WorldWideScience

Sample records for single-stranded restriction sites

  1. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.

    1985-01-01

    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  2. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.

    1978-01-01

    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  3. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  4. On-site detection of Phytophthora spp.—single-stranded target DNA as the limiting factor to improve on-chip hybridization

    International Nuclear Information System (INIS)

    Schwenkbier, Lydia; Pollok, Sibyll; Popp, Jürgen; Weber, Karina; König, Stephan; Wagner, Stefan; Werres, Sabine; Weber, Jörg; Hentschel, Martin

    2014-01-01

    We report on a lab-on-a-chip approach for on-site detection of Phytophthora species that allows visual signal readout. The results demonstrate the significance of single-stranded DNA (ssDNA) generation in terms of improving the intensity of the hybridization signal and to improve the reliability of the method. Conventional PCR with subsequent heat denaturation, sodium hydroxide-based denaturation, lambda exonuclease digestion and two asymmetric PCR methods were investigated for the species P. fragariae, P. kernoviae, and P. ramorum. The positioning of the capture probe within the amplified yeast GTP-binding protein (YPT1) target DNA was also of interest because it significantly influences the intensity of the signal. Statistical tests were used to validate the impact of the ssDNA generation methods and the capture-target probe position. The single-stranded target DNA generated by Linear-After-The-Exponential PCR (LATE-PCR) was found to produce signal intensities comparable to post-PCR exonuclease treatment. The LATE-PCR is the best method for the on-site detection of Phytophthora because the enzymatic digestion after PCR is more laborious and time-consuming. (author)

  5. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  6. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.

    1978-01-01

    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  7. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS.

    Science.gov (United States)

    Pachkowski, Brian F; Tano, Keizo; Afonin, Valeriy; Elder, Rhoderick H; Takeda, Shunichi; Watanabe, Masami; Swenberg, James A; Nakamura, Jun

    2009-12-01

    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase beta.

  8. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  9. Site-specific binding of viral plus single-stranded RNA to replicase-containing open virus-like particles of yeast.

    OpenAIRE

    Esteban, R; Fujimura, T; Wickner, R B

    1988-01-01

    X double-stranded RNA is a deletion mutant of L-A double-stranded RNA and is encapsidated in viral particles by the L-A-encoded major coat protein. X double-stranded RNA has all the cis sites necessary to be transcribed, encapsidated, and replicated. We have cloned X double-stranded RNA and sequenced it. The complete X double-stranded RNA sequence deduced indicates that the first 25 bases of the X plus-strand 5' end originated from the 5' end of the L-A plus strand and that most, if not all, ...

  10. Mutagenesis of the Agrobacterium VirE2 single-stranded DNA-binding protein identifies regions required for self-association and interaction with VirE1 and a permissive site for hybrid protein construction.

    Science.gov (United States)

    Zhou, X R; Christie, P J

    1999-07-01

    The VirE2 single-stranded DNA-binding protein (SSB) of Agrobacterium tumefaciens is required for delivery of T-DNA to the nuclei of susceptible plant cells. By yeast two-hybrid and immunoprecipitation analyses, VirE2 was shown to self-associate and to interact with VirE1. VirE2 mutants with small deletions or insertions of a 31-residue oligopeptide (i31) at the N or C terminus or with an i31 peptide insertion at Leu236 retained the capacity to form homomultimers. By contrast, VirE2 mutants with modifications outside a central region located between residues 320 and 390 retained the capacity to interact with VirE1. These findings suggest the tertiary structure of VirE2 is important for homomultimer formation whereas a central domain mediates formation of a complex with VirE1. The capacity of VirE2 mutants to interact with full-length VirE2 in the yeast Saccharomyces cerevisiae correlated with the abundance of the mutant proteins in A. tumefaciens, suggesting that VirE2 is stabilized by homomultimerization in the bacterium. We further characterized the promoter and N- and C-terminal sequence requirements for synthesis of functional VirE2. A PvirB::virE2 construct yielded functional VirE2 protein as defined by complementation of a virE2 null mutation. By contrast, PvirE or Plac promoter constructs yielded functional VirE2 only if virE1 was coexpressed with virE2. Deletion of 10 or 9 residues from the N or C terminus of VirE2, respectively, or addition of heterologous peptides or proteins to either terminus resulted in a loss of protein function. However, an i31 peptide insertion at Tyr39 had no effect on protein function as defined by the capacity of the mutant protein to (i) interact with native VirE2, (ii) interact with VirE1, (iii) accumulate at abundant levels in A. tumefaciens, and (iv) restore wild-type virulence to a virE2 null mutant. We propose that Tyr39 of VirE2 corresponds to a permissive site for insertion of heterologous peptides or proteins of interest

  11. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks.

    Science.gov (United States)

    Pachkowski, Brian; Nakamura, Jun

    2013-01-01

    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  12. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    Science.gov (United States)

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  13. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.

    1985-01-01

    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  14. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)

    student

    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  15. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis.

    Science.gov (United States)

    Olszewski, Marcin; Mickiewicz, Małgorzata; Kur, Józef

    2008-07-01

    The thermophilic bacterium Thermoanaerobacter tengcongensis has two single-stranded DNA-binding (SSB) proteins, designated TteSSB2 and TteSSB3. In a SSB complementation assay in Escherichia coli, only TteSSB3 took over the in vivo function of EcoSSB. We have cloned the ssb genes obtained by PCR and have developed E. coli overexpression systems. The TteSSB2 and TteSSB3 consist of 153 and 150 amino acids with a calculated molecular mass of 17.29 and 16.96 kDa, respectively. They are the smallest known bacterial SSB proteins. The homology between amino acid sequences of these proteins is 40% identity and 53% similarity. They are functional as homotetramers, with each monomer encoding one single-stranded DNA binding domain (OB-fold). In fluorescence titrations with poly(dT), both proteins bind single-stranded DNA with a binding site size of about 40 nt per homotetramer. Thermostability with half-life of about 30 s at 95 degrees C makes TteSSB3 similar to the known SSB of Thermus aquaticus (TaqSSB). The TteSSB2 was fully active even after 6 h incubation at 100 degrees C. Here, we show for the first time paralogous thermostable homotetrameric SSBs, which could be an attractive alternative for known homodimeric thermostable SSB proteins in their applications for molecular biology methods and analytical purposes.

  16. Improved single-strand DNA sizing accuracy in capillary electrophoresis.

    OpenAIRE

    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B

    1997-01-01

    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  17. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes

    OpenAIRE

    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  18. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  19. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  20. Programmable autonomous synthesis of single-stranded DNA

    Science.gov (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

    2018-02-01

    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  1. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris

    2016-01-01

    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA-binding pro......Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...... leads to enhanced cooperative binding to DNA.Conclusions: Our findings contribute to the emerging picture that bacterial proteins, exemplified here by SsbA, undergo phosphorylation at multiple residues. This results in a complex regulation of cellular functions, and suggests that the complexity...

  2. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    Science.gov (United States)

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  3. Elastic properties of alternative versus single-stranded leveling archwires.

    Science.gov (United States)

    Rucker, Brian K; Kusy, Robert P

    2002-11-01

    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  4. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.

    1976-02-01

    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  5. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.

    1984-01-01

    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  6. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  7. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela

    2010-01-01

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  8. Genetic evidence for single-strand lesions initiating Nbs1-dependent homologous recombination in diversification of Ig v in chicken B lymphocytes.

    Directory of Open Access Journals (Sweden)

    Makoto Nakahara

    2009-01-01

    Full Text Available Homologous recombination (HR is initiated by DNA double-strand breaks (DSB. However, it remains unclear whether single-strand lesions also initiate HR in genomic DNA. Chicken B lymphocytes diversify their Immunoglobulin (Ig V genes through HR (Ig gene conversion and non-templated hypermutation. Both types of Ig V diversification are initiated by AID-dependent abasic-site formation. Abasic sites stall replication, resulting in the formation of single-stranded gaps. These gaps can be filled by error-prone DNA polymerases, resulting in hypermutation. However, it is unclear whether these single-strand gaps can also initiate Ig gene conversion without being first converted to DSBs. The Mre11-Rad50-Nbs1 (MRN complex, which produces 3' single-strand overhangs, promotes the initiation of DSB-induced HR in yeast. We show that a DT40 line expressing only a truncated form of Nbs1 (Nbs1(p70 exhibits defective HR-dependent DSB repair, and a significant reduction in the rate--though not the fidelity--of Ig gene conversion. Interestingly, this defective gene conversion was restored to wild type levels by overproduction of Escherichia coli SbcB, a 3' to 5' single-strand-specific exonuclease, without affecting DSB repair. Conversely, overexpression of chicken Exo1 increased the efficiency of DSB-induced gene-targeting more than 10-fold, with no effect on Ig gene conversion. These results suggest that Ig gene conversion may be initiated by single-strand gaps rather than by DSBs, and, like SbcB, the MRN complex in DT40 may convert AID-induced lesions into single-strand gaps suitable for triggering HR. In summary, Ig gene conversion and hypermutation may share a common substrate-single-stranded gaps. Genetic analysis of the two types of Ig V diversification in DT40 provides a unique opportunity to gain insight into the molecular mechanisms underlying the filling of gaps that arise as a consequence of replication blocks at abasic sites, by HR and error

  9. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.

    1982-01-01

    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  10. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2003-01-01

    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  11. Substrate-assisted 2D DNA lattices and algorithmic lattices from single-stranded tiles.

    Science.gov (United States)

    Kim, Junghoon; Ha, Tai Hwan; Park, Sung Ha

    2015-08-07

    We present a simple route to circumvent kinetic traps which affect many types of DNA nanostructures in their self-assembly process. Using this method, a new 2D DNA lattice made up of short, single-stranded tile (SST) motifs was created. Previously, the growth of SST DNA assemblies was restricted to 1D (tubes and ribbons) or finite-sized 2D (molecular canvases). By utilizing the substrate-assisted growth method, sets of SSTs were designed as unit cells to self-assemble into periodic and aperiodic 2D lattices which continuously grow both along and orthogonal to the helical axis. Notably, large-scale (∼1 μm(2)) fully periodic 2D lattices were fabricated using a minimum of just 2 strand species. Furthermore, the ability to create 2D lattices from a few motifs enables certain rules to be encoded into these SSTs to carry out algorithmic self-assembly. A set of these motifs was designed to execute simple 1-input 1-output COPY and NOT algorithms, the space-time manifestations which were aperiodic 2D algorithmic SST lattices. The methodology presented here can be straightforwardly applied to other motifs which fall into this type of kinetic trap to create novel DNA crystals.

  12. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.

    OpenAIRE

    Barany, F; Boeke, J D

    1983-01-01

    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  13. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes

    Science.gov (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.

    2015-01-01

    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  14. Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages.

    Science.gov (United States)

    Kodaira, K; Godson, N G; Taketo, A

    1995-01-25

    The minus origins for complementary strand DNA synthesis (-ori) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, phi K, alpha 3, and St-1 closely resemble each other in DNA structure and contain two potential secondary hairpin loops (I and II) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the -ori regions of phi K and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the phi K mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several phi K and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway.

  15. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  16. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)

    1994-09-01

    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  17. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair

    Science.gov (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.

    2009-01-01

    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  18. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-05

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity*

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.

    2015-01-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  20. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.

    1992-01-01

    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  1. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  2. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase.

    Science.gov (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias

    2017-06-02

    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi

    1990-01-01

    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  4. Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

    Science.gov (United States)

    Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

    2011-01-01

    In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

  5. Internal restriction sites: quality assurance aids in genotyping.

    Science.gov (United States)

    O'Rourke, Brendon A; Dennis, Julie A; Healy, Peter J

    2006-03-01

    Improvements to restriction fragment length polymorphism (RFLP)-based genotyping assays currently used for detection of mutations responsible for bovine ferrochelatase and myophosphorylase deficiencies, and equine hyperkalemic periodic paralysis (HYPP) are described. Reports of sporadic inhibition of restriction enzyme activity suggest a critical factor in RFLP-based genotyping assays should be assurance that restriction enzymes perform to specification with every sample. The RFLP genotyping assays that use either a mismatched recognition sequence in one or both of the oligonucleotides, or incorporate a second native site within the PCR amplicon, provide the mechanism by which efficiency of restriction enzymes can be assessed with every sample. The outcome is confirmation of the activity of the discriminating enzyme regardless of genotype.

  6. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der

    1988-01-01

    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  7. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.

    2002-01-01

    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit...

  8. Ion assisted structural collapse of a single stranded DNA: A molecular dynamics approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Soumadwip; Dixit, Himanshu; Chakrabarti, Rajarshi, E-mail: rajarshi@chem.iitb.ac.in

    2015-09-28

    Highlights: • The dynamics of a single-stranded DNA in presence of different concentrations of Mg{sup 2+} is investigated. • The initial DNA chain collapse is characterized by the formation of non-sequentially stacked base pairs. • The DNA chain re-swells at high concentrations of Mg{sup 2+} as a consequence of overcharging. - Abstract: The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counterions. It is well known that the structural collapse of DNA is favoured in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl{sub 2}) single stranded DNA with base sequence 5′-CGCGAATTCGCG-3′ (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  9. Dynamics of RecA filaments on single-stranded DNA

    NARCIS (Netherlands)

    Van Loenhout, M.T.J.; Van der Heijden, T.; Kanaar, R.; Wyman, C.; Dekker, C.

    2009-01-01

    RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on

  10. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2001-01-01

    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  11. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP

    1996-01-01

    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  12. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  13. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket.

    Science.gov (United States)

    Pham, Hanh T; Bergoin, Max; Tijssen, Peter

    2013-03-14

    The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  14. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket

    OpenAIRE

    Pham, Hanh T.; Bergoin, Max; Tijssen, Peter

    2013-01-01

    International audience; The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  15. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.

    1983-01-01

    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  16. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B

    2006-01-01

    by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  17. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  18. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud

    2012-06-01

    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  19. A partial digest approach to restriction site mapping.

    Science.gov (United States)

    Skiena, S S; Sundaram, G

    1994-03-01

    We present a new, practical algorithm to resolve the experimental data in restriction site analysis, which is a common technique for mapping DNA. Specifically, we assert that multiple digestions with a single restriction enzyme can provide sufficient information to identify the positions of the restriction sites with high probability. The motivation for the new approach comes from combinatorial results on the number of mutually homeometric sets in one dimension, where two sets of n points are homeometric if the multiset of n(n-1)/2 distances they determine are the same. Since experimental data contain errors, we propose algorithms for reconstructing sets from noisy interpoint distances, including the possibility of missing fragments. We analyse the performance of these algorithms under a reasonable probability distribution, establishing a relative error limit of r = theta(1/n2) beyond which our technique becomes infeasible. Through simulations, we establish that our technique is robust enough to reconstruct data with relative errors of up to 7.0% in the measured fragment lengths for typical problems, which appears sufficient for certain biological applications.

  20. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana.

    Science.gov (United States)

    Olszewski, Marcin; Grot, Anna; Wojciechowski, Marek; Nowak, Marta; Mickiewicz, Małgorzata; Kur, Józef

    2010-10-15

    In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. We report the characterization of single-stranded DNA binding proteins (SSBs) from the thermophilic bacteria Thermotoga maritima (TmaSSB) and Thermotoga neapolitana (TneSSB). They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively). They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold) in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC) the melting temperature (Tm) was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR).

  1. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata

    2010-10-01

    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  2. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.

    1982-01-01

    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  3. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    Science.gov (United States)

    Hong, Ka Lok

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  4. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification

    OpenAIRE

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-01-01

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen...

  5. In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides

    International Nuclear Information System (INIS)

    Oppenheim, Amos B.; Rattray, Alison J.; Bubunenko, Mikhail; Thomason, Lynn C.; Court, Donald L.

    2004-01-01

    We demonstrate that the bacteriophage λ Red functions efficiently recombine linear DNA or single-strand oligonucleotides (ss-oligos) into bacteriophage λ to create specific changes in the viral genome. Point mutations, deletions, and gene replacements have been created. While recombineering with oligonucleotides, we encountered other mutations accompanying the desired point mutational change. DNA sequence analysis suggests that these unwanted mutations are mainly frameshift deletions introduced during oligonucleotide synthesis

  6. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana.

    Science.gov (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L

    2005-04-01

    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  7. Intercalation of single-strand oligonucleotides between nucleolipid anionic membranes: a neutron diffraction study.

    Science.gov (United States)

    Milani, Silvia; Berti, Debora; Dante, Silvia; Hauss, Thomas; Baglioni, Piero

    2009-04-07

    This contribution presents a neutron diffraction investigation of anionic lamellar phases composed of mixtures of 1-palmitoyl, 2-oleoyl phosphatidyl-nucleosides (POPN, where N is either adenosine or uridine), and POPC (1-palmitoyl,2-oleoyl-phosphatidyl-choline). Their behavior is studied for two different mole ratios and in the presence of nucleic acids. The samples are formed by the evaporation of liposomal dispersions prepared in water or in solutions containing single-strand oligonucleotides. Previous small angle X-ray scattering (SAXS) experiments on the system POPA/polyU (polyuridylic acid, high degree of polymerization, synthetic ribonucleic acid) proved that the insertion and ordering of the biopolymer in the phospholipid lamellae were driven by molecular recognition. In the present study, we extend the previous investigation to single-strand monodisperse oligonucleotides (50-mers). Structural details of the membranes were obtained from the analysis of the neutron diffraction scattering length density profiles. The evidence of direct and specific interactions, driven by molecular recognition between the nucleic polar heads of the nucleolipid and the single-strand nucleic acid, is strengthened by the comparison with identically charged bilayers formed by POPG/POPC. These results contribute to the understanding of the parameters governing the interactions between nucleolipid membranes and oligonucleotides, providing a novel strategy for the design of lipid-based vehicles for nucleic acids.

  8. Stretching and controlled motion of single-stranded DNA in locally heated solid-state nanopores.

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B; Aksimentiev, Aleksei

    2013-08-27

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4-8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA.

  9. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids.

    Science.gov (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R

    2015-04-08

    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  10. Repair of ultraviolet light damage in Saccharomyces cerevisiae as studied with double- and single-stranded incoming DNAs

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, D.; Hieda, K.

    1992-01-01

    Purified double- and single-stranded DNAs of the autonomously replicating vector M13RK9-T were irradiated with ultraviolet light (UV) in vitro and introduced into competent whole cells of Saccharomyces cerevisiae. Incoming double-stranded DNA was more sensitive to UV in excision repair-deficient rad2-1 cells than in proficient repair RAD + cells, while single-stranded DNA exhibited high sensitivity in both host cells. The results indicate that in yeast there is no effective rescue of UV-incoming single-stranded DNA by excision repair or other constitutive dark repair processes

  11. SiteFind: A software tool for introducing a restriction site as a marker for successful site-directed mutagenesis

    Directory of Open Access Journals (Sweden)

    Evans Paul M

    2005-12-01

    Full Text Available Abstract Background Site-directed mutagenesis is a widely-used technique for introducing mutations into a particular DNA sequence, often with the goal of creating a point mutation in the corresponding amino acid sequence but otherwise leaving the overall sequence undisturbed. However, this method provides no means for verifying its success other than sequencing the putative mutant construct: This can quickly become an expensive method for screening for successful mutations. An alternative to sequencing is to simultaneously introduce a restriction site near the point mutation in manner such that the restriction site has no effect on the translated amino acid sequence. Thus, the novel restriction site can be used as a marker for successful mutation which can be quickly and easily assessed. However, finding a restriction site that does not disturb the corresponding amino acid sequence is a time-consuming task even for experienced researchers. A fast and easy to use computer program is needed for this task. Results We wrote a computer program, called SiteFind, to help us design a restriction site within the mutation primers without changing the peptide sequence. Because of the redundancy of genetic code, a given peptide can be encoded by many different DNA sequences. Since the list of possible restriction sites for a given DNA sequence is not always obvious, SiteFind automates this task. The number of possible sequences a computer program must search through increases exponentially as the sequence length increases. SiteFind uses a novel "moving window" algorithm to reduce the number of possible sequences to be searched to a manageable level. The user enters a nucleotide sequence, specifies what amino acid residues should be changed in the mutation, and SiteFind generates a list of possible restriction sites and what nucleotides must be changed to introduce that site. As a demonstration of its use, we successfully generated a single point mutation

  12. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)

    2012-04-04

    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  13. A general fluorescent sensor design strategy for "turn-on" activity detection of exonucleases and restriction endonucleases based on graphene oxide.

    Science.gov (United States)

    Zhang, Qi; Kong, De-Ming

    2013-11-07

    Using graphene oxide (GO) as a nanoquencher, a universal sensor design strategy was developed on the basis of significantly different binding affinities of GO to single-stranded DNAs (ss-DNAs) with different lengths. The proposed sensors could be used for the activity detection of both exonucleases and restriction endonucleases. To achieve this, a single-labeled fluorescent oligonucleotide probe, which had a single-stranded structure or a hairpin structure with a long single-stranded loop, was used. Such a probe could be efficiently absorbed on the surface of GO, resulting in the quenching of the fluorescent signal. Excision of the single-stranded probe by exonucleases or site-specific cleavage at the double-stranded stem of the hairpin probe by restriction endonuclease released fluorophore-labeled nucleotide, which could not be efficiently absorbed by GO, thus leading to increase in fluorescence of the corresponding sensing system. As examples, three sensors, which were used for activity detection of the exonuclease Exo 1 and the restriction endonucleases EcoR I and Hind III, were developed. These three sensors could specifically and sensitively detect the activities of Exo 1, EcoR I and Hind III with detection limits of 0.03 U mL(-1), 0.06 U mL(-1) and 0.04 U mL(-1), respectively. Visual detection was also possible.

  14. Capillary electrophoresis ribosomal RNA single-stranded conformation polymorphism: a new approach for characterization of low-diversity microbial communities.

    Science.gov (United States)

    Nai, Yi H; Zemb, Oliver; Gutierrez-Zamora, Maria-Luisa; Manefield, Mike; Powell, Shane M; Breadmore, Michael C

    2012-10-01

    Capillary electrophoresis (CE) has been the principle system for nucleic acid analysis since the early 1990s due to its inherent advantages such as fast analysis time, high resolution and efficiency, minimal sample requirement, high detection sensitivity, and automation. In the past few decades, microbial community fingerprinting methods such as terminal restriction fragment length polymorphism and single-stranded conformation polymorphism (SSCP) have migrated to CE to utilize its advantages over conventional slab gel electrophoresis. Recently, a gel-based direct rRNA fingerprint method was demonstrated. Different from other existing microbial community characterization approaches, this novel approach is polymerase chain reaction free and capable of providing information on the relative abundance of rRNA from individual phylotypes in low-diversity samples. As a gel-based method, it has a long analysis time and relatively large reagent and sample requirements. Here, we addressed these limitations by transferring the RNA fingerprint approach to the CE platform. Analysis time significantly improved from 24 h to 60 min, and the use of a fluorescently labeled hybridization probe as the detection strategy decreased the sample requirement by ten-fold. The combination of fast analysis time, low sample requirement, and sensitive fluorescence detection makes CE-RNA-SSCP an appealing new approach for characterizing low-diversity microbial communities.

  15. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))

    1993-03-01

    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  16. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.

    1980-01-01

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  17. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth

    2014-01-01

    . We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices......Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells...

  18. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela

    2015-01-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  19. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted

    2014-01-01

    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  20. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams

    2014-01-01

    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  1. Identification and characterization of single-stranded DNA-binding protein from the facultative psychrophilic bacteria Pseudoalteromonas haloplanktis.

    Science.gov (United States)

    Olszewski, Marcin; Nowak, Marta; Cyranka-Czaja, Anna; Kur, Józef

    2014-01-01

    Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism such as DNA replication, repair, and recombination, and is essential for cell survival. This study reports on the ssb-like gene cloning, gene expression and characterization of a single-stranded DNA-binding protein of Pseudoalteromonas haloplanktis (PhaSSB) and is the first report of such a protein from psychrophilic microorganism. PhaSSB possesses a high sequence similarity to Escherichia coli SSB (48% identity and 57% similarity) and has the longest amino acid sequence (244 amino acid residues) of all the known bacterial SSBs with one OB-fold per monomer. An analysis of purified PhaSSB by means of chemical cross-linking experiments, sedimentation analysis and size exclusion chromatography revealed a stable tetramer in solution. Using EMSA, we characterized the stoichiometry of PhaSSB complexed with a series of ssDNA homopolymers, and the size of the binding site was determined as being approximately 35 nucleotides long. In fluorescence titrations, the occluded site size of PhaSSB on poly(dT) is 34 nucleotides per tetramer under low-salt conditions (2mM NaCl), but increases to 54-64 nucleotides at higher-salt conditions (100-300mM NaCl). This suggests that PhaSSB undergoes a transition between ssDNA binding modes, which is observed for EcoSSB. The binding properties of PhaSSB investigated using SPR technology revealed that the affinity of PhaSSB to ssDNA is typical of SSB proteins. The only difference in the binding mode of PhaSSB to ssDNA is a faster association phase, when compared to EcoSSB, though compensated by faster dissociation rate. When analyzed by differential scanning calorimetry (DSC), the melting temperature (Tm) was determined as 63 °C, which is only a few degrees lower than for EcoSSB. Copyright © 2013 Elsevier GmbH. All rights reserved.

  2. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng

    2015-05-08

    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  3. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    Science.gov (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora.

    Science.gov (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E

    2003-08-01

    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  5. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Science.gov (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  6. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification.

    Science.gov (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-10-07

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  7. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  8. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)

    2015-04-22

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  9. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia

    2009-01-01

    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  10. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA.

    Science.gov (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi

    2008-03-28

    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  11. Oxidized base damage and single-strand break repair in mammalian genomes: role of disordered regions and posttranslational modifications in early enzymes.

    Science.gov (United States)

    Hegde, Muralidhar L; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic endonuclease 1 (APE1), form complexes with downstream repair (and other noncanonical) proteins via pairwise interactions. Furthermore, a unique feature of mammalian early BER/SSBR enzymes is the presence of a disordered terminal extension that is absent in their Escherichia coli prototypes. These nonconserved segments usually contain organelle-targeting signals, common interaction interfaces, and sites of posttranslational modifications that may be involved in regulating their repair function including lesion scanning. Finally, the linkage of BER/SSBR deficiency to cancer, aging, and human neurodegenerative diseases, and therapeutic targeting of BER/SSBR are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Empirical model for matching spectrophotometric reflectance of yarn windings and multispectral imaging reflectance of single strands of yarns.

    Science.gov (United States)

    Luo, Lin; Shen, Hui-Liang; Shao, Si-Jie; Xin, John

    2015-08-01

    The state-of-the-art multispectral imaging system can directly acquire the reflectance of a single strand of yarn that is impossible for traditional spectrophotometers. Instead, the spectrophotometric reflectance of a yarn winding, which is constituted by yarns wound on a background card, is regarded as the yarn reflectance in textile. While multispectral imaging systems and spectrophotometers can be separately used to acquire the reflectance of a single strand of yarn and corresponding yarn winding, the quantitative relationship between them is not yet known. In this paper, the relationship is established based on models that describe the spectral response of a spectrophotometer to a yarn winding and that of a multispectral imaging system to a single strand of yarn. The reflectance matching function from a single strand of yarn to corresponding yarn winding is derived to be a second degree polynomial function, which coefficients are the solutions of a constrained nonlinear optimization problem. Experiments on 100 pairs of samples show that the proposed approach can reduce the color difference between yarn windings and single strands of yarns from 2.449 to 1.082 CIEDE2000 units. The coefficients of the optimal reflection matching function imply that the reflectance of a yarn winding measured by a spectrophotometer consists of not only the intrinsic reflectance of yarn but also the nonignorable interreflection component between yarns.

  13. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  14. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan

    2015-01-01

    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  15. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik

    1992-04-01

    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  16. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.

    1987-01-01

    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  17. Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Gust, I.D.; Feinstone, S.M.; Purcell, R.H.; Alter, H.J.

    1980-01-01

    A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

  18. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata).

    Science.gov (United States)

    Jackson, Elliot W; Bistolas, Kalia S I; Button, Jason B; Hewson, Ian

    2016-01-01

    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates.

  19. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.

    1980-01-01

    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  20. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux

    2016-12-01

    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  1. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  2. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif

    Science.gov (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  3. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H

    2012-02-22

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  4. Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1

    DEFF Research Database (Denmark)

    Yang, Jay; Bachrati, Csanad Z; Ou, Jiongwen

    2010-01-01

    -passage mechanism. We generated single-stranded catenanes that resemble the proposed dissolution intermediate recognized by human topoisomerase IIIalpha. We demonstrate that human topoisomerase IIIalpha is a single-stranded DNA decatenase that is specifically stimulated by the BLM-RMI1 pair. In addition, RMI1......Human topoisomerase IIIalpha is a type IA DNA topoisomerase that functions with BLM and RMI1 to resolve DNA replication and recombination intermediates. BLM, human topoisomerase IIIalpha, and RMI1 catalyze the dissolution of double Holliday junctions into noncrossover products via a strand...

  5. Programmable DNA-Guided Artificial Restriction Enzymes.

    Science.gov (United States)

    Enghiad, Behnam; Zhao, Huimin

    2017-05-19

    Restriction enzymes are essential tools for recombinant DNA technology that have revolutionized modern biological research. However, they have limited sequence specificity and availability. Here we report a Pyrococcus furiosus Argonaute (PfAgo) based platform for generating artificial restriction enzymes (AREs) capable of recognizing and cleaving DNA sequences at virtually any arbitrary site and generating defined sticky ends of varying length. Short DNA guides are used to direct PfAgo to target sites for cleavage at high temperatures (>87 °C) followed by reannealing of the cleaved single stranded DNAs. We used this platform to generate over 18 AREs for DNA fingerprinting and molecular cloning of PCR-amplified or genomic DNAs. These AREs work as efficiently as their naturally occurring counterparts, and some of them even do not have any naturally occurring counterparts, demonstrating easy programmability, generality, versatility, and high efficiency for this new technology.

  6. SDM-Assist software to design site-directed mutagenesis primers introducing "silent" restriction sites.

    Science.gov (United States)

    Karnik, Abhijit; Karnik, Rucha; Grefen, Christopher

    2013-03-22

    Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. We have developed a program - 'SDM-Assist' which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of 'mutated clones' by a simple restriction digest. The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs.

  7. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.

    1988-01-01

    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  8. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.

    2012-01-01

    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  9. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues

    Science.gov (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak

    2006-01-01

    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  10. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos

    2015-09-01

    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  11. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol

    2010-05-01

    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  12. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.

    2007-01-01

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  13. Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems.

    Science.gov (United States)

    Musumeci, Domenica; Rozza, Lucia; Merlino, Antonello; Paduano, Luigi; Marzo, Tiziano; Massai, Lara; Messori, Luigi; Montesarchio, Daniela

    2015-08-21

    The interaction of the anticancer Ru(iii) complex AziRu - in comparison with its analogue NAMI-A, currently in advanced clinical trials as an antimetastatic agent - with DNA model systems, both single stranded and duplex oligonucleotides, was investigated using a combined approach, including absorption UV-vis spectroscopy, circular dichroism (CD) and electrospray mass spectrometry (ESI-MS) techniques. UV-vis absorption spectra of the Ru complexes were recorded at different times in a pseudo-physiological solution, to monitor the ligand exchange processes in the absence and in the presence of the examined oligonucleotides. CD experiments provided information on the overall conformational changes of the DNA model systems induced by these metal complexes. UV- and CD-monitored thermal denaturation studies were performed to analyse the effects of AziRu and NAMI-A on the stability of the duplex structures. ESI-MS experiments, carried out on the oligonucleotide/metal complex mixtures under investigation, allowed us to detect the formation of stable adducts between the guanine-containing oligomers and the ruthenium complexes. These data unambiguously demonstrate that both AziRu and NAMI-A can interact with the DNA model systems. Although very similar in their structures, the two metal compounds manifest a markedly different reactivity with the examined sequences, respectively, with either a naked Ru(3+) ion or a Ru(Im)(3+) (Im = imidazole) fragment being incorporated into the oligonucleotide structure via stable linkages.

  14. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop.

    Science.gov (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S

    2009-05-01

    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  15. Biophysical characterization of the association of histones with single-stranded DNA.

