistance and host-pathogen interactions; from the discovery of the mechanisms regulating stem cell differentiation to the characterization of the early event of human embryogenesis.

  13. RNA interactions in the 5' region of the HIV-1 genome

    DEFF Research Database (Denmark)

    Damgaard, Christian Kroun; Andersen, Ebbe Sloth; Knudsen, Bjarne


    The untranslated leader of the dimeric HIV-1 RNA genome is folded into a complex structure that plays multiple and essential roles in the viral replication cycle. Here, we have investigated secondary and tertiary structural elements within the 5' 744 nucleotides of the HIV-1 genome using...... a combination of bioinformatics, enzymatic probing, native gel electrophoresis, and UV-crosslinking experiments. We used a recently developed RNA folding algorithm (Pfold) to predict the common secondary structure of an alignment of 20 divergent HIV-1 sequences. Combining this analysis with biochemical data, we...... present a secondary structure model for the entire 744 nucleotide fragment, which incorporates previously recognized and novel structural elements. In particular, our data provided strong evidence for a long-distance interaction between the region encompassing the AUG Gag initiation codon and an upstream...

  14. Efficient cellular release of Rift Valley fever virus requires genomic RNA.

    Directory of Open Access Journals (Sweden)

    Mary E Piper


    Full Text Available The Rift Valley fever virus is responsible for periodic, explosive epizootics throughout sub-Saharan Africa. The development of therapeutics targeting this virus is difficult due to a limited understanding of the viral replicative cycle. Utilizing a virus-like particle system, we have established roles for each of the viral structural components in assembly, release, and virus infectivity. The envelope glycoprotein, Gn, was discovered to be necessary and sufficient for packaging of the genome, nucleocapsid protein and the RNA-dependent RNA polymerase into virus particles. Additionally, packaging of the genome was found to be necessary for the efficient release of particles, revealing a novel mechanism for the efficient generation of infectious virus. Our results identify possible conserved targets for development of anti-phlebovirus therapies.

  15. A geminivirus-based guide RNA delivery system for CRISPR/Cas9 mediated plant genome editing


    Yin, Kangquan; Han, Ting; Liu, Guang; Chen, Tianyuan; Wang, Ying; Yu, Alice Yunzi L.; Liu, Yule


    CRISPR/Cas has emerged as potent genome editing technology and has successfully been applied in many organisms, including several plant species. However, delivery of genome editing reagents remains a challenge in plants. Here, we report a virus-based guide RNA (gRNA) delivery system for CRISPR/Cas9 mediated plant genome editing (VIGE) that can be used to precisely target genome locations and cause mutations. VIGE is performed by using a modified Cabbage Leaf Curl virus (CaLCuV) vector to expr...

  16. Assessing single-stranded oligonucleotide drug-induced effects in vitro reveals key risk factors for thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Sabine Sewing

    Full Text Available Single-stranded oligonucleotides (ON comprise a promising therapeutic platform that enables selective modulation of currently undruggable targets. The development of novel ON drug candidates has demonstrated excellent efficacy, but in certain cases also some safety liabilities were reported. Among them are events of thrombocytopenia, which have recently been evident in late stage trials with ON drugs. The underlying mechanisms are poorly understood and the risk for ON candidates causing such events cannot be sufficiently assessed pre-clinically. We investigated potential thrombocytopenia risk factors of ONs and implemented a set of in vitro assays to assess these risks. Our findings support previous observations that phosphorothioate (PS-ONs can bind to platelet proteins such as platelet collagen receptor glycoprotein VI (GPVI and activate human platelets in vitro to various extents. We also show that these PS-ONs can bind to platelet factor 4 (PF4. Binding to platelet proteins and subsequent activation correlates with ON length and connected to this, the number of PS in the backbone of the molecule. Moreover, we demonstrate that locked nucleic acid (LNA ribosyl modifications in the wings of the PS-ONs strongly suppress binding to GPVI and PF4, paralleled by markedly reduced platelet activation. In addition, we provide evidence that PS-ONs do not directly affect hematopoietic cell differentiation in culture but at higher concentrations show a pro-inflammatory potential, which might contribute to platelet activation. Overall, our data confirm that certain molecular attributes of ONs are associated with a higher risk for thrombocytopenia. We propose that applying the in vitro assays discussed here during the lead optimization phase may aid in deprioritizing ONs with a potential to induce thrombocytopenia.

  17. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold. (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G


    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  18. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio


    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  19. Slowing single-stranded DNA translocation through a solid-state nanopore by decreasing the nanopore diameter. (United States)

    Akahori, Rena; Haga, Takanobu; Hatano, Toshiyuki; Yanagi, Itaru; Ohura, Takeshi; Hamamura, Hirotaka; Iwasaki, Tomio; Yokoi, Takahide; Anazawa, Takashi


    To slow the translocation of single-stranded DNA (ssDNA) through a solid-state nanopore, a nanopore was narrowed, and the effect of the narrowing on the DNA translocation speed was investigated. In order to accurately measure the speed, long (5.3 kb) ssDNA (namely, ss-poly(dA)) with uniform length (±0.4 kb) was synthesized. The diameters of nanopores fabricated by a transmission electron microscope were controlled by atomic-layer deposition. Reducing the nanopore diameter from 4.5 to 2.3 nm slowed down the translocation of ssDNA by more than 16 times (to 0.18 μs base(-1)) when 300 mV was applied across the nanopore. It is speculated that the interaction between the nanopore and the ssDNA dominates the translocation speed. Unexpectedly, the translocation speed of ssDNA through the 4.5 nm nanopore is more than two orders of magnitude higher than that of double-stranded DNA (dsDNA) through a nanopore of almost the same size. The cause of such a faster translocation of ssDNA can be explained by the weaker drag force inside the nanopore. Moreover, the measured translocation speeds of ssDNA and dsDNA agree well with those calculated by molecular-dynamics (MD) simulation. The MD simulation predicted that reducing the nanopore diameter to almost the same as that of ssDNA (i.e. 1.4 nm) decreases the translocation speed (to 1.4 μs base(-1)). Narrowing the nanopore is thus an effective approach for accomplishing nanopore DNA sequencing.

  20. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines. (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao


    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  1. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate. (United States)

    Zhang, Xueru; McGown, Linda B


    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Asymmetric Modification of Hepatitis B Virus (HBV) Genomes by an Endogenous Cytidine Deaminase inside HBV Cores Informs a Model of Reverse Transcription. (United States)

    Nair, Smita; Zlotnick, Adam


    Cytidine deaminases inhibit replication of a broad range of DNA viruses by deaminating cytidines on single-stranded DNA (ssDNA) to generate uracil. While several lines of evidence have revealed hepatitis B virus (HBV) genome editing by deamination, it is still unclear which nucleic acid intermediate of HBV is modified. Hepatitis B virus has a relaxed circular double-stranded DNA (rcDNA) genome that is reverse transcribed within virus cores from a RNA template. The HBV genome also persists as covalently closed circular DNA (cccDNA) in the nucleus of an infected cell. In the present study, we found that in HBV-producing HepAD38 and HepG2.2.15 cell lines, endogenous cytidine deaminases edited 10 to 25% of HBV rcDNA genomes, asymmetrically with almost all mutations on the 5' half of the minus strand. This region corresponds to the last half of the minus strand to be protected by plus-strand synthesis. Within this half of the genome, the number of mutations peaks in the middle. Overexpressed APOBEC3A and APOBEC3G could be packaged in HBV capsids but did not change the amount or distribution of mutations. We found no deamination on pregenomic RNA (pgRNA), indicating that an intact genome is encapsidated and deaminated during or after reverse transcription. The deamination pattern suggests a model of rcDNA synthesis in which pgRNA and then newly synthesized minus-sense single-stranded DNA are protected from deaminase by interaction with the virus capsid; during plus-strand synthesis, when enough dsDNA has been synthesized to displace the remaining minus strand from the capsid surface, the single-stranded DNA becomes deaminase sensitive. IMPORTANCE Host-induced mutation of the HBV genome by APOBEC proteins may be a path to clearing the virus. We examined cytidine-to-thymidine mutations in the genomes of HBV particles grown in the presence or absence of overexpressed APOBEC proteins. We found that genomes were subjected to deamination activity during reverse transcription

  3. Expression of IMP1 Enhances Production of Murine Leukemia Virus Vector by Facilitating Viral Genomic RNA Packaging


    Mai, Yun; Gao, Guangxia


    Murine leukemia virus (MLV)-based retroviral vector is widely used for gene transfer. Efficient packaging of the genomic RNA is critical for production of high-titer virus. Here, we report that expression of the insulin-like growth factor II mRNA binding protein 1 (IMP1) enhanced the production of infectious MLV vector. Overexpression of IMP1 increased the stability of viral genomic RNA in virus producer cells and packaging of the RNA into progeny virus in a dose-dependent manner. Downregulat...

  4. Polymorphism identification and improved genome annotation of Brassica rapa through Deep RNA sequencing. (United States)

    Devisetty, Upendra Kumar; Covington, Michael F; Tat, An V; Lekkala, Saradadevi; Maloof, Julin N


    The mapping and functional analysis of quantitative traits in Brassica rapa can be greatly improved with the availability of physically positioned, gene-based genetic markers and accurate genome annotation. In this study, deep transcriptome RNA sequencing (RNA-Seq) of Brassica rapa was undertaken with two objectives: SNP detection and improved transcriptome annotation. We performed SNP detection on two varieties that are parents of a mapping population to aid in development of a marker system for this population and subsequent development of high-resolution genetic map. An improved Brassica rapa transcriptome was constructed to detect novel transcripts and to improve the current genome annotation. This is useful for accurate mRNA abundance and detection of expression QTL (eQTLs) in mapping populations. Deep RNA-Seq of two Brassica rapa genotypes-R500 (var. trilocularis, Yellow Sarson) and IMB211 (a rapid cycling variety)-using eight different tissues (root, internode, leaf, petiole, apical meristem, floral meristem, silique, and seedling) grown across three different environments (growth chamber, greenhouse and field) and under two different treatments (simulated sun and simulated shade) generated 2.3 billion high-quality Illumina reads. A total of 330,995 SNPs were identified in transcribed regions between the two genotypes with an average frequency of one SNP in every 200 bases. The deep RNA-Seq reassembled Brassica rapa transcriptome identified 44,239 protein-coding genes. Compared with current gene models of B. rapa, we detected 3537 novel transcripts, 23,754 gene models had structural modifications, and 3655 annotated proteins changed. Gaps in the current genome assembly of B. rapa are highlighted by our identification of 780 unmapped transcripts. All the SNPs, annotations, and predicted transcripts can be viewed at Copyright © 2014 Devisetty et al.

  5. Does RNA editing compensate for Alu invasion of the primate genome? (United States)

    Levanon, Erez Y; Eisenberg, Eli


    One of the distinctive features of the primate genome is the Alu element, a repetitive short interspersed element, over a million highly similar copies of which account for >10% of the genome. A direct consequence of this feature is that primates' transcriptome is highly enriched in long stable dsRNA structures, the preferred target of adenosine deaminases acting on RNAs (ADARs), which are the enzymes catalyzing A-to-I RNA editing. Indeed, A-to-I editing by ADARs is extremely abundant in primates: over a hundred million editing sites exist in their genomes. However, there are few essential editing sites conserved across mammals that have maintained their editing level despite the radical change in ADAR target landscape. Here, we review and discuss the cost of having an unusual amount of dsRNA and editing in the transcriptome, as well as the opportunities it presents, which might have contributed to the accelerated evolution of the primates. © 2015 WILEY Periodicals, Inc.

  6. Advances in CRISPR-Cas9 genome engineering: lessons learned from RNA interference (United States)

    Barrangou, Rodolphe; Birmingham, Amanda; Wiemann, Stefan; Beijersbergen, Roderick L.; Hornung, Veit; Smith, Anja van Brabant


    The discovery that the machinery of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9 bacterial immune system can be re-purposed to easily create deletions, insertions and replacements in the mammalian genome has revolutionized the field of genome engineering and re-invigorated the field of gene therapy. Many parallels have been drawn between the newly discovered CRISPR-Cas9 system and the RNA interference (RNAi) pathway in terms of their utility for understanding and interrogating gene function in mammalian cells. Given this similarity, the CRISPR-Cas9 field stands to benefit immensely from lessons learned during the development of RNAi technology. We examine how the history of RNAi can inform today's challenges in CRISPR-Cas9 genome engineering such as efficiency, specificity, high-throughput screening and delivery for in vivo and therapeutic applications. PMID:25800748

  7. Aprataxin resolves adenylated RNA-DNA junctions to maintain genome integrity (United States)

    Tumbale, Percy; Williams, Jessica S.; Schellenberg, Matthew J.; Kunkel, Thomas A.; Williams, R. Scott


    Faithful maintenance and propagation of eukaryotic genomes is ensured by three-step DNA ligation reactions employed by ATP-dependent DNA ligases1,2. Paradoxically, when DNA ligases encounter nicked DNA structures with abnormal DNA termini, DNA ligase catalytic activity can generate and/or exacerbate DNA damage through abortive ligation that produces chemically adducted, toxic 5′-adenylated (5′-AMP) DNA lesions3–6 (Fig. 1a). Aprataxin (Aptx) reverses DNA-adenylation but the context for deadenylation repair is unclear. Here we examine the importance of Aptx to RNaseH2-dependent excision repair (RER) of a lesion that is very frequently introduced into DNA, a ribonucleotide. We show that ligases generate adenylated 5′-ends containing a ribose characteristic of RNaseH2 incision. Aptx efficiently repairs adenylated RNA-DNA, and acting in an RNA-DNA damage response (RDDR), promotes cellular survival and prevents S-phase checkpoint activation in budding yeast undergoing RER. Structure-function studies of human Aptx/RNA-DNA/AMP/Zn complexes define a mechanism for detecting and reversing adenylation at RNA-DNA junctions. This involves A-form RNA-binding, proper protein folding and conformational changes, all of which are impacted by heritable APTX mutations in Ataxia with Oculomotor Apraxia 1 (AOA1). Together, these results suggest that accumulation of adenylated RNA-DNA may contribute to neurological disease. PMID:24362567

  8. Mitochondrial Genome Evolution and a Novel RNA Editing System in Deep-Branching Heteroloboseids. (United States)

    Yang, Jiwon; Harding, Tommy; Kamikawa, Ryoma; Simpson, Alastair G B; Roger, Andrew J


    Discoba (Excavata) is an evolutionarily important group of eukaryotes that includes Jakobida, with the most bacterial-like mitochondrial genomes known, and Euglenozoa, many of which have extensively fragmented mitochondrial genomes. However, little is known about the mitochondrial genomes of Heterolobosea, the third main group of Discoba. Here, we studied two heteroloboseids-an undescribed amoeba "BB2" and Pharyngomonas kirbyi. Phylogenomic analysis revealed that they form a clade that is a sister group to all other Heterolobosea. We characterized the mitochondrial genomes of BB2 and P. kirbyi, which encoded 44 and 48 putative protein-coding genes respectively. Their gene contents were similar to that of Naegleria. In BB2, mitochondrially encoded RNAs were heavily edited, with ∼500 mononucleotide insertion events, mostly guanosines. These insertions always have the same identity as an adjacent nucleotide. Editing occurs in all ribosomal RNAs and protein-coding transcripts except one, and half of the transfer RNAs. Analysis of Illumina deep-sequencing data suggested that this RNA editing is very accurate and efficient, and most likely co-transcriptional. The dissimilarity of this editing process to other RNA editing phenomena in discobids, as well as its apparent absence in P. kirbyi, suggest that this remarkably extensive system of insertional editing evolved independently in the BB2 lineage, after its divergence from the P. kirbyi lineage. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. Theory Meets Experiment: Metal Ion Effects in HCV Genomic RNA Kissing Complex Formation. (United States)

    Sun, Li-Zhen; Heng, Xiao; Chen, Shi-Jie


    The long-range base pairing between the 5BSL3. 2 and 3'X domains in hepatitis C virus (HCV) genomic RNA is essential for viral replication. Experimental evidence points to the critical role of metal ions, especially Mg 2+ ions, in the formation of the 5BSL3.2:3'X kissing complex. Furthermore, NMR studies suggested an important ion-dependent conformational switch in the kissing process. However, for a long time, mechanistic understanding of the ion effects for the process has been unclear. Recently, computational modeling based on the Vfold RNA folding model and the partial charge-based tightly bound ion (PCTBI) model, in combination with the NMR data, revealed novel physical insights into the role of metal ions in the 5BSL3.2-3'X system. The use of the PCTBI model, which accounts for the ion correlation and fluctuation, gives reliable predictions for the ion-dependent electrostatic free energy landscape and ion-induced population shift of the 5BSL3.2:3'X kissing complex. Furthermore, the predicted ion binding sites offer insights about how ion-RNA interactions shift the conformational equilibrium. The integrated theory-experiment study shows that Mg 2+ ions may be essential for HCV viral replication. Moreover, the observed Mg 2+ -dependent conformational equilibrium may be an adaptive property of the HCV genomic RNA such that the equilibrium is optimized to the intracellular Mg 2+ concentration in liver cells for efficient viral replication.

  10. Reexamining microRNA site accessibility in Drosophila: a population genomics study.

    Directory of Open Access Journals (Sweden)

    Kevin Chen

    Full Text Available Kertesz et al. (Nature Genetics 2008 described PITA, a miRNA target prediction algorithm based on hybridization energy and site accessibility. In this note, we used a population genomics approach to reexamine their data and found that the PITA algorithm had lower specificity than methods based on evolutionary conservation at comparable levels of sensitivity.We also showed that deeply conserved miRNAs tend to have stronger hybridization energies to their targets than do other miRNAs. Although PITA had higher specificity in predicting targets than a naïve seed-match method, this signal was primarily due to the use of a single cutoff score for all miRNAs and to the observed correlation between conservation and hybridization energy. Overall, our results clarify the accuracy of different miRNA target prediction algorithms in Drosophila and the role of site accessibility in miRNA target prediction.

  11. SEXCMD: Development and validation of sex marker sequences for whole-exome/genome and RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Seongmun Jeong

    Full Text Available Over the last decade, a large number of nucleotide sequences have been generated by next-generation sequencing technologies and deposited to public databases. However, most of these datasets do not specify the sex of individuals sampled because researchers typically ignore or hide this information. Male and female genomes in many species have distinctive sex chromosomes, XX/XY and ZW/ZZ, and expression levels of many sex-related genes differ between the sexes. Herein, we describe how to develop sex marker sequences from syntenic regions of sex chromosomes and use them to quickly identify the sex of individuals being analyzed. Array-based technologies routinely use either known sex markers or the B-allele frequency of X or Z chromosomes to deduce the sex of an individual. The same strategy has been used with whole-exome/genome sequence data; however, all reads must be aligned onto a reference genome to determine the B-allele frequency of the X or Z chromosomes. SEXCMD is a pipeline that can extract sex marker sequences from reference sex chromosomes and rapidly identify the sex of individuals from whole-exome/genome and RNA sequencing after training with a known dataset through a simple machine learning approach. The pipeline counts total numbers of hits from sex-specific marker sequences and identifies the sex of the individuals sampled based on the fact that XX/ZZ samples do not have Y or W chromosome hits. We have successfully validated our pipeline with mammalian (Homo sapiens; XY and avian (Gallus gallus; ZW genomes. Typical calculation time when applying SEXCMD to human whole-exome or RNA sequencing datasets is a few minutes, and analyzing human whole-genome datasets takes about 10 minutes. Another important application of SEXCMD is as a quality control measure to avoid mixing samples before bioinformatics analysis. SEXCMD comprises simple Python and R scripts and is freely available at

  12. SEXCMD: Development and validation of sex marker sequences for whole-exome/genome and RNA sequencing. (United States)

    Jeong, Seongmun; Kim, Jiwoong; Park, Won; Jeon, Hongmin; Kim, Namshin


    Over the last decade, a large number of nucleotide sequences have been generated by next-generation sequencing technologies and deposited to public databases. However, most of these datasets do not specify the sex of individuals sampled because researchers typically ignore or hide this information. Male and female genomes in many species have distinctive sex chromosomes, XX/XY and ZW/ZZ, and expression levels of many sex-related genes differ between the sexes. Herein, we describe how to develop sex marker sequences from syntenic regions of sex chromosomes and use them to quickly identify the sex of individuals being analyzed. Array-based technologies routinely use either known sex markers or the B-allele frequency of X or Z chromosomes to deduce the sex of an individual. The same strategy has been used with whole-exome/genome sequence data; however, all reads must be aligned onto a reference genome to determine the B-allele frequency of the X or Z chromosomes. SEXCMD is a pipeline that can extract sex marker sequences from reference sex chromosomes and rapidly identify the sex of individuals from whole-exome/genome and RNA sequencing after training with a known dataset through a simple machine learning approach. The pipeline counts total numbers of hits from sex-specific marker sequences and identifies the sex of the individuals sampled based on the fact that XX/ZZ samples do not have Y or W chromosome hits. We have successfully validated our pipeline with mammalian (Homo sapiens; XY) and avian (Gallus gallus; ZW) genomes. Typical calculation time when applying SEXCMD to human whole-exome or RNA sequencing datasets is a few minutes, and analyzing human whole-genome datasets takes about 10 minutes. Another important application of SEXCMD is as a quality control measure to avoid mixing samples before bioinformatics analysis. SEXCMD comprises simple Python and R scripts and is freely available at

  13. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis. (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J


    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  14. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.


    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  15. The effect of RNA stiffness on the self-assembly of virus particles (United States)

    Li, Siyu; Erdemci-Tandogan, Gonca; van der Schoot, Paul; Zandi, Roya


    Under many in vitro conditions, some small viruses spontaneously encapsidate a single stranded (ss) RNA into a protein shell called the capsid. While viral RNAs are found to be compact and highly branched because of long distance base-pairing between nucleotides, recent experiments reveal that in a head-to-head competition between an ssRNA with no secondary or higher order structure and a viral RNA, the capsid proteins preferentially encapsulate the linear polymer! In this paper, we study the impact of genome stiffness on the encapsidation free energy of the complex of RNA and capsid proteins. We show that an increase in effective chain stiffness because of base-pairing could be the reason why under certain conditions linear chains have an advantage over branched chains when it comes to encapsidation efficiency. While branching makes the genome more compact, RNA base-pairing increases the effective Kuhn length of the RNA molecule, which could result in an increase of the free energy of RNA confinement, that is, the work required to encapsidate RNA, and thus less efficient packaging.

  16. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça


    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  17. Synthesis of a gene for the HIV transactivator protein TAT by a novel single stranded approach involving in vivo gap repair.


    Adams, S E; Johnson, I D; Braddock, M; Kingsman, A J; Kingsman, S M; Edwards, R M


    The synthesis of a gene for the HIV TAT protein is described using a novel approach that capitalises on the ability to synthesise oligonucleotides of greater than 100 bp in length. It involves the synthesis of large oligomers covering one strand of the desired gene in its entirety and the use of small complementary bridging and adapter oligonucleotides to direct the assembly and cloning of the large oligomers. After ligation to the cloning vector the partially single stranded intermediate is ...

  18. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers


    Antolin, M. F.; Bosio, C. F.; Cotton, J.; Sweeney, W.; Strand, M. R.; Black-IV, W. C.


    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  19. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr


    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single- strand ed DNA -binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  20. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.


    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  1. Escherichia coli Single-Stranded DNA-Binding Protein: NanoESI-MS Studies of Salt-Modulated Subunit Exchange and DNA Binding Transactions (United States)

    Mason, Claire E.; Jergic, Slobodan; Lo, Allen T. Y.; Wang, Yao; Dixon, Nicholas E.; Beck, Jennifer L.


    Single-stranded DNA-binding proteins (SSBs) are ubiquitous oligomeric proteins that bind with very high affinity to single-stranded DNA and have a variety of essential roles in DNA metabolism. Nanoelectrospray ionization mass spectrometry (nanoESI-MS) was used to monitor subunit exchange in full-length and truncated forms of the homotetrameric SSB from Escherichia coli. Subunit exchange in the native protein was found to occur slowly over a period of hours, but was significantly more rapid in a truncated variant of SSB from which the eight C-terminal residues were deleted. This effect is proposed to result from C-terminus mediated stabilization of the SSB tetramer, in which the C-termini interact with the DNA-binding cores of adjacent subunits. NanoESI-MS was also used to examine DNA binding to the SSB tetramer. Binding of single-stranded oligonucleotides [one molecule of (dT)70, one molecule of (dT)35, or two molecules of (dT)35] was found to prevent SSB subunit exchange. Transfer of SSB tetramers between discrete oligonucleotides was also observed and is consistent with predictions from solution-phase studies, suggesting that SSB-DNA complexes can be reliably analyzed by ESI mass spectrometry.

  2. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.


    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  3. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.


    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  4. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes. (United States)

    Castro-Chavez, Fernando


    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  5. Hepatitis C virus double-stranded RNA is the predominant form in human liver and in interferon-treated cells. (United States)

    Klepper, Arielle; Eng, Francis J; Doyle, Erin H; El-Shamy, Ahmed; Rahman, Adeeb H; Fiel, M Isabel; Avino, Gonzalo Carrasco; Lee, Moonju; Ye, Fei; Roayaie, Sasan; Bansal, Meena B; MacDonald, Margaret R; Schiano, Thomas D; Branch, Andrea D


    Hepatitis C virus (HCV) is unique among RNA viruses in its ability to establish chronic infection in the majority of exposed adults. HCV persists in the liver despite interferon (IFN)-stimulated gene (ISG) induction; robust induction actually predicts treatment failure and viral persistence. It is unclear which forms of HCV RNA are associated with ISG induction and IFN resistance during natural infections. To thoroughly delineate HCV RNA populations, we developed conditions that fully separate the strands of long double-stranded RNA (dsRNA) and allow the released RNAs to be quantified in reverse transcription/polymerase chain reaction assays. These methods revealed that dsRNA, a pathogen-associated molecular pattern (PAMP), comprised 52% (standard deviation, 28%) of the HCV RNA in the livers of patients with chronic infection. HCV dsRNA was proportionally higher in patients with the unfavorable IL28B TT (rs12979860) genotype. Higher ratios of HCV double-stranded to single-stranded RNA (ssRNA) correlated positively with ISG induction. In Huh-7.5 cells, IFN treatment increased the total amount of HCV dsRNA through a process that required de novo viral RNA synthesis and shifted the ratio of viral dsRNA/ssRNA in favor of dsRNA. This shift was blocked by ribavirin (RBV), an antiviral drug that reduces relapse in HCV patients. Northern blotting established that HCV dsRNA contained genome-length minus strands. HCV dsRNA is the predominant form in the HCV-infected liver and has features of both a PAMP and a genomic reservoir. Interferon treatment increased rather than decreased HCV dsRNA. This unexpected finding suggests that HCV produces dsRNA in response to IFN, potentially to antagonize antiviral defenses. (Hepatology 2017;66:357-370). © 2016 The Authors. Hepatology published by Wiley Periodicals, Inc., on behalf of the American Association for the Study of Liver Diseases.

  6. Intron gain by tandem genomic duplication: a novel case in a potato gene encoding RNA-dependent RNA polymerase

    Directory of Open Access Journals (Sweden)

    Ming-Yue Ma


    Full Text Available The origin and subsequent accumulation of spliceosomal introns are prominent events in the evolution of eukaryotic gene structure. However, the mechanisms underlying intron gain remain unclear because there are few proven cases of recently gained introns. In an RNA-dependent RNA polymerase (RdRp gene, we found that a tandem duplication occurred after the divergence of potato and its wild relatives among other Solanum plants. The duplicated sequence crosses the intron-exon boundary of the first intron and the second exon. A new intron was detected at this duplicated region, and it includes a small previously exonic segment of the upstream copy of the duplicated sequence and the intronic segment of the downstream copy of the duplicated sequence. The donor site of this new intron was directly obtained from the small previously exonic segment. Most of the splicing signals were inherited directly from the parental intron/exon structure, including a putative branch site, the polypyrimidine tract, the 3′ splicing site, two putative exonic splicing enhancers, and the GC contents differed between the intron and exon. In the widely cited model of intron gain by tandem genomic duplication, the duplication of an AGGT-containing exonic segment provides the GT and AG splicing sites for the new intron. Our results illustrate that the tandem duplication model of intron gain should be diverse in terms of obtaining the proper splicing signals.

  7. Structure of noncoding RNA is a determinant of function of RNA binding proteins in transcriptional regulation

    Directory of Open Access Journals (Sweden)

    Oyoshi Takanori


    Full Text Available Abstract The majority of the noncoding regions of mammalian genomes have been found to be transcribed to generate noncoding RNAs (ncRNAs, resulting in intense interest in their biological roles. During the past decade, numerous ncRNAs and aptamers have been identified as regulators of transcription. 6S RNA, first described as a ncRNA in E. coli, mimics an open promoter structure, which has a large bulge with two hairpin/stalk structures that regulate transcription through interactions with RNA polymerase. B2 RNA, which has stem-loops and unstructured single-stranded regions, represses transcription of mRNA in response to various stresses, including heat shock in mouse cells. The interaction of TLS (translocated in liposarcoma with CBP/p300 was induced by ncRNAs that bind to TLS, and this in turn results in inhibition of CBP/p300 histone acetyltransferase (HAT activity in human cells. Transcription regulator EWS (Ewing's sarcoma, which is highly related to TLS, and TLS specifically bind to G-quadruplex structures in vitro. The carboxy terminus containing the Arg-Gly-Gly (RGG repeat domains in these proteins are necessary for cis-repression of transcription activation and HAT activity by the N-terminal glutamine-rich domain. Especially, the RGG domain in the carboxy terminus of EWS is important for the G-quadruplex specific binding. Together, these data suggest that functions of EWS and TLS are modulated by specific structures of ncRNAs.

  8. De novo reconstruction of consensus master genomes of plant RNA and DNA viruses from siRNAs. (United States)

    Seguin, Jonathan; Rajeswaran, Rajendran; Malpica-López, Nachelli; Martin, Robert R; Kasschau, Kristin; Dolja, Valerian V; Otten, Patricia; Farinelli, Laurent; Pooggin, Mikhail M


    Virus-infected plants accumulate abundant, 21-24 nucleotide viral siRNAs which are generated by the evolutionary conserved RNA interference (RNAi) machinery that regulates gene expression and defends against invasive nucleic acids. Here we show that, similar to RNA viruses, the entire genome sequences of DNA viruses are densely covered with siRNAs in both sense and antisense orientations. This implies pervasive transcription of both coding and non-coding viral DNA in the nucleus, which generates double-stranded RNA precursors of viral siRNAs. Consistent with our finding and hypothesis, we demonstrate that the complete genomes of DNA viruses from Caulimoviridae and Geminiviridae families can be reconstructed by deep sequencing and de novo assembly of viral siRNAs using bioinformatics tools. Furthermore, we prove that this 'siRNA omics' approach can be used for reliable identification of the consensus master genome and its microvariants in viral quasispecies. Finally, we utilized this approach to reconstruct an emerging DNA virus and two viroids associated with economically-important red blotch disease of grapevine, and to rapidly generate a biologically-active clone representing the wild type master genome of Oilseed rape mosaic virus. Our findings show that deep siRNA sequencing allows for de novo reconstruction of any DNA or RNA virus genome and its microvariants, making it suitable for universal characterization of evolving viral quasispecies as well as for studying the mechanisms of siRNA biogenesis and RNAi-based antiviral defense.

  9. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)


    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  10. Efficient CRISPR/Cas9-Mediated Genome Editing Using a Chimeric Single-Guide RNA Molecule

    KAUST Repository

    Butt, Haroon


    The CRISPR/Cas9 system has been applied in diverse eukaryotic organisms for targeted mutagenesis. However, targeted gene editing is inefficient and requires the simultaneous delivery of a DNA template for homology-directed repair (HDR). Here, we used CRISPR/Cas9 to generate targeted double-strand breaks and to deliver an RNA repair template for HDR in rice (Oryza sativa). We used chimeric single-guide RNA (cgRNA) molecules carrying both sequences for target site specificity (to generate the double-strand breaks) and repair template sequences (to direct HDR), flanked by regions of homology to the target. Gene editing was more efficient in rice protoplasts using repair templates complementary to the non-target DNA strand, rather than the target strand. We applied this cgRNA repair method to generate herbicide resistance in rice, which showed that this cgRNA repair method can be used for targeted gene editing in plants. Our findings will facilitate applications in functional genomics and targeted improvement of crop traits.

  11. Inference of high resolution HLA types using genome-wide RNA or DNA sequencing reads. (United States)

    Bai, Yu; Ni, Min; Cooper, Blerta; Wei, Yi; Fury, Wen


    Accurate HLA typing at amino acid level (four-digit resolution) is critical in hematopoietic and organ transplantations, pathogenesis studies of autoimmune and infectious diseases, as well as the development of immunoncology therapies. With the rapid adoption of genome-wide sequencing in biomedical research, HLA typing based on transcriptome and whole exome/genome sequencing data becomes increasingly attractive due to its high throughput and convenience. However, unlike targeted amplicon sequencing, genome-wide sequencing often employs a reduced read length and coverage that impose great challenges in resolving the highly homologous HLA alleles. Though several algorithms exist and have been applied to four-digit typing, some deliver low to moderate accuracies, some output ambiguous predictions. Moreover, few methods suit diverse read lengths and depths, and both RNA and DNA sequencing inputs. New algorithms are therefore needed to leverage the accuracy and flexibility of HLA typing at high resolution using genome-wide sequencing data. We have developed a new algorithm named PHLAT to discover the most probable pair of HLA alleles at four-digit resolution or higher, via a unique integration of a candidate allele selection and a likelihood scoring. Over a comprehensive set of benchmarking data (a total of 768 HLA alleles) from both RNA and DNA sequencing and with a broad range of read lengths and coverage, PHLAT consistently achieves a high accuracy at four-digit (92%-95%) and two-digit resolutions (96%-99%), outcompeting most of the existing methods. It also supports targeted amplicon sequencing data from Illumina Miseq. PHLAT significantly leverages the accuracy and flexibility of high resolution HLA typing based on genome-wide sequencing data. It may benefit both basic and applied research in immunology and related fields as well as numerous clinical applications.