    Science.gov (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier

    2017-11-01

    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong

    2008-01-01

    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  17. Effect of Conformational Entropy on the Nanomechanics of Microcantilever-Based Single-Stranded DNA Sensors

    Directory of Open Access Journals (Sweden)

    Zou-Qing Tan

    2014-09-01

    Full Text Available An entropy-controlled bending mechanism is presented to study the nanomechanics of microcantilever-based single-stranded DNA (ssDNA sensors. First; the conformational free energy of the ssDNA layer is given with an improved scaling theory of thermal blobs considering the curvature effect; and the mechanical energy of the non-biological layer is described by Zhang’s two-variable method for laminated beams. Then; an analytical model for static deflections of ssDNA microcantilevers is formulated by the principle of minimum energy. The comparisons of deflections predicted by the proposed model; Utz–Begley’s model and Hagan’s model are also examined. Numerical results show that the conformational entropy effect on microcantilever deflections cannot be ignored; especially at the conditions of high packing density or long chain systems; and the variation of deflection predicted by the proposed analytical model not only accords with that observed in the related experiments qualitatively; but also appears quantitatively closer to the experimental values than that by the preexisting models. In order to improve the sensitivity of static-mode biosensors; it should be as small as possible to reduce the substrate stiffness.

  18. In vitro selection and characterization of single stranded DNA aptamers for luteolin: A possible recognition tool.

    Science.gov (United States)

    Tuma Sabah, Jinan; Zulkifli, Razauden Mohamed; Shahir, Shafinaz; Ahmed, Farediah; Abdul Kadir, Mohammed Rafiq; Zakaria, Zarita

    2018-03-06

    Distinctive bioactivities possessed by luteolin (3', 4', 5, 7-tetrahydroxy-flavone) are advantageous for sundry practical applications. This paper reports the in vitro selection and characterization of single stranded-DNA (ssDNA) aptamers, specific for luteolin (LUT). 76-mer library containing 1015 randomized ssDNA were screened via systematic evolution of ligands by exponential enrichment (SELEX). The recovered ssDNA pool from the 8th round was amplified with unlabeled primers and cloned into PSTBlue-1 vector prior to sequencing. 22 of LUT-binding aptamer variants were further classified into one of the seven groups based on their N40 random sequence regions, wherein one representative from each group was characterized. The dissociation constant of aptamers designated as LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively with high binding affinity towards LUT. Prediction analysis of the secondary structure suggested discrete features with typical loop and stem motifs. Furthermore, LUT#3 displayed higher specificity with insignificant binding toward kaempferol and quercetin despite its structural and functional similarity compared to LUT#28 and LUT#20. Further LUT#3 can detect free luteolin within 0.2-1 mM in solution. It was suggested that LUT#3 aptamer were the most suitable for LUT recognition tool at laboratory scale based on the condition tested. Copyright © 2018. Published by Elsevier Inc.

  19. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska

    2017-12-01

    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  20. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.

    1985-01-01

    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  1. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  2. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.

    1987-01-01

    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  3. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks.

    Science.gov (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P

    2012-09-01

    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  4. Partial digestion with restriction enzymes of ultraviolet-irradiated human genomic DNA: a method for identifying restriction site polymorphisms

    International Nuclear Information System (INIS)

    Nobile, C.; Romeo, G.

    1988-01-01

    A method for partial digestion of total human DNA with restriction enzymes has been developed on the basis of a principle already utilized by P.A. Whittaker and E. Southern for the analysis of phage lambda recombinants. Total human DNA irradiated with uv light of 254 nm is partially digested by restriction enzymes that recognize sequences containing adjacent thymidines because of TT dimer formation. The products resulting from partial digestion of specific genomic regions are detected in Southern blots by genomic-unique DNA probes with high reproducibility. This procedure is rapid and simple to perform because the same conditions of uv irradiation are used for different enzymes and probes. It is shown that restriction site polymorphisms occurring in the genomic regions analyzed are recognized by the allelic partial digest patterns they determine

  5. [Application of double created restriction site PCR-RFLP to identify MGMT gene polymorphisms].

    Science.gov (United States)

    Wang, Wei; Miao, Wenbin; Qiu, Yulan; Xia, Zhaolin

    2008-01-01

    To develop a proper assay for identifying single nucleotide polymorphisms( SNPs) of the MGMT gene. PCR primers were designed by create restriction site (CRS) method, then polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was adopted to identify four SNPs in MGMT gene. By PCR, one primer pair yielded target products containing MGMT84 SNP site, and the other primer pair yielded target products containing MGMT143, 160, 178 SNP sites. Four restriction enzymes were adopted to identify the four SNPs, respectively. The effects of PCR and RFLP were good. The methods for four SNPs of MGMT determinated by CRS-PCR-RFLP theory could be facility, economy, and rapidness.

  6. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.

    1995-01-01

    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  7. Distinct circular single-stranded DNA viruses exist in different soil types.

    Science.gov (United States)

    Reavy, Brian; Swanson, Maud M; Cock, Peter J A; Dawson, Lorna; Freitag, Thomas E; Singh, Brajesh K; Torrance, Lesley; Mushegian, Arcady R; Taliansky, Michael

    2015-06-15

    The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  8. A high throughput system for the preparation of single stranded templates grown in microculture.

    Science.gov (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M

    1994-01-01

    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  9. Complex shapes self-assembled from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng

    2012-05-30

    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  10. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

    Science.gov (United States)

    Richardson, Tomas T; Harran, Omar; Murray, Heath

    2016-06-16

    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

  11. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses.

    Science.gov (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn

    2011-06-01

    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  12. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  13. Localization of specific sequences and DNA single-strand breaks in individual UV-A-irradiated human lymphocytes by COMET FISH

    Science.gov (United States)

    Bock, Claudia; Rapp, Alexander; Dittmar, Heike; Monajembashi, Shamci; Greulich, Karl-Otto

    1999-01-01

    The COMET assay, a single cell electrophoresis technique which allows to separate electrophoretically fractionated DNA according to size has been combined with fluorescence in situ hybridization (FISH) which allows to localize specific genes or gene regions. This combination (COMET FISH) allows the detection of DNA single strand breaks in specific regions of the genome of human lymphocytes at the single cell level. Various types of DNA probes, e.g. centromere-, (alpha) - satellite-, telomere-, whole chromosome-, single copy- and region specific DNA probes have been used to investigate whether the UV-A induced DNA single strand breaks are distributed randomly all over the human genome or induced at specific sites ('hot spots'). In the investigated human peripheral blood lymphocytes all but one centromere reveal low sensitivity for UV-A irradiation (500 kJ/m2), while telomeres are randomly distributed over COMET heads and tails. The human chromosome 1 is fractionated by irradiation, but remains in the COMET head, indicating an only moderate degree of fractionation. Among three tested single copy probes, c- myc, p53 and p58, the p53 gene located on chromosome 17p13.1 and the p58 gene (1p36) appear to be located in UV-A stable regions of the human genome in 95% of 65 investigated lymphocytes. In contrast, the c-myc proto-oncogene (8q24) is found in the COMET tail in 90% of the 27 investigated lymphocytes and thus appears to be more sensitive to UV-A irradiation.

  14. Evidence that single-stranded DNA breaks are a normal feature of koala sperm chromatin, while double-stranded DNA breaks are indicative of DNA damage.

    Science.gov (United States)

    Zee, Yeng Peng; López-Fernández, Carmen; Arroyo, F; Johnston, Stephen D; Holt, William V; Gosalvez, Jaime

    2009-08-01

    In this study, we have used single and double comet assays to differentiate between single- and double-stranded DNA damage in an effort to refine the interpretation of DNA damage in mature koala spermatozoa. We have also investigated the likelihood that single-stranded DNA breakage is part of the natural spermiogenic process in koalas, where its function would be the generation of structural bends in the DNA molecule so that appropriate packaging and compaction can occur. Koala spermatozoa were examined using the sperm chromatin dispersion test (SCDt) and comet assays to investigate non-orthodox double-stranded DNA. Comet assays were conducted under 1) neutral conditions; and 2) neutral followed by alkaline conditions (double comet assay); the latter technique enabled simultaneous visualisation of both single-stranded and double-stranded DNA breaks. Following the SCDt, there was a continuum of nuclear morphotypes, ranging from no apparent DNA fragmentation to those with highly dispersed and degraded chromatin. Dispersion morphotypes were mirrored by a similar diversity of comet morphologies that could be further differentiated using the double comet assay. The majority of koala spermatozoa had nuclei with DNA abasic-like residues that produced single-tailed comets following the double comet assay. The ubiquity of these residues suggests that constitutive alkali-labile sites are part of the structural configuration of the koala sperm nucleus. Spermatozoa with 'true' DNA fragmentation exhibited a continuum of comet morphologies, ranging from a more severe form of alkaline-susceptible DNA with a diffuse single tail to nuclei that exhibited both single- and double-stranded breaks with two comet tails.

  15. Electrical conduction and photoresponses of gamma-ray-irradiated single-stranded DNA/single-walled carbon nanotube composite systems

    Energy Technology Data Exchange (ETDEWEB)

    Hong, W.; Lee, E.M.; Kim, D.W.; Lee, Cheol Eui, E-mail: rscel@korea.ac.kr

    2015-04-15

    Highlights: •Effects of gamma-ray irradiation on single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. •Barrier for thermally activated conduction in the composite systems modified by the gamma-ray irradiation. •Photoresponses reveal photoexcitation and oxygen photodesorption modified by gamma-ray irradiation. -- Abstract: Effects of gamma-ray irradiation on the electrical conductivity and photoresponse have been studied for single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. The temperature-dependent electrical conductivity of the ssDNA/SWNT composite films, well described by a fluctuation-induced tunneling model, indicated modification of the barrier for thermally activated conduction by the gamma-ray irradiation. Besides, the photoresponse measurements indicated modified photoexcited charge carrier generation and oxygen photodesorption in the composite systems due to the gamma-ray irradiation.

  16. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.

    2006-01-01

    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  17. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    Science.gov (United States)

    2014-09-30

    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  18. Selective binding and reverse transcription inhibition of single-strand poly(A) RNA by metal TMPyP complexes.

    Science.gov (United States)

    Zhou, Zhu-Xin; Gao, Feng; Chen, Xing; Tian, Xiang-Jing; Ji, Liang-Nian

    2014-10-06

    Ni-, Cu-, and Zn-TMPyP are capable of binding to single-strand poly(A) RNA with high preference and affinity and inhibiting the reverse transcription of RNA by both M-MuLV and HIV-1 reverse transcriptase. With 10 nM azidothymidine, the IC50 value of M-TMPyP could be lowered to 10(-1) μM order.

  19. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.

    2013-01-01

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  20. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.

    1977-01-01

    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  1. The Adsorption of Short Single-Stranded DNA Oligomers on Mineral Surfaces

    Science.gov (United States)

    Kopstein, M.; Sverjensky, D. A.; Hazen, R. M.; Cleaves, H. J.

    2009-12-01

    Previous studies have described feasible pathways for the synthesis of simple organic building blocks such as formaldehyde and hydrogen cyanide, and their reaction to form more complex biomolecules such as nucleotide bases, amino acids and sugars (Miller and Orgel 1974, Miller and Cleaves 2006). However, the polymerization of monomers into a useful genetic material remains problematic (Orgel 2004). Organic building blocks were unlikely to polymerize from very dilute aqueous solution in the primitive oceans. Mineral surface adsorption has been suggested as a possible mechanism for concentrating the necessary building blocks (Bernal 1951). This study focused on the adsorption behavior of single-stranded DNA homo-oligomers of adenine and thymine (including the monomers, dimers, tetramers, hexamers, octomers, and decamers) with five different mineral surfaces (pyrite, rutile, hematite, olivine and calcite). Adsorption was studied in 0.1 M pH 8.1 KHCO3 with0.05 M NaCl as background electrolyte. Solutions were mixed for 24 hours at room temperature, centrifuged and the supernatants analyzed by UV/visible spectrophotometry. Equilibrium solution concentrations were measured and used to determine the number of moles adsorbed per square meter. Langmuir isotherms were constructed using the experimental data. It was found that adenine-containing molecules tend to bind much more strongly than thymine-containing molecules. It was also found that the number of moles adsorbed at saturation tends to fall with increasing chain length, while adsorption affinity tends to rise. Oligomer length appears to affect adsorption more than the mineral type. These results may have implications for the primordial organization of the first nucleic acid molecules as the persistence of extra-cellular nucleic acids in the environment. References Bernal, J. D. (1951) The Physical Basis of Life (Routledge, London). Miller S.L. and Cleaves, H.J. (2006) Prebiotic chemistry on the primitive Earth. In

  2. Role of electrostatics in the assembly pathway of a single-stranded RNA virus.

    Science.gov (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M

    2014-09-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  3. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong

    2011-04-01

    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  4. Attitudes toward smoking restrictions in work sites, restaurants, and bars among North Carolinians.

    Science.gov (United States)

    Maguire, Rachel Loflin; Brinkley, Jason; Mansfield, Christopher

    2010-01-01

    Public support for smoking restrictions has increased in recent years, but support varies among groups and according to where restrictions should apply. National studies show that Americans are less likely to favor smoking restrictions in restaurants and bars than at other work sites but that the support varies across segments of the population. A full examination of the changes and status of attitudes toward smoking restrictions by site and across subgroups in North Carolina has not been undertaken. Data from US Census Bureau Current Population Surveys conducted during 2001-2002 and 2006-2007 were analyzed. Trends in attitudes toward smoke-free policies at indoor work sites, restaurants, and bars are presented overall and by occupation, smoking status, income, race/ethnicity, workplace smoking policy, age, sex, and education. Logistic regression was used to identify key factors predicting support for smoke-free policies at work sites. Support for smoke-free policies increased by at least 7.4 percentage points at each venue between 2001-2002 and 2006-2007. In 2006-2007, the strongest public support for smoking restrictions was reported for work sites (69.6%), followed by restaurants (52.3%) and bars (36.1%). Whether a person smokes is the strongest predictor of their attitude about smoking restrictions in indoor work sites. Data are self-reported, from independent samples, and lack county identifiers. There is substantial and increasing public support for smoke-free policies in North Carolina. These findings show extensive support for extending smoking bans to all indoor work sites, with nearly 70% of respondents in 2006-2007 favoring smoke-free work sites.

  5. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity.

    Science.gov (United States)

    Monnet, Jordan; Kozelka, Jiří

    2012-10-01

    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. Site-selective scission of human genome using PNA-based artificial restriction DNA cutter.

    Science.gov (United States)

    Ito, Kenichiro; Komiyama, Makoto

    2014-01-01

    Site-selective scission of genomes is quite important for future biotechnology. However, naturally occurring restriction enzymes cut these huge DNAs at too many sites and cannot be used for this purpose. Recently, we have developed a completely chemistry-based artificial restriction DNA cutter (ARCUT) by combining a pair of pseudo-complementary PNA (pcPNA) strands (sequence recognition moiety) and Ce(IV)/EDTA complex (molecular scissors). The scission site of ARCUT and its scission specificity can be freely modulated in terms of the sequences and lengths of the pcPNA strands so that even huge genomes can be selectively cut at only one predetermined site. In this chapter, the method of site-selective scission of human genomic DNA using ARCUT is described in detail.

  7. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  8. Development of an Interaction Assay between Single-Stranded Nucleic Acids Trapped with Silica Particles and Fluorescent Compounds

    Directory of Open Access Journals (Sweden)

    R. Maeda

    2012-09-01

    Full Text Available Biopolymers are easily denatured by heating, a change in pH or chemical substances when they are immobilized on a substrate. To prevent denaturation of biopolymers, we developed a method to trap a polynucleotide on a substrate by hydrogen bonding using silica particles with surfaces modified by aminoalkyl chains ([A-AM silane]/SiO2. [A-AM silane]/SiO2 was synthesized by silane coupling reaction of N-2-(aminoethyl-3-aminopropyltrimethoxysilane (A-AM silane with SiO2 particles with a diameter of 5 μm at 100 °C for 20 min. The surface chemical structure of [A-AM silane]/SiO2 was characterized by Fourier transform infrared spectroscopy and molecular orbital calculations. The surface of the silica particles was modified with A-AM silane and primary amine groups were formed. [A-AM silane]/SiO2 was trapped with single-stranded nucleic acids [(Poly-X; X = A (adenine, G (guanine and C (cytosine] in PBS solution at 37 °C for 1 h. The single-stranded nucleic acids were trapped on the surface of the [A-AM silane]/SiO2 by hydrogen bonding to form conjugated materials. The resulting complexes were further conjugated by derivatives of acridine orange (AO as fluorescent labels under the same conditions to form [AO:Poly-X:A-AM silane]/SiO2 complexes. Changes in the fluorescence intensity of these complexes originating from interactions between the single-stranded nucleic acid and aromatic compounds were also evaluated. The change in intensity displayed the order [AO: Poly-G: A-AM silane]/SiO2 > [AO:Poly-A:A-AM silane]/SiO2 >> [AO:Poly-C:A-AM silane]/SiO2. This suggests that the single-stranded nucleic acids conjugated with aminoalkyl chains on the surfaces of SiO2 particles and the change in fluorescence intensity reflected the molecular interaction between AO and the nucleic-acid base in a polynucleotide.

  9. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide

    Science.gov (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio

    1998-01-01

    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  10. Conformation effects of CpG methylation on single-stranded DNA oligonucleotides: analysis of the opioid peptide dynorphin-coding sequences.

    Directory of Open Access Journals (Sweden)

    Malik Mumtaz Taqi

    Full Text Available Single-stranded DNA (ssDNA is characterized by high conformational flexibility that allows these molecules to adopt a variety of conformations. Here we used native polyacrylamide gel electrophoresis (PAGE, circular dichroism (CD spectroscopy and nuclear magnetic resonance (NMR spectroscopy to show that cytosine methylation at CpG sites affects the conformational flexibility of short ssDNA molecules. The CpG containing 37-nucleotide PDYN (prodynorphin fragments were used as model molecules. The presence of secondary DNA structures was evident from differences in oligonucleotide mobilities on PAGE, from CD spectra, and from formation of A-T, G-C, and non-canonical G-T base pairs observed by NMR spectroscopy. The oligonucleotides displayed secondary structures at 4°C, and some also at 37°C. Methylation at CpG sites prompted sequence-dependent formation of novel conformations, or shifted the equilibrium between different existing ssDNA conformations. The effects of methylation on gel mobility and base pairing were comparable in strength to the effects induced by point mutations in the DNA sequences. The conformational effects of methylation may be relevant for epigenetic regulatory events in a chromatin context, including DNA-protein or DNA-DNA recognition in the course of gene transcription, and DNA replication and recombination when double-stranded DNA is unwinded to ssDNA.

  11. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism.

    Science.gov (United States)

    Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong

    2016-07-01

    A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.

  12. Characterization of the single-stranded DNA binding protein pV(VGJΦ) of VGJΦ phage from Vibrio cholerae.

    Science.gov (United States)

    Falero, Alina; Caballero, Andy; Trigueros, Sonia; Pérez, Celso; Campos, Javier; Marrero, Karen; Fando, Rafael

    2011-09-01

    pV(VGJΦ), a single-stranded DNA binding protein of the vibriophage VGJΦ was subject to biochemical analysis. Here, we show that this protein has a general affinity for single-stranded DNA (ssDNA) as documented by Electrophoretic Mobility Shift Assay (EMSA). The apparent molecular weight of the monomer is about 12.7kDa as measured by HPLC-SEC. Moreover, isoelectrofocusing showed an isoelectric point for pV(VGJΦ) of 6.82 pH units. Size exclusion chromatography in 150mM NaCl, 50mM sodium phosphate buffer, pH 7.0 revealed a major protein species of 27.0kDa, suggesting homodimeric protein architecture. Furthermore, pV(VGJΦ) binds ssDNA at extreme temperatures and the complex was stable after extended incubation times. Upon frozen storage at -20°C for a year the protein retained its integrity, biological activity and oligomericity. On the other hand, bioinformatics analysis predicted that pV(VGJΦ) protein has a disordered C-terminal, which might be involved in its functional activity. All the aforementioned features make pV(VGJΦ) interesting for biotechnological applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles.

    Science.gov (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng

    2015-11-21

    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  14. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  15. 1996 Hanford site report on land disposal restrictions for mixed waste

    Energy Technology Data Exchange (ETDEWEB)

    Black, D.G.

    1996-04-01

    This report was submitted to meet the requirements of Hanford Federal Facility Agreement and Consent Order milestone M-26-OIF. This milestone requires the preparation of an annual report that covers characterization, treatment, storage, minimization, and other aspects of land disposal-restricted mixed waste management at the Hanford Site.

  16. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    Science.gov (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system.

    Science.gov (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus

    2011-04-06

    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  18. Application of Created Restriction Site PCR-RFLP to Identify POT1 Gene Polymorphism.

    Science.gov (United States)

    Wang, Tuanwei; Wang, Sihua; Duan, Xiaoran; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Feng, Feifei; Yu, Songcheng; Wu, Yiming; Wang, Wei

    2016-06-01

    Protection of telomeres protein 1 (POT1) plays pivotal roles in protection of chromosome ends and regulation of telomere length with other telomere binding proteins; its genetic polymorphisms are associated with many diseases. In this study, we explored a novel PCR-RFLP method for typing the single nucleotide polymorphism (SNP) rs1034794 of the human POT1 gene. A new restriction enzyme site was introduced into a POT1 gene amplification product by created restriction site PCR (CRS-PCR). One primer was designed based on changed sequence; after PCR amplification, a new restriction enzyme site for AluI was introduced into the PCR products. One hundred and seventy eight samples from Han Chinese individuals were tested to evaluate this new method. The 3'-end of the forward primer was next to the polymorphic site, and the third base from the 3'-end was the mismatched base A. The final PCR product contained the AGCT sequence (AluI recognition site) when the ancestral POT1 alleles were amplified. The data obtained with the new method perfectly matched those obtained with the sequencing method. Thus, CRS-PCR is a new low-cost and high-efficiency alternative for rs1034794 typing.

  19. Restriction-modification system with methyl-inhibited base excision and abasic-site cleavage activities.

    Science.gov (United States)

    Fukuyo, Masaki; Nakano, Toshiaki; Zhang, Yingbiao; Furuta, Yoshikazu; Ishikawa, Ken; Watanabe-Matsui, Miki; Yano, Hirokazu; Hamakawa, Takeshi; Ide, Hiroshi; Kobayashi, Ichizo

    2015-03-11

    The restriction-modification systems use epigenetic modification to distinguish between self and nonself DNA. A modification enzyme transfers a methyl group to a base in a specific DNA sequence while its cognate restriction enzyme introduces breaks in DNA lacking this methyl group. So far, all the restriction enzymes hydrolyze phosphodiester bonds linking the monomer units of DNA. We recently reported that a restriction enzyme (R.PabI) of the PabI superfamily with half-pipe fold has DNA glycosylase activity that excises an adenine base in the recognition sequence (5'-GTAC). We now found a second activity in this enzyme: at the resulting apurinic/apyrimidinic (AP) (abasic) site (5'-GT#C, # = AP), its AP lyase activity generates an atypical strand break. Although the lyase activity is weak and lacks sequence specificity, its covalent DNA-R.PabI reaction intermediates can be trapped by NaBH4 reduction. The base excision is not coupled with the strand breakage and yet causes restriction because the restriction enzyme action can impair transformation ability of unmethylated DNA even in the absence of strand breaks in vitro. The base excision of R.PabI is inhibited by methylation of the target adenine base. These findings expand our understanding of genetic and epigenetic processes linking those in prokaryotes and eukaryotes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Site accessibility tailors DNA cleavage by restriction enzymes in DNA confined monolayers.

    Science.gov (United States)

    Rotella, Chiara; Doni, Giovanni; Bosco, Alessandro; Castronovo, Matteo; De Vita, Alessandro; Casalis, Loredana; Pavan, Giovanni M; Parisse, Pietro

    2017-05-18

    Density-tunable nanografted monolayers (NAMs) of short oligonucleotide sequences on gold surfaces show novel properties that make them suitable for advanced biosensing applications, and in particular to study the effects of crowding and confinement on biomolecular interactions. Here, combining atomic force microscopy nanolithography, topography measurements and coarse-grained molecular dynamics simulations, we investigated restriction enzyme reaction mechanisms within confined DNA brushes highlighting the role played by the DNA sequence conformation and restriction site position along the chain, respectively, in determining the accessibility of the enzyme, and its consequent cleavage efficiency.

  1. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail: meicun2006@163.com; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

    2016-12-01

    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  2. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  3. [Application of created restriction site PCR-RFLP to identify alcohol dehydrogenase 2 gene polymorphism].

    Science.gov (United States)

    Jiao, Jie; Wang, Wei; Liu, Jing; Xia, Zhaolin

    2009-01-01

    To develop a appropriate assay for identifying single nucleotide polymorphism (SNP) of alcohol dehydrogenase 2 (ADH2) gene. According to base substitution situation of one single base mutational site, we designed the present study primers. One of the primers was designed on the basis of neighbourhood sequence of the mutational site, that is, we made one mismatch base to let product a new enzyme site between the 3' end of the primer and the single base mutation type after the PCR amplification. Then PCR-RFLP was adopted to identify the SNP in ADH2 gene. One primer pair can get target products containing ADH2 SNP site by PCR, restriction enzymes Bsh1236I were adopted to identify the SNP site. The expected results were reached. It suggested that the method of detecting the SNP of ADH2 based on CRS-PCR-RFLP theory is facilitated, economic, and rapid.

  4. Highly stable triple helix formation by homopyrimidine (l)-acyclic threoninol nucleic acids with single stranded DNA and RNA

    DEFF Research Database (Denmark)

    Kumar, Vipin; Kesavan, Venkitasamy; Gothelf, Kurt Vesterager

    2015-01-01

    Acyclic (l)-threoninol nucleic acid (aTNA) containing thymine, cytosine and adenine nucleobases were synthesized and shown to form surprisingly stable triplexes with complementary single stranded homopurine DNA or RNA targets. The triplex structures consist of two (l)-aTNA strands and one DNA...... or RNA, and these triplexes are significantly stronger than the corresponding DNA or RNA duplexes as shown in competition experiments. As a unique property the (l)-aTNAs exclusively form triplex structures with DNA and RNA and no duplex structures are observed by gel electrophoresis. The results were...... compared to the known enantiomer (d)-aTNA, which forms much weaker triplexes depending upon temperature and time. It was demonstrated that (l)-aTNA triplexes are able to stop primer extension on a DNA template, showing the potential of (l)-aTNA for antisense applications....

  5. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample.

    Science.gov (United States)

    Cui, Lunbiao; Wu, Binyao; Zhu, Xiaojuan; Guo, Xiling; Ge, Yiyue; Zhao, Kangchen; Qi, Xian; Shi, Zhiyang; Zhu, Fengcai; Sun, Lixin; Zhou, Minghao

    2017-11-01

    Metagenomic analysis through high-throughput sequencing is a tool for detecting both known and novel viruses. Using this technique, a novel circular single-stranded DNA (ssDNA) virus genome was discovered in respiratory secretions from a febrile traveler. The virus, named human respiratory-associated PSCV-5-like virus (HRAPLV), has a genome comprising 3,018 bases, with two major putative ORFs inversely encoding capsid (Cap) and replicase (Rep) protein and separated by two intergenic regions. One stem-loop structure was predicted in the larger intergenic region (LIR). The predicted amino acid sequences of the Cap and Rep proteins of HRAPLV showed highest identity to those of porcine stool-associated circular virus 5 isolate CP3 (PoSCV 5) (53.0% and 48.9%, respectively). The host tropism of the virus is unknown, and further study is warranted to determine whether this novel virus is associated with human disease.

  6. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Vrushali S. [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Gokhale, Suresh P.; Patil, Kashinath R. [Physical and Material Chemistry Division, National Chemical Laboratory, Pune (India); Haram, Santosh K., E-mail: haram@chem.unipune.ernet.i [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)

    2010-02-15

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 +- 2 mum and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, alpha-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k{sup 0}) and electron transfer coefficient (alpha) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  7. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    International Nuclear Information System (INIS)

    Joshi, Vrushali S.; Gokhale, Suresh P.; Patil, Kashinath R.; Haram, Santosh K.

    2010-01-01

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 ± 2 μm and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, α-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k 0 ) and electron transfer coefficient (α) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  8. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  9. Quenching of Single-Walled Carbon Nanotube Fluorescence by Dissolved Oxygen Reveals Selective Single-Stranded DNA Affinities.

    Science.gov (United States)

    Zheng, Yu; Bachilo, Sergei M; Weisman, R Bruce

    2017-05-04

    The selective interactions between short oligomers of single-stranded DNA (ssDNA) and specific structures of single-walled carbon nanotubes have been exploited in powerful methods for nanotube sorting. We report here that nanotubes coated with ssDNA also display selective interactions through the selective quenching of nanotube fluorescence by dissolved oxygen. In aqueous solutions equilibrated under 1 atm of O 2 , emission intensity from semiconducting nanotubes is reduced by between 9 and 40%, varying with the combination of ssDNA sequence and nanotube structure. This quenching reverses promptly and completely on the removal of dissolved O 2 and may be due to physisorption on nanotube surfaces. Fluorescence quenching offers a simple, nondestructive approach for studying the structure-selective interactions of ssDNA with single-walled carbon nanotubes and identifying recognition sequences.

  10. Surface treatment on amorphous InGaZnO4 thin film for single-stranded DNA biosensing

    Science.gov (United States)

    Sun, Dali; Matsui, Hiroaki; Wu, Chun-Nan; Tabata, Hitoshi

    2015-01-01

    Amorphous InGaZnO4 (aIGZO) has been widely used as a transparent semiconductor. However, no research has been found yet applying aIGZO to biosensing. This paper examined the single strand DNA (ssDNA) immobilization on aIGZO by absorption with a comparison to ITO, which is the first step for many biosensing schemas. The DNA quantification by florescence intensity shows that the absorption capacity of aIGZO film to ssDNA is 6.7 times greater than that of ITO. XPS and contact angle analysis proved the high DNA absorption affinity on aIGZO film is related to its high effectiveness to OH- attachment. A feasible method to immobilized ssDNA on aIGZO thin film is evaluated in this paper, and consequently, enables a possible approach to apply aIGZO in biosensing.

  11. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol

    2013-01-01

    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  12. Charge enhancement of single-stranded DNA in negative electrospray ionization using the supercharging reagent meta-nitrobenzyl alcohol.

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1% m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1% m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  13. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  14. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB).

    Science.gov (United States)

    van Loon, Barbara; Samson, Leona D

    2013-03-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  15. Aptamer based voltammetric determination of ampicillin using a single-stranded DNA binding protein and DNA functionalized gold nanoparticles.

    Science.gov (United States)

    Wang, Jun; Ma, Kui; Yin, Huanshun; Zhou, Yunlei; Ai, Shiyun

    2017-12-20

    An aptamer based method is described for the electrochemical determination of ampicillin. It is based on the use of DNA aptamer, DNA functionalized gold nanoparticles (DNA-AuNPs), and single-stranded DNA binding protein (ssDNA-BP). When the aptamer hybridizes with the target DNA on the AuNPs, the ssDNA-BP is captured on the electrode surface via its specific interaction with ss-DNA. This results in a decreased electrochemical signal of the redox probe Fe(CN) 6 3- which is measured best at a voltage of 0.188 mV (vs. reference electrode). In the presence of ampicillin, the formation of aptamer-ampicillin conjugate blocks the further immobilization of DNA-AuNPs and ssDNA-BP, and this leads to an increased response. The method has a linear reposne that convers the 1 pM to 5 nM ampicillin concentration range, with a 0.38 pM detection limit (at an S/N ratio of 3). The assay is selective, stable and reproducible. It was applied to the determination of ampicillin in spiked milk samples where it gave recoveries ranging from 95.5 to 105.5%. Graphical abstract Schematic of a simple and sensitive electrochemical apta-biosensor for ampicillin detection. It is based on the use of gold nanoparticles (AuNPs), DNA aptamer, DNA functionalized AuNPs (DNA-AuNPs), and single-strand DNA binding protein (SSBP).

  16. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.

    1994-01-01

    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  17. Traffic restrictions: Meyrin site and entrance of Prévessin site

    CERN Multimedia

    GS Department

    2010-01-01

    Between 10 April and 19 April 2010 a number of roads on the Meyrin site and at the entrance of the Prévessin site will be resurfaced. The work will be done by zones, as shown below: 12-14 April Intersection of Route Fermi and Route Gregory. Route Fermi, between Building 268 and Route Jentschke Route Fermi, Route Jentschke and Route Einstein, up to Building 593 and between Buildings 194 and 555. Plus Route Oppenheimer. 15 April Intersection of Route Bloch and Route Maxwell, and Route Maxwell itself. Route Sherrer between the overhead walkway (Building 50) and the exit from the carpark behind Building 4. 16 April and 19 April Route Fermi, Route Jentschke and Route Einstein, up to Building 593 and between Buildings 194 and 555. Prévessin site: from Route Adams to the access control Building. The construction works may result in some disruption to traffic. Users are requested to comply with the temporary traffic signs and arrangements.  Thank you for your understanding. GS/...