  12. Cell-type-specific genome editing with a microRNA-responsive CRISPR-Cas9 switch. (United States)

    Hirosawa, Moe; Fujita, Yoshihiko; Parr, Callum J C; Hayashi, Karin; Kashida, Shunnichi; Hotta, Akitsu; Woltjen, Knut; Saito, Hirohide


    The CRISPR-Cas9 system is a powerful genome-editing tool useful in a variety of biotechnology and biomedical applications. Here we developed a synthetic RNA-based, microRNA (miRNA)-responsive CRISPR-Cas9 system (miR-Cas9 switch) in which the genome editing activity of Cas9 can be modulated through endogenous miRNA signatures in mammalian cells. We created miR-Cas9 switches by using a miRNA-complementary sequence in the 5΄-UTR of mRNA encoding Streptococcus pyogenes Cas9. The miR-21-Cas9 or miR-302-Cas9 switches selectively and efficiently responded to miR-21-5p in HeLa cells or miR-302a-5p in human induced pluripotent stem cells, and post-transcriptionally attenuated the Cas9 activity only in the target cells. Moreover, the miR-Cas9 switches could differentially control the genome editing by sensing endogenous miRNA activities within a heterogeneous cell population. Our miR-Cas9 switch system provides a promising framework for cell-type selective genome editing and cell engineering based on intracellular miRNA information. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Cell-type-specific genome editing with a microRNA-responsive CRISPR–Cas9 switch (United States)

    Hirosawa, Moe; Fujita, Yoshihiko; Parr, Callum J. C.; Hayashi, Karin; Kashida, Shunnichi; Hotta, Akitsu; Woltjen, Knut


    Abstract The CRISPR–Cas9 system is a powerful genome-editing tool useful in a variety of biotechnology and biomedical applications. Here we developed a synthetic RNA-based, microRNA (miRNA)-responsive CRISPR–Cas9 system (miR-Cas9 switch) in which the genome editing activity of Cas9 can be modulated through endogenous miRNA signatures in mammalian cells. We created miR-Cas9 switches by using a miRNA-complementary sequence in the 5΄-UTR of mRNA encoding Streptococcus pyogenes Cas9. The miR-21-Cas9 or miR-302-Cas9 switches selectively and efficiently responded to miR-21-5p in HeLa cells or miR-302a-5p in human induced pluripotent stem cells, and post-transcriptionally attenuated the Cas9 activity only in the target cells. Moreover, the miR-Cas9 switches could differentially control the genome editing by sensing endogenous miRNA activities within a heterogeneous cell population. Our miR-Cas9 switch system provides a promising framework for cell-type selective genome editing and cell engineering based on intracellular miRNA information. PMID:28525578

  14. Exploring systemic RNA interference in insects: a genome-wide survey for RNAi genes in Tribolium. (United States)

    Tomoyasu, Yoshinori; Miller, Sherry C; Tomita, Shuichiro; Schoppmeier, Michael; Grossmann, Daniela; Bucher, Gregor


    RNA interference (RNAi) is a highly conserved cellular mechanism. In some organisms, such as Caenorhabditis elegans, the RNAi response can be transmitted systemically. Some insects also exhibit a systemic RNAi response. However, Drosophila, the leading insect model organism, does not show a robust systemic RNAi response, necessitating another model system to study the molecular mechanism of systemic RNAi in insects. We used Tribolium, which exhibits robust systemic RNAi, as an alternative model system. We have identified the core RNAi genes, as well as genes potentially involved in systemic RNAi, from the Tribolium genome. Both phylogenetic and functional analyses suggest that Tribolium has a somewhat larger inventory of core component genes than Drosophila, perhaps allowing a more sensitive response to double-stranded RNA (dsRNA). We also identified three Tribolium homologs of C. elegans sid-1, which encodes a possible dsRNA channel. However, detailed sequence analysis has revealed that these Tribolium homologs share more identity with another C. elegans gene, tag-130. We analyzed tag-130 mutants, and found that this gene does not have a function in systemic RNAi in C. elegans. Likewise, the Tribolium sid-like genes do not seem to be required for systemic RNAi. These results suggest that insect sid-1-like genes have a different function than dsRNA uptake. Moreover, Tribolium lacks homologs of several genes important for RNAi in C. elegans. Although both Tribolium and C. elegans show a robust systemic RNAi response, our genome-wide survey reveals significant differences between the RNAi mechanisms of these organisms. Thus, insects may use an alternative mechanism for the systemic RNAi response. Understanding this process would assist with rendering other insects amenable to systemic RNAi, and may influence pest control approaches.

  15. Cytoplasmic translocation of polypyrimidine tract-binding protein and its binding to viral RNA during Japanese encephalitis virus infection inhibits virus replication.

    Directory of Open Access Journals (Sweden)

    Deepika Bhullar

    Full Text Available Japanese encephalitis virus (JEV has a single-stranded, positive-sense RNA genome containing a single open reading frame flanked by the 5'- and 3'-non-coding regions (NCRs. The virus genome replicates via a negative-sense RNA intermediate. The NCRs and their complementary sequences in the negative-sense RNA are the sites for assembly of the RNA replicase complex thereby regulating the RNA synthesis and virus replication. In this study, we show that the 55-kDa polypyrimidine tract-binding protein (PTB interacts in vitro with both the 5'-NCR of the positive-sense genomic RNA--5NCR(+, and its complementary sequence in the negative-sense replication intermediate RNA--3NCR(-. The interaction of viral RNA with PTB was validated in infected cells by JEV RNA co-immunoprecipitation and JEV RNA-PTB colocalization experiments. Interestingly, we observed phosphorylation-coupled translocation of nuclear PTB to cytoplasmic foci that co-localized with JEV RNA early during JEV infection. Our studies employing the PTB silencing and over-expression in cultured cells established an inhibitory role of PTB in JEV replication. Using RNA-protein binding assay we show that PTB competitively inhibits association of JEV 3NCR(- RNA with viral RNA-dependent RNA polymerase (NS5 protein, an event required for the synthesis of the plus-sense genomic RNA. cAMP is known to promote the Protein kinase A (PKA-mediated PTB phosphorylation. We show that cells treated with a cAMP analogue had an enhanced level of phosphorylated PTB in the cytoplasm and a significantly suppressed JEV replication. Data presented here show a novel, cAMP-induced, PTB-mediated, innate host response that could effectively suppress JEV replication in mammalian cells.

  16. Evasion of early innate immune response by 2'-O-methylation of dengue genomic RNA. (United States)

    Chang, David C; Hoang, Long T; Mohamed Naim, Ahmad Nazri; Dong, Hongping; Schreiber, Mark J; Hibberd, Martin L; Tan, Min Jie Alvin; Shi, Pei-Yong


    Dengue virus (DENV) is the most prevalent mosquito-borne virus pathogen in humans. There is currently no antiviral therapeutic or widely available vaccine against dengue infection. The DENV RNA genome is methylated on its 5' cap by its NS5 protein. DENV bearing a single E216A point mutation in NS5 loses 2'-O-methylation of its genome. While this mutant DENV is highly attenuated and immunogenic, the mechanism of this attenuation has not been elucidated. In this study, we find that replication of this mutant DENV is attenuated very early during infection. This early attenuation is not dependent on a functional type I interferon response and coincides with early activation of the innate immune response. Taken together, our data suggest that 2'-O-methylation of DENV genomic RNA is important for evasion of the host immune response during the very early stages of infection as the virus seeks to establish infection. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. In Silico Reconstruction of Viral Genomes from Small RNAs Improves Virus-Derived Small Interfering RNA Profiling ▿ † ‡ (United States)

    Vodovar, Nicolas; Goic, Bertsy; Blanc, Hervé; Saleh, Maria-Carla


    RNA interference (RNAi) is the essential component of antiviral immunity in invertebrates and plants. One of the landmarks of the antiviral RNAi response is the production of virus-derived small interfering RNA (vsiRNA) from viral double-stranded RNA (dsRNA). vsiRNAs constitute a fragmented image of the viral genome sequence that results from Dicer cleavage. vsiRNA sequence profiling is used extensively as a surrogate to study the antiviral RNAi response by determining the nature of the viral dsRNA molecules exposed to and processed by the RNAi machinery. The accuracy of these profiles depends on the actual viral genome sequence used as a reference to align vsiRNA reads, and the interpretation of inaccurate profiles can be misleading. Using Flock house virus and Drosophila melanogaster as a model RNAi-competent organism, we show accurate reconstruction of full-length virus reference sequence from vsiRNAs and prediction of the structure of defective interfering particles (DIs). We developed a Perl script, named Paparazzi, that reconstitutes viral genomes through an iterative alignment/consensus call procedure using a related reference sequence as scaffold. As prevalent DI-derived reads introduce artifacts during reconstruction, Paparazzi eliminates DI-specific reads to improve the quality of the reconstructed genome. Paparazzi constitutes a promising alternative to Sanger sequencing in this context and an effective tool to study antiviral RNAi mechanisms by accurately quantifying vsiRNA along the replicating viral genome. We further discuss Paparazzi as a companion tool for virus discovery as it provides full-length genome sequences and corrects for potential artifacts of assembly. PMID:21880776

  18. Whole-Genome Thermodynamic Analysis Reduces siRNA Off-Target Effects (United States)

    Chen, Xi; Liu, Peng; Chou, Hui-Hsien


    Small interfering RNAs (siRNAs) are important tools for knocking down targeted genes, and have been widely applied to biological and biomedical research. To design siRNAs, two important aspects must be considered: the potency in knocking down target genes and the off-target effect on any nontarget genes. Although many studies have produced useful tools to design potent siRNAs, off-target prevention has mostly been delegated to sequence-level alignment tools such as BLAST. We hypothesize that whole-genome thermodynamic analysis can identify potential off-targets with higher precision and help us avoid siRNAs that may have strong off-target effects. To validate this hypothesis, two siRNA sets were designed to target three human genes IDH1, ITPR2 and TRIM28. They were selected from the output of two popular siRNA design tools, siDirect and siDesign. Both siRNA design tools have incorporated sequence-level screening to avoid off-targets, thus their output is believed to be optimal. However, one of the sets we tested has off-target genes predicted by Picky, a whole-genome thermodynamic analysis tool. Picky can identify off-target genes that may hybridize to a siRNA within a user-specified melting temperature range. Our experiments validated that some off-target genes predicted by Picky can indeed be inhibited by siRNAs. Similar experiments were performed using commercially available siRNAs and a few off-target genes were also found to be inhibited as predicted by Picky. In summary, we demonstrate that whole-genome thermodynamic analysis can identify off-target genes that are missed in sequence-level screening. Because Picky prediction is deterministic according to thermodynamics, if a siRNA candidate has no Picky predicted off-targets, it is unlikely to cause off-target effects. Therefore, we recommend including Picky as an additional screening step in siRNA design. PMID:23484018

  19. A Universal Next-Generation Sequencing Protocol To Generate Noninfectious Barcoded cDNA Libraries from High-Containment RNA Viruses (United States)

    Moser, Lindsey A.; Ramirez-Carvajal, Lisbeth; Puri, Vinita; Pauszek, Steven J.; Matthews, Krystal; Dilley, Kari A.; Mullan, Clancy; McGraw, Jennifer; Khayat, Michael; Beeri, Karen; Yee, Anthony; Dugan, Vivien; Heise, Mark T.; Frieman, Matthew B.; Rodriguez, Luis L.; Bernard, Kristen A.; Wentworth, David E.


    ABSTRACT Several biosafety level 3 and/or 4 (BSL-3/4) pathogens are high-consequence, single-stranded RNA viruses, and their genomes, when introduced into permissive cells, are infectious. Moreover, many of these viruses are select agents (SAs), and their genomes are also considered SAs. For this reason, cDNAs and/or their derivatives must be tested to ensure the absence of infectious virus and/or viral RNA before transfer out of the BSL-3/4 and/or SA laboratory. This tremendously limits the capacity to conduct viral genomic research, particularly the application of next-generation sequencing (NGS). Here, we present a sequence-independent method to rapidly amplify viral genomic RNA while simultaneously abolishing both viral and genomic RNA infectivity across multiple single-stranded positive-sense RNA (ssRNA+) virus families. The process generates barcoded DNA amplicons that range in length from 300 to 1,000 bp, which cannot be used to rescue a virus and are stable to transport at room temperature. Our barcoding approach allows for up to 288 barcoded samples to be pooled into a single library and run across various NGS platforms without potential reconstitution of the viral genome. Our data demonstrate that this approach provides full-length genomic sequence information not only from high-titer virion preparations but it can also recover specific viral sequence from samples with limited starting material in the background of cellular RNA, and it can be used to identify pathogens from unknown samples. In summary, we describe a rapid, universal standard operating procedure that generates high-quality NGS libraries free of infectious virus and infectious viral RNA. IMPORTANCE This report establishes and validates a standard operating procedure (SOP) for select agents (SAs) and other biosafety level 3 and/or 4 (BSL-3/4) RNA viruses to rapidly generate noninfectious, barcoded cDNA amenable for next-generation sequencing (NGS). This eliminates the burden of testing all

  20. Transmissible Gastroenteritis Coronavirus Genome Packaging Signal Is Located at the 5′ End of the Genome and Promotes Viral RNA Incorporation into Virions in a Replication-Independent Process


    Morales, Lucia; Mateos-Gomez, Pedro A.; Capiscol, Carmen; del Palacio, Lorena; Enjuanes, Luis; Sola, Isabel


    Preferential RNA packaging in coronaviruses involves the recognition of viral genomic RNA, a crucial process for viral particle morphogenesis mediated by RNA-specific sequences, known as packaging signals. An essential packaging signal component of transmissible gastroenteritis coronavirus (TGEV) has been further delimited to the first 598 nucleotides (nt) from the 5′ end of its RNA genome, by using recombinant viruses transcribing subgenomic mRNA that included potential packaging signals. Th...

  1. The contribution of co-transcriptional RNA:DNA hybrid structures to DNA damage and genome instability. (United States)

    Hamperl, Stephan; Cimprich, Karlene A


    Accurate DNA replication and DNA repair are crucial for the maintenance of genome stability, and it is generally accepted that failure of these processes is a major source of DNA damage in cells. Intriguingly, recent evidence suggests that DNA damage is more likely to occur at genomic loci with high transcriptional activity. Furthermore, loss of certain RNA processing factors in eukaryotic cells is associated with increased formation of co-transcriptional RNA:DNA hybrid structures known as R-loops, resulting in double-strand breaks (DSBs) and DNA damage. However, the molecular mechanisms by which R-loop structures ultimately lead to DNA breaks and genome instability is not well understood. In this review, we summarize the current knowledge about the formation, recognition and processing of RNA:DNA hybrids, and discuss possible mechanisms by which these structures contribute to DNA damage and genome instability in the cell. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Coordination of Genomic RNA Packaging with Viral Assembly in HIV-1

    Directory of Open Access Journals (Sweden)

    Chris Hellmund


    Full Text Available The tremendous progress made in unraveling the complexities of human immunodeficiency virus (HIV replication has resulted in a library of drugs to target key aspects of the replication cycle of the virus. Yet, despite this accumulated wealth of knowledge, we still have much to learn about certain viral processes. One of these is virus assembly, where the viral genome and proteins come together to form infectious progeny. Here we review this topic from the perspective of how the route to production of an infectious virion is orchestrated by the viral genome, and we compare and contrast aspects of the assembly mechanisms employed by HIV-1 with those of other RNA viruses.

  3. Lingering Questions about Enhancer RNA and Enhancer Transcription-Coupled Genomic Integrity (United States)

    Rothschild, Gerson; Basu, Uttiya


    Intergenic and intragenic enhancers found inside topologically associated regulatory domains (TADs) express noncoding RNAs, known as enhancer RNAs (eRNAs). Recent studies have indicated these eRNAs play a role in gene regulatory networks by controlling promoter and enhancer interactions and topology of higher-order chromatin structure. Misregulation of enhancer and promoter associated noncoding RNAs (ncRNAs) could stabilize deleterious secondary DNA structures, noncoding RNA associated DNA/RNA hybrid formation, and promote collisions of transcription complexes with replisomes. It is revealing that many chromosomal aberrations, some associated with malignancies, are present inside enhancer and/or promoter sequences. Here, we expand on current concepts to discuss enhancer RNAs and enhancer transcription, and how enhancer transcription influences genomic organization and integrity. PMID:28087167

  4. Lingering Questions about Enhancer RNA and Enhancer Transcription-Coupled Genomic Instability. (United States)

    Rothschild, Gerson; Basu, Uttiya


    Intergenic and intragenic enhancers found inside topologically associated regulatory domains (TADs) express noncoding RNAs, known as enhancer RNAs (eRNAs). Recent studies have indicated these eRNAs play a role in gene regulatory networks by controlling promoter and enhancer interactions and topology of higher-order chromatin structure. Misregulation of enhancer and promoter associated noncoding RNAs (ncRNAs) could stabilize deleterious secondary DNA structures, noncoding RNA associated DNA/RNA hybrid formation, and promote collisions of transcription complexes with replisomes. It is revealing that many chromosomal aberrations, some associated with malignancies, are present inside enhancer and/or promoter sequences. Here, we expand on current concepts to discuss enhancer RNAs and enhancer transcription, and how enhancer transcription influences genomic organization and integrity. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. TRFolder-W: a web server for telomerase RNA structure prediction in yeast genomes. (United States)

    Zhang, Dong; Xue, Xingran; Malmberg, Russell L; Cai, Liming


    TRFolder-W is a web server capable of predicting core structures of telomerase RNA (TR) in yeast genomes. TRFolder is a command-line Python toolkit for TR-specific structure prediction. We developed a web-version built on the django web framework, leveraging the work done previously, to include enhancements to increase flexibility of usage. To date, there are five core sub-structures commonly found in TR of fungal species, which are the template region, downstream pseudoknot, boundary element, core-closing stem and triple helix. The aim of TRFolder-W is to use the five core structures as fundamental units to predict potential TR genes for yeast, and to provide a user-friendly interface. Moreover, the application of TRFolder-W can be extended to predict the characteristic structure on species other than fungal species. The web server TRFolder-W is available at

  6. Theory Meets Experiment: Metal Ion Effects in HCV Genomic RNA Kissing Complex Formation


    Sun, Li-Zhen; Heng, Xiao; Chen, Shi-Jie


    The long-range base pairing between the 5BSL3. 2 and 3′X domains in hepatitis C virus (HCV) genomic RNA is essential for viral replication. Experimental evidence points to the critical role of metal ions, especially Mg2+ ions, in the formation of the 5BSL3.2:3′X kissing complex. Furthermore, NMR studies suggested an important ion-dependent conformational switch in the kissing process. However, for a long time, mechanistic understanding of the ion effects for the process has been unclear. Rece...

  7. Genome-wide exploration of miRNA function in mammalian muscle cell differentiation. (United States)

    Polesskaya, Anna; Degerny, Cindy; Pinna, Guillaume; Maury, Yves; Kratassiouk, Gueorgui; Mouly, Vincent; Morozova, Nadya; Kropp, Jeremie; Frandsen, Niels; Harel-Bellan, Annick


    MiRNAs impact on the control of cell fate by regulating gene expression at the post-transcriptional level. Here, using mammalian muscle differentiation as a model and a phenotypic loss-of-function screen, we explored the function of miRNAs at the genome-wide level. We found that the depletion of a high number of miRNAs (63) impacted on differentiation of human muscle precursors, underscoring the importance of this post-transcriptional mechanism of gene regulation. Interestingly, a comparison with miRNA expression profiles revealed that most of the hit miRNAs did not show any significant variations of expression during differentiation. These constitutively expressed miRNAs might be required for basic and/or essential cell function, or else might be regulated at the post-transcriptional level. MiRNA inhibition yielded a variety of phenotypes, reflecting the widespread miRNA involvement in differentiation. Using a functional screen (the STarS--Suppressor Target Screen--approach, i. e. concomitant knockdown of miRNAs and of candidate target proteins), we discovered miRNA protein targets that are previously uncharacterized controllers of muscle-cell terminal differentiation. Our results provide a strategy for functional annotation of the human miRnome.

  8. DMS-MaPseq for genome-wide or targeted RNA structure probing in vivo. (United States)

    Zubradt, Meghan; Gupta, Paromita; Persad, Sitara; Lambowitz, Alan M; Weissman, Jonathan S; Rouskin, Silvi


    Coupling of structure-specific in vivo chemical modification to next-generation sequencing is transforming RNA secondary structure studies in living cells. The dominant strategy for detecting in vivo chemical modifications uses reverse transcriptase truncation products, which introduce biases and necessitate population-average assessments of RNA structure. Here we present dimethyl sulfate (DMS) mutational profiling with sequencing (DMS-MaPseq), which encodes DMS modifications as mismatches using a thermostable group II intron reverse transcriptase. DMS-MaPseq yields a high signal-to-noise ratio, can report multiple structural features per molecule, and allows both genome-wide studies and focused in vivo investigations of even low-abundance RNAs. We apply DMS-MaPseq for the first analysis of RNA structure within an animal tissue and to identify a functional structure involved in noncanonical translation initiation. Additionally, we use DMS-MaPseq to compare the in vivo structure of pre-mRNAs with their mature isoforms. These applications illustrate DMS-MaPseq's capacity to dramatically expand in vivo analysis of RNA structure.

  9. Bovine viral diarrhea virus: molecular cloning of genomic RNA and its diagnostic application

    International Nuclear Information System (INIS)

    Brock, K.V.


    Molecular cloning of a field isolate of bovine viral diarrhea virus (BVDV) strain 72 RNA was done in this study. The sensitivity and specificity of cloned cDNA sequences in hybridization assays with various BVDV strains were determined. cDNA was synthesized from polyadenylated BVDV RNA templates with oligo-dT primers, reverse transcriptase, and DNA polymerase I. The newly synthesized double-stranded BVDV cDNA was C-tailed with terminal deoxytransferase and annealed into G-tailed, Pst-1-cut pUC9 plasmid. Escherichia coli was transformed with the recombinant plasmids and a library of approximately 200 BVDV specific cDNA clones varying in length from 0.5 to 2.6 kilobases were isolated. The sensitivity and specificity of hybridization between the labelled cDNA and BVDV target sequences were determined. Cloned BVDV sequences were isolated from pUC9 plasmid DNA and labelled with 32 P by nick translation. The detection limit by dot blot hybridization assay was 20 pg of purified genomic BVDV RNA. cDNA hybridization probes were specific for all strains of BVDV tested, regardless of whether they were noncytopathic and cytopathic, but did not hybridize with heterologous bovine viruses tested. Probes did not hybridize with uninfected cell culture or cellular RNA. Hybridization probes were at least as sensitive as infectivity assays in detecting homologous virus

  10. Origin and evolution of a placental-specific microRNA family in the human genome

    Directory of Open Access Journals (Sweden)

    Gong Lejun


    Full Text Available Abstract Background MicroRNAs (miRNAs are a class of short regulatory RNAs encoded in the genome of DNA viruses, some single cell organisms, plants and animals. With the rapid development of technology, more and more miRNAs are being discovered. However, the origin and evolution of most miRNAs remain obscure. Here we report the origin and evolution dynamics of a human miRNA family. Results We have shown that all members of the miR-1302 family are derived from MER53 elements. Although the conservation scores of the MER53-derived pre-miRNA sequences are low, we have identified 36 potential paralogs of MER53-derived miR-1302 genes in the human genome and 58 potential orthologs of the human miR-1302 family in placental mammals. We suggest that in placental species, this miRNA family has evolved following the birth-and-death model of evolution. Three possible mechanisms that can mediate miRNA duplication in evolutionary history have been proposed: the transposition of the MER53 element, segmental duplications and Alu-mediated recombination. Finally, we have found that the target genes of miR-1302 are over-represented in transportation, localization, and system development processes and in the positive regulation of cellular processes. Many of them are predicted to function in binding and transcription regulation. Conclusions The members of miR-1302 family that are derived from MER53 elements are placental-specific miRNAs. They emerged at the early stage of the recent 180 million years since eutherian mammals diverged from marsupials. Under the birth-and-death model, the miR-1302 genes have experienced a complex expansion with some members evolving by segmental duplications and some by Alu-mediated recombination events.

  11. Theory Meets Experiment: Metal Ion Effects in HCV Genomic RNA Kissing Complex Formation

    Directory of Open Access Journals (Sweden)

    Li-Zhen Sun


    Full Text Available The long-range base pairing between the 5BSL3. 2 and 3′X domains in hepatitis C virus (HCV genomic RNA is essential for viral replication. Experimental evidence points to the critical role of metal ions, especially Mg2+ ions, in the formation of the 5BSL3.2:3′X kissing complex. Furthermore, NMR studies suggested an important ion-dependent conformational switch in the kissing process. However, for a long time, mechanistic understanding of the ion effects for the process has been unclear. Recently, computational modeling based on the Vfold RNA folding model and the partial charge-based tightly bound ion (PCTBI model, in combination with the NMR data, revealed novel physical insights into the role of metal ions in the 5BSL3.2-3′X system. The use of the PCTBI model, which accounts for the ion correlation and fluctuation, gives reliable predictions for the ion-dependent electrostatic free energy landscape and ion-induced population shift of the 5BSL3.2:3′X kissing complex. Furthermore, the predicted ion binding sites offer insights about how ion-RNA interactions shift the conformational equilibrium. The integrated theory-experiment study shows that Mg2+ ions may be essential for HCV viral replication. Moreover, the observed Mg2+-dependent conformational equilibrium may be an adaptive property of the HCV genomic RNA such that the equilibrium is optimized to the intracellular Mg2+ concentration in liver cells for efficient viral replication.

  12. RNA-dependent RNA targeting by CRISPR-Cas9


    Strutt, Steven C; Torrez, Rachel M; Kaya, Emine; Negrete, Oscar A; Doudna, Jennifer A


    Double-stranded DNA (dsDNA) binding and cleavage by Cas9 is a hallmark of type II CRISPR-Cas bacterial adaptive immunity. All known Cas9 enzymes are thought to recognize DNA exclusively as a natural substrate, providing protection against DNA phage and plasmids. Here, we show that Cas9 enzymes from both subtypes II-A and II-C can recognize and cleave single-stranded RNA (ssRNA) by an RNA-guided mechanism that is independent of a protospacer-adjacent motif (PAM) sequence in the target RNA. RNA...

  13. Probing the HIV-1 genomic RNA trafficking pathway and dimerization by genetic recombination and single virion analyses.

    Directory of Open Access Journals (Sweden)

    Michael D Moore


    Full Text Available Once transcribed, the nascent full-length RNA of HIV-1 must travel to the appropriate host cell sites to be translated or to find a partner RNA for copackaging to form newly generated viruses. In this report, we sought to delineate the location where HIV-1 RNA initiates dimerization and the influence of the RNA transport pathway used by the virus on downstream events essential to viral replication. Using a cell-fusion-dependent recombination assay, we demonstrate that the two RNAs destined for copackaging into the same virion select each other mostly within the cytoplasm. Moreover, by manipulating the RNA export element in the viral genome, we show that the export pathway taken is important for the ability of RNA molecules derived from two viruses to interact and be copackaged. These results further illustrate that at the point of dimerization the two main cellular export pathways are partially distinct. Lastly, by providing Gag in trans, we have demonstrated that Gag is able to package RNA from either export pathway, irrespective of the transport pathway used by the gag mRNA. These findings provide unique insights into the process of RNA export in general, and more specifically, of HIV-1 genomic RNA trafficking.

  14. RNA:DNA hybrids in the human genome have distinctive nucleotide characteristics, chromatin composition, and transcriptional relationships. (United States)

    Nadel, Julie; Athanasiadou, Rodoniki; Lemetre, Christophe; Wijetunga, N Ari; Ó Broin, Pilib; Sato, Hanae; Zhang, Zhengdong; Jeddeloh, Jeffrey; Montagna, Cristina; Golden, Aaron; Seoighe, Cathal; Greally, John M


    RNA:DNA hybrids represent a non-canonical nucleic acid structure that has been associated with a range of human diseases and potential transcriptional regulatory functions. Mapping of RNA:DNA hybrids in human cells reveals them to have a number of characteristics that give insights into their functions. We find RNA:DNA hybrids to occupy millions of base pairs in the human genome. A directional sequencing approach shows the RNA component of the RNA:DNA hybrid to be purine-rich, indicating a thermodynamic contribution to their in vivo stability. The RNA:DNA hybrids are enriched at loci with decreased DNA methylation and increased DNase hypersensitivity, and within larger domains with characteristics of heterochromatin formation, indicating potential transcriptional regulatory properties. Mass spectrometry studies of chromatin at RNA:DNA hybrids shows the presence of the ILF2 and ILF3 transcription factors, supporting a model of certain transcription factors binding preferentially to the RNA:DNA conformation. Overall, there is little to indicate a dependence for RNA:DNA hybrids forming co-transcriptionally, with results from the ribosomal DNA repeat unit instead supporting the intriguing model of RNA generating these structures in trans. The results of the study indicate heterogeneous functions of these genomic elements and new insights into their formation and stability in vivo.

  15. Heterologous and endogenous U6 snRNA promoters enable CRISPR/Cas9 mediated genome editing in Aspergillus niger. (United States)

    Zheng, Xiaomei; Zheng, Ping; Sun, Jibin; Kun, Zhang; Ma, Yanhe


    U6 promoters have been used for single guide RNA (sgRNA) transcription in the clustered regularly interspaced short palindromic repeats/CRISPR-associated protein (CRISPR/Cas9) genome editing system. However, no available U6 promoters have been identified in Aspergillus niger, which is an important industrial platform for organic acid and protein production. Two CRISPR/Cas9 systems established in A. niger have recourse to the RNA polymerase II promoter or in vitro transcription for sgRNA synthesis, but these approaches generally increase cloning efforts and genetic manipulation. The validation of functional RNA polymerase II promoters is therefore an urgent need for A. niger . Here, we developed a novel CRISPR/Cas9 system in A. niger for sgRNA expression, based on one endogenous U6 promoter and two heterologous U6 promoters. The three tested U6 promoters enabled sgRNA transcription and the disruption of the polyketide synthase albA gene in A. niger . Furthermore, this system enabled highly efficient gene insertion at the targeted genome loci in A. niger using donor DNAs with homologous arms as short as 40-bp. This study demonstrated that both heterologous and endogenous U6 promoters were functional for sgRNA expression in A. niger . Based on this result, a novel and simple CRISPR/Cas9 toolbox was established in A. niger, that will benefit future gene functional analysis and genome editing.

  16. Probing of RNA structures in a positive sense RNA virus reveals selection pressures for structural elements (United States)

    Watters, Kyle E; Choudhary, Krishna; Aviran, Sharon; Perry, Keith L


    Abstract In single stranded (+)-sense RNA viruses, RNA structural elements (SEs) play essential roles in the infection process from replication to encapsidation. Using selective 2′-hydroxyl acylation analyzed by primer extension sequencing (SHAPE-Seq) and covariation analysis, we explore the structural features of the third genome segment of cucumber mosaic virus (CMV), RNA3 (2216 nt), both in vitro and in plant cell lysates. Comparing SHAPE-Seq and covariation analysis results revealed multiple SEs in the coat protein open reading frame and 3′ untranslated region. Four of these SEs were mutated and serially passaged in Nicotiana tabacum plants to identify biologically selected changes to the original mutated sequences. After passaging, loop mutants showed partial reversion to their wild-type sequence and SEs that were structurally disrupted by mutations were restored to wild-type-like structures via synonymous mutations in planta. These results support the existence and selection of virus open reading frame SEs in the host organism and provide a framework for further studies on the role of RNA structure in viral infection. Additionally, this work demonstrates the applicability of high-throughput chemical probing in plant cell lysates and presents a new method for calculating SHAPE reactivities from overlapping reverse transcriptase priming sites. PMID:29294088

  17. General enumeration of RNA secondary structures based on new ...

    African Journals Online (AJOL)


    In Biology, the nucleic acids play an important role in coding, transferring and retrieving genetic information, and in directing cell metabolism. The nucleic acid includes DNA and RNA molecule. RNA molecule is a single-stranded nucleic acid of four different kinds of nucleotides. The four nucleotides only differ by one part,.

  18. Terahertz time-domain spectroscopy and imaging of artificial RNA

    DEFF Research Database (Denmark)

    Fischer, Bernd M.; Hoffmann, Matthias; Helm, Hanspeter


    We use terahertz time-domain spectroscopy (THz-TDS) to measure the far-infrared dielectric function of two artificial RNA single strands, composed of polyadenylic acid (poly-A) and polycytidylic acid (poly-C). We find a significant difference in the absorption between the two types of RNA strands...

  19. SL1 revisited: functional analysis of the structure and conformation of HIV-1 genome RNA. (United States)

    Sakuragi, Sayuri; Yokoyama, Masaru; Shioda, Tatsuo; Sato, Hironori; Sakuragi, Jun-Ichi


    The dimer initiation site/dimer linkage sequence (DIS/DLS) region of HIV is located on the 5' end of the viral genome and suggested to form complex secondary/tertiary structures. Within this structure, stem-loop 1 (SL1) is believed to be most important and an essential key to dimerization, since the sequence and predicted secondary structure of SL1 are highly stable and conserved among various virus subtypes. In particular, a six-base palindromic sequence is always present at the hairpin loop of SL1 and the formation of kissing-loop structure at this position between the two strands of genomic RNA is suggested to trigger dimerization. Although the higher-order structure model of SL1 is well accepted and perhaps even undoubted lately, there could be stillroom for consideration to depict the functional SL1 structure while in vivo (in virion or cell). In this study, we performed several analyses to identify the nucleotides and/or basepairing within SL1 which are necessary for HIV-1 genome dimerization, encapsidation, recombination and infectivity. We unexpectedly found that some nucleotides that are believed to contribute the formation of the stem do not impact dimerization or infectivity. On the other hand, we found that one G-C basepair involved in stem formation may serve as an alternative dimer interactive site. We also report on our further investigation of the roles of the palindromic sequences on viral replication. Collectively, we aim to assemble a more-comprehensive functional map of SL1 on the HIV-1 viral life cycle. We discovered several possibilities for a novel structure of SL1 in HIV-1 DLS. The newly proposed structure model suggested that the hairpin loop of SL1 appeared larger, and genome dimerization process might consist of more complicated mechanism than previously understood. Further investigations would be still required to fully understand the genome packaging and dimerization of HIV.