  18. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian

    2012-07-06

    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  19. RADX interacts with single-stranded DNA to promote replication fork stability

    DEFF Research Database (Denmark)

    Schubert, Lisa; Ho, Teresa; Hoffmann, Saskia

    2017-01-01

    has an essential genome maintenance role, protecting ssDNA regions from nucleolytic degradation and providing a recruitment platform for proteins involved in responses to replication stress and DNA damage. Here, we identify the uncharacterized protein RADX (CXorf57) as an ssDNA-binding factor in human...... cells. RADX binds ssDNA via an N-terminal OB fold cluster, which mediates its recruitment to sites of replication stress. Deregulation of RADX expression and ssDNA binding leads to enhanced replication fork stalling and degradation, and we provide evidence that a balanced interplay between RADX and RPA...

  20. Different modulation by dietary restriction of adipokine expression in white adipose tissue sites in the rat

    Directory of Open Access Journals (Sweden)

    Esteve Montserrat

    2009-07-01

    Full Text Available Abstract Background White adipose tissue (WAT is a disperse organ acting as energy storage depot and endocrine/paracrine controlling factor in the management of energy availability and inflammation. WAT sites response under energy-related stress is not uniform. In the present study we have analyzed how different WAT sites respond to limited food restriction as a way to better understand the role of WAT in the pathogenesis of the metabolic syndrome. Methods Overweight male rats had their food intake reduced a 40% compared with free-feeding controls. On day ten, the rats were killed; circulating glucose, insulin, leptin, adiponectin, triacylglycerols and other parameters were measured. The main WAT sites were dissected: mesenteric, retroperitoneal, epididymal and subcutaneous inguinal, which were weighed and frozen. Later all subcutaneous WAT was also dissected and weighed. Samples were used for DNA (cellularity analysis and mRNA extraction and semiquantitarive RT-PCR analysis of specific cytokine gene expressions. Results There was a good correlation between serum leptin and cumulative WAT leptin gene mRNA, but not for adiponectin. Food restriction reduced WAT size, but not its DNA content (except for epididymal WAT. Most cytokines were correlated to WAT site weight, but not to DNA. There was WAT site specialization in the differential expression (and probably secretion of adipokines: subcutaneous WAT showed the highest concentration for leptin, CD68 and MCP-1, mesenteric WAT for TNFα (and both tissues for the interleukins 1β and 6; resistin was highly expressed in subcutaneous and retroperitoneal WAT. Conclusion Food restriction induced different patterns for mesenteric and the other WAT sites, which may be directly related to both the response to intestine-derived energy availability, and an inflammatory-related response. However, retroperitoneal WAT, and to a lower extent, subcutaneous and epididymal, reacted decreasing the expression of

  1. REMA: A computer-based mapping tool for analysis of restriction sites in multiple DNA sequences.

    Science.gov (United States)

    Szubert, Jan; Reiff, Caroline; Thorburn, Andrew; Singh, Brajesh K

    2007-05-01

    REMA is an interactive web-based program which predicts endonuclease cut sites in DNA sequences. It analyses multiple sequences simultaneously and predicts the number and size of fragments as well as provides restriction maps. The users can select single or paired combinations of all commercially available enzymes. Additionally, REMA permits prediction of multiple sequence terminal fragment sizes and suggests suitable restriction enzymes for maximally discriminatory results. REMA is an easy to use, web based program which will have a wide application in molecular biology research. REMA is written in Perl and is freely available for non-commercial use. Detailed information on installation can be obtained from Jan Szubert (jan.szubert@gmail.com) and the web based application is accessible on the internet at the URL http://www.macaulay.ac.uk/rema b.singh@macaulay.ac.uk.

  2. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  3. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii.

    Science.gov (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten

    2012-01-01

    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  4. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der

    1978-01-01

    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  5. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

    1982-01-01

    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  6. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.

    2006-01-01

    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  7. Restriction site heteroplasmy in the mitochondrial DNA of Brycon opalinus (Cuvier, 1819 (Characiformes, Characidae, Bryconiae

    Directory of Open Access Journals (Sweden)

    A.W.S. Hilsdorf

    2004-03-01

    Full Text Available Homoplasmy is a feature usually found in the mtDNA of higher animal taxa. On the other hand, the presence of two classes of mtDNA in the same cell or organism is rare and may appear in length or site variation. Data from mtDNA RFLP analysis of Brycon opalinus populations (Cuvier, 1819; Characiformes, Characidae, Bryconinae revealed site heteroplasmy from endonuclease NheI digestion. Southern blotting hybridization was used to survey a total of 257 specimens with 24 restriction enzymes. Three different restriction fragment patterns of mtDNA were obtained from NheI digestion. Two individuals from hatchery broodstock were found to have two of them. NheI digests of heteroplasmic individuals yielded two fragments of approximately 1180 and 1260 bp. Despite the low frequency of this type of heteroplasmy in the whole B. opalinus population, the presence of site heteroplasmy in this species supports the evidence of this phenomenon in lower vertebrate groups.

  8. Functional analysis of multiple single-stranded DNA-binding proteins from Methanosarcina acetivorans and their effects on DNA synthesis by DNA polymerase BI.

    Science.gov (United States)

    Robbins, Justin B; Murphy, Mary C; White, Bryan A; Mackie, Roderick I; Ha, Taekjip; Cann, Isaac K O

    2004-02-20

    Single-stranded DNA-binding proteins and their functional homologs, replication protein A, are essential components of cellular DNA replication, repair and recombination. We describe here the isolation and characterization of multiple replication protein A homologs, RPA1, RPA2, and RPA3, from the archaeon Methanosarcina acetivorans. RPA1 comprises four single-stranded DNA-binding domains, while RPA2 and RPA3 are each composed of two such domains and a zinc finger domain. Gel filtration analysis suggested that RPA1 exists as homotetramers and homodimers in solution, while RPA2 and RPA3 form only homodimers. Unlike the multiple RPA proteins found in other Archaea and eukaryotes, each of the M. acetivorans RPAs can act as a distinct single-stranded DNA-binding protein. Fluorescence resonance energy transfer and fluorescence polarization anisotropy studies revealed that the M. acetivorans RPAs bind to as few as 10 single-stranded DNA bases. However, more stable binding is achieved with single-stranded DNA of 18-23 bases, and for such substrates the estimated Kd was 3.82 +/- 0.28 nM, 173.6 +/- 105.17 nM, and 5.92 +/- 0.23 nM, for RPA1, RPA2, and RPA3, respectively. The architectures of the M. acetivorans RPAs are different from those of hitherto reported homologs. Thus, these proteins may represent novel forms of replication protein A. Most importantly, our results show that the three RPAs and their combinations highly stimulate the primer extension capacity of M. acetivorans DNA polymerase BI. Although bacterial SSB and eukaryotic RPA have been shown to stimulate DNA synthesis by their cognate DNA polymerases, our findings provide the first in vitro biochemical evidence for the conservation of this property in an archaeon.

  9. Epitopes associated with MHC restriction site of T cells. III. I-J epitope on MHC-restricted T helper cells

    International Nuclear Information System (INIS)

    Asano, Y.; Nakayama, T.; Kubo, M.; Yagi, J.; Tada, T.

    1987-01-01

    I-J epitopes were found to be associated with the functional site of the class II MHC-restricted helper T (Th) cells: Virtually all of the H-2k-restricted Th cell function of H-2kxbF1 T cells was inhibited by the anti-I-Jk mAb, leaving the H-2b-restricted function unaffected. The I-Jk epitope was inducible in Th cells of different genotype origin according to the environmental class II antigens present in the early ontogeny of T cells. Although above results suggested that I-J is the structure reflecting the inducible MHC restriction specificity, further studies revealed some interesting controversies: First, the I-J phenotype did not always correlate with the class II restriction specificity, e.g., I-Ab-restricted Th from 5R was I-Jk-positive, whereas I-Ak-restricted Th of 4R was not. Second, there was no trans expression of parental I-J phenotypes and restriction specificities in F1 Th, e.g., the I-J phenotype was detected only on I-Ab-restricted Th of (4R X 5R)F1, whereas it was absent on I-Ak-restricted Th. This strict linkage between the restriction specificity and I-J phenotype was also found on Th cells developed in bone marrow chimera constructed with intra-H-2-recombinant mice. The expression of I-Jk was always associated with the restriction specificity of the relevant host. Thus, the restriction specificity of Th cells followed the host type, and the I-J expression on Th was exactly the same as that expressed by the host haplotype. These results indicate that I-J is an isomorphic structure adaptively expressed on Th cells that is involved in the unidirectional regulatory cell interactions, and that the polymorphism cannot be explained merely by the restriction specificity of the conventional T cell receptor heterodimer

  10. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  11. EFFECTOR OF TRANSCRIPTION2 is involved in xylem differentiation and includes a functional DNA single strand cutting domain.

    Science.gov (United States)

    Ivanov, Rumen; Tiedemann, Jens; Czihal, Andreas; Schallau, Anna; Diep, Le Hong; Mock, Hans-Peter; Claus, Bernhard; Tewes, Annegret; Bäumlein, Helmut

    2008-01-01

    EFFECTORS OF TRANSCRIPTION2 (ET) are plant-specific regulatory proteins characterized by the presence of two to five C-terminal DNA- and Zn-binding repeats, and a highly conserved cysteine pattern. We describe the structural characterization of the three member Arabidopsis thaliana ET gene family and reveal some allelic sequence polymorphisms. A mutation analysis showed that AtET2 affects the expression of various KNAT genes involved in the maintenance of the undifferentiated state of cambial meristem cells. It also plays a role in the regulation of GA5 (gibberellin 3-beta-dioxygenase) and the cell-cycle-related GASA4. A correlation was established between AtET2 expression and the cellular differentiation state. AtET-GFP fusion proteins shuttle between the cytoplasm and nucleus, with the AtET2 product prevented from entering the nucleus in non-differentiating cells. Within the nucleus, AtET2 probably acts via a single strand cutting domain. A more general regulatory role for ET factors is proposed, governing cell differentiation in cambial meristems, a crucial process for the development of plant vascular tissues.

  12. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.

    1985-01-01

    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  13. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA

    Science.gov (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana

    2009-04-01

    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  14. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  15. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  16. Chemical and biological studies of the major DNA adduct of cis-diamminedichloroplatinum(II), cis-[Pt(NH3)2/d(GpG)/], built into a specific site in a viral genome

    International Nuclear Information System (INIS)

    Naser, L.J.; Pinto, A.L.; Lippard, S.J.; Essigmann, J.M.

    1988-01-01

    A duplex Escherichia coli bacteriophage M13 genome was constructed containing a single cis-[Pt(NH 3 ) 2 /d(GpG)/] intrastrand cross-link, the major DNA adduct of the anticancer drug cis-diamminedichloroplatinum(II). The duplex dodecamer d(AGAAGGCCTAGA) x d(TCTAGGCCTTCT) was ligated into the HincII site of M13mp18 to produce an insertion mutant containing a unique StuI restriction enzyme cleavage site. A genome with a 12-base gap in the minus strand was created by hybridizing HincII-linearized M13mp18 duplex DNA with the single-stranded circular DNA of the 12-base insertion mutant. Characterization by pH-dependent 1 H NMR spectroscopy established that platinum binds to the N7 positions of the adjacent guanosines. The platinated oligonucleotide was phosphorylated in the presence of [γ- 32 P]ATP with bacteriophage T4 polynucleotide kinase and incorporated into the 12-base gap of the heteroduplex, thus situating the adduct specifically within the StuI site in the minus strand of the genome. The site of incorporation of the dodecamer was mapped to the expected 36-base region delimited by the recognition sites of XbaI and HindIII. Gradient denaturing gel electrophoresis of a 289-base-pair fragment encompassing the site of adduction revealed that the presence of the cis-[Pt(NH 3 ) 2 /d)GpG)/] cross-link induces localized weakening of the DNA double helix. Comparative studies revealed no difference in survival between platinated and unmodified double-stranded genomes. In contrast, survival of the single-stranded platinated genome was only 10-12% that of the corresponding unmodified single-stranded genome, indicating that the solitary cis-[Pt(NH 3 ) 2 /d(GpG)/] cross-link is lethal to the single-stranded bacteriophage

  17. Dysbiotic bacterial and fungal communities not restricted to clinically affected skin sites in dandruff

    Directory of Open Access Journals (Sweden)

    Renan Cardoso Soares

    2016-11-01

    Full Text Available Dandruff is a prevalent chronic inflammatory skin condition of the scalp that has been associated with Malassezia yeasts. However, the microbial role has not been elucidated yet, and the etiology of the disorder remains poorly understood. Using high-throughput 16S rDNA and ITS1 sequencing, we characterized cutaneous bacterial and fungal microbiotas from healthy and dandruff subjects, comparing scalp and forehead (lesional and non-lesional skin sites. Bacterial and fungal communities from dandruff analyzed at genus level differed in comparison with healthy ones, presenting higher diversity and greater intragroup variation. The microbial shift was observed also in non-lesional sites from dandruff subjects, suggesting that dandruff is related to a systemic process that is not restricted to the site exhibiting clinical symptoms. In contrast, Malassezia microbiota analyzed at species level did not differ according to health status. A 2-step OTU assignment using combined databases substantially increased fungal assigned sequences, and revealed the presence of highly prevalent uncharacterized Malassezia organisms (>37% of the reads. Although clinical symptoms of dandruff manifest locally, microbial dysbiosis beyond clinically affected skin sites suggests that subjects undergo systemic alterations, which could be considered for redefining therapeutic approaches.

  18. 1995 Report on Hanford site land disposal restrictions for mixed waste

    Energy Technology Data Exchange (ETDEWEB)

    Black, D.G.

    1995-04-01

    This report was submitted to meet the requirements of Hanford Federal Facility Agreement and Consent Order Milestone M-26-01E. This milestone requires the preparation of an annual report that covers characterization, treatment, storage, minimization, and other aspects of land disposal restricted mixed waste at the Hanford Site. The U.S. Department of Energy, its predecessors, and contractors at the Hanford Site were involved in the production and purification of nuclear defense materials from the early 1940s to the late 1980s. These production activities have generated large quantities of liquid and solid radioactive mixed waste. This waste is subject to regulation under authority of both the Resource Conservation and Recovery Act of 1976 and Atomic Energy Act of 1954. This report covers mixed waste only. The Washington State Department of Ecology, U.S. Environmental Protection Agency, and U.S. Department of Energy have entered into an agreement, the Hanford Federal Facility Agreement and Consent Order (commonly referred to as the Tri-Party Agreement) to bring the Hanford Site operations into compliance with dangerous waste regulations. The Tri-Party Agreement required development of the original land disposal restrictions (LDRs) plan and its annual updates to comply with LDR requirements for radioactive mixed waste. This report is the fifth update of the plan first issued in 1990. Tri-Party Agreement negotiations completed in 1993 and approved in January 1994 changed and added many new milestones. Most of the changes were related to the Tank Waste Remediation System and these changes are incorporated into this report.

  19. Assessing single-stranded oligonucleotide drug-induced effects in vitro reveals key risk factors for thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Sabine Sewing

    Full Text Available Single-stranded oligonucleotides (ON comprise a promising therapeutic platform that enables selective modulation of currently undruggable targets. The development of novel ON drug candidates has demonstrated excellent efficacy, but in certain cases also some safety liabilities were reported. Among them are events of thrombocytopenia, which have recently been evident in late stage trials with ON drugs. The underlying mechanisms are poorly understood and the risk for ON candidates causing such events cannot be sufficiently assessed pre-clinically. We investigated potential thrombocytopenia risk factors of ONs and implemented a set of in vitro assays to assess these risks. Our findings support previous observations that phosphorothioate (PS-ONs can bind to platelet proteins such as platelet collagen receptor glycoprotein VI (GPVI and activate human platelets in vitro to various extents. We also show that these PS-ONs can bind to platelet factor 4 (PF4. Binding to platelet proteins and subsequent activation correlates with ON length and connected to this, the number of PS in the backbone of the molecule. Moreover, we demonstrate that locked nucleic acid (LNA ribosyl modifications in the wings of the PS-ONs strongly suppress binding to GPVI and PF4, paralleled by markedly reduced platelet activation. In addition, we provide evidence that PS-ONs do not directly affect hematopoietic cell differentiation in culture but at higher concentrations show a pro-inflammatory potential, which might contribute to platelet activation. Overall, our data confirm that certain molecular attributes of ONs are associated with a higher risk for thrombocytopenia. We propose that applying the in vitro assays discussed here during the lead optimization phase may aid in deprioritizing ONs with a potential to induce thrombocytopenia.

  20. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA.

    Science.gov (United States)

    Rogers, Cody M; Bochman, Matthew L

    2017-05-13

    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold.

    Science.gov (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G

    2005-05-24

    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  2. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage

    Science.gov (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio

    1998-01-01

    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  3. Slowing single-stranded DNA translocation through a solid-state nanopore by decreasing the nanopore diameter.

    Science.gov (United States)

    Akahori, Rena; Haga, Takanobu; Hatano, Toshiyuki; Yanagi, Itaru; Ohura, Takeshi; Hamamura, Hirotaka; Iwasaki, Tomio; Yokoi, Takahide; Anazawa, Takashi

    2014-07-11

    To slow the translocation of single-stranded DNA (ssDNA) through a solid-state nanopore, a nanopore was narrowed, and the effect of the narrowing on the DNA translocation speed was investigated. In order to accurately measure the speed, long (5.3 kb) ssDNA (namely, ss-poly(dA)) with uniform length (±0.4 kb) was synthesized. The diameters of nanopores fabricated by a transmission electron microscope were controlled by atomic-layer deposition. Reducing the nanopore diameter from 4.5 to 2.3 nm slowed down the translocation of ssDNA by more than 16 times (to 0.18 μs base(-1)) when 300 mV was applied across the nanopore. It is speculated that the interaction between the nanopore and the ssDNA dominates the translocation speed. Unexpectedly, the translocation speed of ssDNA through the 4.5 nm nanopore is more than two orders of magnitude higher than that of double-stranded DNA (dsDNA) through a nanopore of almost the same size. The cause of such a faster translocation of ssDNA can be explained by the weaker drag force inside the nanopore. Moreover, the measured translocation speeds of ssDNA and dsDNA agree well with those calculated by molecular-dynamics (MD) simulation. The MD simulation predicted that reducing the nanopore diameter to almost the same as that of ssDNA (i.e. 1.4 nm) decreases the translocation speed (to 1.4 μs base(-1)). Narrowing the nanopore is thus an effective approach for accomplishing nanopore DNA sequencing.

  4. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  5. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler

    2007-12-01

    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  6. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines.

    Science.gov (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao

    2017-07-01

    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  7. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA.

    Science.gov (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee

    2011-03-24

    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  8. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. A versatile prokaryotic cloning vector with six dual restriction enzyme sites in the polylinker facilitates efficient subcloning into vectors with unique cloning sites.

    Science.gov (United States)

    Sage, D R; Chillemi, A C; Fingeroth, J D

    1998-09-01

    In large and complex vectors a single restriction enzyme recognition site may be available for introduction of additional DNA requiring the development of linker fragments to create compatible insertion sites. This technology can be time consuming and costly. We describe the construction of a simple phagemid, pSFI, with a polylinker that contains six pairs of dual, rare-cutting, restriction enzyme recognition sites (NotI, SpeI, EcoRV, PstI, SacII, EagI) with multiple unique sites between each pair. This has permitted rapid subcloning of DNA with creation of single flanking restriction enzyme sites. pSFI was used to expedite transfer of viral genes to a LacZ-inducible expression vector and to an adenovirus expression cassette for production of replication-defective virus. The use of this phagemid has facilitated complex vector manipulations and is a valuable adjunct to the family of multifunctional cloning vectors.

  10. Calendar Year 2002 Hanford Site mixed waste land disposal restrictions report (section 1 thru 3)

    International Nuclear Information System (INIS)

    MISKHO, A.G.

    2003-01-01

    Volume 1 presents information concerning the storage and minimization of mixed waste and the potential sources for the generation of additional mixed waste. This information, presented in accordance with ''Hanford Federal Facility Agreement and Consent Order'' (Tri-Party Agreement) (Ecology et al. 2001) Milestone M-26-01M, is Volume 1 of a two-volume report on the status of Hanford Site land disposal restricted mixed waste, other mixed waste, and other waste that the U.S. Department of Energy (DOE), Washington State Department of Ecology (Ecology), and US. Environmental Protection Agency (EPA) have agreed to include in this report. This volume contains the approval page for both volumes and includes the storage report. Information pertaining to waste characterization and treatment are addressed in Volume 2. Appendix A lists the land disposal restrictions (LDR) reporting requirements and explains where the requirements are addressed in this report. The reporting period for this document is from January 1, 2002, to December 31, 2002. Clearance form only sent to RHA

  11. Development of Transcriptomic Markers for Population Analysis Using Restriction Site Associated RNA Sequencing (RARseq.

    Directory of Open Access Journals (Sweden)

    Magdy S Alabady

    Full Text Available We describe restriction site associated RNA sequencing (RARseq, an RNAseq-based genotype by sequencing (GBS method. It includes the construction of RNAseq libraries from double stranded cDNA digested with selected restriction enzymes. To test this, we constructed six single- and six-dual-digested RARseq libraries from six F2 pitcher plant individuals and sequenced them on a half of a Miseq run. On average, the de novo approach of population genome analysis detected 544 and 570 RNA SNPs, whereas the reference transcriptome-based approach revealed an average of 1907 and 1876 RNA SNPs per individual, from single- and dual-digested RARseq data, respectively. The average numbers of RNA SNPs and alleles per loci are 1.89 and 2.17, respectively. Our results suggest that the RARseq protocol allows good depth of coverage per loci for detecting RNA SNPs and polymorphic loci for population genomics and mapping analyses. In non-model systems where complete genomes sequences are not always available, RARseq data can be analyzed in reference to the transcriptome. In addition to enriching for functional markers, this method may prove particularly useful in organisms where the genomes are not favorable for DNA GBS.

  12. HIV-1 splicing at the major splice donor site is restricted by RNA structure.

    Science.gov (United States)

    Mueller, Nancy; van Bel, Nikki; Berkhout, Ben; Das, Atze T

    2014-11-01

    The 5' leader region of the HIV-1 RNA contains the major 5' splice site (ss) that is used in the production of all spliced viral RNAs. This splice-donor (SD) region can fold a stem-loop structure. We demonstrate that whereas stabilization of this SD hairpin reduces splicing efficiency, destabilization increases splicing. Both stabilization and destabilization reduce viral fitness. These results demonstrate that the stability of the SD hairpin can modulate the level of splicing, most likely by controlling the accessibility of the 5'ss for the splicing machinery. The natural stability of the SD hairpin restricts splicing and this stability seems to be fine-tuned to reach the optimal balance between unspliced and spliced RNAs for efficient virus replication. The 5'ss region of different HIV-1 isolates and the related SIVmac239 can fold a similar structure. This evolutionary conservation supports the importance of this structure in viral replication. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. An efficient method for multiple site-directed mutagenesis using type IIs restriction enzymes.

    Science.gov (United States)

    Zhang, Zhiqiang; Xu, Kun; Xin, Ying; Zhang, Zhiying

    2015-05-01

    Site-directed mutagenesis (SDM) methods are very important in modern molecular biology, biochemistry, and protein engineering. Here, we present a novel SDM method that can be used for multiple mutation generation using type IIs restriction enzymes. This approach is faster and more convenient than the overlap polymerase chain reaction (PCR) method due to its having fewer reaction steps and being cheaper than, but as convenient as, enzymatic assembly. We illustrate the usefulness of our method by introducing three mutations into the bacterial Streptococcus thermophilus Cas9 (bStCas9) gene, converting the humanized S. thermophilus Cas9 (hStCas9) gene into nuclease dead or H847A nickase mutants and generating sunnyTALEN mutagenesis from a wild-type TALEN backbone. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis.

    Science.gov (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J

    2012-01-01

    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  15. Random Tagging Genotyping by Sequencing (rtGBS, an Unbiased Approach to Locate Restriction Enzyme Sites across the Target Genome.

    Directory of Open Access Journals (Sweden)

    Elena Hilario

    Full Text Available Genotyping by sequencing (GBS is a restriction enzyme based targeted approach developed to reduce the genome complexity and discover genetic markers when a priori sequence information is unavailable. Sufficient coverage at each locus is essential to distinguish heterozygous from homozygous sites accurately. The number of GBS samples able to be pooled in one sequencing lane is limited by the number of restriction sites present in the genome and the read depth required at each site per sample for accurate calling of single-nucleotide polymorphisms. Loci bias was observed using a slight modification of the Elshire et al.some restriction enzyme sites were represented in higher proportions while others were poorly represented or absent. This bias could be due to the quality of genomic DNA, the endonuclease and ligase reaction efficiency, the distance between restriction sites, the preferential amplification of small library restriction fragments, or bias towards cluster formation of small amplicons during the sequencing process. To overcome these issues, we have developed a GBS method based on randomly tagging genomic DNA (rtGBS. By randomly landing on the genome, we can, with less bias, find restriction sites that are far apart, and undetected by the standard GBS (stdGBS method. The study comprises two types of biological replicates: six different kiwifruit plants and two independent DNA extractions per plant; and three types of technical replicates: four samples of each DNA extraction, stdGBS vs. rtGBS methods, and two independent library amplifications, each sequenced in separate lanes. A statistically significant unbiased distribution of restriction fragment size by rtGBS showed that this method targeted 49% (39,145 of BamH I sites shared with the reference genome, compared to only 14% (11,513 by stdGBS.

  16. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  17. Synthesis of a gene for the HIV transactivator protein TAT by a novel single stranded approach involving in vivo gap repair.

    OpenAIRE

    Adams, S E; Johnson, I D; Braddock, M; Kingsman, A J; Kingsman, S M; Edwards, R M

    1988-01-01

    The synthesis of a gene for the HIV TAT protein is described using a novel approach that capitalises on the ability to synthesise oligonucleotides of greater than 100 bp in length. It involves the synthesis of large oligomers covering one strand of the desired gene in its entirety and the use of small complementary bridging and adapter oligonucleotides to direct the assembly and cloning of the large oligomers. After ligation to the cloning vector the partially single stranded intermediate is ...

  18. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers

    OpenAIRE

    Antolin, M. F.; Bosio, C. F.; Cotton, J.; Sweeney, W.; Strand, M. R.; Black-IV, W. C.

    1996-01-01

    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  19. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr

    2015-01-01

    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single- strand ed DNA -binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  20. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.

    1979-10-01

    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  1. Escherichia coli Single-Stranded DNA-Binding Protein: NanoESI-MS Studies of Salt-Modulated Subunit Exchange and DNA Binding Transactions

    Science.gov (United States)

    Mason, Claire E.; Jergic, Slobodan; Lo, Allen T. Y.; Wang, Yao; Dixon, Nicholas E.; Beck, Jennifer L.

    2013-02-01

    Single-stranded DNA-binding proteins (SSBs) are ubiquitous oligomeric proteins that bind with very high affinity to single-stranded DNA and have a variety of essential roles in DNA metabolism. Nanoelectrospray ionization mass spectrometry (nanoESI-MS) was used to monitor subunit exchange in full-length and truncated forms of the homotetrameric SSB from Escherichia coli. Subunit exchange in the native protein was found to occur slowly over a period of hours, but was significantly more rapid in a truncated variant of SSB from which the eight C-terminal residues were deleted. This effect is proposed to result from C-terminus mediated stabilization of the SSB tetramer, in which the C-termini interact with the DNA-binding cores of adjacent subunits. NanoESI-MS was also used to examine DNA binding to the SSB tetramer. Binding of single-stranded oligonucleotides [one molecule of (dT)70, one molecule of (dT)35, or two molecules of (dT)35] was found to prevent SSB subunit exchange. Transfer of SSB tetramers between discrete oligonucleotides was also observed and is consistent with predictions from solution-phase studies, suggesting that SSB-DNA complexes can be reliably analyzed by ESI mass spectrometry.

  2. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  3. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.

    1992-01-01

    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  4. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: simonaclichici@yahoo.com [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)

    2012-03-15

    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  5. 1993 report on Hanford Site land disposal restrictions for mixed wastes

    Energy Technology Data Exchange (ETDEWEB)

    Black, D.

    1993-04-01

    Since the early 1940s, the contractors at the Hanford Site have been involved in the production and purification of nuclear defense materials. These production activities have resulted in the generation of large quantities of liquid and solid radioactive mixed waste (RMW). This waste is subject to regulation under authority of both the Resource Conservation and Recovery Act of 1976{sup 2}(RCRA) and Atomic Energy Act{sup 3}. This report covers mixed waste only. Hazardous waste that is not contaminated with radionuclides is not addressed in this report. The Washington State Department of Ecology, US Environmental Protection Agency, and US Department of Energy have entered into an agreement, the Hanford Federal Facility Agreement and Consent Order{sup 1} (commonly referred to as the Tri-Party Agreement) to bring the Hanford Site operations into compliance with dangerous waste regulations. The Tri-Party Agreement required development of the original land disposal restrictions (LDR) plan and its annual updates to comply with LDR requirements for RMW. This report is the third update of the plan first issued in 1990. The Tri-Party Agreement requires, and the baseline plan and annual update reports provide, the information that follows: Waste characterization information; storage data; treatment information; waste reduction information; schedule; and progress.

  6. Thermodynamic DNA Looping by a Two-Site Restriction Endonuclease Studied using Optical Tweezers

    Science.gov (United States)

    Gemmen, Gregory J.

    2005-03-01

    Many enzyme-DNA interactions involve multimeric protein complexes that bind at two distant sites such that the DNA is looped. An example is the type IIe restriction enzyme Sau3AI, which requires two recognition sites to cleave the DNA. Here we study this process at the single DNA level using force measuring optical tweezers. We characterize cleavage rates of single DNA molecules in the presence of Sau3AI as a function of enzyme concentration, incubation time, and the fractional extension of the DNA molecule. Activity is completely inhibited by tensions of a few picoNewtons. By replacing Mg^2+ with Ca^2+, the Sau3AI dimers form but do not cleave the DNA, thus trapping DNA loops. We are able to pull apart these loops, measuring the force needed and the length of DNA released for each. We also characterize the number and length distributions of these loops as a function of incubation time and DNA fractional extension. The results of these studies are discussed in the context of a Brownian dynamics model of DNA looping.

  7. 1997 Hanford site report on land disposal restrictions for mixed waste

    Energy Technology Data Exchange (ETDEWEB)

    Black, D.G.

    1997-04-07

    The baseline land disposal restrictions (LDR) plan was prepared in 1990 in accordance with the Hanford Federal Facility Agreement and Consent Order (commonly referred to as the Tn-Party Agreement) Milestone M-26-00 (Ecology et al, 1989). The text of this milestone is below. ''LDR requirements include limitations on storage of specified hazardous wastes (including mixed wastes). In accordance with approved plans and schedules, the U.S. Department of Energy (DOE) shall develop and implement technologies necessary to achieve full compliance with LDR requirements for mixed wastes at the Hanford Site. LDR plans and schedules shall be developed with consideration of other action plan milestones and will not become effective until approved by the U.S. Environmental Protection Agency (EPA) (or Washington State Department of Ecology [Ecology]) upon authorization to administer LDRs pursuant to Section 3006 of the Resource Conservation and Recovery Act of 1976 (RCRA). Disposal of LDR wastes at any time is prohibited except in accordance with applicable LDR requirements for nonradioactive wastes at all times. The plan will include, but not be limited to, the following: Waste characterization plan; Storage report; Treatment report; Treatment plan; Waste minimization plan; A schedule depicting the events necessary to achieve full compliance with LDR requirements; and A process for establishing interim milestones.