  20. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.


    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  1. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.


    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  2. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy


    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried


    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  3. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.


    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  4. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.


    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  5. The complete genome sequence of a double-stranded RNA mycovirus from Fusarium graminearum strain HN1. (United States)

    Wang, Luan; Wang, Shuangchao; Yang, Xiufen; Zeng, Hongmei; Qiu, Dewen; Guo, Lihua


    The complete nucleotide sequence of a double-stranded RNA (dsRNA) mycovirus, Fusarium graminearum dsRNA virus 5 (FgV5), was identified and characterized. The FgV5 genome comprises two dsRNA genome segments of 2030 bp and 1740 bp. FgV5 dsRNA1 contains a single open reading frame (ORF1), which is predicted to encode a protein of 613 amino acids (aa) with a molecular mass of 70.4 kDa and has a conserved RNA-dependent RNA polymerase (RdRp) motif. FgV5 dsRNA2 is predicted to contain two discontinuous ORFs (ORF2 and ORF3) that code for products of unknown function. Sequence comparisons showed that FgV5 has the highest aa sequence identities to Fusarium graminearum virus 4 (FgV4) (83.01% for ORF1, 78.70% for ORF2, and 76.27% for ORF3), suggesting that FgV5 and FgV4 should be regarded as members of different species. Phylogenetic analysis indicated that FgV5 belongs to a taxonomically unassigned dsRNA mycovirus group that is related to the families Amalgaviridae and Partitiviridae. Here, we propose that FgV5 and related viruses are members of a yet to be named and formally recognized new family.

  6. Ongoing phenotypic and genomic changes in experimental coevolution of RNA bacteriophage Qβ and Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Akiko Kashiwagi


    Full Text Available According to the Red Queen hypothesis or arms race dynamics, coevolution drives continuous adaptation and counter-adaptation. Experimental models under simplified environments consisting of bacteria and bacteriophages have been used to analyze the ongoing process of coevolution, but the analysis of both parasites and their hosts in ongoing adaptation and counter-adaptation remained to be performed at the levels of population dynamics and molecular evolution to understand how the phenotypes and genotypes of coevolving parasite-host pairs change through the arms race. Copropagation experiments with Escherichia coli and the lytic RNA bacteriophage Qβ in a spatially unstructured environment revealed coexistence for 54 days (equivalent to 163-165 replication generations of Qβ and fitness analysis indicated that they were in an arms race. E. coli first adapted by developing partial resistance to infection and later increasing specific growth rate. The phage counter-adapted by improving release efficiency with a change in host specificity and decrease in virulence. Whole-genome analysis indicated that the phage accumulated 7.5 mutations, mainly in the A2 gene, 3.4-fold faster than in Qβ propagated alone. E. coli showed fixation of two mutations (in traQ and csdA faster than in sole E. coli experimental evolution. These observations suggest that the virus and its host can coexist in an evolutionary arms race, despite a difference in genome mutability (i.e., mutations per genome per replication of approximately one to three orders of magnitude.

  7. Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging. (United States)

    Nikolaitchik, Olga A; Hu, Wei-Shau


    A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1

  8. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms. (United States)

    Swanson, Colby A; Sliwinski, Marek K


    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  9. A computational search for box C/D snoRNA genes in the Drosophila melanogaster genome. (United States)

    Accardo, M C; Giordano, E; Riccardo, S; Digilio, F A; Iazzetti, G; Calogero, R A; Furia, M


    In eukaryotes, the family of non-coding RNA genes includes a number of genes encoding small nucleolar RNAs (mainly C/D and H/ACA snoRNAs), which act as guides in the maturation or post-transcriptional modifications of target RNA molecules. Since in Drosophila melanogaster (Dm) only few examples of snoRNAs have been identified so far by cDNA libraries screening, integration of the molecular data with in silico identification of these types of genes could throw light on their organization in the Dm genome. We have performed a computational screening of the Dm genome for C/D snoRNA genes, followed by experimental validation of the putative candidates. Few of the 26 confirmed snoRNAs had been recognized by cDNA library analysis. Organization of the Dm genome was also found to be more variegated than previously suspected, with snoRNA genes nested in both the introns and exons of protein-coding genes. This finding suggests that the presence of additional mechanisms of snoRNA biogenesis based on the alternative production of overlapping mRNA/snoRNA molecules. Additional information is available at

  10. A genome-wide map of hyper-edited RNA reveals numerous new sites (United States)

    Porath, Hagit T.; Carmi, Shai; Levanon, Erez Y.


    Adenosine-to-inosine editing is one of the most frequent post-transcriptional modifications, manifested as A-to-G mismatches when comparing RNA sequences with their source DNA. Recently, a number of RNA-seq data sets have been screened for the presence of A-to-G editing, and hundreds of thousands of editing sites identified. Here we show that existing screens missed the majority of sites by ignoring reads with excessive (‘hyper’) editing that do not easily align to the genome. We show that careful alignment and examination of the unmapped reads in RNA-seq studies reveal numerous new sites, usually many more than originally discovered, and in precisely those regions that are most heavily edited. Specifically, we discover 327,096 new editing sites in the heavily studied Illumina Human BodyMap data and more than double the number of detected sites in several published screens. We also identify thousands of new sites in mouse, rat, opossum and fly. Our results establish that hyper-editing events account for the majority of editing sites. PMID:25158696

  11. Bioinformatics Study of Structural Patterns in Plant MicroRNA Precursors. (United States)

    Miskiewicz, J; Tomczyk, K; Mickiewicz, A; Sarzynska, J; Szachniuk, M


    According to the RNA world theory, RNAs which stored genetic information and catalyzed chemical reactions had their contribution in the formation of current living organisms. In recent years, researchers studied this molecule diversity, i.a. focusing on small non-coding regulatory RNAs. Among them, of particular interest is evolutionarily ancient, 19-24 nt molecule of microRNA (miRNA). It has been already recognized as a regulator of gene expression in eukaryotes. In plants, miRNA plays a key role in the response to stress conditions and it participates in the process of growth and development. MicroRNAs originate from primary transcripts (pri-miRNA) encoded in the nuclear genome. They are processed from single-stranded stem-loop RNA precursors containing hairpin structures. While the mechanism of mature miRNA production in animals is better understood, its biogenesis in plants remains less clear. Herein, we present the results of bioinformatics analysis aimed at discovering how plant microRNAs are recognized within their precursors (pre-miRNAs). The study has been focused on sequential and structural motif identification in the neighbourhood of microRNA.

  12. RNA virus interference via CRISPR/Cas13a system in plants

    KAUST Repository

    Aman, Rashid


    CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single-stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants.CRISPR/Cas13a produces interference against green fluorescent protein (GFP)-expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. CRISPR RNA (crRNAs) targeting the HC-Pro and GFP sequences exhibit better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs.Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses and for other RNA manipulations in plants.

  13. Completed sequence and corrected annotation of the genome of maize Iranian mosaic virus. (United States)

    Ghorbani, Abozar; Izadpanah, Keramatollah; Dietzgen, Ralf G


    Maize Iranian mosaic virus (MIMV) is a negative-sense single-stranded RNA virus that is classified in the genus Nucleorhabdovirus, family Rhabdoviridae. The MIMV genome contains six open reading frames (ORFs) that encode in 3΄ to 5΄ order the nucleocapsid protein (N), phosphoprotein (P), putative movement protein (P3), matrix protein (M), glycoprotein (G) and RNA-dependent RNA polymerase (L). In this study, we determined the first complete genome sequence of MIMV using Illumina RNA-Seq and 3'/5' RACE. MIMV genome ('Fars' isolate) is 12,426 nucleotides in length. Unexpectedly, the predicted N gene ORF of this isolate and of four other Iranian isolates is 143 nucleotides shorter than that of the MIMV coding-complete reference isolate 'Shiraz 1' (Genbank NC_011542), possibly due to a minor error in the previous sequence. Genetic variability among the N, P, P3 and G ORFs of Iranian MIMV isolates was limited, but highest in the G gene ORF. Phylogenetic analysis of complete nucleorhabdovirus genomes demonstrated a close evolutionary relationship between MIMV, maize mosaic virus and taro vein chlorosis virus.

  14. Rapid Genome-wide Recruitment of RNA Polymerase II Drives Transcription, Splicing, and Translation Events during T Cell Responses

    Directory of Open Access Journals (Sweden)

    Kathrin Davari


    Full Text Available Summary: Activation of immune cells results in rapid functional changes, but how such fast changes are accomplished remains enigmatic. By combining time courses of 4sU-seq, RNA-seq, ribosome profiling (RP, and RNA polymerase II (RNA Pol II ChIP-seq during T cell activation, we illustrate genome-wide temporal dynamics for ∼10,000 genes. This approach reveals not only immediate-early and posttranscriptionally regulated genes but also coupled changes in transcription and translation for >90% of genes. Recruitment, rather than release of paused RNA Pol II, primarily mediates transcriptional changes. This coincides with a genome-wide temporary slowdown in cotranscriptional splicing, even for polyadenylated mRNAs that are localized at the chromatin. Subsequent splicing optimization correlates with increasing Ser-2 phosphorylation of the RNA Pol II carboxy-terminal domain (CTD and activation of the positive transcription elongation factor (pTEFb. Thus, rapid de novo recruitment of RNA Pol II dictates the course of events during T cell activation, particularly transcription, splicing, and consequently translation. : Davari et al. visualize global changes in RNA Pol II binding, transcription, splicing, and translation. T cells change their functional program by rapid de novo recruitment of RNA Pol II and coupled changes in transcription and translation. This coincides with fluctuations in RNA Pol II phosphorylation and a temporary reduction in cotranscriptional splicing. Keywords: RNA Pol II, cotranscriptional splicing, T cell activation, ribosome profiling, 4sU, H3K36, Ser-5 RNA Pol II, Ser-2 RNA Pol II, immune response, immediate-early genes

  15. Analysis of IAV Replication and Co-infection Dynamics by a Versatile RNA Viral Genome Labeling Method

    Directory of Open Access Journals (Sweden)

    Dan Dou


    Full Text Available Genome delivery to the proper cellular compartment for transcription and replication is a primary goal of viruses. However, methods for analyzing viral genome localization and differentiating genomes with high identity are lacking, making it difficult to investigate entry-related processes and co-examine heterogeneous RNA viral populations. Here, we present an RNA labeling approach for single-cell analysis of RNA viral replication and co-infection dynamics in situ, which uses the versatility of padlock probes. We applied this method to identify influenza A virus (IAV infections in cells and lung tissue with single-nucleotide specificity and to classify entry and replication stages by gene segment localization. Extending the classification strategy to co-infections of IAVs with single-nucleotide variations, we found that the dependence on intracellular trafficking places a time restriction on secondary co-infections necessary for genome reassortment. Altogether, these data demonstrate how RNA viral genome labeling can help dissect entry and co-infections.

  16. Varieties of charge distributions in coat proteins of ssRNA+  viruses (United States)

    Lošdorfer Božič, Anže; Podgornik, Rudolf


    A major part of the interactions involved in the assembly and stability of icosahedral, positive-sense single-stranded RNA (ssRNA+) viruses is electrostatic in nature, as can be inferred from the strong pH- and salt-dependence of their assembly phase diagrams. Electrostatic interactions do not act only between the capsid coat proteins (CPs), but just as often provide a significant contribution to the interactions of the CPs with the genomic RNA, mediated to a large extent by positively charged, flexible N-terminal tails of the CPs. In this work, we provide two clear and complementary definitions of an N-terminal tail of a protein, and use them to extract the tail sequences of a large number of CPs of ssRNA+  viruses. We examine the pH-dependent interplay of charge on both tails and CPs alike, and show that—in contrast to the charge on the CPs—the net positive charge on the N-tails persists even to very basic pH values. In addition, we note a limit to the length of the wild-type genomes of those viruses which utilize positively charged tails, when compared to viruses without charged tails and similar capsid size. At the same time, we observe no clear connection between the charge on the N-tails and the genome lengths of the viruses included in our study.

  17. Evolution of endogenous non-retroviral genes integrated into plant genomes

    Directory of Open Access Journals (Sweden)

    Hyosub Chu


    Full Text Available Numerous comparative genome analyses have revealed the wide extent of horizontal gene transfer (HGT in living organisms, which contributes to their evolution and genetic diversity. Viruses play important roles in HGT. Endogenous viral elements (EVEs are defined as viral DNA sequences present within the genomes of non-viral organisms. In eukaryotic cells, the majority of EVEs are derived from RNA viruses using reverse transcription. In contrast, endogenous non-retroviral elements (ENREs are poorly studied. However, the increasing availability of genomic data and the rapid development of bioinformatics tools have enabled the identification of several ENREs in various eukaryotic organisms. To date, a small number of ENREs integrated into plant genomes have been identified. Of the known non-retroviruses, most identified ENREs are derived from double-strand (ds RNA viruses, followed by single-strand (ss DNA and ssRNA viruses. At least eight virus families have been identified. Of these, viruses in the family Partitiviridae are dominant, followed by viruses of the families Chrysoviridae and Geminiviridae. The identified ENREs have been primarily identified in eudicots, followed by monocots. In this review, we briefly discuss the current view on non-retroviral sequences integrated into plant genomes that are associated with plant-virus evolution and their possible roles in antiviral resistance.

  18. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)


    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  19. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA. (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J


    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  20. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H


    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  1. On-site detection of Phytophthora spp.—single-stranded target DNA as the limiting factor to improve on-chip hybridization

    International Nuclear Information System (INIS)

    Schwenkbier, Lydia; Pollok, Sibyll; Popp, Jürgen; Weber, Karina; König, Stephan; Wagner, Stefan; Werres, Sabine; Weber, Jörg; Hentschel, Martin


    We report on a lab-on-a-chip approach for on-site detection of Phytophthora species that allows visual signal readout. The results demonstrate the significance of single-stranded DNA (ssDNA) generation in terms of improving the intensity of the hybridization signal and to improve the reliability of the method. Conventional PCR with subsequent heat denaturation, sodium hydroxide-based denaturation, lambda exonuclease digestion and two asymmetric PCR methods were investigated for the species P. fragariae, P. kernoviae, and P. ramorum. The positioning of the capture probe within the amplified yeast GTP-binding protein (YPT1) target DNA was also of interest because it significantly influences the intensity of the signal. Statistical tests were used to validate the impact of the ssDNA generation methods and the capture-target probe position. The single-stranded target DNA generated by Linear-After-The-Exponential PCR (LATE-PCR) was found to produce signal intensities comparable to post-PCR exonuclease treatment. The LATE-PCR is the best method for the on-site detection of Phytophthora because the enzymatic digestion after PCR is more laborious and time-consuming. (author)

  2. RNA binding specificity of Ebola virus transcription factor VP30. (United States)

    Schlereth, Julia; Grünweller, Arnold; Biedenkopf, Nadine; Becker, Stephan; Hartmann, Roland K


    The transcription factor VP30 of the non-segmented RNA negative strand Ebola virus balances viral transcription and replication. Here, we comprehensively studied RNA binding by VP30. Using a novel VP30:RNA electrophoretic mobility shift assay, we tested truncated variants of 2 potential natural RNA substrates of VP30 - the genomic Ebola viral 3'-leader region and its complementary antigenomic counterpart (each ∼155 nt in length) - and a series of other non-viral RNAs. Based on oligonucleotide interference, the major VP30 binding region on the genomic 3'-leader substrate was assigned to the internal expanded single-stranded region (∼ nt 125-80). Best binding to VP30 was obtained with ssRNAs of optimally ∼ 40 nt and mixed base composition; underrepresentation of purines or pyrimidines was tolerated, but homopolymeric sequences impaired binding. A stem-loop structure, particularly at the 3'-end or positioned internally, supports stable binding to VP30. In contrast, dsRNA or RNAs exposing large internal loops flanked by entirely helical arms on both sides are not bound. Introduction of a 5´-Cap(0) structure impaired VP30 binding. Also, ssDNAs bind substantially weaker than isosequential ssRNAs and heparin competes with RNA for binding to VP30, indicating that ribose 2'-hydroxyls and electrostatic contacts of the phosphate groups contribute to the formation of VP30:RNA complexes. Our results indicate a rather relaxed RNA binding specificity of filoviral VP30, which largely differs from that of the functionally related transcription factor of the Paramyxoviridae which binds to ssRNAs as short as 13 nt with a preference for oligo(A) sequences.

  3. RNA Packing Specificity and Folding during Assembly of the Bacteriophage MS2

    Directory of Open Access Journals (Sweden)

    Ottar Rolfsson


    Full Text Available Using a combination of biochemistry, mass spectrometry, NMR spectroscopy and cryo-electron microscopy (cryo-EM, we have been able to show that quasi-equivalent conformer switching in the coat protein (CP of an RNA bacteriophage (MS2 is controlled by a sequence-specific RNA–protein interaction. The RNA component of this complex is an RNA stem-loop encompassing just 19 nts from the phage genomic RNA, which is 3569 nts in length. This binding results in the conversion of a CP dimer from a symmetrical conformation to an asymmetric one. Only when both symmetrical and asymmetrical dimers are present in solution is assembly of the T = 3 phage capsid efficient. This implies that the conformers, we have characterized by NMR correspond to the two distinct quasi-equivalent conformers seen in the 3D structure of the virion. An icosahedrally-averaged single particle cryo-EM reconstruction of the wild-type phage (to ∼9 Å resolution has revealed icosahedrally ordered density encompassing up to 90% of the single-stranded RNA genome. The RNA is seen with a novel arrangement of two concentric shells, with connections between them along the 5-fold symmetry axes. RNA in the outer shell interacts with each of the 90 CP dimers in the T = 3 capsid and although the density is icosahedrally averaged, there appears to be a different average contact at the different quasi-equivalent protein dimers: precisely the result that would be expected if protein conformer switching is RNA-mediated throughout the assembly pathway. This unprecedented RNA structure provides new constraints for models of viral assembly and we describe experiments aimed at probing these. Together, these results suggest that viral genomic RNA folding is an important factor in efficient assembly, and further suggest that RNAs that could sequester viral CPs but not fold appropriately could act as potent inhibitors of viral assembly.

  4. Improved replication efficiency of echovirus 5 after transfection of colon cancer cells using an authentic 5' RNA genome end methodology. (United States)

    Israelsson, S; Sävneby, A; Ekström, J-O; Jonsson, N; Edman, K; Lindberg, A M


    Oncolytic virotherapy is a promising novel form of cancer treatment, but the therapeutic efficiency needs improvement. A potential strategy to enhance the therapeutic effect of oncolytic viruses is to use infectious nucleic acid as therapeutic agent to initiate an oncolytic infection, without administrating infectious viral particles. Here we demonstrate improved viral replication activation efficiency when transfecting cells with 5' end authentic in vitro transcribed enterovirus RNA as compared to genomic RNA with additional non-genomic 5' nucleotides generated by conventional cloning methods. We used echovirus 5 (E5) as an oncolytoc model virus due to its ability to replicate in and completely destroy five out of six colon cancer cell lines and kill artificial colon cancer tumors (HT29 spheroids), as shown here. An E5 infectious cDNA clone including a hammerhead ribozyme sequence was used to generate in vitro transcripts with native 5' genome ends. In HT29 cells, activation of virus replication is approximately 20-fold more efficient for virus genome transcripts with native 5' genome ends compared to E5 transcripts generated from a standard cDNA clone. This replication advantage remains when viral progeny release starts by cellular lysis 22 h post transfection. Hence, a native 5' genomic end improves infection activation efficacy of infectious nucleic acid, potentially enhancing its therapeutic effect when used for cancer treatment. The clone design with a hammerhead ribozyme is likely to be applicable to a variety of oncolytic positive sense RNA viruses for the purpose of improving the efficacy of oncolytic virotherapy.

  5. Genome-wide miRNA response to anacardic acid in breast cancer cells.

    Directory of Open Access Journals (Sweden)

    David J Schultz

    Full Text Available MicroRNAs are biomarkers and potential therapeutic targets for breast cancer. Anacardic acid (AnAc is a dietary phenolic lipid that inhibits both MCF-7 estrogen receptor α (ERα positive and MDA-MB-231 triple negative breast cancer (TNBC cell proliferation with IC50s of 13.5 and 35 μM, respectively. To identify potential mediators of AnAc action in breast cancer, we profiled the genome-wide microRNA transcriptome (microRNAome in these two cell lines altered by the AnAc 24:1n5 congener. Whole genome expression profiling (RNA-seq and subsequent network analysis in MetaCore Gene Ontology (GO algorithm was used to characterize the biological pathways altered by AnAc. In MCF-7 cells, 69 AnAc-responsive miRNAs were identified, e.g., increased let-7a and reduced miR-584. Fewer, i.e., 37 AnAc-responsive miRNAs were identified in MDA-MB-231 cells, e.g., decreased miR-23b and increased miR-1257. Only two miRNAs were increased by AnAc in both cell lines: miR-612 and miR-20b; however, opposite miRNA arm preference was noted: miR-20b-3p and miR-20b-5p were upregulated in MCF-7 and MDA-MB-231, respectively. miR-20b-5p target EFNB2 transcript levels were reduced by AnAc in MDA-MB-231 cells. AnAc reduced miR-378g that targets VIM (vimentin and VIM mRNA transcript expression was increased in AnAc-treated MCF-7 cells, suggesting a reciprocal relationship. The top three enriched GO terms for AnAc-treated MCF-7 cells were B cell receptor signaling pathway and ribosomal large subunit biogenesis and S-adenosylmethionine metabolic process for AnAc-treated MDA-MB-231 cells. The pathways modulated by these AnAc-regulated miRNAs suggest that key nodal molecules, e.g., Cyclin D1, MYC, c-FOS, PPARγ, and SIN3, are targets of AnAc activity.

  6. CpG preconditioning regulates miRNA expression that modulates genomic reprogramming associated with neuroprotection against ischemic injury (United States)

    Vartanian, Keri B; Mitchell, Hugh D; Stevens, Susan L; Conrad, Valerie K; McDermott, Jason E; Stenzel-Poore, Mary P


    Cytosine-phosphate-guanine (CpG) preconditioning reprograms the genomic response to stroke to protect the brain against ischemic injury. The mechanisms underlying genomic reprogramming are incompletely understood. MicroRNAs (miRNAs) regulate gene expression; however, their role in modulating gene responses produced by CpG preconditioning is unknown. We evaluated brain miRNA expression in response to CpG preconditioning before and after stroke using microarray. Importantly, we have data from previous gene microarrays under the same conditions, which allowed integration of miRNA and gene expression data to specifically identify regulated miRNA gene targets. CpG preconditioning did not significantly alter miRNA expression before stroke, indicating that miRNA regulation is not critical for the initiation of preconditioning-induced neuroprotection. However, after stroke, differentially regulated miRNAs between CpG- and saline-treated animals associated with the upregulation of several neuroprotective genes, implicating these miRNAs in genomic reprogramming that increases neuroprotection. Statistical analysis revealed that the miRNA targets were enriched in the gene population regulated in the setting of stroke, implying that miRNAs likely orchestrate this gene expression. These data suggest that miRNAs regulate endogenous responses to stroke and that manipulation of these miRNAs may have the potential to acutely activate novel neuroprotective processes that reduce damage. PMID:25388675

  7. Unexpected inheritance: multiple integrations of ancient bornavirus and ebolavirus/marburgvirus sequences in vertebrate genomes.

    Directory of Open Access Journals (Sweden)

    Vladimir A Belyi


    Full Text Available Vertebrate genomes contain numerous copies of retroviral sequences, acquired over the course of evolution. Until recently they were thought to be the only type of RNA viruses to be so represented, because integration of a DNA copy of their genome is required for their replication. In this study, an extensive sequence comparison was conducted in which 5,666 viral genes from all known non-retroviral families with single-stranded RNA genomes were matched against the germline genomes of 48 vertebrate species, to determine if such viruses could also contribute to the vertebrate genetic heritage. In 19 of the tested vertebrate species, we discovered as many as 80 high-confidence examples of genomic DNA sequences that appear to be derived, as long ago as 40 million years, from ancestral members of 4 currently circulating virus families with single strand RNA genomes. Surprisingly, almost all of the sequences are related to only two families in the Order Mononegavirales: the Bornaviruses and the Filoviruses, which cause lethal neurological disease and hemorrhagic fevers, respectively. Based on signature landmarks some, and perhaps all, of the endogenous virus-like DNA sequences appear to be LINE element-facilitated integrations derived from viral mRNAs. The integrations represent genes that encode viral nucleocapsid, RNA-dependent-RNA-polymerase, matrix and, possibly, glycoproteins. Integrations are generally limited to one or very few copies of a related viral gene per species, suggesting that once the initial germline integration was obtained (or selected, later integrations failed or provided little advantage to the host. The conservation of relatively long open reading frames for several of the endogenous sequences, the virus-like protein regions represented, and a potential correlation between their presence and a species' resistance to the diseases caused by these pathogens, are consistent with the notion that their products provide some important

  8. Progress in Genome Editing Technology and Its Application in Plants. (United States)

    Zhang, Kai; Raboanatahiry, Nadia; Zhu, Bin; Li, Maoteng


    Genome editing technology (GET) is a versatile approach that has progressed rapidly as a mechanism to alter the genotype and phenotype of organisms. However, conventional genome modification using GET cannot satisfy current demand for high-efficiency and site-directed mutagenesis, retrofitting of artificial nucleases has developed into a new avenue within this field. Based on mechanisms to recognize target genes, newly-developed GETs can generally be subdivided into three cleavage systems, protein-dependent DNA cleavage systems (i.e., zinc-finger nucleases, ZFN, and transcription activator-like effector nucleases, TALEN), RNA-dependent DNA cleavage systems (i.e., clustered regularly interspaced short palindromic repeats-CRISPR associated proteins, CRISPR-Cas9, CRISPR-Cpf1, and CRISPR-C2c1), and RNA-dependent RNA cleavage systems (i.e., RNA interference, RNAi, and CRISPR-C2c2). All these techniques can lead to double-stranded (DSB) or single-stranded breaks (SSB), and result in either random mutations via non-homologous end-joining (NHEJ) or targeted mutation via homologous recombination (HR). Thus, site-directed mutagenesis can be induced via targeted gene knock-out, knock-in, or replacement to modify specific characteristics including morphology-modification, resistance-enhancement, and physiological mechanism-improvement along with plant growth and development. In this paper, an non-comprehensive review on the development of different GETs as applied to plants is presented.

  9. Progress in Genome Editing Technology and Its Application in Plants (United States)

    Zhang, Kai; Raboanatahiry, Nadia; Zhu, Bin; Li, Maoteng


    Genome editing technology (GET) is a versatile approach that has progressed rapidly as a mechanism to alter the genotype and phenotype of organisms. However, conventional genome modification using GET cannot satisfy current demand for high-efficiency and site-directed mutagenesis, retrofitting of artificial nucleases has developed into a new avenue within this field. Based on mechanisms to recognize target genes, newly-developed GETs can generally be subdivided into three cleavage systems, protein-dependent DNA cleavage systems (i.e., zinc-finger nucleases, ZFN, and transcription activator-like effector nucleases, TALEN), RNA-dependent DNA cleavage systems (i.e., clustered regularly interspaced short palindromic repeats-CRISPR associated proteins, CRISPR-Cas9, CRISPR-Cpf1, and CRISPR-C2c1), and RNA-dependent RNA cleavage systems (i.e., RNA interference, RNAi, and CRISPR-C2c2). All these techniques can lead to double-stranded (DSB) or single-stranded breaks (SSB), and result in either random mutations via non-homologous end-joining (NHEJ) or targeted mutation via homologous recombination (HR). Thus, site-directed mutagenesis can be induced via targeted gene knock-out, knock-in, or replacement to modify specific characteristics including morphology-modification, resistance-enhancement, and physiological mechanism-improvement along with plant growth and development. In this paper, an non-comprehensive review on the development of different GETs as applied to plants is presented. PMID:28261237

  10. Ex vivo gene editing of the dystrophin gene in muscle stem cells mediated by peptide nucleic acid single stranded oligodeoxynucleotides induces stable expression of dystrophin in a mouse model for Duchenne muscular dystrophy. (United States)

    Nik-Ahd, Farnoosh; Bertoni, Carmen


    Duchenne muscular dystrophy (DMD) is a fatal disease caused by mutations in the dystrophin gene, which result in the complete absence of dystrophin protein throughout the body. Gene correction strategies hold promise to treating DMD. Our laboratory has previously demonstrated the ability of peptide nucleic acid single-stranded oligodeoxynucleotides (PNA-ssODNs) to permanently correct single-point mutations at the genomic level. In this study, we show that PNA-ssODNs can target and correct muscle satellite cells (SCs), a population of stem cells capable of self-renewing and differentiating into muscle fibers. When transplanted into skeletal muscles, SCs transfected with correcting PNA-ssODNs were able to engraft and to restore dystrophin expression. The number of dystrophin-positive fibers was shown to significantly increase over time. Expression was confirmed to be the result of the activation of a subpopulation of SCs that had undergone repair as demonstrated by immunofluorescence analyses of engrafted muscles using antibodies specific to full-length dystrophin transcripts and by genomic DNA analysis of dystrophin-positive fibers. Furthermore, the increase in dystrophin expression detected over time resulted in a significant improvement in muscle morphology. The ability of transplanted cells to return into quiescence and to activate upon demand was confirmed in all engrafted muscles following injury. These results demonstrate the feasibility of using gene editing strategies to target and correct SCs and further establish the therapeutic potential of this approach to permanently restore dystrophin expression into muscle of DMD patients. © 2014 AlphaMed Press.

  11. SeqFold: genome-scale reconstruction of RNA secondary structure integrating high-throughput sequencing data. (United States)

    Ouyang, Zhengqing; Snyder, Michael P; Chang, Howard Y


    We present an integrative approach, SeqFold, that combines high-throughput RNA structure profiling data with computational prediction for genome-scale reconstruction of RNA secondary structures. SeqFold transforms experimental RNA structure information into a structure preference profile (SPP) and uses it to select stable RNA structure candidates representing the structure ensemble. Under a high-dimensional classification framework, SeqFold efficiently matches a given SPP to the most likely cluster of structures sampled from the Boltzmann-weighted ensemble. SeqFold is able to incorporate diverse types of RNA structure profiling data, including parallel analysis of RNA structure (PARS), selective 2'-hydroxyl acylation analyzed by primer extension sequencing (SHAPE-Seq), fragmentation sequencing (FragSeq) data generated by deep sequencing, and conventional SHAPE data. Using the known structures of a wide range of mRNAs and noncoding RNAs as benchmarks, we demonstrate that SeqFold outperforms or matches existing approaches in accuracy and is more robust to noise in experimental data. Application of SeqFold to reconstruct the secondary structures of the yeast transcriptome reveals the diverse impact of RNA secondary structure on gene regulation, including translation efficiency, transcription initiation, and protein-RNA interactions. SeqFold can be easily adapted to incorporate any new types of high-throughput RNA structure profiling data and is widely applicable to analyze RNA structures in any transcriptome.

  12. Genome engineering of mammalian haploid embryonic stem cells using the Cas9/RNA system

    Directory of Open Access Journals (Sweden)

    Takuro Horii


    Full Text Available Haploid embryonic stem cells (ESCs are useful for studying mammalian genes because disruption of only one allele can cause loss-of-function phenotypes. Here, we report the use of haploid ESCs and the CRISPR RNA-guided Cas9 nuclease gene-targeting system to manipulate mammalian genes. Co-transfection of haploid ESCs with vectors expressing Cas9 nuclease and single-guide RNAs (sgRNAs targeting Tet1, Tet2, and Tet3 resulted in the complete disruption of all three genes and caused a loss-of-function phenotype with high efficiency (50%. Co-transfection of cells with vectors expressing Cas9 and sgRNAs targeting two loci on the same chromosome resulted in the creation of a large chromosomal deletion and a large inversion. Thus, the use of the CRISPR system in combination with haploid ESCs provides a powerful platform to manipulate the mammalian genome.

  13. RNA interference for functional genomics and improvement of cotton (Gossypium spp.

    Directory of Open Access Journals (Sweden)

    Ibrokhim Y. Abdurakhmonov


    Full Text Available RNA interference (RNAi, is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.. The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialisation.