  8. Genome Filtering Using Methylation- Sensitive Restriction Enzymes with Six Base Pair Recognition Sites

    Directory of Open Access Journals (Sweden)

    John P. Fellers

    2008-11-01

    Full Text Available The large fraction of repetitive DNA in many plant genomes has complicated all aspects of DNA sequencing and assembly, and thus techniques that enrich for genes and low-copy sequences have been employed to isolate gene space. Methyl-sensitive restriction enzymes, with six base pair recognition sites, were evaluated on genomic DNA of the bread wheat ‘Chinese Spring’ as a different approach to enrich for genes. I, I, I, and II were used to digest wheat genomic DNA and fragments ranging from 400 bp to 2.0 kb were cloned and unidirectionally sequenced. All four enzymes provided some level of enrichment for gene space; however, II and I reduced the number of clones with repeat elements to just 16.2 and 19.1%, respectively. II and I were also effective in enrichment in corn and tobacco. Corn libraries made with II and I had 58.7 and 71.2%, respectively, of the clones with significant expressed sequence tag (EST alignments, while tobacco libraries made with the same enzymes had 51.7 and 65.3%, respectively. With the development of ultra-throughput sequencing technologies, this technique provides an opportunity to rapidly and efficiently obtain sequencing from gene-rich regions.

  9. Restriction site polymorphisms in the pig beta-globin gene cluster.

    Science.gov (United States)

    Rando, A; Masina, P

    1985-01-01

    A restriction fragment length polymorphism was detected in pig DNA digested with Hind III restriction endonuclease and probed with rabbit beta 1-globin gene. Eight different phenotypes were observed and for six of them family data demonstrated that they are determined by three alleles. As this polymorphism is not found with four other restriction endonucleases (Bam HI, Eco RI, Kpn I, and Pst I), single point mutations are proposed to explain the observed differences.

  10. The Rev1 interacting region (RIR) motif in the scaffold protein XRCC1 mediates a low-affinity interaction with polynucleotide kinase/phosphatase (PNKP) during DNA single-strand break repair.

    Science.gov (United States)

    Breslin, Claire; Mani, Rajam S; Fanta, Mesfin; Hoch, Nicolas; Weinfeld, Michael; Caldecott, Keith W

    2017-09-29

    The scaffold protein X-ray repair cross-complementing 1 (XRCC1) interacts with multiple enzymes involved in DNA base excision repair and single-strand break repair (SSBR) and is important for genetic integrity and normal neurological function. One of the most important interactions of XRCC1 is that with polynucleotide kinase/phosphatase (PNKP), a dual-function DNA kinase/phosphatase that processes damaged DNA termini and that, if mutated, results in ataxia with oculomotor apraxia 4 (AOA4) and microcephaly with early-onset seizures and developmental delay (MCSZ). XRCC1 and PNKP interact via a high-affinity phosphorylation-dependent interaction site in XRCC1 and a forkhead-associated domain in PNKP. Here, we identified using biochemical and biophysical approaches a second PNKP interaction site in XRCC1 that binds PNKP with lower affinity and independently of XRCC1 phosphorylation. However, this interaction nevertheless stimulated PNKP activity and promoted SSBR and cell survival. The low-affinity interaction site required the highly conserved Rev1-interacting region (RIR) motif in XRCC1 and included three critical and evolutionarily invariant phenylalanine residues. We propose a bipartite interaction model in which the previously identified high-affinity interaction acts as a molecular tether, holding XRCC1 and PNKP together and thereby promoting the low-affinity interaction identified here, which then stimulates PNKP directly. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. ICRPfinder: a fast pattern design algorithm for coding sequences and its application in finding potential restriction enzyme recognition sites

    Directory of Open Access Journals (Sweden)

    Stafford Phillip

    2009-09-01

    Full Text Available Abstract Background Restriction enzymes can produce easily definable segments from DNA sequences by using a variety of cut patterns. There are, however, no software tools that can aid in gene building -- that is, modifying wild-type DNA sequences to express the same wild-type amino acid sequences but with enhanced codons, specific cut sites, unique post-translational modifications, and other engineered-in components for recombinant applications. A fast DNA pattern design algorithm, ICRPfinder, is provided in this paper and applied to find or create potential recognition sites in target coding sequences. Results ICRPfinder is applied to find or create restriction enzyme recognition sites by introducing silent mutations. The algorithm is shown capable of mapping existing cut-sites but importantly it also can generate specified new unique cut-sites within a specified region that are guaranteed not to be present elsewhere in the DNA sequence. Conclusion ICRPfinder is a powerful tool for finding or creating specific DNA patterns in a given target coding sequence. ICRPfinder finds or creates patterns, which can include restriction enzyme recognition sites, without changing the translated protein sequence. ICRPfinder is a browser-based JavaScript application and it can run on any platform, in on-line or off-line mode.

  12. ICRPfinder: a fast pattern design algorithm for coding sequences and its application in finding potential restriction enzyme recognition sites.

    Science.gov (United States)

    Li, Chao; Li, Yuhua; Zhang, Xiangmin; Stafford, Phillip; Dinu, Valentin

    2009-09-11

    Restriction enzymes can produce easily definable segments from DNA sequences by using a variety of cut patterns. There are, however, no software tools that can aid in gene building -- that is, modifying wild-type DNA sequences to express the same wild-type amino acid sequences but with enhanced codons, specific cut sites, unique post-translational modifications, and other engineered-in components for recombinant applications. A fast DNA pattern design algorithm, ICRPfinder, is provided in this paper and applied to find or create potential recognition sites in target coding sequences. ICRPfinder is applied to find or create restriction enzyme recognition sites by introducing silent mutations. The algorithm is shown capable of mapping existing cut-sites but importantly it also can generate specified new unique cut-sites within a specified region that are guaranteed not to be present elsewhere in the DNA sequence. ICRPfinder is a powerful tool for finding or creating specific DNA patterns in a given target coding sequence. ICRPfinder finds or creates patterns, which can include restriction enzyme recognition sites, without changing the translated protein sequence. ICRPfinder is a browser-based JavaScript application and it can run on any platform, in on-line or off-line mode.

  13. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus

    Science.gov (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.

    2016-01-01

    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  14. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy

    OpenAIRE

    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried

    2013-01-01

    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  15. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  16. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.

    1989-01-01

    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  17. A single-stranded RNA copy of the Giardia lamblia virus double-stranded RNA genome is present in the infected Giardia lamblia.

    OpenAIRE

    Furfine, E S; White, T C; Wang, A L; Wang, C C

    1989-01-01

    An isolate of Giardia lamblia infected with the double-stranded RNA virus (GLV) has two major species of RNA that are not present in an uninfected isolate. One of these species is the previously characterized double-stranded RNA genome of GLV (1). The second species of RNA appears to be a full length copy of one strand of the double-stranded RNA genome. This full length single-stranded RNA is not present in viral particles isolated from the growth medium. The cellular concentration of the sin...

  18. 1994 Report on Hanford Site land disposal restrictions for mixed waste

    Energy Technology Data Exchange (ETDEWEB)

    Black, D.G.

    1994-04-01

    The baseline land disposal restrictions (LDR) plan was prepared in 1990 in accordance with the Hanford Federal Facility Agreement and Consent Order (commonly referred to as the Tri-Party Agreement) Milestone M-26-00 (Ecology et al. 1992). The text of this milestone is below. LDR requirements include limitations on storage of specified hazardous wastes (including mixed wastes). In accordance with approved plans and schedules, the US Department of Energy (DOE) shall develop and implement technologies necessary to achieve full compliance with LDR requirements for mixed wastes at the Hanford Site. LDR plans and schedules shall be developed with consideration at other action plan milestones and will not become effective until approved by the US Environmental Protection Agency (EPA) (or Washington State Department of Ecology [Ecology]) upon authorization to administer LDRs pursuant to Section 3006 of the Resource Conservation and Recovery Act of 1976 (RCRA). Disposal of LDR wastes at any time is prohibited except in accordance with applicable LDR requirements for nonradioactive wastes at all times. The plan will include, but not be limited to, the following: waste characterization plan; storage report; treatment report; treatment plan; waste minimization plan; a schedule depicting the events necessary to achieve full compliance with LDR requirements; a process for establishing interim milestones. The original plan was published in October 1990. This is the fourth of a series of annual updates required by Tri-Party Agreement Milestone M-26-01. A Tri-Party Agreement change request approved in March 1992 changed the annual due date from October to April and consolidated this report with a similar one prepared under Milestone M-25-00. The reporting period for this report is from April 1, 1993, to March 31, 1994.

  19. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples.

    Science.gov (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J

    2006-03-01

    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  20. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast.

    Science.gov (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A

    2010-08-05

    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  1. Isolation and characterization of a single-stranded DNA virus infecting the marine diatom Chaetoceros sp. strain SS628-11 isolated from western Japan.

    Directory of Open Access Journals (Sweden)

    Kei Kimura

    Full Text Available Diatoms are significant organisms for primary production in the earth's aquatic environment. Hence, their dynamics are an important focus area in current studies. Viruses are a great concern as potential factors of diatom mortality, along with other physical, chemical, and biological factors. We isolated and characterized a new diatom virus (Csp07DNAV that lyses the marine planktonic diatom Chaetoceros sp. strain SS628-11. This paper examines the physiological, morphological, and genomic characteristics of Csp07DNAV. The virus was isolated from a surface water sample that was collected at Hiroshima Bay, Japan. It was icosahedral, had a diameter of 34 nm, and accumulated in the nuclei of host cells. Rod-shaped virus particles also coexisted in the host nuclei. The latent period and burst size were estimated to be <12 h and 29 infectious units per host cell, respectively. Csp07DNAV had a closed circular single-stranded DNA genome (5,552 nucleotides, which included a double-stranded region and 3 open reading frames. The monophyly of Csp07DNAV and other Bacilladnavirus group single-stranded DNA viruses was supported by phylogenetic analysis that was based on the amino acid sequence of each virus protein. On the basis of these results, we considered Csp07DNAV to be a new member of the genus Bacilladnavirus.

  2. Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library.

    Directory of Open Access Journals (Sweden)

    Sumate Pengpumkiat

    Full Text Available Chemical synthesis of oligonucleotides is a widely used tool in the field of biochemistry. Several methods for gene synthesis have been introduced in the growing area of genomics. In this paper, a novel method of constructing dsDNA is proposed. Short (28-mer oligo fragments from a library were assembled through successive annealing and ligation processes, followed by PCR. First, two oligo fragments annealed to form a dsDNA molecule. The double-stranded oligo was immobilized onto magnetic beads (solid support via streptavidin-biotin binding. Next, single-stranded oligo fragments were added successively through ligation to form the complete DNA molecule. The synthesized DNA was amplified through PCR and gel electrophoresis was used to characterize the product. Sanger sequencing showed that more than 97% of the nucleotides matched the expected sequence. Extending the length of the DNA molecule by adding single-stranded oligonucleotides from a basis set (library via ligation enables a more convenient and rapid mechanism for the design and synthesis of oligonucleotides on the go. Coupled with an automated dispensing system and libraries of short oligo fragments, this novel DNA synthesis method would offer an efficient and cost-effective method for producing dsDNA.

  3. Fluorescence quenching of graphene oxide combined with the site-specific cleavage of restriction endonuclease for deoxyribonucleic acid demethylase activity assay.

    Science.gov (United States)

    Ji, Lijuan; Qian, Yingdan; Wu, Ping; Zhang, Hui; Cai, Chenxin

    2015-04-15

    We report on the development of a sensitive and selective deoxyribonucleic acid (DNA) demethylase (using MBD2 as an example) activity assay by coupling the fluorescence quenching of graphene oxide (GO) with the site-specific cleavage of HpaII endonuclease to improve the selectivity. This approach was developed by designing a single-stranded probe (P1) that carries a binding region to facilitate the interaction with GO, which induces fluorescence quenching of the labeled fluorophore (FAM, 6-carboxyfluorescein), and a sensing region, which contains a hemi-methylated site of 5'-CmCGG-3', to specifically recognize the target (T1, a 32-mer DNA from the promoter region of p53 gene) and hybridize with it to form a P1/T1 duplex. After demethylation with MBD2, the duplex can be specifically cleaved using HpaII, which releases the labeled FAM from the GO surface and results in the recovery of fluorescence. However, this cleavage is blocked by the hemi-methylation of this site. Thus, the magnitude of the recovered fluorescence signal is related to the MBD2 activity, which establishes the basis of the DNA demethylase activity assay. This assay can determine as low as ∼(0.05±0.01) ng mL(-1) (at a signal/noise of 3) of MBD2 with a linear range of 0.2-300 ng mL(-1) and recognize MBD2 from other possibly coexisting proteins and cancer cell extracts. The advantage of this assay is its ability to avoid false signals and no requirement of bisulfite conversion, PCR amplification, radioisotope labeling, or separation. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Exploring both sequence detection and restriction endonuclease cleavage kinetics by recognition site via single-molecule microfluidic trapping.

    Science.gov (United States)

    Xu, Weilin; Muller, Susan J

    2011-02-07

    We demonstrate the feasibility of a single-molecule microfluidic approach to both sequence detection and obtaining kinetic information for restriction endonucleases on dsDNA. In this method, a microfluidic stagnation point flow is designed to trap, hold, and linearize double-stranded (ds) genomic DNA to which a restriction endonuclease has been pre-bound sequence-specifically. By introducing the cofactor magnesium, we determine the binding location of the enzyme by the cleavage process of dsDNA as in optical restriction mapping, however here the DNA need not be immobilized on a surface. We note that no special labeling of the enzyme is required, which makes it simpler than our previous scheme using stagnation point flows for sequence detection. Our accuracy in determining the location of the recognition site is comparable to or better than other single molecule techniques due to the fidelity with which we can control the linearization of the DNA molecules. In addition, since the cleavage process can be followed in real time, information about the cleavage kinetics, and subtle differences in binding and cleavage frequencies among the recognition sites, may also be obtained. Data for the five recognition sites for the type II restriction endonuclease EcoRI on λ-DNA are presented as a model system. While the roles of the varying fluid velocity and tension along the chain backbone on the measured kinetics remain to be determined, we believe this new method holds promise for a broad range of studies of DNA-protein interactions, including the kinetics of other DNA cleavage processes, the dissociation of a restriction enzyme from the cleaved substrate, and other macromolecular cleavage processes.

  5. Engineering BspQI nicking enzymes and application of N.BspQI in DNA labeling and production of single-strand DNA.

    Science.gov (United States)

    Zhang, Penghua; Too, Priscilla Hiu-Mei; Samuelson, James C; Chan, Siu-Hong; Vincze, Tamas; Doucette, Stephanie; Bäckström, Stefan; Potamousis, Konstantinos D; Schramm, Timothy M; Forrest, Dan; Schwartz, David C; Xu, Shuang-yong

    2010-02-01

    BspQI is a thermostable Type IIS restriction endonuclease (REase) with the recognition sequence 5'GCTCTTC N1/N4 3'. Here we report the cloning and expression of the bspQIR gene for the BspQI restriction enzyme in Escherichia coli. Alanine scanning of the BspQI charged residues identified a number of DNA nicking variants. After sampling combinations of different amino acid substitutions, an Nt.BspQI triple mutant (E172A/E248A/E255K) was constructed with predominantly top-strand DNA nicking activity. Furthermore, a triple mutant of BspQI (Nb.BspQI, N235A/K331A/R428A) was engineered to create a bottom-strand nicking enzyme. In addition, we demonstrated the application of Nt.BspQI in optical mapping of single DNA molecules. Nt or Nb.BspQI-nicked dsDNA can be further digested by E. coli exonuclease III to create ssDNA for downstream applications. BspQI contains two potential catalytic sites: a top-strand catalytic site (Ct) with a D-H-N-K motif found in the HNH endonuclease family and a bottom-strand catalytic site (Cb) with three scattered Glu residues. BlastP analysis of proteins in GenBank indicated a putative restriction enzyme with significant amino acid sequence identity to BspQI from the sequenced bacterial genome Croceibacter atlanticus HTCC2559. This restriction gene was amplified by PCR and cloned into a T7 expression vector. Restriction mapping and run-off DNA sequencing of digested products from the partially purified enzyme indicated that it is an EarI isoschizomer with 6-bp recognition, which we named CatHI (CTCTTC N1/N4).

  6. ICRPfinder: a fast pattern design algorithm for coding sequences and its application in finding potential restriction enzyme recognition sites

    OpenAIRE

    Li, Chao; Li, Yuhua; Zhang, Xiangmin; Stafford, Phillip; Dinu, Valentin

    2009-01-01

    Abstract Background Restriction enzymes can produce easily definable segments from DNA sequences by using a variety of cut patterns. There are, however, no software tools that can aid in gene building -- that is, modifying wild-type DNA sequences to express the same wild-type amino acid sequences but with enhanced codons, specific cut sites, unique post-translational modifications, and other engineered-in components for recombinant applications. A fast DNA pattern design algorithm, ICRPfinder...

  7. 1999 Report on Hanford Site land disposal restriction for mixed waste

    International Nuclear Information System (INIS)

    BLACK, D.G.

    1999-01-01

    This report was submitted to meet the requirements of Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) Milestone M-26-011. This milestone requires the preparation of an annual report that covers characterization, treatment, storage, minimization, and other aspects of managing land-disposal-restricted mixed waste at the Hanford Facility

  8. 1999 Report on Hanford Site land disposal restriction for mixed waste

    Energy Technology Data Exchange (ETDEWEB)

    BLACK, D.G.

    1999-03-25

    This report was submitted to meet the requirements of Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) Milestone M-26-011. This milestone requires the preparation of an annual report that covers characterization, treatment, storage, minimization, and other aspects of managing land-disposal-restricted mixed waste at the Hanford Facility.

  9. The X chromosome shows less genetic variation at restriction sites than the autosomes

    NARCIS (Netherlands)

    Hofker, M. H.; Skraastad, M. I.; Bergen, A. A.; Wapenaar, M. C.; Bakker, E.; Millington-Ward, A.; van Ommen, G. J.; Pearson, P. L.

    1986-01-01

    Using a standard technique, 122 single-copy probes were screened for their ability to detect restriction fragment length polymorphisms (RFLPs) in the human genome. The use of a standardized RFLP screening enables the introduction of statistical methods in the analysis of differences in RFLP content

  10. Synthesis of a wild-type and three mutant Cucurbita maxima trypsin inhibitor-encoding genes by a single-strand approach.

    Science.gov (United States)

    Botes, D P; Qobose, M D; Corfield, V A

    1991-09-15

    A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.

  11. The casein genes in goat breeds from different Continents: analysis by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP

    Directory of Open Access Journals (Sweden)

    A. Caroli

    2010-04-01

    Full Text Available A screening of casein gene variability was carried out by Polymerase Chain Reaction – Single Strand Conformation Polymorphism in 8 goat breeds from Sudan (Nubian goat, Turkey (Angora Goat Lalahan Tiftic, Angora Goat Yerkoy, Hair goat and India (Jammu, Maharashtra, Rajasthan, South Goat. A total of 16 different alleles or groups of alleles were found, showing conspicuous differences among breeds. The allele frequencies were submitted to cluster analysis in order to highlight differences between breeds, also including data from Red Sokoto, West African Dwarf Nigeria, West African Dwarf Cameroon, and Borno Goat. The tree obtained from the cluster analysis showed two main lineages. The West African goat clustered together, the Indian and Turkish breeds were in the other group. Nubian goat was found in an intermediate position.

  12. Investigation of single-strand conformational polymorphism of the TP53 gene in women with a family history of breast cancer

    Directory of Open Access Journals (Sweden)

    R.R. Burbano

    2000-11-01

    Full Text Available Breast cancer in families with germ line mutations in the TP53 gene has been described in the medical literature. Mutation screening for susceptibility genes should allow effective prophylactic and preventive measures. Using single-strand conformational polymorphism, we screened for mutations in exons 5, 6, 7 and 8 of gene TP53 in the peripheral blood of 8 young non-affected members (17 to 36 years old of families with a history of breast cancer. Studies of this type on young patients (mean age, 25 years are very rare in the literature. The identification of these mutations would contribute to genetic counseling of members of families with predisposition to breast cancer. The results obtained did not show any polymorphism indicating mutation. In our sample, the familial tumorigenesis is probably related to other gene etiologies.

  13. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.

    1994-01-01

    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  14. Influence of the single-strand linker composition on the structural/dynamical properties of a truncated octahedral DNA nano-cage family.

    Science.gov (United States)

    Iacovelli, Federico; Alves, Cassio; Falconi, Mattia; Oteri, Francesco; de Oliveira, Cristiano L P; Desideri, Alessandro

    2014-10-01

    The structural/dynamical properties of three truncated octahedral DNA nano-cages composed by identical double helices but single strand linkers with different composition, namely 7 thymidines, 7 adenines, and 7 alternated thymidines and adenines, have been investigated through classical molecular dynamics simulations. Trajectories have been analyzed to investigate the role of the linkers in defining nano-cages stability and flexibility, including possible influence on the internal cages motions. The data indicate that the cages behavior is almost identical and that the structural/dynamical parameters measured along the trajectories are not particularly affected by the presence of different bases. These results demonstrate that the constraints imposed by the nano-structure geometry are the main factor in modulating these properties

  15. Bifunctional TaqII restriction endonuclease: redefining the prototype DNA recognition site and establishing the Fidelity Index for partial cleaving.

    Science.gov (United States)

    Zylicz-Stachula, Agnieszka; Zołnierkiewicz, Olga; Sliwińska, Katarzyna; Jeżewska-Frąckowiak, Joanna; Skowron, Piotr M

    2011-12-05

    The TaqII enzyme is a member of the Thermus sp. enzyme family that we propounded previously within Type IIS restriction endonucleases, containing related thermophilic bifunctional endonucleases-methyltransferases from various Thermus sp.: TaqII, Tth111II, TthHB27I, TspGWI, TspDTI and TsoI. These enzymes show significant nucleotide and amino acid sequence similarities, a rare phenomenon among restriction endonucleases, along with similarities in biochemical properties, molecular size, DNA recognition sequences and cleavage sites. They also feature some characteristics of Types I and III. Barker et al. reported the Type IIS/IIC restriction endonuclease TaqII as recognizing two distinct cognate site variants (5'-GACCGA-3' and 5'-CACCCA-3') while cleaving 11/9 nucleotides downstream. We used four independent methods, namely, shotgun cloning and sequencing, restriction pattern analysis, digestion of particular custom substrates and GeneScan analysis, to demonstrate that the recombinant enzyme recognizes only 5'-GACCGA-3' sites and cleaves 11/9 nucleotides downstream. We did not observe any 5'-CACCCA-3' cleavage under a variety of conditions and site arrangements tested. We also characterized the enzyme biochemically and established new digestion conditions optimal for practical enzyme applications. Finally, we developed and propose a new version of the Fidelity Index - the Fidelity Index for Partial Cleavage (FI-PC). The DNA recognition sequence of the bifunctional prototype TaqII endonuclease-methyltransferase from Thermus aquaticus has been redefined as recognizing only 5'-GACCGA-3' cognate sites. The reaction conditions (pH and salt concentrations) were designed either to minimize (pH = 8.0 and 10 mM ammonium sulphate) or to enhance star activity (pH = 6.0 and no salt). Redefinition of the recognition site and reaction conditions makes this prototype endonuclease a useful tool for DNA manipulation; as yet, this enzyme has no practical applications. The extension of

  16. Functional roles of the N- and C-terminal regions of the human mitochondrial single-stranded DNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Marcos T Oliveira

    2010-10-01

    Full Text Available Biochemical studies of the mitochondrial DNA (mtDNA replisome demonstrate that the mtDNA polymerase and the mtDNA helicase are stimulated by the mitochondrial single-stranded DNA-binding protein (mtSSB. Unlike Escherichia coli SSB, bacteriophage T7 gp2.5 and bacteriophage T4 gp32, mtSSBs lack a long, negatively charged C-terminal tail. Furthermore, additional residues at the N-terminus (notwithstanding the mitochondrial presequence are present in the sequence of species across the animal kingdom. We sought to analyze the functional importance of the N- and C-terminal regions of the human mtSSB in the context of mtDNA replication. We produced the mature wild-type human mtSSB and three terminal deletion variants, and examined their physical and biochemical properties. We demonstrate that the recombinant proteins adopt a tetrameric form, and bind single-stranded DNA with similar affinities. They also stimulate similarly the DNA unwinding activity of the human mtDNA helicase (up to 8-fold. Notably, we find that unlike the high level of stimulation that we observed previously in the Drosophila system, stimulation of DNA synthesis catalyzed by human mtDNA polymerase is only moderate, and occurs over a narrow range of salt concentrations. Interestingly, each of the deletion variants of human mtSSB stimulates DNA synthesis at a higher level than the wild-type protein, indicating that the termini modulate negatively functional interactions with the mitochondrial replicase. We discuss our findings in the context of species-specific components of the mtDNA replisome, and in comparison with various prokaryotic DNA replication machineries.

  17. Direct imaging of hexaamine-ruthenium(III) in domain boundaries in monolayers of single-stranded DNA

    DEFF Research Database (Denmark)

    Grubb, Mikala; Wackerbarth, Hainer; Wengel, J.

    2007-01-01

    We describe adsorption and identification of the binding sites of [Ru(NH3)(6)](3+) (RuHex) molecules in a closely packed monolayer of a 13-base ss-DNA on Au(111) electrodes by electrochemical in situ scanning tunneling microscopy (STM), cyclic voltammetry and interfacial capacitance data. In situ...

  18. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  19. Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

    Directory of Open Access Journals (Sweden)

    Jiabing Ji

    Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

  20. A G-C-rich palindromic structural motif and a stretch of single-stranded purines are required for optimal packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA.

    Science.gov (United States)

    Jaballah, Soumeya Ali; Aktar, Suriya J; Ali, Jahabar; Phillip, Pretty Susan; Al Dhaheri, Noura Salem; Jabeen, Aayesha; Rizvi, Tahir A

    2010-09-03

    During retroviral RNA packaging, two copies of genomic RNA are preferentially packaged into the budding virus particles whereas the spliced viral RNAs and the cellular RNAs are excluded during this process. Specificity towards retroviral RNA packaging is dependent upon sequences at the 5' end of the viral genome, which at times extend into Gag sequences. It has earlier been suggested that the Mason-Pfizer monkey virus (MPMV) contains packaging sequences within the 5' untranslated region (UTR) and Gag. These studies have also suggested that the packaging determinants of MPMV that lie in the UTR are bipartite and are divided into two regions both upstream and downstream of the major splice donor. However, the precise boundaries of these discontinuous regions within the UTR and the role of the intervening sequences between these dipartite sequences towards MPMV packaging have not been investigated. Employing a combination of genetic and structural prediction analyses, we have shown that region "A", immediately downstream of the primer binding site, is composed of 50 nt, whereas region "B" is composed of the last 23 nt of UTR, and the intervening 55 nt between these two discontinuous regions do not contribute towards MPMV RNA packaging. In addition, we have identified a 14-nt G-C-rich palindromic sequence (with 100% autocomplementarity) within region A that has been predicted to fold into a structural motif and is essential for optimal MPMV RNA packaging. Furthermore, we have also identified a stretch of single-stranded purines (ssPurines) within the UTR and 8 nt of these ssPurines are duplicated in region B. The native ssPurines or its repeat in region B when predicted to refold as ssPurines has been shown to be essential for RNA packaging, possibly functioning as a potential nucleocapsid binding site. Findings from this study should enhance our understanding of the steps involved in MPMV replication including RNA encapsidation process. Copyright (c) 2010 Elsevier Ltd

  1. A rapid method for site-specific mutagenesis and directional subcloning by using the polymerase chain reaction to generate recombinant circles.

    Science.gov (United States)

    Jones, D H; Howard, B H

    1990-02-01

    Site-specific mutagenesis and directional subcloning were accomplished by using the polymerase chain reaction to generate products that can recombine to form circular DNA. This DNA was transfected into E. coli without phosphorylation of primers, restriction enzyme digestion or ligation. Specifically, the polymerase chain reaction was used to generate products that when combined, denatured and reannealed, form double-stranded DNA with discrete, cohesive single-stranded ends. The generation of these cohesive ends of DNA permits the formation of precise, directional DNA joints without dependence on enzyme restriction sites. The primers were designed such that these cohesive single-stranded ends annealed to form circular DNA. The recombinant of interest was generated following only 14 amplification cycles. These recombinant circles of DNA were directly transfected into E. coli. In the mutagenesis protocol, the desired mutant was obtained at 83%-100% efficiency. Unwanted mutations were not detected, indicating a less than 0.025% nucleotide misincorporation frequency. In the directional subcloning protocol, inserts were positioned precisely in the recipient plasmid and were in the correct orientation. One unwanted mutation was detected after sequencing 900 bases, indicating a 0.11% nucleotide misincorporation frequency. Each manipulation, from setting up for the DNA amplification to transfection into E. coli. can easily be accomplished in one day.

  2. Activation of 2'-5' oligoadenylate synthetase by single-stranded and double-stranded RNA aptamers

    DEFF Research Database (Denmark)

    Hartmann, R; Norby, P L; Martensen, P M

    1998-01-01

    A number of small RNA molecules that are high affinity ligands for the 46-kDa form of human 2'-5' oligoadenylate synthetase have been identified by the SELEX method. Surface plasmon resonance analysis indicates that these RNAs bind to the enzyme with dissociation constants in the nanomolar range....... Competition experiments indicate that the binding site for the small RNAs on the 2'-5' oligoadenylate synthetase molecule at least partially overlaps that for the synthetic double-stranded RNA, poly(I).poly(C). Several of the RNAs function as potent activators of 2'-5' oligoadenylate synthetase in vitro......-stranded RNA, can also be activated by RNA ligands with little secondary structure. Since 2'-5' oligoadenylate synthetase possesses no homology to other known RNA-binding proteins, the development of small specific ligands by SELEX should facilitate studies of RNA-protein interactions and may reveal novel...

  3. 1998 report on Hanford Site land disposal restrictions for mixed waste

    International Nuclear Information System (INIS)

    Black, D.G.

    1998-01-01

    This report was submitted to meet the requirements of Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) Milestone M-26-01H. This milestone requires the preparation of an annual report that covers characterization, treatment, storage, minimization, and other aspects of managing land-disposal-restricted mixed waste at the Hanford Facility. The US Department of Energy, its predecessors, and contractors on the Hanford Facility were involved in the production and purification of nuclear defense materials from the early 1940s to the late 1980s. These production activities have generated large quantities of liquid and solid mixed waste. This waste is regulated under authority of both the Resource Conservation and Recovery Act of l976 and the Atomic Energy Act of 1954. This report covers only mixed waste. The Washington State Department of Ecology, US Environmental Protection Agency, and US Department of Energy have entered into the Tri-Party Agreement to bring the Hanford Facility operations into compliance with dangerous waste regulations. The Tri-Party Agreement required development of the original land disposal restrictions (LDR) plan and its annual updates to comply with LDR requirements for mixed waste. This report is the eighth update of the plan first issued in 1990. The Tri-Party Agreement requires and the baseline plan and annual update reports provide the following information: (1) Waste Characterization Information -- Provides information about characterizing each LDR mixed waste stream. The sampling and analysis methods and protocols, past characterization results, and, where available, a schedule for providing the characterization information are discussed. (2) Storage Data -- Identifies and describes the mixed waste on the Hanford Facility. Storage data include the Resource Conservation and Recovery Act of 1976 dangerous waste codes, generator process knowledge needed to identify the waste and to make LDR determinations, quantities

  4. 1998 report on Hanford Site land disposal restrictions for mixed waste

    Energy Technology Data Exchange (ETDEWEB)

    Black, D.G.

    1998-04-10

    This report was submitted to meet the requirements of Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) Milestone M-26-01H. This milestone requires the preparation of an annual report that covers characterization, treatment, storage, minimization, and other aspects of managing land-disposal-restricted mixed waste at the Hanford Facility. The US Department of Energy, its predecessors, and contractors on the Hanford Facility were involved in the production and purification of nuclear defense materials from the early 1940s to the late 1980s. These production activities have generated large quantities of liquid and solid mixed waste. This waste is regulated under authority of both the Resource Conservation and Recovery Act of l976 and the Atomic Energy Act of 1954. This report covers only mixed waste. The Washington State Department of Ecology, US Environmental Protection Agency, and US Department of Energy have entered into the Tri-Party Agreement to bring the Hanford Facility operations into compliance with dangerous waste regulations. The Tri-Party Agreement required development of the original land disposal restrictions (LDR) plan and its annual updates to comply with LDR requirements for mixed waste. This report is the eighth update of the plan first issued in 1990. The Tri-Party Agreement requires and the baseline plan and annual update reports provide the following information: (1) Waste Characterization Information -- Provides information about characterizing each LDR mixed waste stream. The sampling and analysis methods and protocols, past characterization results, and, where available, a schedule for providing the characterization information are discussed. (2) Storage Data -- Identifies and describes the mixed waste on the Hanford Facility. Storage data include the Resource Conservation and Recovery Act of 1976 dangerous waste codes, generator process knowledge needed to identify the waste and to make LDR determinations, quantities

  5. Fluorescence quenching of graphene oxide combined with the site-specific cleavage of restriction endonuclease for deoxyribonucleic acid demethylase activity assay

    Energy Technology Data Exchange (ETDEWEB)

    Ji, Lijuan; Qian, Yingdan; Wu, Ping; Zhang, Hui; Cai, Chenxin, E-mail: cxcai@njnu.edu.cn

    2015-04-15

    Highlights: • An approach for sensitive and selective DNA demethylase activity assay is reported. • This assay is based on the fluorescence quenching of GO and site-specific cleavage of endonuclease. • It can determine as low as 0.05 ng mL{sup −1} of MBD2 with a linear range of 0.2–300 ng mL{sup −1}. • It has an ability to recognize MBD2 from other possibly coexisting proteins and cancer cell extracts. • It can avoid false signals, requiring no bisulfite conversion, PCR amplification, radioisotope-labeling. - Abstract: We report on the development of a sensitive and selective deoxyribonucleic acid (DNA) demethylase (using MBD2 as an example) activity assay by coupling the fluorescence quenching of graphene oxide (GO) with the site-specific cleavage of HpaII endonuclease to improve the selectivity. This approach was developed by designing a single-stranded probe (P1) that carries a binding region to facilitate the interaction with GO, which induces fluorescence quenching of the labeled fluorophore (FAM, 6-carboxyfluorescein), and a sensing region, which contains a hemi-methylated site of 5′-CmCGG-3′, to specifically recognize the target (T1, a 32-mer DNA from the promoter region of p53 gene) and hybridize with it to form a P1/T1 duplex. After demethylation with MBD2, the duplex can be specifically cleaved using HpaII, which releases the labeled FAM from the GO surface and results in the recovery of fluorescence. However, this cleavage is blocked by the hemi-methylation of this site. Thus, the magnitude of the recovered fluorescence signal is related to the MBD2 activity, which establishes the basis of the DNA demethylase activity assay. This assay can determine as low as ∼(0.05 ± 0.01) ng mL{sup −1} (at a signal/noise of 3) of MBD2 with a linear range of 0.2–300 ng mL{sup −1} and recognize MBD2 from other possibly coexisting proteins and cancer cell extracts. The advantage of this assay is its ability to avoid false signals and no

  6. An A-T linker adapter polymerase chain reaction method for chromosome walking without restriction site cloning bias.

    Science.gov (United States)

    Trinh, Quoclinh; Xu, Wentao; Shi, Hui; Luo, Yunbo; Huang, Kunlun

    2012-06-01

    A-T linker adapter polymerase chain reaction (PCR) was modified and employed for the isolation of genomic fragments adjacent to a known DNA sequence. The improvements in the method focus on two points. The first is the modification of the PO(4) and NH(2) groups in the adapter to inhibit the self-ligation of the adapter or the generation of nonspecific products. The second improvement is the use of the capacity of rTaq DNA polymerase to add an adenosine overhang at the 3' ends of digested DNA to suppress self-ligation in the digested DNA and simultaneously resolve restriction site clone bias. The combination of modifications in the adapter and in the digested DNA leads to T/A-specific ligation, which enhances the flexibility of this method and makes it feasible to use many different restriction enzymes with a single adapter. This novel A-T linker adapter PCR overcomes the inherent limitations of the original ligation-mediated PCR method such as low specificity and a lack of restriction enzyme choice. Moreover, this method also offers higher amplification efficiency, greater flexibility, and easier manipulation compared with other PCR methods for chromosome walking. Experimental results from 143 Arabidopsis mutants illustrate that this method is reliable and efficient in high-throughput experiments. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Supplemental Investigation Plan for FFACO Use Restrictions, Nevada Test Site, Nevada, Revision 0

    Energy Technology Data Exchange (ETDEWEB)

    Lynn Kidman

    2008-02-01

    This document is part of an effort to re-evaluate all FFACO URs against the current RBCA criteria (referred to in this document as the Industrial Sites [IS] RBCA process) as defined in the Industrial Sites Project Establishment of Final Action Levels (NNSA/NSO, 2006a). After reviewing all of the existing FFACO URs, the 12 URs addressed in this Supplemental Investigation Plan (SIP) could not be evaluated against the current RBCA criteria as sufficient information about the contamination at each site was not available. This document presents the plan for conducting field investigations to obtain the needed information. This SIP includes URs from Corrective Action Units (CAUs) 326, 339, 358, 452, 454, 464, and 1010, located in Areas 2, 6, 12, 19, 25, and 29 of the Nevada Test Site, which is approximately 65 miles northwest of Las Vegas, Nevada; and CAU 403, located in Area 3 of the Tonopah Test Range, which is approximately 165 miles north of Las Vegas, Nevada.

  8. Post-Closure Strategy for Use-Restricted Sites on the Nevada National Security Site, Nevada Test and Training Range, and Tonopah Test Range, Nevada

    International Nuclear Information System (INIS)

    Silvas, A. J.

    2014-01-01

    The purpose of this Post-Closure Strategy is to provide a consistent methodology for continual evaluation of post-closure requirements for use-restricted areas on the Nevada National Security Site (NNSS), Nevada Test and Training Range (NTTR), and Tonopah Test Range (TTR) to consolidate, modify, or streamline the program. In addition, this document stipulates the creation of a single consolidated Post-Closure Plan that will detail the current post-closure requirements for all active use restrictions (URs) and outlines its implementation and subsequent revision. This strategy will ensure effective management and control of the post-closure sites. There are currently over 200 URs located on the NNSS, NTTR, and TTR. Post-closure requirements were initially established in the Closure Report for each site. In some cases, changes to the post-closure requirements have been implemented through addenda, errata sheets, records of technical change, or letters. Post-closure requirements have been collected from these multiple sources and consolidated into several formats, such as summaries and databases. This structure increases the possibility of inconsistencies and uncertainty. As more URs are established and the post-closure program is expanded, the need for a comprehensive approach for managing the program will increase. Not only should the current requirements be obtainable from a single source that supersedes all previous requirements, but the strategy for modifying the requirements should be standardized. This will enable more effective management of the program into the future. This strategy document and the subsequent comprehensive plan are to be implemented under the assumption that the NNSS and outlying sites will be under the purview of the U.S. Department of Energy, National Nuclear Security Administration for the foreseeable future. This strategy was also developed assuming that regulatory control of the sites remains static. The comprehensive plan is not

  9. The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange.

    Science.gov (United States)

    Qian, Yufeng; Johnson, Kenneth A

    2017-08-04

    The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB-ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB) 30 and (SSB) 60 , defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB) 60 and (SSB) 30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 10 9 m -1 s -1 ) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide

    2015-10-01

    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  11. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2016-05-28

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  12. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy

    2008-01-01

    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  13. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray.

    Science.gov (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino

    2008-08-25

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  14. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Science.gov (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino

    2008-01-01

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  15. A biomarker model of sublethal genotoxicity (DNA single-strand breaks and adducts) using the sentinel organism Aporrectodea longa in spiked soil

    International Nuclear Information System (INIS)

    Martin, Francis L.; Piearce, Trevor G.; Hewer, Alan; Phillips, David H.; Semple, Kirk T.

    2005-01-01

    There is a need to develop risk biomarkers during the remediation of contaminated land. We employed the earthworm, Aporrectodea longa (Ude), to determine whether genotoxicity measures could be applied to this organism's intestinal tissues. Earthworms were added, for 24 h or 7 days, to soil samples spiked with benzo[a]pyrene (B[a]P) and/or lindane. After exposure, intestinal tissues (crop/gizzard or intestine) were removed prior to the measurement in disaggregated cells of DNA single-strand breaks (SSBs) by the alkaline comet assay. Damage was quantified by comet tail length (CTL, μm). B[a]P 24-h exposure induced dose-related increases (P 32 P-postlabelling, showed a two-adduct-spot pattern. This preliminary investigation suggests that earthworm tissues may be incorporated into genotoxicity assays to facilitate hazard identification within terrestrial ecosystems. - Sublethal genotoxicity in the sentinel organism A. longa can be used to monitor the effects of contaminants in soil

  16. Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Krzysztof Lepek

    2015-01-01

    Full Text Available Monitoring and control of infections are key parts of surveillance systems and epidemiological risk prevention. In the case of influenza A viruses (IAVs, which show high variability, a wide range of hosts, and a potential of reassortment between different strains, it is essential to study not only people, but also animals living in the immediate surroundings. If understated, the animals might become a source of newly formed infectious strains with a pandemic potential. Special attention should be focused on pigs, because of the receptors specific for virus strains originating from different species, localized in their respiratory tract. Pigs are prone to mixed infections and may constitute a reservoir of potentially dangerous IAV strains resulting from genetic reassortment. It has been reported that a quadruple reassortant, A(H1N1pdm09, can be easily transmitted from humans to pigs and serve as a donor of genetic segments for new strains capable of infecting humans. Therefore, it is highly desirable to develop a simple, cost-effective, and rapid method for evaluation of IAV genetic variability. We describe a method based on multitemperature single-strand conformational polymorphism (MSSCP, using a fragment of the hemagglutinin (HA gene, for detection of coinfections and differentiation of genetic variants of the virus, difficult to identify by conventional diagnostic.

  17. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against the Pesticide Fipronil and Sensitive Detection in River Water

    Directory of Open Access Journals (Sweden)

    Ka L. Hong

    2017-12-01

    Full Text Available Fipronil is a commonly used insecticide that has been shown to have environmental and human health risks. The current standard methods of detection for fipronil and its metabolites, such as GC-MS, are time consuming and labor intensive. In this study, a variant of systematic evolution of ligands by exponential enrichment (SELEX, was utilized to identify the first single-stranded DNA (ssDNA molecular recognition element (MRE that binds to fipronil with high affinity (Kd = 48 ± 8 nM. The selected MRE displayed low cross binding activity on various environmentally relevant, structurally unrelated herbicides and pesticides, in addition to broad-spectrum binding activity on major metabolites of fipronil and a structurally similar pesticide in prepared river samples. Additionally, a proof-of-principle fluorescent detection assay was developed by using the selected ssDNA MRE as a signal-reporting element, with a limit of detection of 105 nM in a prepared river water sample.

  18. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Boye, E.; Johansen, I.; Brustad, T.

    1976-01-01

    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 2 0 C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 2 0 C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  19. Clonal origin of multiple lung cancers: K-ras and p53 mutations determined by nonradioisotopic single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Lau, D H; Yang, B; Hu, R; Benfield, J R

    1997-08-01

    Disease stage is the most important factor in determining prognosis and treatment of lung cancer. Staging of lung cancer is complicated by presentation of multiple pulmonary malignant lesions with a similar histology. It is a dilemma to decide if these lesions are synchronous primaries arising from different malignant clones or metastases from a single clone. Lung cancer is associated with multiple genetic abnormalities including mutations of K-ras and p53, which are believed to occur prior to onset of metastasis. To determine the clonal origin of multiple pulmonary malginant nodules, we analyzed point-mutations of K-ras and p53 by microdissection, polymerase chain reactions (PCR), nonradioisotopic single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. Each pulmonary lesion was microdissected from paraffin slides. Genomic DNA was amplified by two sequential PCRs followed by electrophoresis in a minigel and silver staining. Deoxyribonucleic acid sequencing was performed if necessary to confirm a mutation found upon SSCP analysis. Applying this molecular approach, we were able to differentiate the clonal origins of multiple malignant nodules of the lung as exemplified by the two cases presented.

  20. Simultaneous identification of seven foodborne pathogens and Escherichia coli (pathogenic and nonpathogenic) using capillary electrophoresis-based single-strand conformation polymorphism coupled with multiplex PCR.

    Science.gov (United States)

    Oh, Mi-Hwa; Paek, Se-Hee; Shin, Gi Won; Kim, Hae-Yeong; Jung, Gyoo Yeol; Oh, Sangsuk

    2009-06-01

    The objective of this study was to develop a novel technique for parallel analysis of eight important foodborne microbes using capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) coupled with multiplex PCR. Specific primers for multiplex PCR amplification of the 16S rRNA gene were designed, corresponding to eight species of bacteria, including Escherichia coli, Clostridium perfringens, Campylobacter jejuni, Salmonella enterica, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Bacillus cereus, for the species-specific identification and optimal separation of their PCR products in subsequent analysis by CE-SSCP. Multiplex PCR conditions including annealing temperature, extension time, the number of PCR cycles, and primer concentrations were then optimized for simultaneous detection of all target foodborne bacteria. The diagnostic system using CE-SSCP combined with multiplex PCR developed here can be used for rapid investigation of causative agents of foodborne illness. The simplicity and high sensitivity of the method may lead to improved management of safety and illness related to food.

  1. Selection and Characterization of Single-Stranded DNA Aptamers Binding Human B-Cell Surface Protein CD20 by Cell-SELEX

    Directory of Open Access Journals (Sweden)

    Mansoureh Haghighi

    2018-03-01

    Full Text Available The B-lymphocyte antigen (CD20 is a suitable target for single-stranded (ss nucleic acid oligomer (aptamers. The aim of study was selection and characterization of a ssDNA aptamer against CD20 using Cell-Systematic Evolution of Ligands by Exponential Enrichment (Cell-SELEX. The cDNA clone of CD20 (pcDNA-CD20 was transfected to human embryonic kidney (HEK293T cells. Ten rounds of Cell-SELEX was performed on recombinant HEK-CD20 cells. The final eluted ssDNA pool was amplified and ligated in T/A vector for cloning. The plasmids of positive clones were extracted, sequenced and the secondary structures of the aptamers predicted using DNAMAN® software. The sequencing results revealed 10 different types; three of them had the highest thermodynamic stability, named AP-1, AP-2 and AP-3. The AP-1 aptamer was the most thermodynamically stable one (ΔGAP-1 = −10.87 kcal/mol with the highest binding affinity to CD20 (96.91 ± 4.5 nM. Since, the CD20 is a suitable target for recognition of B-Cell. The selected aptamers could be comparable to antibodies with many advantages. The AP-1, AP-2 and AP-3 could be candidate instead of antibodies for diagnostic and therapeutic applications in immune deficiency, autoimmune diseases, leukemia and lymphoma.

  2. Integrative modelling coupled with ion mobility mass spectrometry reveals structural features of the clamp loader in complex with single-stranded DNA binding protein.

    Science.gov (United States)

    Politis, Argyris; Park, Ah Young; Hall, Zoe; Ruotolo, Brandon T; Robinson, Carol V

    2013-11-29

    DNA polymerase III, a decameric 420-kDa assembly, simultaneously replicates both strands of the chromosome in Escherichia coli. A subassembly of this holoenzyme, the seven-subunit clamp loader complex, is responsible for loading the sliding clamp (β2) onto DNA. Here, we use structural information derived from ion mobility mass spectrometry (IM-MS) to build three-dimensional models of one form of the full clamp loader complex, γ3δδ'ψχ (254 kDa). By probing the interaction between the clamp loader and a single-stranded DNA (ssDNA) binding protein (SSB4) and by identifying two distinct conformational states, with and without ssDNA, we assemble models of ψχ-SSB4 (108 kDa) and the clamp loader-SSB4 (340 kDa) consistent with IM data. A significant increase in measured collision cross-section (~10%) of the clamp loader-SSB4 complex upon DNA binding suggests large conformational rearrangements. This DNA bound conformation represents the active state and, along with the presence of ψχ, stabilises the clamp loader-SSB4 complex. Overall, this study of a large heteromeric complex analysed by IM-MS, coupled with integrative modelling, highlights the potential of such an approach to reveal structural features of previously unknown complexes of high biological importance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Polymorphic restriction sites in the horse beta-globin gene cluster.

    Science.gov (United States)

    Rando, A; Di Gregorio, P; Masina, P

    1986-01-01

    Horse DNA samples digested with PstI and probed with the rabbit beta 1 globin gene show three phenotypes determined by one fragment of variable length (about 5.1 or 3.3 kb). Family data demonstrate that these fragments segregate as Mendelian alleles. The frequencies of the two alleles are 0.66 for the 3.3-kb fragment and 0.34 for the 5.1-kb one. Another polymorphism has been detected with BamHI. Again three phenotypes determined by two alleles (fragments of 7.5 and 3.8 kb) have been observed. Allelic frequencies of the 7.5- and 3.8-kb fragments are 0.24 and 0.76 respectively. The two polymorphic sites are non-randomly associated.

  4. Development of Insertion and Deletion Markers for Bottle Gourd Based on Restriction Site-associated DNA Sequencing Data

    Directory of Open Access Journals (Sweden)

    Xinyi WU

    2017-01-01

    Full Text Available Bottle gourd is an important cucurbit crop worldwide. To provide more available molecular markers for this crop, a bioinformatic approach was employed to develop insertion–deletions (InDels markers in bottle gourd based on restriction site-associated DNA sequencing (RAD-Seq data. A total of 892 Indels were predicted, with the length varying from 1 bp to 167 bp. Single-nucleotide InDels were the predominant types of InDels. To validate these InDels, PCR primers were designed from 162 loci where InDels longer than 2 bp were predicated. A total of 112 InDels were found to be polymorphic among 9 bottle gourd accessions under investigation. The rate of prediction accuracy was thus at a high level of 72.7%. DNA fingerprinting for 4 cultivars were performed using 8 selected Indels markers, demonstrating the usefulness of these markers.

  5. porphyrin with single strand DNAs

    Indian Academy of Sciences (India)

    for organization of porphyrin molecules into extended assemblies, providing opportunities for construction of supramolecular structures.6–8 Among the porphyrin .... and consequently the mono- and bi-exponential nature of the decays were judged by the reduced chi-square. (χ2) values and distribution of the weighted ...

  6. Construction of a high-density genetic map for grape using next generation restriction-site associated DNA sequencing

    Directory of Open Access Journals (Sweden)

    Wang Nian

    2012-08-01

    Full Text Available Abstract Background Genetic mapping and QTL detection are powerful methodologies in plant improvement and breeding. Construction of a high-density and high-quality genetic map would be of great benefit in the production of superior grapes to meet human demand. High throughput and low cost of the recently developed next generation sequencing (NGS technology have resulted in its wide application in genome research. Sequencing restriction-site associated DNA (RAD might be an efficient strategy to simplify genotyping. Combining NGS with RAD has proven to be powerful for single nucleotide polymorphism (SNP marker development. Results An F1 population of 100 individual plants was developed. In-silico digestion-site prediction was used to select an appropriate restriction enzyme for construction of a RAD sequencing library. Next generation RAD sequencing was applied to genotype the F1 population and its parents. Applying a cluster strategy for SNP modulation, a total of 1,814 high-quality SNP markers were developed: 1,121 of these were mapped to the female genetic map, 759 to the male map, and 1,646 to the integrated map. A comparison of the genetic maps to the published Vitis vinifera genome revealed both conservation and variations. Conclusions The applicability of next generation RAD sequencing for genotyping a grape F1 population was demonstrated, leading to the successful development of a genetic map with high density and quality using our designed SNP markers. Detailed analysis revealed that this newly developed genetic map can be used for a variety of genome investigations, such as QTL detection, sequence assembly and genome comparison.

  7. Construction of a high-density genetic map for grape using next generation restriction-site associated DNA sequencing.

    Science.gov (United States)

    Wang, Nian; Fang, Linchuan; Xin, Haiping; Wang, Lijun; Li, Shaohua

    2012-08-21

    Genetic mapping and QTL detection are powerful methodologies in plant improvement and breeding. Construction of a high-density and high-quality genetic map would be of great benefit in the production of superior grapes to meet human demand. High throughput and low cost of the recently developed next generation sequencing (NGS) technology have resulted in its wide application in genome research. Sequencing restriction-site associated DNA (RAD) might be an efficient strategy to simplify genotyping. Combining NGS with RAD has proven to be powerful for single nucleotide polymorphism (SNP) marker development. An F1 population of 100 individual plants was developed. In-silico digestion-site prediction was used to select an appropriate restriction enzyme for construction of a RAD sequencing library. Next generation RAD sequencing was applied to genotype the F1 population and its parents. Applying a cluster strategy for SNP modulation, a total of 1,814 high-quality SNP markers were developed: 1,121 of these were mapped to the female genetic map, 759 to the male map, and 1,646 to the integrated map. A comparison of the genetic maps to the published Vitis vinifera genome revealed both conservation and variations. The applicability of next generation RAD sequencing for genotyping a grape F1 population was demonstrated, leading to the successful development of a genetic map with high density and quality using our designed SNP markers. Detailed analysis revealed that this newly developed genetic map can be used for a variety of genome investigations, such as QTL detection, sequence assembly and genome comparison.

  8. C.U.R.R.F. (Codon Usage regarding Restriction Finder): a free Java(®)-based tool to detect potential restriction sites in both coding and non-coding DNA sequences.

    Science.gov (United States)

    Gatter, Michael; Gatter, Thomas; Matthäus, Falk

    2012-10-01

    The synthesis of complete genes is becoming a more and more popular approach in heterologous gene expression. Reasons for this are the decreasing prices and the numerous advantages in comparison to classic molecular cloning methods. Two of these advantages are the possibility to adapt the codon usage to the host organism and the option to introduce restriction enzyme target sites of choice. C.U.R.R.F. (Codon Usage regarding Restriction Finder) is a free Java(®)-based software program which is able to detect possible restriction sites in both coding and non-coding DNA sequences by introducing multiple silent or non-silent mutations, respectively. The deviation of an alternative sequence containing a desired restriction motive from the sequence with the optimal codon usage is considered during the search of potential restriction sites in coding DNA and mRNA sequences as well as protein sequences. C.U.R.R.F is available at http://www.zvm.tu-dresden.de/die_tu_dresden/fakultaeten/fakultaet_mathematik_und_naturwissenschaften/fachrichtung_biologie/mikrobiologie/allgemeine_mikrobiologie/currf.

  9. A restriction site to differentiate Plasmodium and Haemoproteus infections in birds: on the inefficiency of general primers for detection of mixed infections.

    Science.gov (United States)

    Martínez, J; Martínez-DE LA Puente, J; Herrero, J; Del Cerro, S; Lobato, E; Rivero-DE Aguilar, J; Vásquez, R A; Merino, S

    2009-06-01

    Avian Plasmodium and Haemoproteus parasites are easily detected by DNA analyses of infected samples but only correctly assigned to each genus by sequencing and use of a phylogenetic approach. Here, we present a restriction site to differentiate between both parasite genera avoiding the use of those analyses. Alignments of 820 sequences currently listed in GenBank encoding a particular cytochrome B region of avian Plasmodium and Haemoproteus show a shared restriction site for both genera using the endonuclease Hpy CH4III. An additional restriction site is present in Plasmodium sequences that would initially allow differentiation of both genera by differential migration of digested products on gels. Overall 9 out of 326 sequences containing both potential restriction sites do not fit to the general rule. We used this differentiation of parasite genera based on Hpy CH4III restriction sites to evaluate the efficacy of 2 sets of general primers in detecting mixed infections. To do so, we used samples from hosts infected by parasites of both genera. The use of general primers was only able to detect 25% or less of the mixed infections. Therefore, parasite DNA amplification using general primers to determine the species composition of haemosporidian infections in individual hosts is not recommended. Specific primers for each species and study area should be designed until a new method can efficiently discriminate both parasites.

  10. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA.

    Science.gov (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S

    2000-09-20

    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  11. Flow cytometry analysis of single-strand DNA damage in neuroblastoma cell lines using the F7-26 monoclonal antibody.

    Science.gov (United States)

    Grigoryan, Rita S; Yang, Bo; Keshelava, Nino; Barnhart, Jerry R; Reynolds, C Patrick

    2007-11-01

    The F7-26 monoclonal antibody (Mab) has been reported to be specific for single-strand DNA damage (ssDNA) and to also identify cells in apoptosis. We carriedout studies to determine if F7-26 binding measured by flow cytometry was able to specifically identify exogenous ssDNA as opposed to DNA damage from apoptosis. Neuroblastoma cells were treated with melphalan (L-PAM), fenretinide, 4-hydroperoxycyclophosphamide (4-HC)+/-pan-caspase inhibitor BOC-d-fmk, topotecan or with 10Gy gamma radiation+/-hydrogen peroxide (H2O2) and fixed immediately postradiation. Cytotoxicity was measured by DIMSCAN digital imaging fluorescence assay. The degree of ssDNA damage was analyzed by flow cytometry using Mab F7-26, with DNA visualized by propidium iodide counterstaining. Flow cytometry was used to measure apoptosis detected by terminal deoxynucleotidyltransferase (TUNEL) assay and reactive oxygen species (ROS) by carboxy-dichlorofluorescein diacetate. Irradiated and immediately fixed neuroblastoma cells showed increased ssDNA, but not apoptosis by TUNEL (TUNEL-negative). 4-HC or L-PAM+/-BOC-d-fmk increased ssDNA (F7-26-positive), but BOC-d-fmk prevented TUNEL staining. Fenretinide increased apoptosis by TUNEL but not ssDNA damage detected with F7-26. Enhanced ssDNA in neuroblastoma cells treated with radiation+H2O2 was associated with increased ROS. Topotecan increased both ssDNA and cytotoxicity in 4-HC-treated cells. These data demonstrate that Mab F7-26 recognized ssDNA due to exogenous DNA damage, rather than apoptosis. This assay should be useful to characterize the mechanism of action of antineoplastic drugs. Copyright (c) 2007 International Society for Analytical Cytology.

  12. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani

    2006-09-01

    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  13. Detection of p53 mutations by single-strand conformation polymorphisms (SSCP) gel electrophoresis. A comparative study of radioactive and nonradioactive silver-stained SSCP analysis.

    Science.gov (United States)

    Bosari, S; Marchetti, A; Buttitta, F; Graziani, D; Borsani, G; Loda, M; Bevilacqua, G; Coggi, G

    1995-12-01

    p53 mutations are the most common genetic abnormality in humans tumors, but their clinical significance remains to be precisely elucidated. Conventional single-strand conformation polymorphism (SSCP) analysis, a well-established technique for detecting p53 mutations, uses radioactively labeled polymerase chain reaction (PCR) products, which migrate abnormally in the presence of mutations. We performed radioactive PCR-SSCP analysis in a series of 30 formalin-fixed, paraffin-embedded ovarian carcinomas and two cell lines (SW480 and Caov4) harboring known homozygous p53 mutations and compared the results with nonradioactive silver-stained SSCP. The purpose was to assess whether nonradioactive SSCP is suitable for detecting p53 mutations in a rapid, sensitive, cost-effective fashion, without the need of radioactive isotopes. We accomplished PCR amplification of p53 exons 5 through 8 in 26 carcinomas, and radioactive SSCP detected p53 mutations in 13 tumors; three mutations were localized in exon 5, six in exon 6, two in exon 7, and two in exon 8. All mutations were correctly identified with nonradioactive SSCP, except for one exon 8 mutation. To establish the sensitivity of nonradioactive SSCP, DNA samples of SW480 and Caov4 were mixed with increasing amounts (0-90%) of normal DNA and subjected to PCR-SSCP analysis. Mutations were detected until the concentration of SW480 and Caov4 was 15% and 10%, respectively, of the total sample. The results of our investigation demonstrate that nonradioactive silver-stained SSCP is a sensitive, rapid, and simple technique to detect p53 mutations, even in formalin-fixed tissues, and could be easily used to investigate large series of patients to assess the clinical significance of p53 mutations in human tumors.

  14. Ampelomyces mycoparasites from apple powdery mildew identified as a distinct group based on single-stranded conformation polymorphism analysis of the rDNA ITS region.

    Science.gov (United States)

    Szentiványi, Orsolya; Kiss, Levente; Russell, John C; Kovács, Gábor M; Varga, Krisztina; Jankovics, Tünde; Lesemann, Silke; Xu, Xiang-Ming; Jeffries, Peter

    2005-04-01

    Pycnidial fungi belonging to the genus Ampelomyces are the most common natural antagonists of powdery mildews worldwide. During a study of the interactions between apple powdery mildew (Podosphaera leucotricha) and Ampelomyces mycoparasites, 52 new Ampelomyces isolates were obtained from P. leucotricha and, in addition, 13 new isolates from other species of the Erysiphaceae in four European countries. Their genetic diversity was screened using single-stranded conformation polymorphism (SSCP) analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). For comparison, 24 isolates obtained from genetic resource collections or other sources were included in this study. Based on the ITS-SSCP patterns, the isolates were placed in eight groups. The isolates belonged to two types based on their growth in culture. The faster-growing and the slower-growing isolates were included in different SSCP groups. A phylogenetic analysis of the ITS sequences of representatives of these groups confirmed the results obtained with the SSCP method, and showed that the faster-growing isolates do not belong to Ampelomyces as suggested by earlier studies. All the isolates from P. leucotricha fell into a distinct SSCP group of genetically homogeneous isolates. This suggests that Ampelomyces mycoparasites which occur in apple powdery mildew are slightly different from the other Ampelomyces groups which contain mycoparasites from various powdery mildew species. This may be because the main growth period of Ampelomyces mycoparasites in apple powdery mildew is isolated in time from that of Ampelomyces isolates that occur in other species of the Erysiphaceae. P. leucotricha starts its life-cycle early in the season, usually in March-April, while most powdery mildews are active in the same environments only late in the year.

  15. Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody: a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody.

    Science.gov (United States)

    Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua

    2018-02-01

    Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.

  16. Variabilidad genética de Aedes aegypti en algunas áreas del Perú usando Single Stranded Conformational Polymorphism (SSCP

    Directory of Open Access Journals (Sweden)

    Nélida Leiva G

    2004-07-01

    Full Text Available Aedes aegypti es el vector responsable de la transmisión del virus del dengue, su distribución geográfica se ha ampliado rápidamente debido principalmente a la intervención de los seres humanos. Objetivo: Analizar la variabilidad genética de este mosquito mediante la comparación del Segundo Espaciador Transcrito Interno (ITS 2 perteneciente al ADN ribosomal (rADN. Materiales y Métodos: Se analizaron muestras de ocho localidades (Jaén, Tingo María, Iquitos, Lambayeque, el distrito de El Rimac, Sullana y Zarumilla y uno de la provincia de Huaquillas (Ecuador. El análisis de la variabilidad se determinó usando la técnica conocida como SSCP (Single Stranded Conformation Polymorphism. Resultados: El estudio muestra que existe variabilidad genética entre las poblaciones analizadas, principalmente entre las muestras localizadas en la costa del Perú (Zarumilla, El Rímac, Sullana y Huaquillas y las muestras del nororiente (Tingo María, Iquitos, Jaén y Lambayeque Conclusión: Se determinaron dos variantes genéticas entre las poblaciones de Aedes aegypti: Costeña y Nororiental, que probablemente provienen de dos ancestros diferentes y cuyo ancestro común sufrió de aislamiento por distancia. Se observó que no existe relación entre las distancias genéticas y las distancias geográficas indicando que la migración de estas poblaciones es el resultado de la intervención de los seres humanos que diseminan al vector y no por la migración activa del mosquito. Se plantea el papel de la Cordillera de los Andes en la migración y separación de las poblaciones de Aedes.

  17. Detection of hybridization of single-strand DNA PCR products in temperature change process by a novel metal-clamping piezoelectric sensor.

    Science.gov (United States)

    Chen, Qinghai; Bian, Zhiheng; Hua, Xing; Yao, Chunyan; Wu, Wei; Zhang, Xue; Zhang, Bo; Huang, Junfu; Tang, Wanli; Fu, Weiling

    2010-05-15

    Oligonucleotide probes on the sensor surface can be hybridized with single-strand DNA (ssDNA) that is formed from PCR products in ice bath after degeneration. Thus, detection of PCR products by piezoelectric sensors requires the participation of ssDNA PCR products in ice bath. When PCR products in ice bath are added into the buffer of the sensor well at room temperature, there will be a temperature change process during mixing. However, it still remains unclear whether the temperature change affects the frequency baseline stability of the sensor and the result judgment, which is the basic condition for detecting hybridization of nucleic acid. In this study, we detected the hybridization of HPV PCR products during temperature change process by a self-designed adjustable metal-clamping piezoelectric sensor. The study mainly involves sensor adjustment, probe immobilization and ice bath sample addition (at different concentrations and different volumes). The response curve of basic frequency in temperature change process showed three stages, i.e., increase, decrease to baseline, and continuous decrease to stability. The early increase of frequency and duration of the time can reach 55+/-7.4 Hz and 39 min when 40 microL sample (0-1 degrees C) was added into 110 microL buffer (25 degrees C). The frequency increase effect caused by temperature difference at early stage depends on the volume ratio of two liquids and on the temperature difference. The results indicate that we should pay more attention to possibly small volume of PCR products in ice bath and minor temperature difference of two liquids in operation. 2010 Elsevier B.V. All rights reserved.