  14. Optimized paired-sgRNA/Cas9 cloning and expression cassette triggers high-efficiency multiplex genome editing in kiwifruit. (United States)

    Wang, Zupeng; Wang, Shuaibin; Li, Dawei; Zhang, Qiong; Li, Li; Zhong, Caihong; Liu, Yifei; Huang, Hongwen


    Kiwifruit is an important fruit crop; however, technologies for its functional genomic and molecular improvement are limited. The clustered regulatory interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) system has been successfully applied to genetic improvement in many crops, but its editing capability is variable depending on the different combinations of the synthetic guide RNA (sgRNA) and Cas9 protein expression devices. Optimizing conditions for its use within a particular species is therefore needed to achieve highly efficient genome editing. In this study, we developed a new cloning strategy for generating paired-sgRNA/Cas9 vectors containing four sgRNAs targeting the kiwifruit phytoene desaturase gene (AcPDS). Comparing to the previous method of paired-sgRNA cloning, our strategy only requires the synthesis of two gRNA-containing primers which largely reduces the cost. We further compared efficiencies of paired-sgRNA/Cas9 vectors containing different sgRNA expression devices, including both the polycistronic tRNA-sgRNA cassette (PTG) and the traditional CRISPR expression cassette. We found the mutagenesis frequency of the PTG/Cas9 system was 10-fold higher than that of the CRISPR/Cas9 system, coinciding with the relative expressions of sgRNAs in two different expression cassettes. In particular, we identified large chromosomal fragment deletions induced by the paired-sgRNAs of the PTG/Cas9 system. Finally, as expected, we found both systems can successfully induce the albino phenotype of kiwifruit plantlets regenerated from the G418-resistance callus lines. We conclude that the PTG/Cas9 system is a more powerful system than the traditional CRISPR/Cas9 system for kiwifruit genome editing, which provides valuable clues for optimizing CRISPR/Cas9 editing system in other plants. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons

  15. Live Attenuated Influenza Vaccine contains Substantial and Unexpected Amounts of Defective Viral Genomic RNA. (United States)

    Gould, Philip S; Easton, Andrew J; Dimmock, Nigel J


    The live attenuated influenza vaccine FluMist ® was withdrawn in the USA by the Centers for Disease Control and Prevention after its failure to provide adequate protective immunity during 2013-2016. The vaccine uses attenuated core type A and type B viruses, reconfigured each year to express the two major surface antigens of the currently circulating viruses. Here Fluenz™ Tetra, the European version of this vaccine, was examined directly for defective-interfering (DI) viral RNAs. DI RNAs are deleted versions of the infectious virus genome, and have powerful biological properties including attenuation of infection, reduction of infectious virus yield, and stimulation of some immune responses. Reverse transcription polymerase chain reaction followed by cloning and sequencing showed that Fluenz™ vaccine contains unexpected and substantial amounts of DI RNA arising from both its influenza A and influenza B components, with 87 different DI RNA sequences identified. Flu A DI RNAs from segment 3 replaced the majority of the genomic full-length segment 3, thus compromising its infectivity. DI RNAs arise during vaccine production and non-infectious DI virus replaces infectious virus pro rata so that fewer doses of the vaccine can be made. Instead the vaccine carries a large amount of non-infectious but biologically active DI virus. The presence of DI RNAs could significantly reduce the multiplication in the respiratory tract of the vaccine leading to reduced immunizing efficacy and could also stimulate the host antiviral responses, further depressing vaccine multiplication. The role of DI viruses in the performance of this and other vaccines requires further investigation.

  16. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB)


    van Loon, Barbara; Samson, Leona D.


    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known...

  17. RNA virus interference via CRISPR/Cas13a system in plants

    KAUST Repository

    Aman, Rashid


    CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants. CRISPR/Cas13a produced interference against green fluorescent protein (GFP) expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. crRNAs targeting the HC-Pro and GFP sequences exhibited better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs. Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses, and for other RNA manipulations in plants.

  18. Nucleocapsid protein structures from orthobunyaviruses reveal insight into ribonucleoprotein architecture and RNA polymerization. (United States)

    Ariza, Antonio; Tanner, Sian J; Walter, Cheryl T; Dent, Kyle C; Shepherd, Dale A; Wu, Weining; Matthews, Susan V; Hiscox, Julian A; Green, Todd J; Luo, Ming; Elliott, Richard M; Fooks, Anthony R; Ashcroft, Alison E; Stonehouse, Nicola J; Ranson, Neil A; Barr, John N; Edwards, Thomas A


    All orthobunyaviruses possess three genome segments of single-stranded negative sense RNA that are encapsidated with the virus-encoded nucleocapsid (N) protein to form a ribonucleoprotein (RNP) complex, which is uncharacterized at high resolution. We report the crystal structure of both the Bunyamwera virus (BUNV) N-RNA complex and the unbound Schmallenberg virus (SBV) N protein, at resolutions of 3.20 and 2.75 Å, respectively. Both N proteins crystallized as ring-like tetramers and exhibit a high degree of structural similarity despite classification into different orthobunyavirus serogroups. The structures represent a new RNA-binding protein fold. BUNV N possesses a positively charged groove into which RNA is deeply sequestered, with the bases facing away from the solvent. This location is highly inaccessible, implying that RNA polymerization and other critical base pairing events in the virus life cycle require RNP disassembly. Mutational analysis of N protein supports a correlation between structure and function. Comparison between these crystal structures and electron microscopy images of both soluble tetramers and authentic RNPs suggests the N protein does not bind RNA as a repeating monomer; thus, it represents a newly described architecture for bunyavirus RNP assembly, with implications for many other segmented negative-strand RNA viruses.

  19. Nucleocapsid protein structures from orthobunyaviruses reveal insight into ribonucleoprotein architecture and RNA polymerization (United States)

    Ariza, Antonio; Tanner, Sian J.; Walter, Cheryl T.; Dent, Kyle C.; Shepherd, Dale A.; Wu, Weining; Matthews, Susan V.; Hiscox, Julian A.; Green, Todd J.; Luo, Ming; Elliott, Richard M.; Fooks, Anthony R.; Ashcroft, Alison E.; Stonehouse, Nicola J.; Ranson, Neil A.; Barr, John N.; Edwards, Thomas A.


    All orthobunyaviruses possess three genome segments of single-stranded negative sense RNA that are encapsidated with the virus-encoded nucleocapsid (N) protein to form a ribonucleoprotein (RNP) complex, which is uncharacterized at high resolution. We report the crystal structure of both the Bunyamwera virus (BUNV) N–RNA complex and the unbound Schmallenberg virus (SBV) N protein, at resolutions of 3.20 and 2.75 Å, respectively. Both N proteins crystallized as ring-like tetramers and exhibit a high degree of structural similarity despite classification into different orthobunyavirus serogroups. The structures represent a new RNA-binding protein fold. BUNV N possesses a positively charged groove into which RNA is deeply sequestered, with the bases facing away from the solvent. This location is highly inaccessible, implying that RNA polymerization and other critical base pairing events in the virus life cycle require RNP disassembly. Mutational analysis of N protein supports a correlation between structure and function. Comparison between these crystal structures and electron microscopy images of both soluble tetramers and authentic RNPs suggests the N protein does not bind RNA as a repeating monomer; thus, it represents a newly described architecture for bunyavirus RNP assembly, with implications for many other segmented negative-strand RNA viruses. PMID:23595147

  20. From The Cover: Genome-wide RNA interference screen identifies previously undescribed regulators of polyglutamine aggregation (United States)

    Nollen, Ellen A. A.; Garcia, Susana M.; van Haaften, Gijs; Kim, Soojin; Chavez, Alejandro; Morimoto, Richard I.; Plasterk, Ronald H. A.


    Protein misfolding and the formation of aggregates are increasingly recognized components of the pathology of human genetic disease and hallmarks of many neurodegenerative disorders. As exemplified by polyglutamine diseases, the propensity for protein misfolding is associated with the length of polyglutamine expansions and age-dependent changes in protein-folding homeostasis, suggesting a critical role for a protein homeostatic buffer. To identify the complement of protein factors that protects cells against the formation of protein aggregates, we tested transgenic Caenorhabditis elegans strains expressing polyglutamine expansion yellow fluorescent protein fusion proteins at the threshold length associated with the age-dependent appearance of protein aggregation. We used genome-wide RNA interference to identify genes that, when suppressed, resulted in the premature appearance of protein aggregates. Our screen identified 186 genes corresponding to five principal classes of polyglutamine regulators: genes involved in RNA metabolism, protein synthesis, protein folding, and protein degradation; and those involved in protein trafficking. We propose that each of these classes represents a molecular machine collectively comprising the protein homeostatic buffer that responds to the expression of damaged proteins to prevent their misfolding and aggregation. protein misfolding | neurodegenerative diseases

  1. MicroRNA repertoire for functional genome research in tilapia identified by deep sequencing. (United States)

    Yan, Biao; Wang, Zhen-Hua; Zhu, Chang-Dong; Guo, Jin-Tao; Zhao, Jin-Liang


    The Nile tilapia (Oreochromis niloticus; Cichlidae) is an economically important species in aquaculture and occupies a prominent position in the aquaculture industry. MicroRNAs (miRNAs) are a class of noncoding RNAs that post-transcriptionally regulate gene expression involved in diverse biological and metabolic processes. To increase the repertoire of miRNAs characterized in tilapia, we used the Illumina/Solexa sequencing technology to sequence a small RNA library using pooled RNA sample isolated from the different developmental stages of tilapia. Bioinformatic analyses suggest that 197 conserved and 27 novel miRNAs are expressed in tilapia. Sequence alignments indicate that all tested miRNAs and miRNAs* are highly conserved across many species. In addition, we characterized the tissue expression patterns of five miRNAs using real-time quantitative PCR. We found that miR-1/206, miR-7/9, and miR-122 is abundantly expressed in muscle, brain, and liver, respectively, implying a potential role in the regulation of tissue differentiation or the maintenance of tissue identity. Overall, our results expand the number of tilapia miRNAs, and the discovery of miRNAs in tilapia genome contributes to a better understanding the role of miRNAs in regulating diverse biological processes.

  2. Evolution: In Chloroplast Genomes, Anything Goes. (United States)

    Smith, David Roy


    A new study shows that Cladophorales green algae have the most unconventional chloroplast DNAs ever observed, whereby genes are located on small linear single-stranded palindromic elements. This puzzling architecture has parallels with mini-circular chloroplast genomes of dinoflagellates and raises many questions about how it arose and is maintained. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Avian reovirus L2 genome segment sequences and predicted structure/function of the encoded RNA-dependent RNA polymerase protein

    Directory of Open Access Journals (Sweden)

    Xu Wanhong


    Full Text Available Abstract Background The orthoreoviruses are infectious agents that possess a genome comprised of 10 double-stranded RNA segments encased in two concentric protein capsids. Like virtually all RNA viruses, an RNA-dependent RNA polymerase (RdRp enzyme is required for viral propagation. RdRp sequences have been determined for the prototype mammalian orthoreoviruses and for several other closely-related reoviruses, including aquareoviruses, but have not yet been reported for any avian orthoreoviruses. Results We determined the L2 genome segment nucleotide sequences, which encode the RdRp proteins, of two different avian reoviruses, strains ARV138 and ARV176 in order to define conserved and variable regions within reovirus RdRp proteins and to better delineate structure/function of this important enzyme. The ARV138 L2 genome segment was 3829 base pairs long, whereas the ARV176 L2 segment was 3830 nucleotides long. Both segments were predicted to encode λB RdRp proteins 1259 amino acids in length. Alignments of these newly-determined ARV genome segments, and their corresponding proteins, were performed with all currently available homologous mammalian reovirus (MRV and aquareovirus (AqRV genome segment and protein sequences. There was ~55% amino acid identity between ARV λB and MRV λ3 proteins, making the RdRp protein the most highly conserved of currently known orthoreovirus proteins, and there was ~28% identity between ARV λB and homologous MRV and AqRV RdRp proteins. Predictive structure/function mapping of identical and conserved residues within the known MRV λ3 atomic structure indicated most identical amino acids and conservative substitutions were located near and within predicted catalytic domains and lining RdRp channels, whereas non-identical amino acids were generally located on the molecule's surfaces. Conclusion The ARV λB and MRV λ3 proteins showed the highest ARV:MRV identity values (~55% amongst all currently known ARV and MRV

  4. An efficient and high fidelity method for amplification, cloning and sequencing of complete tospovirus genomic RNA segments (United States)

    Amplification and sequencing of the complete M- and S-RNA segments of Tomato spotted wilt virus and Impatiens necrotic spot virus as a single fragment is useful for whole genome sequencing of tospoviruses co-infecting a single host plant. It avoids issues associated with overlapping amplicon-based ...

  5. Epidemiology of rotavirus diarrhea in the Highlands of Papua, New Guinea, in 1979, as revealed by electrophoresis of genome RNA.


    Albert, M J; Bishop, R F; Shann, F A


    Results of gel electrophoresis of rotavirus genome RNA from feces of children in two provinces in Papua, New Guinea, suggest that the epidemiology of rotavirus infection in small communities with a total population of 3,000 may differ from that in urban or closely settled rural areas.

  6. The unusual nucleotide content of the HIV RNA genome results in a biased amino acid composition of HIV proteins

    NARCIS (Netherlands)

    Berkhout, B.; van Hemert, F. J.


    Extremely high frequencies of the A nucleotide are found in the RNA genomes of the lentivirus group of retroviruses. It is presently unknown what molecular force is responsible for this A-pressure. In this manuscript, we demonstrate a correlation between this 'A-pressure' and the amino acid-usage of

  7. De novo reconstruction of consensus master genomes of plant RNA and DNA viruses from siRNAs (United States)

    In antiviral defense, plants produce massive quantities of 21-24 nucleotide siRNAs. Here we demonstrate that the complete genomes of DNA and RNA viruses and viroids can be reconstructed by deep sequencing and de novo assembly of viral/viroid siRNAs from experimentally- and naturally-infected plants....

  8. A viral genome landscape of RNA polyadenylation from KSHV latent to lytic infection.

    Directory of Open Access Journals (Sweden)

    Vladimir Majerciak

    Full Text Available RNA polyadenylation (pA is one of the major steps in regulation of gene expression at the posttranscriptional level. In this report, a genome landscape of pA sites of viral transcripts in B lymphocytes with Kaposi sarcoma-associated herpesvirus (KSHV infection was constructed using a modified PA-seq strategy. We identified 67 unique pA sites, of which 55 could be assigned for expression of annotated ~90 KSHV genes. Among the assigned pA sites, twenty are for expression of individual single genes and the rest for multiple genes (average 2.7 genes per pA site in cluster-gene loci of the genome. A few novel viral pA sites that could not be assigned to any known KSHV genes are often positioned in the antisense strand to ORF8, ORF21, ORF34, K8 and ORF50, and their associated antisense mRNAs to ORF21, ORF34 and K8 could be verified by 3'RACE. The usage of each mapped pA site correlates to its peak size, the larger (broad and wide peak size, the more usage and thus, the higher expression of the pA site-associated gene(s. Similar to mammalian transcripts, KSHV RNA polyadenylation employs two major poly(A signals, AAUAAA and AUUAAA, and is regulated by conservation of cis-elements flanking the mapped pA sites. Moreover, we found two or more alternative pA sites downstream of ORF54, K2 (vIL6, K9 (vIRF1, K10.5 (vIRF3, K11 (vIRF2, K12 (Kaposin A, T1.5, and PAN genes and experimentally validated the alternative polyadenylation for the expression of KSHV ORF54, K11, and T1.5 transcripts. Together, our data provide not only a comprehensive pA site landscape for understanding KSHV genome structure and gene expression, but also the first evidence of alternative polyadenylation as another layer of posttranscriptional regulation in viral gene expression.

  9. Two Negative-Strand RNA Viruses Identified in Watermelon Represent a Novel Clade in the Order Bunyavirales

    Directory of Open Access Journals (Sweden)

    Min Xin


    Full Text Available Two novel negative-sense, single-stranded (ss RNA viruses were identified in watermelon plants and named watermelon crinkle leaf-associated virus 1 and 2 (WCLaV-1 and -2, respectively. The multipartite genomes consist of three RNA molecules of ~6.8, 1.4, and 1.3 kb. The genomes and the deduced proteins of RNA1 and RNA3 show features resembling those of members in the genus Phlebovirus and Tenuivirus; however, the predicted proteins encoded by RNA2 are related to the movement protein (MP in the genus Ophiovirus and Emaravirus. Furthermore, these two viruses define a novel clade in the family Phenuiviridae, order Bunyavirales, which is phylogenetically related to the viruses in the above four genera. Moreover, after mechanical inoculation with WCLaV-1 seedlings of the natural host watermelon plants develop crinkling similar to those observed in the field. These findings enhance our understanding of the evolution and the classification of ssRNA viruses.

  10. Visualization and measurement of ATP levels in living cells replicating hepatitis C virus genome RNA.

    Directory of Open Access Journals (Sweden)

    Tomomi Ando

    Full Text Available Adenosine 5'-triphosphate (ATP is the primary energy currency of all living organisms and participates in a variety of cellular processes. Although ATP requirements during viral lifecycles have been examined in a number of studies, a method by which ATP production can be monitored in real-time, and by which ATP can be quantified in individual cells and subcellular compartments, is lacking, thereby hindering studies aimed at elucidating the precise mechanisms by which viral replication energized by ATP is controlled. In this study, we investigated the fluctuation and distribution of ATP in cells during RNA replication of the hepatitis C virus (HCV, a member of the Flaviviridae family. We demonstrated that cells involved in viral RNA replication actively consumed ATP, thereby reducing cytoplasmic ATP levels. Subsequently, a method to measure ATP levels at putative subcellular sites of HCV RNA replication in living cells was developed by introducing a recently-established Förster resonance energy transfer (FRET-based ATP indicator, called ATeam, into the NS5A coding region of the HCV replicon. Using this method, we were able to observe the formation of ATP-enriched dot-like structures, which co-localize with non-structural viral proteins, within the cytoplasm of HCV-replicating cells but not in non-replicating cells. The obtained FRET signals allowed us to estimate ATP concentrations within HCV replicating cells as ∼5 mM at possible replicating sites and ∼1 mM at peripheral sites that did not appear to be involved in HCV replication. In contrast, cytoplasmic ATP levels in non-replicating Huh-7 cells were estimated as ∼2 mM. To our knowledge, this is the first study to demonstrate changes in ATP concentration within cells during replication of the HCV genome and increased ATP levels at distinct sites within replicating cells. ATeam may be a powerful tool for the study of energy metabolism during replication of the viral genome.

  11. A genome editing primer for the hematologist


    Hoban, Megan D.; Bauer, Daniel E.