  18. Gauging the Nanotoxicity of h2D-C2N toward Single-Stranded DNA: An in Silico Molecular Simulation Approach.

    Science.gov (United States)

    Mukhopadhyay, Titas Kumar; Bhattacharyya, Kalishankar; Datta, Ayan

    2018-04-12

    Recent toxicological assessments of graphene, graphene oxides, and some other two-dimensional (2D) materials have shown them to be substantially toxic at the nanoscale, where they inhibit and eventually disrupt biological processes. These shortfalls of graphene and analogs have resulted in a quest for novel biocompatible 2D materials with minimum cytotoxicity. In this article, we demonstrate C 2 N (h2D-C 2 N), a newly synthesized 2D porous graphene analog, to be non-nanotoxic toward genetic materials from an "in-silico" point of view through sequence-dependent binding of different polynucleotide single-stranded DNA (ssDNA) onto it. The calculated binding energy of nucleobases and the free energy of binding of polynucleotides follow the common trait, cytosine > guanine > adenine > thymine, and are well within the limits of physisorption. Ab-initio simulations completely exclude the possibility of any chemical reaction, demonstrating purely noncovalent binding of nucleobases with C 2 N through a crucial interplay between hydrogen bonding and π-stacking interactions with the surface. Further, we show that the extent of distortion inflicted upon ssDNA by C 2 N is negligible. Analysis of the density of states of the nucleobase-C 2 N hybrids confirms minimum electronic perturbation of the bases after adsorption. Most importantly, we demonstrate the potency of C 2 N in nucleic acid transportation via reversible binding of ssDNA. The plausible use of C 2 N as a template for DNA repair is illustrated through an example of C 2 N-assisted complementary ssDNA winding.

  19. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms.

    Science.gov (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A

    2012-05-01

    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    Science.gov (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Breaking RAD: an evaluation of the utility of restriction site-associated DNA sequencing for genome scans of adaptation.

    Science.gov (United States)

    Lowry, David B; Hoban, Sean; Kelley, Joanna L; Lotterhos, Katie E; Reed, Laura K; Antolin, Michael F; Storfer, Andrew

    2017-03-01

    Understanding how and why populations evolve is of fundamental importance to molecular ecology. Restriction site-associated DNA sequencing (RADseq), a popular reduced representation method, has ushered in a new era of genome-scale research for assessing population structure, hybridization, demographic history, phylogeography and migration. RADseq has also been widely used to conduct genome scans to detect loci involved in adaptive divergence among natural populations. Here, we examine the capacity of those RADseq-based genome scan studies to detect loci involved in local adaptation. To understand what proportion of the genome is missed by RADseq studies, we developed a simple model using different numbers of RAD-tags, genome sizes and extents of linkage disequilibrium (length of haplotype blocks). Under the best-case modelling scenario, we found that RADseq using six- or eight-base pair cutting restriction enzymes would fail to sample many regions of the genome, especially for species with short linkage disequilibrium. We then surveyed recent studies that have used RADseq for genome scans and found that the median density of markers across these studies was 4.08 RAD-tag markers per megabase (one marker per 245 kb). The length of linkage disequilibrium for many species is one to three orders of magnitude less than density of the typical recent RADseq study. Thus, we conclude that genome scans based on RADseq data alone, while useful for studies of neutral genetic variation and genetic population structure, will likely miss many loci under selection in studies of local adaptation. © 2016 John Wiley & Sons Ltd.

  3. Peculiarities of the interaction of the restriction endonuclease BspD6I with DNA containing its recognition site.

    Science.gov (United States)

    Abrosimova, Liudmila A; Kubareva, Elena A; Migur, Anzhela Yu; Gavshina, Aleksandra V; Ryazanova, Aleksandra Yu; Norkin, Maxim V; Perevyazova, Tatiana A; Wende, Wolfgang; Hianik, Tibor; Zheleznaya, Liudmila A; Oretskaya, Tatiana S

    2016-09-01

    Nicking endonucleases are enzymes that recognize specific sites in double-stranded DNA and cleave only one strand at a predetermined position. These enzymes are involved in DNA replication and repair; they can also function as subunits of bacterial heterodimeric restriction endonucleases. One example of such a proteins is the restriction endonuclease BspD6I (R.BspD6I) from Bacillus species strain D6, which consists of the large subunit - nicking endonuclease BspD6I (Nt.BspD6I), and the small subunit (ss.BspD6I). Nt.BspD6I can function independently. Similar enzymes are now widely used in numerous biotechnological applications. The aim of this study was to investigate the fundamental properties of two subunits of R.BspD6I and their interdependence in the course of R.BspD6I activity. The binding and hydrolysis of DNA duplexes by R.BspD6I are primary analyzed by gel electrophoresis. To elucidate the difference between Nt.BspD6I interaction with the substrate and product of hydrolysis, the thickness shear mode acoustic method is used. The thermodynamic and kinetic parameters of the Nt.BspD6I interaction with DNA are determined. For the first time we demonstrated that Nt.BspD6I bends the DNA during complex formation. Nt.BspD6I is able to form complexes with the product nicked in the top strand and ss.BspD6I cleaves the bottom strand of the DNA consecutively. Furthermore, the influence of dA methylation in the R.BspD6I recognition site on ss.BspD6I activity is analyzed. The obtained results provide evidence that Nt.BspD6I coordinates the activity of R.BspD6I by strictly coupling of the bottom strand cleavage by ss.BspD6I to the top strand cleavage. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. DNA of a circular minichromosome linearized by restriction enzymes or other reagents is resistant to further cleavage: an influence of chromatin topology on the accessibility of DNA.

    Science.gov (United States)

    Kumala, Sławomir; Hadj-Sahraoui, Yasmina; Rzeszowska-Wolny, Joanna; Hancock, Ronald

    2012-10-01

    The accessibility of DNA in chromatin is an essential factor in regulating its activities. We studied the accessibility of the DNA in a ∼170 kb circular minichromosome to DNA-cleaving reagents using pulsed-field gel electrophoresis and fibre-fluorescence in situ hybridization on combed DNA molecules. Only one of several potential sites in the minichromosome DNA was accessible to restriction enzymes in permeabilized cells, and in growing cells only a single site at an essentially random position was cut by poisoned topoisomerase II, neocarzinostatin and γ-radiation, which have multiple potential cleavage sites; further sites were then inaccessible in the linearized minichromosomes. Sequential exposure to combinations of these reagents also resulted in cleavage at only a single site. Minichromosome DNA containing single-strand breaks created by a nicking endonuclease to relax any unconstrained superhelicity was also cut at only a single position by a restriction enzyme. Further sites became accessible after ≥95% of histones H2A, H2B and H1, and most non-histone proteins were extracted. These observations suggest that a global rearrangement of the three-dimensional packing and interactions of nucleosomes occurs when a circular minichromosome is linearized and results in its DNA becoming inaccessible to probes.

  5. A molecular switch sensor for detection of PRSS1 genotype based on site-specific DNA cleavage of restriction endonuclease.

    Science.gov (United States)

    Liu, Qicai; Gao, Feng; Weng, Shaohuang; Peng, Huaping; Lin, Liqing; Zhao, Chengfei; Lin, Xinhua

    2015-01-01

    PRSS1 mutations or polymorphism in the peripheral blood of patients can be used as susceptible molecular markers to pancreatic cancer. A sensor for selective electrochemical detection of PRSS1 genotypes was developed based on site-specific DNA cleavage of restriction endonuclease EcoRI. A mercapto-modified hairpin probe was immobilized on a gold electrode. The probe's neck can be cleaved by EcoRI in the absence of rs10273639 C/C of PRSS1 genotype, but it cannot be cleaved in the presence of T/T. The difference in quantity of electric charge was monitored by biosensors before and after enzymatic cleavage. Electrochemical signals are generated by differential pulse voltammetry interrogation of methylene blue (MB) that quantitatively binds to surface-confined hairpin probe via electrostatic interactions. The results suggested this method had a good specificity in distinguishing PRSS1 genotypes. There was a good linear relationship between the charge and the logarithmic function of PRSS1 rs10273639 T/T type DNA concentration (current=120.6303+8.8512log C, R=0.9942). The detection limit was estimated at 0.5 fM. The molecular switch sensor has several advantages, and it is possible to qualitatively, quantitatively, and noninvasively detect PRSS1 genotypes in the blood of patients with pancreatic cancer. © 2015 by the Association of Clinical Scientists, Inc.

  6. Reference-free SNP discovery for the Eurasian beaver from restriction site-associated DNA paired-end data.

    Science.gov (United States)

    Senn, Helen; Ogden, Rob; Cezard, Timothee; Gharbi, Karim; Iqbal, Zamin; Johnson, Eric; Kamps-Hughes, Nick; Rosell, Frank; McEwing, Ross

    2013-06-01

    In this study, we used restriction site-associated DNA (RAD) sequencing to discover SNP markers suitable for population genetic and parentage analysis with the aim of using them for monitoring the reintroduction of the Eurasian beaver (Castor fibre) to Scotland. In the absence of a reference genome for beaver, we built contigs and discovered SNPs within them using paired-end RAD data, so as to have sufficient flanking region around the SNPs to conduct marker design. To do this, we used a simple pipeline which catalogued the Read 1 data in stacks and then used the assembler cortex_var to conduct de novo assembly and genotyping of multiple samples using the Read 2 data. The analysis of around 1.1 billion short reads of sequence data was reduced to a set of 2579 high-quality candidate SNP markers that were polymorphic in Norwegian and Bavarian beaver. Both laboratory validation of a subset of eight of the SNPs (1.3% error) and internal validation by confirming patterns of Mendelian inheritance in a family group (0.9% error) confirmed the success of this approach. © 2013 John Wiley & Sons Ltd.

  7. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W

    2009-12-23

    Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation

  8. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  9. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  10. Contribution of single-strand breaks and alkali-labile bonds to the loss of infectivity of γ-irradiated phiX174 RF-DNA in E. coli cells mutant in various repair functions

    International Nuclear Information System (INIS)

    McKee, R.H.

    1975-01-01

    Twenty-one radiation sensitive mutants have been examined for their capacity to support gamma-irradiated phiX174 RF-DNA. The survival of phiX174 RF-DNA was reduced in essentially all of the sensitive mutants. The irradiated phiX174 RF-DNA was then separated into populations containing either single-strand breaks or alkali-labile bonds to examine the capacity of the mutants to repair each of the classes of lesions. It was found that all E. coli strains are unable to repair 22 percent of the single-strand breaks and all sensitive mutants are unable to repair an additional 10 percent of the breaks. All the repair functions examined are involved in single-strand break repair and none are more or less necessary than any of the others. PhiX174 RF-DNA is also inactivated by alkali-labile bonds. In the normal strains the inactivation efficiency is 0.16 lethal events per lesion with a threshold dose of 15 to 20 krads. The mutants are divided into two classes by their sensitivity to alkali-labile bonds. Both classes of mutants are also inactivated by alkali-labile bonds with efficiencies of about 0.17 and 0.29 lethal events per lesion, respectively. It is proposed that the differences seen in survival curves of phiX174 measured in the sensitive mutants is due to this difference. Although in normal cells the efficiency of inactivation of phiX174 by single-strand breaks is 50 percent greater than by alkali-labile bonds, alkali-labile bonds are produced at approximately twice the rate of single-strand breaks so alkali-labile bonds account for about 61 percent of the overall inactivation. In the mutants of least sensitivity alkali-labile bonds account for about 54 percent of the inactivating events and in the most sensitive about 67 percent

  11. The proviral genome of radiation leukemia virus (RadLV): molecular cloning, restriction analysis and integration sites in tumor cell DNA

    International Nuclear Information System (INIS)

    Janowski, M.; Merregaert, J.; Nuyten, J.M.; Maisin, J.R.

    1984-01-01

    An infectious clone of the linear, unintegrated RadLV provirus was obtained by insertion in the plasmid pBR322. Its restriction map was indistinguishable from that of the majority of the multiple proviral copies, which are found apparently at random sites in the DNA of RadLV-induced rat thymic lymphomas [fr

  12. Characterization of a Novel Megabirnavirus from Sclerotinia sclerotiorum Reveals Horizontal Gene Transfer from Single-Stranded RNA Virus to Double-Stranded RNA Virus.

    Science.gov (United States)

    Wang, Minghong; Wang, Yong; Sun, Xiangzhong; Cheng, Jiasen; Fu, Yanping; Liu, Huiquan; Jiang, Daohong; Ghabrial, Said A; Xie, Jiatao

    2015-08-01

    Mycoviruses have been detected in all major groups of filamentous fungi, and their study represents an important branch of virology. Here, we characterized a novel double-stranded RNA (dsRNA) mycovirus, Sclerotinia sclerotiorum megabirnavirus 1 (SsMBV1), in an apparently hypovirulent strain (SX466) of Sclerotinia sclerotiorum. Two similarly sized dsRNA segments (L1- and L2-dsRNA), the genome of SsMBV1, are packaged in rigid spherical particles purified from strain SX466. The full-length cDNA sequence of L1-dsRNA/SsMBV1 comprises two large open reading frames (ORF1 and ORF2), which encode a putative coat protein and an RNA-dependent RNA polymerase (RdRp), respectively. Phylogenetic analysis of the RdRp domain clearly indicates that SsMBV1 is related to Rosellinia necatrix megabirnavirus 1 (RnMBV1). L2-dsRNA/SsMBV1 comprises two nonoverlapping ORFs (ORFA and ORFB) encoding two hypothetical proteins with unknown functions. The 5'-terminal regions of L1- and L2-dsRNA/SsMBV1 share strictly conserved sequences and form stable stem-loop structures. Although L2-dsRNA/SsMBV1 is dispensable for replication, genome packaging, and pathogenicity of SsMBV1, it enhances transcript accumulation of L1-dsRNA/SsMBV1 and stability of virus-like particles (VLPs). Interestingly, a conserved papain-like protease domain similar to a multifunctional protein (p29) of Cryphonectria hypovirus 1 was detected in the ORFA-encoded protein of L2-dsRNA/SsMBV1. Phylogenetic analysis based on the protease domain suggests that horizontal gene transfer may have occurred from a single-stranded RNA (ssRNA) virus (hypovirus) to a dsRNA virus, SsMBV1. Our results reveal that SsMBV1 has a slight impact on the fundamental biological characteristics of its host regardless of the presence or absence of L2-dsRNA/SsMBV1. Mycoviruses are widespread in all major fungal groups, and they possess diverse genomes of mostly ssRNA and dsRNA and, recently, circular ssDNA. Here, we have characterized a novel dsRNA virus

  13. Characterisation of QTL-linked and genome-wide restriction site-associated DNA (RAD markers in farmed Atlantic salmon

    Directory of Open Access Journals (Sweden)

    Houston Ross D

    2012-06-01

    Full Text Available Abstract Background Restriction site-associated DNA sequencing (RAD-Seq is a genome complexity reduction technique that facilitates large-scale marker discovery and genotyping by sequencing. Recent applications of RAD-Seq have included linkage and QTL mapping with a particular focus on non-model species. In the current study, we have applied RAD-Seq to two Atlantic salmon families from a commercial breeding program. The offspring from these families were classified into resistant or susceptible based on survival/mortality in an Infectious Pancreatic Necrosis (IPN challenge experiment, and putative homozygous resistant or susceptible genotype at a major IPN-resistance QTL. From each family, the genomic DNA of the two heterozygous parents and seven offspring of each IPN phenotype and genotype was digested with the SbfI enzyme and sequenced in multiplexed pools. Results Sequence was obtained from approximately 70,000 RAD loci in both families and a filtered set of 6,712 segregating SNPs were identified. Analyses of genome-wide RAD marker segregation patterns in the two families suggested SNP discovery on all 29 Atlantic salmon chromosome pairs, and highlighted the dearth of male recombination. The use of pedigreed samples allowed us to distinguish segregating SNPs from putative paralogous sequence variants resulting from the relatively recent genome duplication of salmonid species. Of the segregating SNPs, 50 were linked to the QTL. A subset of these QTL-linked SNPs were converted to a high-throughput assay and genotyped across large commercial populations of IPNV-challenged salmon fry. Several SNPs showed highly significant linkage and association with resistance to IPN, and population linkage-disequilibrium-based SNP tests for resistance were identified. Conclusions We used RAD-Seq to successfully identify and characterise high-density genetic markers in pedigreed aquaculture Atlantic salmon. These results underline the effectiveness of RAD

  14. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family.

    Science.gov (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław

    2017-05-01

    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  15. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D

    2010-01-01

    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  16. Increased type I collagen content and DNA binding activity of a single-stranded, cytosine-rich sequence in the high-salt buffer protein extract of the copper-deficient rat heart.

    Science.gov (United States)

    Zeng, Huawei; Saari, Jack T

    2004-11-01

    Dietary copper (Cu) deficiency not only causes a hypertrophic cardiomyopathy but also increases cancer risk in rodent models. However, a possible alteration in gene expression has not been fully examined. The present study was undertaken to determine the effect of Cu deficiency on protein profiles in rat heart tissue. Male Sprague-Dawley rats were fed diets that were either a Cu-adequate diet (6.0 microg Cu/g diet, n = 6) or a Cu-deficient diet (0.3 microg Cu/g diet, n = 6) for 5 weeks. The high-salt buffer (HSB) protein extract from heart tissue of Cu-deficient, but not Cu-adequate rats showed a 132 kDa protein band by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. This protein band stained pink with Coomassie Blue, suggesting the presence of collagens or other proline-rich proteins. Dot immunoblotting demonstrated that total type I collagen was increased by 110% in HSB protein extract from Cu-deficient, relative to Cu-adequate, rats. Liquid chromatography with mass spectrometry analysis indicated that the 132 kDa protein band contained a collagen alpha (I) chain precursor as well as a leucine-rich protein 130 (LRP130) in HSB protein extract from Cu-deficient but not Cu-adequate rats. A gel shift assay showed that HSB protein extract from Cu-deficient rats bound to a single-stranded cytosine-rich DNA with higher affinity than the extract of Cu-adequate rats, similar to reports of an increase in LRP130 single-stranded DNA binding activity in several types of tumor cells. Collectively, these results not only suggest an additional feature of altered collagen metabolism with Cu deficiency but also demonstrate for the first time an increase in single-stranded cytosine-rich DNA binding in Cu-deficient rat heart.

  17. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: tcheng@ntu.edu.tw [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)

    2013-02-01

    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ► To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ► ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ► PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ► The findings

  18. New polymorphic mtDNA restriction site in the 12S rRNA gene detected in Tunisian patients with non-syndromic hearing loss

    International Nuclear Information System (INIS)

    Mkaouar-Rebai, Emna; Tlili, Abdelaziz; Masmoudi, Saber; Charfeddine, Ilhem; Fakhfakh, Faiza

    2008-01-01

    The 12S rRNA gene was shown to be a hot spot for aminoglycoside-induced and non-syndromic hearing loss since several deafness-associated mtDNA mutations were identified in this gene. Among them, we distinguished the A1555G, the C1494T and the T1095C mutations and C-insertion or deletion at position 961. One hundred Tunisian patients with non-syndromic hearing loss and 100 hearing individuals were analysed in this study. A PCR-RFLP analysis with HaeIII restriction enzyme showed the presence of the A1555G mutation in the 12S rRNA gene in only one out of the 100 patients. In addition, PCR-RFLP and radioactive PCR revealed the presence of a new HaeIII polymorphic restriction site in the same gene of 12S rRNA site in 4 patients with non-syndromic hearing loss. UVIDOC-008-XD analyses showed the presence of this new polymorphic restriction site with a variable heteroplasmic rates at position +1517 of the human mitochondrial genome. On the other hand, direct sequencing of the entire mitochondrial 12S rRNA gene in the 100 patients and in 100 hearing individuals revealed the presence of the A750G and A1438G polymorphisms and the absence of the C1494T, T1095C and 961insC mutations in all the tested individuals. Sequencing of the whole mitochondrial genome in the 4 patients showing the new HaeIII polymorphic restriction site revealed only the presence of the A8860G transition in the MT-ATP6 gene and the A4769G polymorphism in the ND2 gene

  19. Analytical workflow of double-digest restriction site-associated DNA sequencing based on empirical and in silico optimization in tomato.

    Science.gov (United States)

    Shirasawa, Kenta; Hirakawa, Hideki; Isobe, Sachiko

    2016-04-01

    Double-digest restriction site-associated DNA sequencing (ddRAD-Seq) enables high-throughput genome-wide genotyping with next-generation sequencing technology. Consequently, this method has become popular in plant genetics and breeding. Although computational in silico prediction of restriction sites from the genome sequence is recognized as an effective approach for choosing the restriction enzymes to be used, few reports have evaluated the in silico predictions in actual experimental data. In this study, we designed and demonstrated a workflow for in silico and empirical ddRAD-Seq analysis in tomato, as follows: (i)in silico prediction of optimum restriction enzymes from the reference genome, (ii) verification of the prediction by actual ddRAD-Seq data of four restriction enzyme combinations, (iii) establishment of a computational data processing pipeline for high-confidence single nucleotide polymorphism (SNP) calling, and (iv) validation of SNP accuracy by construction of genetic linkage maps. The quality of SNPs based on de novo assembly reference of the ddRAD-Seq reads was comparable with that of SNPs obtained using the published reference genome of tomato. Comparisons of SNP calls in diverse tomato lines revealed that SNP density in the genome influenced the detectability of SNPs by ddRAD-Seq. In silico prediction prior to actual analysis contributed to optimization of the experimental conditions for ddRAD-Seq, e.g. choices of enzymes and plant materials. Following optimization, this ddRAD-Seq pipeline could help accelerate genetics, genomics, and molecular breeding in both model and non-model plants, including crops. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  20. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: skim1@lsuhsc.edu [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  1. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  2. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee

    2012-01-01

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  3. Replication of the plasmid pBR322 under the control of a cloned replication origin from the single-stranded DNA phage M13.

    OpenAIRE

    Cleary, J M; Ray, D S

    1980-01-01

    The replication origins of viral and complementary strands of bacteriophage M13 DNA are contained within a 507-nucleotide intergenic region of the viral genome. Chimeric plasmids have been constructed by inserting restriction endonuclease fragments of the M13 intergenic region into the plasmid pBR322. Replication of these hybrid plasmids, under conditions not permissive for the plasmid replicon, depends on specific segments of the M13 origin region and on the presence of M13 helper virus. Thu...

  4. Impact of target site distribution for Type I restriction enzymes on the evolution of methicillin-resistant Staphylococcus aureus (MRSA) populations

    Science.gov (United States)

    Roberts, Gareth A.; Houston, Patrick J.; White, John H.; Chen, Kai; Stephanou, Augoustinos S.; Cooper, Laurie P.; Dryden, David T.F.; Lindsay, Jodi A.

    2013-01-01

    A limited number of Methicillin-resistant Staphylococcus aureus (MRSA) clones are responsible for MRSA infections worldwide, and those of different lineages carry unique Type I restriction-modification (RM) variants. We have identified the specific DNA sequence targets for the dominant MRSA lineages CC1, CC5, CC8 and ST239. We experimentally demonstrate that this RM system is sufficient to block horizontal gene transfer between clinically important MRSA, confirming the bioinformatic evidence that each lineage is evolving independently. Target sites are distributed randomly in S. aureus genomes, except in a set of large conjugative plasmids encoding resistance genes that show evidence of spreading between two successful MRSA lineages. This analysis of the identification and distribution of target sites explains evolutionary patterns in a pathogenic bacterium. We show that a lack of specific target sites enables plasmids to evade the Type I RM system thereby contributing to the evolution of increasingly resistant community and hospital MRSA. PMID:23771140

  5. Impact of target site distribution for Type I restriction enzymes on the evolution of methicillin-resistant Staphylococcus aureus (MRSA) populations.

    Science.gov (United States)

    Roberts, Gareth A; Houston, Patrick J; White, John H; Chen, Kai; Stephanou, Augoustinos S; Cooper, Laurie P; Dryden, David T F; Lindsay, Jodi A

    2013-08-01

    A limited number of Methicillin-resistant Staphylococcus aureus (MRSA) clones are responsible for MRSA infections worldwide, and those of different lineages carry unique Type I restriction-modification (RM) variants. We have identified the specific DNA sequence targets for the dominant MRSA lineages CC1, CC5, CC8 and ST239. We experimentally demonstrate that this RM system is sufficient to block horizontal gene transfer between clinically important MRSA, confirming the bioinformatic evidence that each lineage is evolving independently. Target sites are distributed randomly in S. aureus genomes, except in a set of large conjugative plasmids encoding resistance genes that show evidence of spreading between two successful MRSA lineages. This analysis of the identification and distribution of target sites explains evolutionary patterns in a pathogenic bacterium. We show that a lack of specific target sites enables plasmids to evade the Type I RM system thereby contributing to the evolution of increasingly resistant community and hospital MRSA.

  6. Conformationally locked aryl C-nucleosides: synthesis of phosphoramidite monomers and incorporation into single-stranded DNA and LNA (locked nucleic acid)

    DEFF Research Database (Denmark)

    Babu, B. Ravindra; Prasad, Ashok K.; Trikha, Smriti

    2002-01-01

    . The phosphoramidite approach was used for automated incorporation of the LNA-type beta-configured C-aryl monomers 17a-17e into short DNA and 2'-OMe-RNA/LNA strands. It is shown that universal hybridization can be obtained with a conformationally restricted monomer as demonstrated most convincingly for the pyrene LNA...... monomer 17d, both in a DNA context and in an RNA-like context. Increased binding affinity of oligonucleotide probes for universal hybridization can be induced by combining the pyrene LNA monomer 17d with affinity-enhancing 2'-OMe-RNA/LNA monomers....

  7. Insights into the Origin of Clostridium botulinum Strains: Evolution of Distinct Restriction Endonuclease Sites in rrs (16S rRNA gene).

    Science.gov (United States)

    Bhushan, Ashish; Mukherjee, Tanmoy; Joshi, Jayadev; Shankar, Pratap; Kalia, Vipin Chandra

    2015-06-01

    Diversity analysis of Clostridium botulinum strains is complicated by high microheterogeneity caused by the presence of 9-22 copies of rrs (16S rRNA gene). The need is to mine genetic markers to identify very closely related strains. Multiple alignments of the nucleotide sequences of the 212 rrs of 13 C. botulinum strains revealed intra- and inter-genomic heterogeneity. Low intragenomic heterogeneity in rrs was evident in strains 230613, Alaska E43, Okra, Eklund 17B, Langeland, 657, Kyoto, BKT015925, and Loch Maree. The most heterogenous rrs sequences were those of C. botulinum strains ATCC 19397, Hall, H04402065, and ATCC 3502. In silico restriction mapping of these rrs sequences was observable with 137 type II Restriction endonucleases (REs). Nucleotide changes (NC) at these RE sites resulted in appearance of distinct and additional sites, and loss in certain others. De novo appearances of RE sites due to NC were recorded at different positions in rrs gene. A nucleotide transition A>G in rrs of C. botulinum Loch Maree and 657 resulted in the generation of 4 and 10 distinct RE sites, respectively. Transitions A>G, G>A, and T>C led to the loss of RE sites. A perusal of the entire NC and in silico RE mapping of rrs of C. botulinum strains provided insights into their evolution. Segregation of strains on the basis of RE digestion patterns of rrs was validated by the cladistic analysis involving six house keeping genes: dnaN, gyrB, metG, prfA, pyrG, and Rho.

  8. Differentiation of Meat Samples from Domestic Horses (Equus caballus) and Asiatic Wild Asses (Equus hemionus) Using a Species-Specific Restriction Site in the Mitochondrial Cytochrome b Region

    Science.gov (United States)

    Kuehn, Ralph; Kaczensky, Petra; Lkhagvasuren, Davaa; Pietsch, Stephanie; Walzer, Chris

    2011-01-01

    Recent studies suggest that Asiatic wild asses (Equus hemionus) are being increasingly poached in a commercial fashion. Part of the meat is believed to reach the meat markets in the capital Ulaanbaatar. To test this hypothesis, we collected 500 meat samples between February and May 2006. To differentiate between domestic horse (Equus caballus) and wild ass meat, we developed a restriction fragment length polymorphism (RFLP) assay based on the polymerase chain reaction (PCR). We amplified and sequenced a cytochrome b fragment (335 bp) and carried out a multialignment of the generated sequences for the domestic horse, the Asiatic wild ass, the domestic donkey (Equus asinus) and the Przewalski’s horse (Equus ferus przewalskii). We detected a species-specific restriction site (AatII) for the Asiatic wild ass, resulting in a specific restriction fragment length polymorphism (RFLP) band pattern. This RFLP assay represents a rapid and cost-effective method to detect wild ass meat. All of the 500 meat samples we collected and analysed within this pilot project proved to be domestic horsemeat as declared by the sales people. Thus, either the assumption that wild ass meat is sold as “cheap horse meat” is wrong, or we picked the wrong markets, products or season. PMID:22059088

  9. In vitro antibiogram pattern of Staphylococcus aureus isolated from wound infection and molecular analysis of mecA gene and restriction sites in methicillin resistant Staphylococcus aureus

    Directory of Open Access Journals (Sweden)

    V Hemamalini

    2015-01-01

    Full Text Available Staphylococcus aureus is a common nosocomial pathogen with property to develop resistance to antimicrobial agents. But in the modern era, drug resistance had been developed by microbes due to its continuous usage of antibiotics. This study was carried out to evaluate antibiotic resistant pattern of methicillin resistant Staphylococcus aureus (MRSA using molecular genotyping. In view of the present problem, the study has been conducted to detect the molecular genotyping of mecA gene from MRSA and confirmation of its restriction sites using EcoRI and BamHI. The pus samples were swabbed out, and clinical strains were isolated using standard microbiological procedures. Then the strains were subjected to in vitro antibiotic susceptibility assay and identified MRSA. Further molecular genotyping of mecA gene was determined by polymerase chain reaction technique. The percentage analysis was done. The clinical strains were isolated from the wound infected patients. A total of 60 samples were collected, of 60 samples, 40 (66.7% were showed positive to strains of S. aureus. The in vitro antibiotic susceptibility assay was carried to find the drug sensitive and resistant patterns. Further methicillin resistant strains (35% of S. aureus were screened and subjected to molecular genotyping of mecA gene and was confirmed by restriction digestion. Overall, 70% of plasmids show positive for the presence of mecA gene, although all strains have restriction sites. Hence, the present study revealed that the early detection of antibiotic resistant character using molecular genotyping will help the infected patient to cure short period and will reduce the development of multidrug resistance.

  10. Mapping DNA cleavage by the Type ISP restriction-modification enzymes following long-range communication between DNA sites in different orientations

    Science.gov (United States)

    van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D.

    2015-01-01

    The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1–2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand breaks are introduced at random wherever two translocating enzymes form a so-called collision complex following long-range communication between a pair of target sites in inverted (head-to-head) repeat. Paradoxically, structural models for collision suggest that the nuclease domains are too far apart (>30 bp) to dimerise and produce a double-strand DNA break using just two strand-cleavage events. Here, we examined the organisation of different collision complexes and how these lead to nuclease activation. We mapped DNA cleavage when a translocating enzyme collides with a static enzyme bound to its site. By following communication between sites in both head-to-head and head-to-tail orientations, we could show that motor activity leads to activation of the nuclease domains via distant interactions of the helicase or MTase-TRD. Direct nuclease dimerization is not required. To help explain the observed cleavage patterns, we also used exonuclease footprinting to demonstrate that individual Type ISP domains can swing off the DNA. This study lends further support to a model where DNA breaks are generated by multiple random nicks due to mobility of a collision complex with an overall DNA-binding footprint of ∼30 bp. PMID:26507855

  11. Mapping DNA cleavage by the Type ISP restriction-modification enzymes following long-range communication between DNA sites in different orientations.

    Science.gov (United States)

    van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D

    2015-12-02

    The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1-2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand breaks are introduced at random wherever two translocating enzymes form a so-called collision complex following long-range communication between a pair of target sites in inverted (head-to-head) repeat. Paradoxically, structural models for collision suggest that the nuclease domains are too far apart (>30 bp) to dimerise and produce a double-strand DNA break using just two strand-cleavage events. Here, we examined the organisation of different collision complexes and how these lead to nuclease activation. We mapped DNA cleavage when a translocating enzyme collides with a static enzyme bound to its site. By following communication between sites in both head-to-head and head-to-tail orientations, we could show that motor activity leads to activation of the nuclease domains via distant interactions of the helicase or MTase-TRD. Direct nuclease dimerization is not required. To help explain the observed cleavage patterns, we also used exonuclease footprinting to demonstrate that individual Type ISP domains can swing off the DNA. This study lends further support to a model where DNA breaks are generated by multiple random nicks due to mobility of a collision complex with an overall DNA-binding footprint of ∼30 bp. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Suitability of PCR fingerprinting, infrequent-restriction-site PCR, and pulsed-field gel electrophoresis, combined with computerized gel analysis, in library typing of Salmonella enterica serovar enteritidis

    DEFF Research Database (Denmark)

    Garaizar, J.; Lopez-Molina, N.; Laconcha, I.

    2000-01-01

    Strains of Salmonella enterica (n = 212) of different serovars and phage types were used to establish a library typing computerized system for serovar Enteritidis on the basis of PCR fingerprinting, infrequent-restriction-site PCR (IRS-PCR), or pulsed-field gel electrophoresis (PFGE). The rate...... showed an intercenter reproducibility value of 93.3%. The high reproducibility of PFGE combined with the previously determined high discrimination directed its use for library typing. The use of PFGE with enzymes XbaI, BlnI, and SpeI for library typing of serovar Enteritidis was assessed with GelCompar 4.......0 software, Three computer libraries of PFGE DNA profiles were constructed, and their ability to recognize new DNA profiles was analyzed. The results obtained pointed out that the combination of PFGE with computerized analysis could be suitable in long-term epidemiological comparison and surveillance...

  13. Ro60-associated single-stranded RNA links inflammation with fetal cardiac fibrosis via ligation of TLRs: a novel pathway to autoimmune-associated heart block.

    Science.gov (United States)

    Clancy, Robert M; Alvarez, David; Komissarova, Elena; Barrat, Franck J; Swartz, Jordan; Buyon, Jill P

    2010-02-15

    Activation of TLR by ssRNA after FcgammaR-mediated phagocytosis of immune complexes (IC) may be relevant in autoimmune-associated congenital heart block (CHB) where the obligate factor is a maternal anti-SSA/Ro Ab and the fetal factors, protein/RNA on an apoptotic cardiocyte and infiltrating macrophages. This study addressed the hypothesis that Ro60-associated ssRNAs link macrophage activation to fibrosis via TLR engagement. Both macrophage transfection with noncoding ssRNA that bind Ro60 and an IC generated by incubation of Ro60-ssRNA with an IgG fraction from a CHB mother or affinity purified anti-Ro60 significantly increased TNF-alpha secretion, an effect not observed using control RNAs or normal IgG. Dependence on TLR was supported by the significant inhibition of TNF-alpha release by IRS661 and chloroquine. The requirement for FcgammaRIIIa-mediated delivery was provided by inhibition with an anti-CD16a Ab. Fibrosis markers were noticeably increased in fetal cardiac fibroblasts after incubation with supernatants generated from macrophages transfected with ssRNA or incubated with the IC. Supernatants generated from macrophages with ssRNA in the presence of IRS661 or chloroquine did not cause fibrosis. In a CHB heart, but not a healthy heart, TLR7 immunostaining was localized to a region near the atrioventricular groove at a site enriched in mononuclear cells and fibrosis. These data support a novel injury model in CHB, whereby endogenous ligand, Ro60-associated ssRNA, forges a nexus between TLR ligation and fibrosis instigated by binding of anti-Ro Abs to the target protein likely accessible via apoptosis.

  14. A pseudo-full mutation identified in fragile X assay reveals a novel base change abolishing an EcoRI restriction site.

    Science.gov (United States)

    Liang, Shujian; Bass, Harold N; Gao, Hanlin; Astbury, Caroline; Jamehdor, Mehdi R; Qu, Yong

    2008-09-01

    Diagnostic testing for the fragile X syndrome is designed to detect the most common mutation, a CGG expansion in the 5'-untranslated region of the fragile X mental retardation (FMRI) gene. PCR can determine the number of CGG repeats less than 100, whereas Southern analysis can detect large premutations, full mutations, and their methylation status. Bands larger than 5.8 kb observed via Southern analysis are usually considered a methylated full mutation, causing fragile X syndrome in males and varied clinical presentations in females. We observed a 10.9-kb band on a Southern blot assay from an autistic girl with language delay. Further investigation identified a novel G-to-A transition at an EcoRI cleavage site, upstream of the CGG repeat region of the FMRI gene. This base change abolished the EcoRI restriction site, resulting in a 10.9-kb pseudo-full mutation. This G-to-A base change has not been previously reported and was not identified in a subsequent analysis of 105 male and 30 female patient samples. The clear 10.9-kb band detected on a Southern blot assay for fragile X syndrome mimics a large, methylated full mutation, which could result in a misdiagnosis without the benefit of family studies and further testing.

  15. Pst I restriction fragment length polymorphism of human placental alkaline phosphatase gene: Mendelian in segregation and localization of mutation site in the gene

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Sussman, H.H.

    1988-01-01

    The pattern of inheritance of a Pst I restriction fragment length polymorphism (RFLP) of the human placental alkaline phosphatase gene was studied in nine nuclear families by Southern blot hybridization analysis of genomic DNA. The dimorphic RFLP is defined by the presence of allelic fragments 1.0 kilobase and 0.8 kilobase long. The results of this study show that the two alleles of the Pst I RFLP of the placental alkaline phosphatase gene segregate as codominant traits according to Mendelian expectations. For a polymorphism to be useful as a genetic marker the probability that an offspring is informative (PIC) must be at least 0.15. The allelic frequency of the 1.0-kilobase allele is 0.21, which correlates to a probability that an offspring is informative of 0.275 and is indicative of a useful polymorphism. By using probes derived from different regions of the placental alkaline phosphatase cDNA, the mutated Pst I site causing the RFLP was located in the penultimate intron 2497 base pairs downstream from the transcriptional initiation site

  16. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  17. OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

    Directory of Open Access Journals (Sweden)

    Kevin M. Bradley

    2014-08-01

    Full Text Available Synthetic biologists wishing to self-assemble large DNA (L-DNA constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson–Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS, and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting" software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

  18. The interaction of hyperthermophilic TATA-box binding protein with single-stranded DNA is entropically favorable and exhibits a large negative heat capacity change at high salt concentration.

    Science.gov (United States)

    Nagatoishi, Satoru; Tanaka, Yoshikazu; Kudou, Motonori; Tsumoto, Kouhei

    2009-09-01

    We have investigated the thermodynamics of the interaction between the TATA-box-binding protein from Pyrococcus horikoshii (PhoTBP) and its target DNA (TATA-1). The interaction between PhoTBP and double-stranded DNA (dsDNA) is entropically favorable and enthalpically unfavorable. The thermodynamic parameters for TATA-1 duplex formation in the presence of PhoTBP, that is, ternary PhoTBP-dsDNA complexation, are similar to those for TATA-1 duplex formation, which is enthalpically favorable. Surface plasmon resonance analysis indicates that the interaction between PhoTBP and single-stranded DNA (ssDNA) of TATA-1 is entropy driven and has a large negative heat capacity change (-1.19 kcal mol(-1) K(-1)) at high salt concentration (800 mM NaCl). These results suggest that the favorable entropic effect corresponding to the interaction between PhoTBP and dsDNA is due not to ternary complexation but to the interaction between PhoTBP and ssDNA. This report is the first to describe the thermodynamics of the interaction between TBP and ssDNA.

  19. Polymorphism Analysis of the CoA (Coagulase Gene in Isolates of Methicillin-Resistant Staphylococcus aureus with AluI Restriction Sites

    Directory of Open Access Journals (Sweden)

    Anita Dwi Anggraini

    2017-07-01

    Full Text Available Abstract: Analysis of the polymorphism of a gene is important to obtain early information in identifying genetic markers related to the characteristics to be seen. The RFLP method becomes one of the chosen methods because it can see polymorphism that can be detected by using the different fragments of DNA that have been cut by using certain endonuclease enzyme so that it is possible to describe the polymorphism of a gene. Application of RFLP in this study was devoted to see the coagulase gene polymorphism of methichillin-resistant S. aureus. Based on the description above, researcher was interested in conducting the analysis of CoA (coagulase gene polymorphism with AluI restriction site of methicillin-resistant S. aureus isolates. The results of this study are aimed to be scientific information about the genetic variation of the coagulase gene of methicillin-resistant S. aureus, and as information in the management of diseases related to antibiotic resistance. This was a descriptive study intended to discover the coagulase gene polymorphism of methichillin-resistant S. aureus. The research was conducted in Microbiology Laboratory of Health Analyst Department, Surabaya, and Human Genetic Laboratory of Institute of Tropical Disease of Airlangga University Surabaya. Samples from this study was a collection of isolates of MRSA in Microbiology Laboratory of Dr. Soetomo Hospital Surabaya selected by using consecutive sampling. Based on the bacteriological examination, all of the samples were S. aureus and the results of amplification showed that PCR product (amplicon of mecA and CoA gene from specific primers, that were 304 bp and 756 bp, had a positivity of 100%. The results of PCR-RFLP of CoA gene showed that all 25 samples underwent polymorphism which was divided into four RFLP patterns and the biggest one was RFLP I pattern (the one which was not digested by AluI restriction enzyme with a proportion of 64%.

  20. Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay.

    Science.gov (United States)

    Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei

    2017-09-01

    It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

  1. A chronocoulometric LNA sensor for amplified detection of K-ras mutation based on site-specific DNA cleavage of restriction endonuclease.

    Science.gov (United States)

    Lin, Liqing; Liu, Ailin; Zhao, Chengfei; Weng, Shaohuang; Lei, Yun; Liu, Qicai; Lin, Xinhua; Chen, Yuanzhong

    2013-04-15

    An amplified chronocoulometric Locked nucleic acid (LNA) sensor (CLS) for selective electrochemical detection of K-ras mutation was developed based on site-specific DNA cleavage of restriction endonuclease EcoRI. Thiolated-hairpin LNA probe with palindrome structure of stem was immobilized on the gold nanoparticles modified gold electrode (NG/AuE). It can be cleaved by EcoRI in the absence of K-ras mutation-type DNA (complementary with the loop part of hairpin probe), but cannot be cleaved in the presence of mutation-type DNA. The difference before and after enzymatic cleavage was then monitored by chronocoulometric biosensor. Electrochemical signals are generated by chronocoulometric interrogation of Hexaammineruthenium (III) chloride (RuHex) that quantitatively binds to surface-confined hairpin LNA probe via electrostatic interactions. The results suggested this CLS had a good specificity to distinguish the K-ras mutation-type, wild-type and non-complementary sequence. There was a good linear relationship between the charge and the logarithmic function of K-ras mutation-type DNA concentration. The detection limit had been estimated as 0.5 fM. It is possible to qualitatively and quantitatively detect K-ras point mutation in pancreatic cancer. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Genetic consequences of Quaternary climatic oscillations in the Himalayas: Primula tibetica as a case study based on restriction site-associated DNA sequencing.

    Science.gov (United States)

    Ren, Guangpeng; Mateo, Rubén G; Liu, Jianquan; Suchan, Tomasz; Alvarez, Nadir; Guisan, Antoine; Conti, Elena; Salamin, Nicolas

    2017-02-01

    The effects of Quaternary climatic oscillations on the demography of organisms vary across regions and continents. In taxa distributed in Europe and North America, several paradigms regarding the distribution of refugia have been identified. By contrast, less is known about the processes that shaped the species' spatial genetic structure in areas such as the Himalayas, which is considered a biodiversity hotspot. Here, we investigated the phylogeographic structure and population dynamics of Primula tibetica by combining genomic phylogeography and species distribution models (SDMs). Genomic data were obtained for 293 samples of P. tibetica using restriction site-associated DNA sequencing (RADseq). Ensemble SDMs were carried out to predict potential present and past distribution ranges. Four distinct lineages were identified. Approximate Bayesian computation analyses showed that each of them have experienced both expansions and bottlenecks since their divergence, which occurred during or across the Quaternary glacial cycles. The two lineages at both edges of the distribution were found to be more vulnerable and responded in different ways to past climatic changes. These results illustrate how past climatic changes affected the demographic history of Himalayan organisms. Our findings highlight the significance of combining genomic approaches with environmental data when evaluating the effects of past climatic changes. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  3. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

    2003-01-01

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  4. A single-stranded conformational polymorphism (SSCP)-derived quantitative variable to monitor the virulence of a Barley yellow dwarf virus-PAV (BYDV-PAV) isolate during adaptation to the TC14 resistant wheat line.

    Science.gov (United States)

    Delaunay, Agnes; Lacroix, Christelle; Morliere, Stephanie; Riault, Gerard; Chain, Florian; Trottet, Maxime; Jacquot, Emmanuel

    2010-09-01

    A standardized single-stranded conformational polymorphism (SSCP) procedure is proposed as an alternative to the time-consuming biological characterization of Barley yellow dwarf virus-PAV (BYDV-PAV) isolates. Using this procedure, six of 21 overlapping regions used to scan the viral genome gave patterns specific to '4E' (avirulent) or '4T' ('4E'-derived virulent) isolates. The calibration of samples and integration of SSCP patterns corresponding to the nucleotide region 1482-2023 allowed the estimation of P(T) values that reflect the proportions of a '4T'-specific band. Analysis of the biological (area under the pathogen progress curve) and molecular (P(T)) data suggested a positive linear relation between these variables. Moreover, sequence analysis of the nucleotide region 1482-2023 highlighted the presence of a nucleotide polymorphism (C/A(1835)) which can be considered as a candidate for virus-host interactions linked to the monitored virulence. According to these parameters, P(T) values associated with '4E'- and '4T'-derived populations show that: (i) long-term infection of a BYDV-PAV isolate on the 'TC14' resistant host leads to the fixation of virulent individuals in viral populations; and (ii) the introduction of susceptible hosts in successive 'TC14' infections results in the maintenance of low virulence of the populations. Thus, the presented study demonstrates that SSCP is a useful tool for monitoring viral populations during the host adaptation process. The described impact of host alternation provides new opportunities for the use of the 'TC14' resistance source in BYDV-resistant breeding programmes. This study is part of the global effort made by the scientific community to propose sustainable alternatives to the chemical control of this viral disease.

  5. Ex vivo gene editing of the dystrophin gene in muscle stem cells mediated by peptide nucleic acid single stranded oligodeoxynucleotides induces stable expression of dystrophin in a mouse model for Duchenne muscular dystrophy.

    Science.gov (United States)

    Nik-Ahd, Farnoosh; Bertoni, Carmen

    2014-07-01

    Duchenne muscular dystrophy (DMD) is a fatal disease caused by mutations in the dystrophin gene, which result in the complete absence of dystrophin protein throughout the body. Gene correction strategies hold promise to treating DMD. Our laboratory has previously demonstrated the ability of peptide nucleic acid single-stranded oligodeoxynucleotides (PNA-ssODNs) to permanently correct single-point mutations at the genomic level. In this study, we show that PNA-ssODNs can target and correct muscle satellite cells (SCs), a population of stem cells capable of self-renewing and differentiating into muscle fibers. When transplanted into skeletal muscles, SCs transfected with correcting PNA-ssODNs were able to engraft and to restore dystrophin expression. The number of dystrophin-positive fibers was shown to significantly increase over time. Expression was confirmed to be the result of the activation of a subpopulation of SCs that had undergone repair as demonstrated by immunofluorescence analyses of engrafted muscles using antibodies specific to full-length dystrophin transcripts and by genomic DNA analysis of dystrophin-positive fibers. Furthermore, the increase in dystrophin expression detected over time resulted in a significant improvement in muscle morphology. The ability of transplanted cells to return into quiescence and to activate upon demand was confirmed in all engrafted muscles following injury. These results demonstrate the feasibility of using gene editing strategies to target and correct SCs and further establish the therapeutic potential of this approach to permanently restore dystrophin expression into muscle of DMD patients. © 2014 AlphaMed Press.

  6. The SUMOylation Pathway Restricts Gene Transduction by Adeno-Associated Viruses.

    Directory of Open Access Journals (Sweden)

    Christina Hölscher

    2015-12-01

    Full Text Available Adeno-associated viruses are members of the genus dependoviruses of the parvoviridae family. AAV vectors are considered promising vectors for gene therapy and genetic vaccination as they can be easily produced, are highly stable and non-pathogenic. Nevertheless, transduction of cells in vitro and in vivo by AAV in the absence of a helper virus is comparatively inefficient requiring high multiplicity of infection. Several bottlenecks for AAV transduction have previously been described, including release from endosomes, nuclear transport and conversion of the single stranded DNA into a double stranded molecule. We hypothesized that the bottlenecks in AAV transduction are, in part, due to the presence of host cell restriction factors acting directly or indirectly on the AAV-mediated gene transduction. In order to identify such factors we performed a whole genome siRNA screen which identified a number of putative genes interfering with AAV gene transduction. A number of factors, yielding the highest scores, were identified as members of the SUMOylation pathway. We identified Ubc9, the E2 conjugating enzyme as well as Sae1 and Sae2, enzymes responsible for activating E1, as factors involved in restricting AAV. The restriction effect, mediated by these factors, was validated and reproduced independently. Our data indicate that SUMOylation targets entry of AAV capsids and not downstream processes of uncoating, including DNA single strand conversion or DNA damage signaling. We suggest that transiently targeting SUMOylation will enhance application of AAV in vitro and in vivo.

  7. A first linkage map and downy mildew resistance QTL discovery for sweet basil (Ocimum basilicum) facilitated by double digestion restriction site associated DNA sequencing (ddRADseq).

    Science.gov (United States)

    Pyne, Robert; Honig, Josh; Vaiciunas, Jennifer; Koroch, Adolfina; Wyenandt, Christian; Bonos, Stacy; Simon, James

    2017-01-01

    Limited understanding of sweet basil (Ocimum basilicum L.) genetics and genome structure has reduced efficiency of breeding strategies. This is evidenced by the rapid, worldwide dissemination of basil downy mildew (Peronospora belbahrii) in the absence of resistant cultivars. In an effort to improve available genetic resources, expressed sequence tag simple sequence repeat (EST-SSR) and single nucleotide polymorphism (SNP) markers were developed and used to genotype the MRI x SB22 F2 mapping population, which segregates for response to downy mildew. SNP markers were generated from genomic sequences derived from double digestion restriction site associated DNA sequencing (ddRADseq). Disomic segregation was observed in both SNP and EST-SSR markers providing evidence of an O. basilicum allotetraploid genome structure and allowing for subsequent analysis of the mapping population as a diploid intercross. A dense linkage map was constructed using 42 EST-SSR and 1,847 SNP markers spanning 3,030.9 cM. Multiple quantitative trait loci (QTL) model (MQM) analysis identified three QTL that explained 37-55% of phenotypic variance associated with downy mildew response across three environments. A single major QTL, dm11.1 explained 21-28% of phenotypic variance and demonstrated dominant gene action. Two minor QTL dm9.1 and dm14.1 explained 5-16% and 4-18% of phenotypic variance, respectively. Evidence is provided for an additive effect between the two minor QTL and the major QTL dm11.1 increasing downy mildew susceptibility. Results indicate that ddRADseq-facilitated SNP and SSR marker genotyping is an effective approach for mapping the sweet basil genome.

  8. Unveiling the Identity of Wenwan Walnuts and Phylogenetic Relationships of AsianJuglansSpecies Using Restriction Site-Associated DNA-Sequencing.

    Science.gov (United States)

    Mu, Xian-Yun; Sun, Miao; Yang, Pei-Fang; Lin, Qin-Wen

    2017-01-01

    Juglans species have considerable ecological and economic value worldwide. In China, Wenwan walnuts have been collected by aristocrats and noblemen for more than 2000 years. As a diversity center of Asian Juglans , five species are widely distributed in China. The most famous of these is Mahetao ( J. hopeiensis ), which is an uncharacterized species that is mostly cultivated. Wild J. hopeiensis individuals are very rare and are endemic to Hebei Province. Because of the minimal variations in previously used molecular markers and the heterogeneity between chloroplast and nuclear genomes, determining the phylogenetic relationships among the Juglans species has been challenging, and has hindered subsequent evolutionary inferences. In this study, we collected enough materials for both cultivated and wild Mahetao to construct well-resolved phylogenetic trees for Asian Juglans species. We used a high-throughput genome-wide restriction site-associated DNA sequencing method. Consequently, the identity of J. hopeiensis has been clearly resolved. Our results indicate that J. hopeiensis is a hybrid of J. regia and J. mandshurica . However, J. hopeiensis, J. regia and J. sigillata should be considered as a single species from section Juglans . Additionally, J. ailantifolia, J. cathayensis , and J. mandshurica likely represent one species from section Cardiocaryon according to morphological and molecular studies. These results are supported by population structure analysis and morphological comparison. We propose that J. hopeiensis trees growing in the wild should be conserved because of the economic value of their nuts. These trees may be of particular importance to impoverished communities. Furthermore, they may serve as a valuable genetic resource relevant for enhancing the production of edible walnuts. The 2b-RAD method is a viable option for future phylogenetic studies of Juglans species as well as other plant species.

  9. Unveiling the Identity of Wenwan Walnuts and Phylogenetic Relationships of Asian Juglans Species Using Restriction Site-Associated DNA-Sequencing

    Directory of Open Access Journals (Sweden)

    Xian-Yun Mu

    2017-10-01

    Full Text Available Juglans species have considerable ecological and economic value worldwide. In China, Wenwan walnuts have been collected by aristocrats and noblemen for more than 2000 years. As a diversity center of Asian Juglans, five species are widely distributed in China. The most famous of these is Mahetao (J. hopeiensis, which is an uncharacterized species that is mostly cultivated. Wild J. hopeiensis individuals are very rare and are endemic to Hebei Province. Because of the minimal variations in previously used molecular markers and the heterogeneity between chloroplast and nuclear genomes, determining the phylogenetic relationships among the Juglans species has been challenging, and has hindered subsequent evolutionary inferences. In this study, we collected enough materials for both cultivated and wild Mahetao to construct well-resolved phylogenetic trees for Asian Juglans species. We used a high-throughput genome-wide restriction site-associated DNA sequencing method. Consequently, the identity of J. hopeiensis has been clearly resolved. Our results indicate that J. hopeiensis is a hybrid of J. regia and J. mandshurica. However, J. hopeiensis, J. regia and J. sigillata should be considered as a single species from section Juglans. Additionally, J. ailantifolia, J. cathayensis, and J. mandshurica likely represent one species from section Cardiocaryon according to morphological and molecular studies. These results are supported by population structure analysis and morphological comparison. We propose that J. hopeiensis trees growing in the wild should be conserved because of the economic value of their nuts. These trees may be of particular importance to impoverished communities. Furthermore, they may serve as a valuable genetic resource relevant for enhancing the production of edible walnuts. The 2b-RAD method is a viable option for future phylogenetic studies of Juglans species as well as other plant species.

  10. Determination of antimicrobial resistance of Enterococcus strains isolated from pigs and their genotypic characterization by method of amplification of DNA fragments surrounding rare restriction sites (ADSRRS fingerprinting).

    Science.gov (United States)

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Trościańczyk, Aleksandra; Zięba, Przemysław; Gnat, Sebastian

    2017-03-01

    In this study, we analysed phenotypic resistance profiles and their reflection in the genomic profiles of Enterococcus spp. strains isolated from pigs raised on different farms. Samples were collected from five pig farms (n=90 animals) and tested for Enterococcus. MICs of 12 antimicrobials were determined using the broth microdilution method, and epidemiological molecular analysis of strains belonging to selected species (faecalis, faecium and hirae) was performed using the ADSRRS-fingerprinting (amplification of DNA fragments surrounding rare restriction sites) method with a few modifications. The highest percentage of strains was resistant to tetracycline (73.4 %), erythromycin and tylosin (42.5 %) and rifampin (25.2 %), and a large number of strains exhibited high-level resistance to both kanamycin (25.2 %) and streptomycin (27.6 %). The strains of E. faecalis, E. faecium and E. hirae (n=184) revealed varied phenotypic resistance profiles, among which as many as seven met the criteria for multidrug resistance (30.4 % of strains tested). ADSRRS-fingerprinting analysis produced 17 genotypic profiles of individual strains which were correlated with their phenotypic resistance profiles. Only E. hirae strains susceptible to all of the chemotherapeutics tested had two different ADSRRS profiles. Moreover, eight animals were carriers of more than one genotype belonging to the same Enterococcus spp., mainly E. faecalis. Given the possibility of transmission to humans of the high-resistance/multidrug resistance enterococci and the significant role of pigs as food animals in this process, it is necessary to introduce a multilevel control strategy by carrying out research on the resistance and molecular characteristics of indicator bacterial strains isolated from animals on individual farms.

  11. The Transcription Bubble of the RNA Polymerase-Promoter Open Complex Exhibits Conformational Heterogeneity and Millisecond-Scale Dynamics : Implications for Transcription Start-Site Selection

    NARCIS (Netherlands)

    Robb, Nicole C.; Cordes, Thorben; Hwang, Ling Chin; Gryte, Kristofer; Duchi, Diego; Craggs, Timothy D.; Santoso, Yusdi; Weiss, Shimon; Ebright, Richard H.; Kapanidis, Achillefs N.

    2013-01-01

    Bacterial transcription is initiated after RNA polymerase (RNAP) binds to promoter DNA, melts similar to 14 bp around the transcription start site and forms a single-stranded "transcription bubble" within a catalytically active RNAP-DNA open complex (RPo). There is significant flexibility in the

  12. Stalled repair of lesions when present within a clustered DNA damage site

    International Nuclear Information System (INIS)

    Lomax, M.E.; Cunniffe, S.; O'Neill, P.

    2003-01-01

    Ionising radiation produces clustered DNA damages (two or more lesions within one or two helical turns of the DNA) which could challenge the repair mechanism(s) of the cell. Using purified base excision repair (BER) enzymes and synthetic oligonucleotides a number of recent studies have established the excision of a lesion within clustered damage sites is compromised. Evidence will be presented that the efficiency of repair of lesions within a clustered DNA damage site is reduced, relative to that of the isolated lesions, since the lifetime of both lesions is extended by up to four fold. Simple clustered damage sites, comprised of single-strand breaks, abasic sites and base damages, one or five bases 3' or 5' to each other, were synthesised in oligonucleotides and repair carried out in mammalian cell nuclear extracts. The rate of repair of the single-strand break/abasic site within these clustered damage sites is reduced, mainly due to inhibition of the DNA ligase. The mechanism of repair of the single-strand break/abasic site shows some asymmetry. Repair appears to be by the short-patch BER pathway when the lesions are 5' to each other. In contrast, when the lesions are 3' to each other repair appears to proceed along the long-patch BER pathway. The lesions within the cluster are processed sequentially, the single-strand break/abasic site being repaired before excision of 8-oxoG, limiting the formation of double-strand breaks to <2%. Stalled processing of clustered DNA damage extends the lifetime of the lesions to an extent that could have biological consequences, e.g. if the lesions are still present during transcription and/or at replication mutations could arise

  13. Restrictive Cardiomyopathy

    Science.gov (United States)

    ... can be mistaken for a condition called constrictive pericarditis. This condition causes the sac-like membrane around ... inflamed and thickened. Surgery can usually correct constrictive pericarditis. On the other hand, restrictive cardiomyopathy cannot be ...

  14. Integrating restriction site-associated DNA sequencing (RAD-seq) with morphological cladistic analysis clarifies evolutionary relationships among major species groups of bee orchids.

    Science.gov (United States)

    Bateman, Richard M; Sramkó, Gábor; Paun, Ovidiu

    2018-01-25

    Bee orchids (Ophrys) have become the most popular model system for studying reproduction via insect-mediated pseudo-copulation and for exploring the consequent, putatively adaptive, evolutionary radiations. However, despite intensive past research, both the phylogenetic structure and species diversity within the genus remain highly contentious. Here, we integrate next-generation sequencing and morphological cladistic techniques to clarify the phylogeny of the genus. At least two accessions of each of the ten species groups previously circumscribed from large-scale cloned nuclear ribosomal internal transcibed spacer (nrITS) sequencing were subjected to restriction site-associated sequencing (RAD-seq). The resulting matrix of 4159 single nucleotide polymorphisms (SNPs) for 34 accessions was used to construct an unrooted network and a rooted maximum likelihood phylogeny. A parallel morphological cladistic matrix of 43 characters generated both polymorphic and non-polymorphic sets of parsimony trees before being mapped across the RAD-seq topology. RAD-seq data strongly support the monophyly of nine out of ten groups previously circumscribed using nrITS and resolve three major clades; in contrast, supposed microspecies are barely distinguishable. Strong incongruence separated the RAD-seq trees from both the morphological trees and traditional classifications; mapping of the morphological characters across the RAD-seq topology rendered them far more homoplastic. The comparatively high level of morphological homoplasy reflects extensive convergence, whereas the derived placement of the fusca group is attributed to paedomorphic simplification. The phenotype of the most recent common ancestor of the extant lineages is inferred, but it post-dates the majority of the character-state changes that typify the genus. RAD-seq may represent the high-water mark of the contribution of molecular phylogenetics to understanding evolution within Ophrys; further progress will require

  15. Betaine improved restriction digestion.

    Science.gov (United States)

    Sugimoto, Keiki; Makihara, Tohru; Saito, Aya; Ohishi, Nobuya; Nagase, Takahide; Takai, Daiya

    2005-12-02

    Here we report that supplementation of a common compound betaine (1-carboxy-N,N,N-trimethylmethanaminium inner salt) enhances restriction digestion of DNA molecules being resistant to digestion despite the existence of recognition sites. A previous study reported total isostabilization of DNA was achieved in the presence of 5.2M of betaine, however, we have observed the enhancement of restriction kinetics at 0.3M of betaine, therefore, it likely provided some catalytic proficiency to restriction enzymes rather than the induction of DNA conformational changes. Betaine also enhances catalytic efficiency of PCR, and our result of restriction digestion, taken together, suggests potential application of betaine in other enzymatic reactions in an aqueous solution.

  16. Type II restriction endonuclease R.Hpy188I belongs to the GIY-YIG nuclease superfamily, but exhibits an unusual active site.

    Science.gov (United States)

    Kaminska, Katarzyna H; Kawai, Mikihiko; Boniecki, Michal; Kobayashi, Ichizo; Bujnicki, Janusz M

    2008-11-14

    Catalytic domains of Type II restriction endonucleases (REases) belong to a few unrelated three-dimensional folds. While the PD-(D/E)XK fold is most common among these enzymes, crystal structures have been also determined for single representatives of two other folds: PLD (R.BfiI) and half-pipe (R.PabI). Bioinformatics analyses supported by mutagenesis experiments suggested that some REases belong to the HNH fold (e.g. R.KpnI), and that a small group represented by R.Eco29kI belongs to the GIY-YIG fold. However, for a large fraction of REases with known sequences, the three-dimensional fold and the architecture of the active site remain unknown, mostly due to extreme sequence divergence that hampers detection of homology to enzymes with known folds. R.Hpy188I is a Type II REase with unknown structure. PSI-BLAST searches of the non-redundant protein sequence database reveal only 1 homolog (R.HpyF17I, with nearly identical amino acid sequence and the same DNA sequence specificity). Standard application of state-of-the-art protein fold-recognition methods failed to predict the relationship of R.Hpy188I to proteins with known structure or to other protein families. In order to increase the amount of evolutionary information in the multiple sequence alignment, we have expanded our sequence database searches to include sequences from metagenomics projects. This search resulted in identification of 23 further members of R.Hpy188I family, both from metagenomics and the non-redundant database. Moreover, fold-recognition analysis of the extended R.Hpy188I family revealed its relationship to the GIY-YIG domain and allowed for computational modeling of the R.Hpy188I structure. Analysis of the R.Hpy188I model in the light of sequence conservation among its homologs revealed an unusual variant of the active site, in which the typical Tyr residue of the YIG half-motif had been substituted by a Lys residue. Moreover, some of its homologs have the otherwise invariant Arg residue in

  17. Type II restriction endonuclease R.Hpy188I belongs to the GIY-YIG nuclease superfamily, but exhibits an unusual active site

    Directory of Open Access Journals (Sweden)

    Kobayashi Ichizo

    2008-11-01

    Full Text Available Abstract Background Catalytic domains of Type II restriction endonucleases (REases belong to a few unrelated three-dimensional folds. While the PD-(D/EXK fold is most common among these enzymes, crystal structures have been also determined for single representatives of two other folds: PLD (R.BfiI and half-pipe (R.PabI. Bioinformatics analyses supported by mutagenesis experiments suggested that some REases belong to the HNH fold (e.g. R.KpnI, and that a small group represented by R.Eco29kI belongs to the GIY-YIG fold. However, for a large fraction of REases with known sequences, the three-dimensional fold and the architecture of the active site remain unknown, mostly due to extreme sequence divergence that hampers detection of homology to enzymes with known folds. Results R.Hpy188I is a Type II REase with unknown structure. PSI-BLAST searches of the non-redundant protein sequence database reveal only 1 homolog (R.HpyF17I, with nearly identical amino acid sequence and the same DNA sequence specificity. Standard application of state-of-the-art protein fold-recognition methods failed to predict the relationship of R.Hpy188I to proteins with known structure or to other protein families. In order to increase the amount of evolutionary information in the multiple sequence alignment, we have expanded our sequence database searches to include sequences from metagenomics projects. This search resulted in identification of 23 further members of R.Hpy188I family, both from metagenomics and the non-redundant database. Moreover, fold-recognition analysis of the extended R.Hpy188I family revealed its relationship to the GIY-YIG domain and allowed for computational modeling of the R.Hpy188I structure. Analysis of the R.Hpy188I model in the light of sequence conservation among its homologs revealed an unusual variant of the active site, in which the typical Tyr residue of the YIG half-motif had been substituted by a Lys residue. Moreover, some of its homologs

  18. Unusual scarcity of restriction site polymorphism in the human thyroglobulin gene. A linkage study suggesting autosomal dominance of a defective thyroglobulin allele

    NARCIS (Netherlands)

    Baas, F.; Bikker, H.; van Ommen, G. J.; de Vijlder, J. J.