    Gene editing enables the site-specific modification of the genome. These technologies have rapidly advanced such that they have entered common use in experimental hematology to investigate genetic function. In addition, genome editing is becoming increasingly plausible as a treatment modality to rectify genetic blood disorders and improve cellular therapies. Genome modification typically ensues from site-specific double-strand breaks and may result in a myriad of outcomes. Even single-strand ...

  12. VP1, the RNA-dependent RNA polymerase and genome-linked protein of infectious bursal disease virus, interacts with the carboxy-terminal domain of translational eukaryotic initiation factor 4AII

    NARCIS (Netherlands)

    Tacken, M.G.J.; Thomas, A.A.M.; Peeters, B.P.H.; Rottier, P.J.M.; Boot, H.J.


    Infectious bursal disease virus (IBDV), a member of the family Birnaviridae, is a non-enveloped, double-stranded RNA virus. Viral protein 1 (VP1), the putative RNA-dependent RNA polymerase, occurs in virions both as a free polypeptide and as a genome-linked protein, called VPg. To gain more insight

  13. Co-dominant expression of the HLA-G gene and various forms of alternatively spliced HLA-G mRNA in human first trimester trophoblast

    DEFF Research Database (Denmark)

    Hviid, Thomas Vauvert F.; Møller, Charlotte; Sørensen, Steen


    -implantation developmental processes. Animal studies of genomic imprinting of major histocompatibility complex (MHC) antigens in the placenta have shown discordant results. To address this issue in the human placenta, we examined the expression of the non-classical human leukocyte antigen (HLA) class I gene, HLA-G. Genomic...... imprinting of the HLA-G locus could have implications for the interaction in the feto-maternal relationship. Restriction Fragment Length Polymorphism (RFLP), allele-specific amplification and Single Strand Conformation Polymorphism (SSCP) analysis followed by DNA sequencing were performed on Reverse...... Transcription (RT) Polymerase Chain Reaction (PCR) products of HLA-G mRNA to examine the expression of maternal and paternal alleles. Our results demonstrate that HLA-G is co-dominantly expressed in first trimester trophoblast cells. A "new" non-synonymous base substitution in exon 4 was detected. We also...

  14. Improved structural annotation of protein-coding genes in the Meloidogyne hapla genome using RNA-Seq (United States)

    Guo, Yuelong; Bird, David McK; Nielsen, Dahlia M


    As high-throughput cDNA sequencing (RNA-Seq) is increasingly applied to hypothesis-driven biological studies, the prediction of protein coding genes based on these data are usurping strictly in silico approaches. Compared with computationally derived gene predictions, structural annotation is more accurate when based on biological evidence, particularly RNA-Seq data. Here, we refine the current genome annotation for the Meloidogyne hapla genome utilizing RNA-Seq data. Published structural annotation defines 14 420 protein-coding genes in the M. hapla genome. Of these, 25% (3751) were found to exhibit some incongruence with RNA-Seq data. Manual annotation enabled these discrepancies to be resolved. Our analysis revealed 544 new gene models that were missing from the prior annotation. Additionally, 1457 transcribed regions were newly identified on the ends of as-yet-unjoined contigs. We also searched for trans-spliced leaders, and based on RNA-Seq data, identified genes that appear to be trans-spliced. Four 22-bp trans-spliced leaders were identified using our pipeline, including the known trans-spliced leader, which is the M. hapla ortholog of SL1. In silico predictions of trans-splicing were validated by comparison with earlier results derived from an independent cDNA library constructed to capture trans-spliced transcripts. The new annotation, which we term HapPep5, is publically available at PMID:25254153

  15. Mutations in Cytosine-5 tRNA Methyltransferases Impact Mobile Element Expression and Genome Stability at Specific DNA Repeats

    Directory of Open Access Journals (Sweden)

    Bianca Genenncher


    Full Text Available The maintenance of eukaryotic genome stability is ensured by the interplay of transcriptional as well as post-transcriptional mechanisms that control recombination of repeat regions and the expression and mobility of transposable elements. We report here that mutations in two (cytosine-5 RNA methyltransferases, Dnmt2 and NSun2, impact the accumulation of mobile element-derived sequences and DNA repeat integrity in Drosophila. Loss of Dnmt2 function caused moderate effects under standard conditions, while heat shock exacerbated these effects. In contrast, NSun2 function affected mobile element expression and genome integrity in a heat shock-independent fashion. Reduced tRNA stability in both RCMT mutants indicated that tRNA-dependent processes affected mobile element expression and DNA repeat stability. Importantly, further experiments indicated that complex formation with RNA could also contribute to the impact of RCMT function on gene expression control. These results thus uncover a link between tRNA modification enzymes, the expression of repeat DNA, and genomic integrity.

  16. Transcriptome kinetics is governed by a genome-wide coupling of mRNA production and degradation: a role for RNA Pol II.

    Directory of Open Access Journals (Sweden)

    Ophir Shalem


    Full Text Available Transcriptome dynamics is governed by two opposing processes, mRNA production and degradation. Recent studies found that changes in these processes are frequently coordinated and that the relationship between them shapes transcriptome kinetics. Specifically, when transcription changes are counter-acted with changes in mRNA stability, transient fast-relaxing transcriptome kinetics is observed. A possible molecular mechanism underlying such coordinated regulation might lay in two RNA polymerase (Pol II subunits, Rpb4 and Rpb7, which are recruited to mRNAs during transcription and later affect their degradation in the cytoplasm. Here we used a yeast strain carrying a mutant Pol II which poorly recruits these subunits. We show that this mutant strain is impaired in its ability to modulate mRNA stability in response to stress. The normal negative coordinated regulation is lost in the mutant, resulting in abnormal transcriptome profiles both with respect to magnitude and kinetics of responses. These results reveal an important role for Pol II, in regulation of both mRNA synthesis and degradation, and also in coordinating between them. We propose a simple model for production-degradation coupling that accounts for our observations. The model shows how a simple manipulation of the rates of co-transcriptional mRNA imprinting by Pol II may govern genome-wide transcriptome kinetics in response to environmental changes.

  17. Aphis Glycines Virus 2, a Novel Insect Virus with a Unique Genome Structure

    Directory of Open Access Journals (Sweden)

    Sijun Liu


    Full Text Available The invasive soybean aphid, Aphis glycines, is a major pest in soybeans, resulting in substantial economic loss. We analyzed the A. glycines transcriptome to identify sequences derived from viruses of A. glycines. We identified sequences derived from a novel virus named Aphis glycines virus 2 (ApGlV2. The assembled virus genome sequence was confirmed by reverse transcription polymerase chain reaction (RT-PCR and Sanger sequencing, conserved domains were characterized, and distribution, and transmission examined. This virus has a positive sense, single-stranded RNA genome of ~4850 nt that encodes three proteins. The RNA-dependent RNA polymerase (RdRp of ApGlV2 is a permuted RdRp similar to those of some tetraviruses, while the capsid protein is structurally similar to the capsid proteins of plant sobemoviruses. ApGlV2 also encodes a larger minor capsid protein, which is translated by a readthrough mechanism. ApGlV2 appears to be widespread in A. glycines populations and to persistently infect aphids with a 100% vertical transmission rate. ApGlV2 is susceptible to the antiviral RNA interference (RNAi pathway. This virus, with its unique genome structure with both plant- and insect-virus characteristics, is of particular interest from an evolutionary standpoint.

  18. RNA-dependent RNA targeting by CRISPR-Cas9. (United States)

    Strutt, Steven C; Torrez, Rachel M; Kaya, Emine; Negrete, Oscar A; Doudna, Jennifer A


    Double-stranded DNA (dsDNA) binding and cleavage by Cas9 is a hallmark of type II CRISPR-Cas bacterial adaptive immunity. All known Cas9 enzymes are thought to recognize DNA exclusively as a natural substrate, providing protection against DNA phage and plasmids. Here, we show that Cas9 enzymes from both subtypes II-A and II-C can recognize and cleave single-stranded RNA (ssRNA) by an RNA-guided mechanism that is independent of a protospacer-adjacent motif (PAM) sequence in the target RNA. RNA-guided RNA cleavage is programmable and site-specific, and we find that this activity can be exploited to reduce infection by single-stranded RNA phage in vivo. We also demonstrate that Cas9 can direct PAM-independent repression of gene expression in bacteria. These results indicate that a subset of Cas9 enzymes have the ability to act on both DNA and RNA target sequences, and suggest the potential for use in programmable RNA targeting applications. © 2018, Strutt et al.

  19. Synthesis of a wild-type and three mutant Cucurbita maxima trypsin inhibitor-encoding genes by a single-strand approach. (United States)

    Botes, D P; Qobose, M D; Corfield, V A


    A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.

  20. The casein genes in goat breeds from different Continents: analysis by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP

    Directory of Open Access Journals (Sweden)

    A. Caroli


    Full Text Available A screening of casein gene variability was carried out by Polymerase Chain Reaction – Single Strand Conformation Polymorphism in 8 goat breeds from Sudan (Nubian goat, Turkey (Angora Goat Lalahan Tiftic, Angora Goat Yerkoy, Hair goat and India (Jammu, Maharashtra, Rajasthan, South Goat. A total of 16 different alleles or groups of alleles were found, showing conspicuous differences among breeds. The allele frequencies were submitted to cluster analysis in order to highlight differences between breeds, also including data from Red Sokoto, West African Dwarf Nigeria, West African Dwarf Cameroon, and Borno Goat. The tree obtained from the cluster analysis showed two main lineages. The West African goat clustered together, the Indian and Turkish breeds were in the other group. Nubian goat was found in an intermediate position.

  1. Investigation of single-strand conformational polymorphism of the TP53 gene in women with a family history of breast cancer

    Directory of Open Access Journals (Sweden)

    R.R. Burbano


    Full Text Available Breast cancer in families with germ line mutations in the TP53 gene has been described in the medical literature. Mutation screening for susceptibility genes should allow effective prophylactic and preventive measures. Using single-strand conformational polymorphism, we screened for mutations in exons 5, 6, 7 and 8 of gene TP53 in the peripheral blood of 8 young non-affected members (17 to 36 years old of families with a history of breast cancer. Studies of this type on young patients (mean age, 25 years are very rare in the literature. The identification of these mutations would contribute to genetic counseling of members of families with predisposition to breast cancer. The results obtained did not show any polymorphism indicating mutation. In our sample, the familial tumorigenesis is probably related to other gene etiologies.

  2. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.


    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  3. Influence of the single-strand linker composition on the structural/dynamical properties of a truncated octahedral DNA nano-cage family. (United States)

    Iacovelli, Federico; Alves, Cassio; Falconi, Mattia; Oteri, Francesco; de Oliveira, Cristiano L P; Desideri, Alessandro


    The structural/dynamical properties of three truncated octahedral DNA nano-cages composed by identical double helices but single strand linkers with different composition, namely 7 thymidines, 7 adenines, and 7 alternated thymidines and adenines, have been investigated through classical molecular dynamics simulations. Trajectories have been analyzed to investigate the role of the linkers in defining nano-cages stability and flexibility, including possible influence on the internal cages motions. The data indicate that the cages behavior is almost identical and that the structural/dynamical parameters measured along the trajectories are not particularly affected by the presence of different bases. These results demonstrate that the constraints imposed by the nano-structure geometry are the main factor in modulating these properties

  4. Purification, crystallization and preliminary X-ray diffraction analysis of the RNA-dependent RNA polymerase from Thosea asigna virus

    International Nuclear Information System (INIS)

    Ferrero, Diego; Buxaderas, Mònica; Rodriguez, José F.; Verdaguer, Núria


    The RNA-dependent RNA polymerase of Thosea asigna virus has been purified and crystallized in two different crystal forms. Preliminary characterization of P2 1 2 1 2 and C222 1 crystals is reported. Co-crystallization experiments in the presence of lutetium produced a heavy-atom derivative suitable for structure determination. Thosea asigna virus (TaV) is a positive-sense, single-stranded RNA (ssRNA) virus that belongs to the Permutotetravirus genera within the recently created Permutotetraviridae family. The genome of TaV consists of an RNA segment of about 5.700 nucleotides with two open reading frames, encoding for the replicase and capsid protein. The particular TaV replicase does not contain N7-methyl transferase and helicase domains but includes a structurally unique RNA-dependent RNA polymerase (RdRp) with a sequence permutation in the domain where the active site is anchored. This architecture is also found in double-stranded RNA viruses of the Birnaviridae family. Here we report the purification and preliminary crystallographic studies TaV RdRp. The enzyme was crystallized by the sitting-drop vapour diffusion method using PEG 8K and lithium sulfate as precipitants. Two different crystal forms were obtained: native RdRp crystallized in space group P2 1 2 1 2 and diffracts up to 2.1 Å and the RdRp-Lu 3+ derivative co-crystals belong to the C222 1 space group, diffracting to 3.0 Å resolution. The structure of TaV RdRp represents the first structure of a non-canonical RdRp from ssRNA viruses

  5. A genomic portrait of the genetic architecture and regulatory impact of microRNA expression in response to infection. (United States)

    Siddle, Katherine J; Deschamps, Matthieu; Tailleux, Ludovic; Nédélec, Yohann; Pothlichet, Julien; Lugo-Villarino, Geanncarlo; Libri, Valentina; Gicquel, Brigitte; Neyrolles, Olivier; Laval, Guillaume; Patin, Etienne; Barreiro, Luis B; Quintana-Murci, Lluís


    MicroRNAs (miRNAs) are critical regulators of gene expression, and their role in a wide variety of biological processes, including host antimicrobial defense, is increasingly well described. Consistent with their diverse functional effects, miRNA expression is highly context dependent and shows marked changes upon cellular activation. However, the genetic control of miRNA expression in response to external stimuli and the impact of such perturbations on miRNA-mediated regulatory networks at the population level remain to be determined. Here we assessed changes in miRNA expression upon Mycobacterium tuberculosis infection and mapped expression quantitative trait loci (eQTL) in dendritic cells from a panel of healthy individuals. Genome-wide expression profiling revealed that ∼40% of miRNAs are differentially expressed upon infection. We find that the expression of 3% of miRNAs is controlled by proximate genetic factors, which are enriched in a promoter-specific histone modification associated with active transcription. Notably, we identify two infection-specific response eQTLs, for miR-326 and miR-1260, providing an initial assessment of the impact of genotype-environment interactions on miRNA molecular phenotypes. Furthermore, we show that infection coincides with a marked remodeling of the genome-wide relationships between miRNA and mRNA expression levels. This observation, supplemented by experimental data using the model of miR-29a, sheds light on the role of a set of miRNAs in cellular responses to infection. Collectively, this study increases our understanding of the genetic architecture of miRNA expression in response to infection, and highlights the wide-reaching impact of altering miRNA expression on the transcriptional landscape of a cell.

  6. Evidence that single-stranded DNA breaks are a normal feature of koala sperm chromatin, while double-stranded DNA breaks are indicative of DNA damage. (United States)

    Zee, Yeng Peng; López-Fernández, Carmen; Arroyo, F; Johnston, Stephen D; Holt, William V; Gosalvez, Jaime


    In this study, we have used single and double comet assays to differentiate between single- and double-stranded DNA damage in an effort to refine the interpretation of DNA damage in mature koala spermatozoa. We have also investigated the likelihood that single-stranded DNA breakage is part of the natural spermiogenic process in koalas, where its function would be the generation of structural bends in the DNA molecule so that appropriate packaging and compaction can occur. Koala spermatozoa were examined using the sperm chromatin dispersion test (SCDt) and comet assays to investigate non-orthodox double-stranded DNA. Comet assays were conducted under 1) neutral conditions; and 2) neutral followed by alkaline conditions (double comet assay); the latter technique enabled simultaneous visualisation of both single-stranded and double-stranded DNA breaks. Following the SCDt, there was a continuum of nuclear morphotypes, ranging from no apparent DNA fragmentation to those with highly dispersed and degraded chromatin. Dispersion morphotypes were mirrored by a similar diversity of comet morphologies that could be further differentiated using the double comet assay. The majority of koala spermatozoa had nuclei with DNA abasic-like residues that produced single-tailed comets following the double comet assay. The ubiquity of these residues suggests that constitutive alkali-labile sites are part of the structural configuration of the koala sperm nucleus. Spermatozoa with 'true' DNA fragmentation exhibited a continuum of comet morphologies, ranging from a more severe form of alkaline-susceptible DNA with a diffuse single tail to nuclei that exhibited both single- and double-stranded breaks with two comet tails.

  7. Functional roles of the N- and C-terminal regions of the human mitochondrial single-stranded DNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Marcos T Oliveira


    Full Text Available Biochemical studies of the mitochondrial DNA (mtDNA replisome demonstrate that the mtDNA polymerase and the mtDNA helicase are stimulated by the mitochondrial single-stranded DNA-binding protein (mtSSB. Unlike Escherichia coli SSB, bacteriophage T7 gp2.5 and bacteriophage T4 gp32, mtSSBs lack a long, negatively charged C-terminal tail. Furthermore, additional residues at the N-terminus (notwithstanding the mitochondrial presequence are present in the sequence of species across the animal kingdom. We sought to analyze the functional importance of the N- and C-terminal regions of the human mtSSB in the context of mtDNA replication. We produced the mature wild-type human mtSSB and three terminal deletion variants, and examined their physical and biochemical p