    1984-01-01

    Chromosomal DNA prepared from 90 unrelated individuals, mainly of Caucasian origin, was screened for restriction fragment length polymorphisms in the 3' 220 kilobase pairs (kb) of the human thyroglobulin (Tg) gene. The probes used were Tg cDNA fragments and subcloned single-copy genomic segments,

  19. Epstein-Barr Virus Fusion with Epithelial Cells Triggered by gB Is Restricted by a gL Glycosylation Site.

    Science.gov (United States)

    Möhl, Britta S; Chen, Jia; Park, Seo Jin; Jardetzky, Theodore S; Longnecker, Richard

    2017-12-01

    Epstein-Barr virus (EBV) entry into epithelial cells is mediated by the conserved core fusion machinery, composed of the fusogen gB and the receptor-binding complex gH/gL. The heterodimeric gH/gL complex binds to the EBV epithelial cell receptor or gp42, which binds to the B-cell receptor, triggering gB-mediated fusion of the virion envelope with cellular membranes. Our previous study found that the gL glycosylation mutant N69L/S71V had an epithelial cell-specific hyperfusogenic phenotype. To study the influence of this gL mutant on the initiation and kinetics of gB-driven epithelial cell fusion, we established a virus-free split-green fluorescent protein cell-cell fusion assay that enables real-time measurements of membrane fusion using live cells. The gL_N69L/S71V mutant had a large increase in epithelial cell fusion activity of up to 300% greater than that of wild-type gL starting at early time points. The hyperfusogenicity of the gL mutant was not a result of alterations in complex formation with gH or alterations in cellular localization. Moreover, the hyperfusogenic phenotype of the gL mutant correlated with the formation of enlarged syncytia. In summary, our present findings highlight an important role of gL in the kinetics of gB-mediated epithelial cell fusion, adding to previous findings indicating a direct interaction between gL and gB in EBV membrane fusion. IMPORTANCE EBV predominantly infects epithelial cells and B lymphocytes, which are the cells of origin for the EBV-associated malignancies Hodgkin and Burkitt lymphoma as well as nasopharyngeal carcinoma. Contrary to the other key players of the core fusion machinery, gL has the most elusive role during EBV-induced membrane fusion. We found that the glycosylation site N69/S71 of gL is involved in restricting epithelial cell fusion activity, strongly correlating with syncytium size. Interestingly, our data showed that the gL glycosylation mutant increases the fusion activity of the hyperfusogenic g

  20. Suppression of APOBEC3-mediated restriction of HIV-1 by Vif

    Science.gov (United States)

    Feng, Yuqing; Baig, Tayyba T.; Love, Robin P.; Chelico, Linda

    2014-01-01

    The APOBEC3 restriction factors are a family of deoxycytidine deaminases that are able to suppress replication of viruses with a single-stranded DNA intermediate by inducing mutagenesis and functional inactivation of the virus. Of the seven human APOBEC3 enzymes, only APOBEC3-D, -F, -G, and -H appear relevant to restriction of HIV-1 in CD4+ T cells and will be the focus of this review. The restriction of HIV-1 occurs most potently in the absence of HIV-1 Vif that induces polyubiquitination and degradation of APOBEC3 enzymes through the proteasome pathway. To restrict HIV-1, APOBEC3 enzymes must be encapsidated into budding virions. Upon infection of the target cell during reverse transcription of the HIV-1 RNA into (-)DNA, APOBEC3 enzymes deaminate cytosines to form uracils in single-stranded (-)DNA regions. Upon replication of the (-)DNA to (+)DNA, the HIV-1 reverse transcriptase incorporates adenines opposite to the uracils thereby inducing C/G to T/A mutations that can functionally inactivate HIV-1. APOBEC3G is the most studied APOBEC3 enzyme and it is known that Vif attempts to thwart APOBEC3 function not only by inducing its proteasomal degradation but also by several degradation-independent mechanisms, such as inhibiting APOBEC3G virion encapsidation, mRNA translation, and for those APOBEC3G molecules that still become virion encapsidated, Vif can inhibit APOBEC3G mutagenic activity. Although most Vif variants can induce efficient degradation of APOBEC3-D, -F, and -G, there appears to be differential sensitivity to Vif-mediated degradation for APOBEC3H. This review examines APOBEC3-mediated HIV restriction mechanisms, how Vif acts as a substrate receptor for a Cullin5 ubiquitin ligase complex to induce degradation of APOBEC3s, and the determinants and functional consequences of the APOBEC3 and Vif interaction from a biological and biochemical perspective. PMID:25206352

  1. Evolutionary Biology of Trillium and Related Genera (Trilliaceae) : I. Restriction Site Mapping and Variation of Chloroplast DNA and its Systematic Implications

    OpenAIRE

    HIDETOSHI, KATO; SHOICHI, KAWANO; RYOHEI, TERAUCHI; MASASHI, OHARA; FREDERICK H., UTECH; Department of Botany, Faculty of Science, Kyoto University; Department of Botany, Faculty of Science, Kyoto University; Department of Botany, Faculty of Science, Kyoto University; Laboratory of Plant Genetics and Education, Faculty of Agriculture, Hokkaido University; Section of Botany, Carnegie Museum of Natural History

    1995-01-01

    A physical map of chloroplast DNA (cpDNA) was constructed for Trillium kamtschaticum using three restriction enzymes, Apal, Pstl and Xhol. The chloroplast genome is 154.5 kbp in size with each portion of the inverted repeat 26.5 kbp in length, separated by large (82.7 kbp) and small (18.8 kbp) single copy regions. The cpDNA of T. kamtschaticum is similar in structure to the cpDNAs of most angiosperms thus far studied. Chloroplast DNA variation in 25 taxa of Trillium was investigated using 14 ...

  2. DNA cleavage site selection by Type III restriction enzymes provides evidence for head-on protein collisions following 1D bidirectional motion

    Science.gov (United States)

    Schwarz, Friedrich W.; van Aelst, Kara; Tóth, Júlia; Seidel, Ralf; Szczelkun, Mark D.

    2011-01-01

    DNA cleavage by the Type III Restriction–Modification enzymes requires communication in 1D between two distant indirectly-repeated recognitions sites, yet results in non-specific dsDNA cleavage close to only one of the two sites. To test a recently proposed ATP-triggered DNA sliding model, we addressed why one site is selected over another during cleavage. We examined the relative cleavage of a pair of identical sites on DNA substrates with different distances to a free or protein blocked end, and on a DNA substrate using different relative concentrations of protein. Under these conditions a bias can be induced in the cleavage of one site over the other. Monte-Carlo simulations based on the sliding model reproduce the experimentally observed behaviour. This suggests that cleavage site selection simply reflects the dynamics of the preceding stochastic enzyme events that are consistent with bidirectional motion in 1D and DNA cleavage following head-on protein collision. PMID:21724613

  3. A model of EcoRII restriction endonuclease action: the active complex is most likely formed by one protein subunit and one DNA recognition site

    Science.gov (United States)

    Karpova, E. A.; Kubareva, E. A.; Shabarova, Z. A.

    1999-01-01

    To elucidate the mechanism of interaction of restriction endonuclease EcoRII with DNA, we studied by native gel electrophoresis the binding of this endonuclease to a set of synthetic DNA-duplexes containing the modified or canonical recognition sequence 5'-d(CCA/TGG)-3'. All binding substrate or substrate analogues tested could be divided into two major groups: (i) duplexes that, at the interaction with endonuclease EcoRII, form two types of stable complexes on native gel in the absence of Mg2+ cofactor; (ii) duplexes that form only one type of complex, observed both in the presence and absence of Mg2+. Unlike the latter, duplexes under the first group can be hydrolyzed by endonuclease. Data obtained suggest that the active complex is most likely formed by one protein subunit and one DNA recognition sequence. A model of EcoRII endonuclease action is presented.

  4. Differentiation of Meat Samples from Domestic Horses ( Equus caballus and Asiatic Wild Asses ( Equus hemionus Using a Species-Speci fi c Restriction Site in the Mitochondrial Cytochrome b Region

    Directory of Open Access Journals (Sweden)

    Ralph Kuehn

    2006-12-01

    Full Text Available Recent studies suggest that Asiatic wild asses ( Equus hemionus are being increasingly poached in a commercial fashion. Part of the meat is believed to reach the meat markets in the capital Ulaanbaatar. To test this hypothesis, we collected 500 meat samples between February and May 2006. To differentiate between domestic horse ( Equus caballus and wild ass meat, we developed a restriction fragment length polymorphism (RFLP assay based on the polymerase chain reaction (PCR. We ampli fi ed and sequenced a cytochrome b fragment (335 bp and carried out a multialignment of the generated sequences for the domestic horse, the Asiatic wild ass, the domestic donkey ( Equus asinus and the Przewalski’s horse ( Equus ferus przewalskii . We detected a species-speci fi c restriction site (AatII for the Asiatic wild ass, resulting in a speci fi c restriction fragment length polymorphism (RFLP band pattern. This RFLP assay represents a rapid and cost-effective method to detect wild ass meat. All of the 500 meat samples we collected and analysed within this pilot project proved to be domestic horsemeat as declared by the sales people. Thus, either the assumption that wild ass meat is sold as “cheap horse meat” is wrong, or we picked the wrong markets, products or season.

  5. Restricted Mobilities

    DEFF Research Database (Denmark)

    Nielsen, Mette; Lassen, Claus

    2012-01-01

    communities and shopping centres through mobility lenses. The article shows how different mobility systems enable and restrict the public access to private-public spaces, and it points out that proprietary communities create an unequal potential for human movement and access in the city. The main argument......Privatisation of public spaces in the contemporary city has increased during the last decades but only few studies have approached this field from a mobility perspective. Therefore the article seeks to rectify this by exploring two Australian examples of private spaces in the city; gated...... and stratification mechanisms. In conclusion the article therefore suggests that future urban research and planning also needs a mobile understanding of spaces in the cities and how different mobility systems play an important role to sustain the exclusiveness that often characterises the private/public spaces...

  6. EcoBLMcrX, a classical modification-dependent restriction enzyme in Escherichia coli B: Characterization in vivo and in vitro with a new approach to cleavage site determination.

    Directory of Open Access Journals (Sweden)

    Alexey Fomenkov

    Full Text Available Here we characterize the modification-dependent restriction enzyme (MDE EcoBLMcrX in vivo, in vitro and in its genomic environment. MDE cleavage of modified DNAs protects prokaryote populations from lethal infection by bacteriophage with highly modified DNA, and also stabilizes lineages by reducing gene import when sparse modification occurs in the wrong context. The function and distribution of MDE families are thus important. Here we describe the properties of EcoBLMcrX, an enzyme of the E. coli B lineage, in vivo and in vitro. Restriction in vivo and the genome location of its gene, ecoBLmcrX, were determined during construction and sequencing of a B/K-12 hybrid, ER2566. In classical restriction literature, this B system was named r6 or rglAB. Like many genome defense functions, ecoBLmcrX is found within a genomic island, where gene content is variable among natural E. coli isolates. In vitro, EcoBLMcrX was compared with two related enzymes, BceYI and NhoI. All three degrade fully cytosine-modified phage DNA, as expected for EcoBLMcrX from classical T4 genetic data. A new method of characterizing MDE specificity was developed to better understand action on fully-modified targets such as the phage that provide major evolutionary pressure for MDE maintenance. These enzymes also cleave plasmids with m5C in particular motifs, consistent with a role in lineage-stabilization. The recognition sites were characterized using a site-ranking approach that allows visualization of preferred cleavage sites when fully-modified substrates are digested. A technical constraint on the method is that ligation of one-nucleotide 5' extensions favors G:C over A:T approximately five-fold. Taking this bias into account, we conclude that EcoBLMcrX can cleave 3' to the modified base in the motif Rm5C|. This is compatible with, but less specific than, the site reported by others. Highly-modified site contexts, such as those found in base-substituted virulent phages, are

  7. EcoBLMcrX, a classical modification-dependent restriction enzyme in Escherichia coli B: Characterization in vivo and in vitro with a new approach to cleavage site determination.

    Science.gov (United States)

    Fomenkov, Alexey; Sun, Zhiyi; Dila, Deborah K; Anton, Brian P; Roberts, Richard J; Raleigh, Elisabeth A

    2017-01-01

    Here we characterize the modification-dependent restriction enzyme (MDE) EcoBLMcrX in vivo, in vitro and in its genomic environment. MDE cleavage of modified DNAs protects prokaryote populations from lethal infection by bacteriophage with highly modified DNA, and also stabilizes lineages by reducing gene import when sparse modification occurs in the wrong context. The function and distribution of MDE families are thus important. Here we describe the properties of EcoBLMcrX, an enzyme of the E. coli B lineage, in vivo and in vitro. Restriction in vivo and the genome location of its gene, ecoBLmcrX, were determined during construction and sequencing of a B/K-12 hybrid, ER2566. In classical restriction literature, this B system was named r6 or rglAB. Like many genome defense functions, ecoBLmcrX is found within a genomic island, where gene content is variable among natural E. coli isolates. In vitro, EcoBLMcrX was compared with two related enzymes, BceYI and NhoI. All three degrade fully cytosine-modified phage DNA, as expected for EcoBLMcrX from classical T4 genetic data. A new method of characterizing MDE specificity was developed to better understand action on fully-modified targets such as the phage that provide major evolutionary pressure for MDE maintenance. These enzymes also cleave plasmids with m5C in particular motifs, consistent with a role in lineage-stabilization. The recognition sites were characterized using a site-ranking approach that allows visualization of preferred cleavage sites when fully-modified substrates are digested. A technical constraint on the method is that ligation of one-nucleotide 5' extensions favors G:C over A:T approximately five-fold. Taking this bias into account, we conclude that EcoBLMcrX can cleave 3' to the modified base in the motif Rm5C|. This is compatible with, but less specific than, the site reported by others. Highly-modified site contexts, such as those found in base-substituted virulent phages, are strongly preferred.

  8. Problem-Solving Test: Restriction Endonuclease Mapping

    Science.gov (United States)

    Szeberenyi, Jozsef

    2011-01-01

    The term "restriction endonuclease mapping" covers a number of related techniques used to identify specific restriction enzyme recognition sites on small DNA molecules. A method for restriction endonuclease mapping of a 1,000-basepair (bp)-long DNA molecule is described in the fictitious experiment of this test. The most important fact needed to…

  9. Method for introducing unidirectional nested deletions

    Science.gov (United States)

    Dunn, J.J.; Quesada, M.A.; Randesi, M.

    1999-07-27

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector. The cloning vector has an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe. 1 fig.

  10. Correspondence between radioactive and functional methods in the quality control of DNA restriction and modifying enzymes

    DEFF Research Database (Denmark)

    Trujillo, L E; Pupo, E; Miranda, F

    1996-01-01

    We evaluated the use of two radiolabeled lambda DNA/Hpa II substrates to detect 5'-->3', 3'-->5' single and double stranded DNA dependent exonuclease and phosphatase activities found as contaminants in restriction and modifying enzyme preparations. Looking for the meaning of the radioactive assays...... results in a real cloning experience, we performed a cloning simulation assay using the same conditions established for the radioactive assay (enzyme units and pmols of DNA ends). As a result, we found that for degradation percentages of the radioactive DNA substrate per enzyme unit below 0.5, the false...... positives in the cloning stimulation assay were less than 5%. This conditions could ensure a good performance of the enzyme preparations for cloning experiments. Finally, we described the use of the radiolabeled [gamma 33P] ATP lambda Hpa II DNA substrate to detect 5'-->3' single stranded DNA dependent...

  11. Reassessment of QTLs for late blight resistance in the tomato accession L3708 using a restriction site associated DNA (RAD linkage map and highly aggressive isolates of Phytophthora infestans.

    Directory of Open Access Journals (Sweden)

    Ai-Lin Chen

    Full Text Available Tomato late blight caused by the oomycete pathogen Phytophthora infestans (Mont. de Bary is a major threat to tomato production in cool and wet environments. Intensified outbreaks of late blight have been observed globally from the 1980s, and are associated with migration of new and more aggressive populations of P. infestans in the field. The objective of this study was to reassess late blight resistance in the wild tomato accession L3708 (Solanum pimpinellifolium L. against pathogens of different aggressiveness. An F2:3 genetic mapping population was developed using L3708 as the paternal parent. Two isolates of P. infestans, Pi39A and Pi733, were used for inoculation. Pi733 is a highly aggressive genotype that defeats three known late blight resistance genes, Ph-1, Ph-2, and Ph-5t in tomato. In contrast, Pi39A is a less aggressive genotype that defeats only Ph-1. Restriction site Associated DNA Sequencing (RAD-Seq technology was used to massively sequence 90 bp nucleotides adjacent to both sides of PstI restriction enzyme cutting sites in the genome for all individuals in the genetic mapping population. The RAD-seq data were used to construct a genetic linkage map containing 440 single nucleotide polymorphism markers. Quantitative trait locus (QTL analysis identified a new disease-resistant QTL specific to Pi733 on chromosome 2. The Ph-3 gene located on chromosome 9 could be detected whichever isolates were used. This study demonstrated the feasibility and efficiency of RAD-Seq technology for conducting a QTL mapping experiment using an F2:3 mapping population, which allowed the identification of a new late blight resistant QTL in tomato.

  12. Mechanistic studies of ionizing radiation and oxidative mutagenesis: Genetic effects of a single 8-hydroxyguanine (7-hydro-8-oxoguanine) residue inserted at a unique site in a viral genome

    Energy Technology Data Exchange (ETDEWEB)

    Wood, M.L.; Essigmann, J.M. (Massachusetts Institute of Technology, Cambridge (USA)); Dizdaroglu, M.; Gajewski, E. (National Institute of Standards and Technology, Gaithersburg, MD (USA))

    1990-07-31

    T4 RNA ligase was used to construct a deoxypentanucleotide containing a single 8-hydroxyguanine (7-hydro-8-oxoguanine; G{sup 8-OH}) residue, which is one of the putatively mutagenic DNA adducts produced by oxidants and ionizing radiation. The pentamer d(GCTAG{sup 8-OH})p was prepared by the ligation of a chemically synthesized acceptor molecule, d(GCTA), to an adducted donor, 8-hydroxy-2{prime}-deoxyguanosine 5{prime},3{prime}-bisphosphate. Following 3{prime}-dephosphorylation, the pentamer was characterized by UV spectroscopy, by high-pressure liquid chromatography, and by gas chromatography-mass spectrometry of the nucleosides released by enzymatic hydrolysis. Both d(GCTAG{sup 8-OH}) and an unmodified control were 5{prime}-phosphorylated by using ({gamma}-{sup 32}P)ATP and incorporated covalently by DNA ligase into a five-base gap at a unique NheI restriction site in the otherwise duplex genome of an M13mp19 derivative. The adduct was part of a nonsense codon in a unique restriction site in order to facilitate the identification and selection of mutants generated by the replication of the modified genome in Escherichia coli. Both control and adducted pentamers ligated into the genome at 50% of the maximum theoretical efficiency, and nearly all of the site-specifically adducted products possessed pentanucleotides that were covalently linked at both 5{prime} and 3{prime} termini. Transformation of E. coli strain DL7 with the uniquely modified single-stranded genome resulted in {approximately}0.5-1.0% of the progeny phase showing the G {yields} T transversion mutation at the original position of G{sup 8-OH}. The vector containing G{sup 8-OH} also transformed 50-90% as efficiently as the unmodified control, indicating that the adduct can be both weakly cytotoxic and mutagenic to the phase genome.

  13. Preferential role restrictions

    CSIR Research Space (South Africa)

    Britz, K

    2013-07-01

    Full Text Available We extend the Description Logic ALC with preferential role restrictions as class constructs, and argue that preferential universal restriction represents a defeasible version of standard universal restriction. The resulting DL is more expressive...

  14. Assaying multiple restriction endonucleases functionalities and inhibitions on DNA microarray with multifunctional gold nanoparticle probes.

    Science.gov (United States)

    Ma, Lan; Zhu, Zhijun; Li, Tao; Wang, Zhenxin

    2014-02-15

    Herein, a double-stranded (ds) DNA microarray-based resonance light scattering (RLS) assay with multifunctional gold nanoparticle (GNP) probes has been developed for studying restriction endonuclease functionality and inhibition. Because of decreasing significantly melting temperature, the enzyme-cleaved dsDNAs easily unwind to form single-stranded (ss) DNAs. The ssDNAs are hybridized with multiplex complementary ssDNAs functionalized GNP probes followed by silver enhancement and RLS detection. Three restriction endonucleases (EcoRI, BamHI and EcoRV) and three potential inhibitors (doxorubicin hydrochloride (DOX), ethidium bromide (EB) and an EcoRI-derived helical peptide (α4)) were selected to demonstrate capability of the assay. Enzyme activities of restriction endonucleases are detected simultaneously with high specificity down to the limits of 2.0 × 10(-2)U/mL for EcoRI, 1.1 × 10(-2)U/mL for BamHI and 1.6 × 10(-2)U/mL for EcoRV, respectively. More importantly, the inhibitory potencies of three inhibitors are showed quantitatively, indicating that our approach has great promise for high-throughput screening of restriction endonuclease inhibitors. © 2013 Elsevier B.V. All rights reserved.

  15. The Type ISP Restriction-Modification enzymes LlaBIII and LlaGI use a translocation-collision mechanism to cleave non-specific DNA distant from their recognition sites.

    Science.gov (United States)

    Šišáková, Eva; van Aelst, Kara; Diffin, Fiona M; Szczelkun, Mark D

    2013-01-01

    The Type ISP Restriction-Modification (RM) enzyme LlaBIII is encoded on plasmid pJW566 and can protect Lactococcus lactis strains against bacteriophage infections in milk fermentations. It is a single polypeptide RM enzyme comprising Mrr endonuclease, DNA helicase, adenine methyltransferase and target-recognition domains. LlaBIII shares >95% amino acid sequence homology across its first three protein domains with the Type ISP enzyme LlaGI. Here, we determine the recognition sequence of LlaBIII (5'-TnAGCC-3', where the adenine complementary to the underlined base is methylated), and characterize its enzyme activities. LlaBIII shares key enzymatic features with LlaGI; namely, adenosine triphosphate-dependent DNA translocation (∼309 bp/s at 25°C) and a requirement for DNA cleavage of two recognition sites in an inverted head-to-head repeat. However, LlaBIII requires K(+) ions to prevent non-specific DNA cleavage, conditions which affect the translocation and cleavage properties of LlaGI. By identifying the locations of the non-specific dsDNA breaks introduced by LlaGI or LlaBIII under different buffer conditions, we validate that the Type ISP RM enzymes use a common translocation-collision mechanism to trigger endonuclease activity. In their favoured in vitro buffer, both LlaGI and LlaBIII produce a normal distribution of random cleavage loci centred midway between the sites. In contrast, LlaGI in K(+) ions produces a far more distributive cleavage profile.

  16. Isothermal detection of RNA with restriction endonucleases.

    Science.gov (United States)

    Yan, Lei; Nakayama, Shizuka; Yitbarek, Saron; Greenfield, Isabel; Sintim, Herman O

    2011-01-07

    Herein, we demonstrate how to detect nucleic acids that do not contain restriction endonuclease recognition sites with restriction endonucleases. We show that the topology of DNA probes used in this detection strategy remarkably affects the efficiency of RNA/DNA detection.

  17. Massively parallel characterization of restriction endonucleases.

    Science.gov (United States)

    Kamps-Hughes, Nick; Quimby, Aine; Zhu, Zhenyu; Johnson, Eric A

    2013-06-01

    Restriction endonucleases are highly specific in recognizing the particular DNA sequence they act on. However, their activity is affected by sequence context, enzyme concentration and buffer composition. Changes in these factors may lead to either ineffective cleavage at the cognate restriction site or relaxed specificity allowing cleavage of degenerate 'star' sites. Additionally, uncharacterized restriction endonucleases and engineered variants present novel activities. Traditionally, restriction endonuclease activity is assayed on simple substrates such as plasmids and synthesized oligonucleotides. We present and use high-throughput Illumina sequencing-based strategies to assay the sequence specificity and flanking sequence preference of restriction endonucleases. The techniques use fragmented DNA from sequenced genomes to quantify restriction endonuclease cleavage on a complex genomic DNA substrate in a single reaction. By mapping millions of restriction site-flanking reads back to the Escherichia coli and Drosophila melanogaster genomes we were able to quantitatively characterize the cognate and star site activity of EcoRI and MfeI and demonstrate genome-wide decreases in star activity with engineered high-fidelity variants EcoRI-HF and MfeI-HF, as well as quantify the influence on MfeI cleavage conferred by flanking nucleotides. The methods presented are readily applicable to all type II restriction endonucleases that cleave both strands of double-stranded DNA.

  18. A generalized method of subcloning DNA fragments by restriction site reconstruction: application to sequencing the amino-terminal coding region of the transforming gene of Gazdar murine sarcoma virus.

    Science.gov (United States)

    Donoghue, D J; Hunter, T

    1982-01-01

    The technique of restriction site reconstruction was generalized so as to allow the subcloning of any DNA fragment and its subsequent reexcision with EcoRI, XbaI, XhoI or HindIII. After excision, the 3' terminus of each strand will be derived from the starting nucleic acid, permitting the use of such fragments as primers for nucleotide sequencing by primer extension methods. The technique was used to subclone a 56 base pair BstNI-DdeI fragment of Moloney murine sarcoma virus (Mo-MSV) as a unique HindIII-HindIII fragment. This fragment then served as a primer to sequence a portion of the RNA genome of Gazdar murine sarcoma virus (Gz-MSV). The nucleotide sequence which was obtained indicated that the transforming gene of Gz-MSV arose by at least two recombination events involving murine leukemia virus (MLV) and the cellular homologue c-mos. This analysis suggests that a virus indistinguishable from Mo-MSV was an intermediate in the formation of Gz-MSV. Images PMID:6281735

  19. Genome-Wide SNP Discovery and Analysis of Genetic Diversity in Farmed Sika Deer (Cervus nippon) in Northeast China Using Double-Digest Restriction Site-Associated DNA Sequencing.

    Science.gov (United States)

    Ba, Hengxing; Jia, Boyin; Wang, Guiwu; Yang, Yifeng; Kedem, Gilead; Li, Chunyi

    2017-09-07

    Sika deer are an economically valuable species owing to their use in traditional Chinese medicine, particularly their velvet antlers. Sika deer in northeast China are mostly farmed in enclosure. Therefore, genetic management of farmed sika deer would benefit from detailed knowledge of their genetic diversity. In this study, we generated over 1.45 billion high-quality paired-end reads (288 Gbp) across 42 unrelated individuals using double-digest restriction site-associated DNA sequencing (ddRAD-seq). A total of 96,188 (29.63%) putative biallelic SNP loci were identified with an average sequencing depth of 23×. Based on the analysis, we found that the majority of the loci had a deficit of heterozygotes (F IS >0) and low values of H obs , which could be due to inbreeding and Wahlund effects. We also developed a collection of high-quality SNP probes that will likely be useful in a variety of applications in genotyping for cervid species in the future. Copyright © 2017 Ba et al.

  20. Genome-Wide Mapping of Growth-Related Quantitative Trait Loci in Orange-Spotted Grouper (Epinephelus coioides) Using Double Digest Restriction-Site Associated DNA Sequencing (ddRADseq).

    Science.gov (United States)

    Yu, Hui; You, Xinxin; Li, Jia; Liu, Hankui; Meng, Zining; Xiao, Ling; Zhang, Haifa; Lin, Hao-Ran; Zhang, Yong; Shi, Qiong

    2016-04-06

    Mapping of quantitative trait loci (QTL) is essential for the discovery of genetic structures that related to complex quantitative traits. In this study, we identified 264,072 raw SNPs (single-nucleotide polymorphisms) by double digest restriction site associated DNA sequencing (ddRADseq), and utilized 3029 of these SNPs to construct a genetic linkage map in orange-spotted grouper (Epinephelus coioides) using a regression mapping algorithm. The genetic map contained 24 linkage groups (LGs) spanning a total genetic distance of 1231.98 cM. Twenty-seven significant growth-related QTLs were identified. Furthermore, we identified 17 genes (fez2, alg3, ece2, arvcf, sla27a4, sgk223, camk2, prrc2b, mchr1, sardh, pappa, syk, tert, wdrcp91, ftz-f1, mate1 and notch1) including three (tert, ftz-f1 and notch1) that have been reported to be involved in fish growth. To summarize, we mapped growth-related QTLs in the orange-spotted grouper. These QTLs will be useful in marker-assisted selection (MAS) efforts to improve growth-related traits in this economically important fish.

  1. Genome-Wide Mapping of Growth-Related Quantitative Trait Loci in Orange-Spotted Grouper (Epinephelus coioides Using Double Digest Restriction-Site Associated DNA Sequencing (ddRADseq

    Directory of Open Access Journals (Sweden)

    Hui Yu

    2016-04-01

    Full Text Available Mapping of quantitative trait loci (QTL is essential for the discovery of genetic structures that related to complex quantitative traits. In this study, we identified 264,072 raw SNPs (single-nucleotide polymorphisms by double digest restriction site associated DNA sequencing (ddRADseq, and utilized 3029 of these SNPs to construct a genetic linkage map in orange-spotted grouper (Epinephelus coioides using a regression mapping algorithm. The genetic map contained 24 linkage groups (LGs spanning a total genetic distance of 1231.98 cM. Twenty-seven significant growth-related QTLs were identified. Furthermore, we identified 17 genes (fez2, alg3, ece2, arvcf, sla27a4, sgk223, camk2, prrc2b, mchr1, sardh, pappa, syk, tert, wdrcp91, ftz-f1, mate1 and notch1 including three (tert, ftz-f1 and notch1 that have been reported to be involved in fish growth. To summarize, we mapped growth-related QTLs in the orange-spotted grouper. These QTLs will be useful in marker-assisted selection (MAS efforts to improve growth-related traits in this economically important fish.

  2. Genome-Wide Mapping of Growth-Related Quantitative Trait Loci in Orange-Spotted Grouper (Epinephelus coioides) Using Double Digest Restriction-Site Associated DNA Sequencing (ddRADseq)

    Science.gov (United States)

    Yu, Hui; You, Xinxin; Li, Jia; Liu, Hankui; Meng, Zining; Xiao, Ling; Zhang, Haifa; Lin, Hao-Ran; Zhang, Yong; Shi, Qiong

    2016-01-01

    Mapping of quantitative trait loci (QTL) is essential for the discovery of genetic structures that related to complex quantitative traits. In this study, we identified 264,072 raw SNPs (single-nucleotide polymorphisms) by double digest restriction site associated DNA sequencing (ddRADseq), and utilized 3029 of these SNPs to construct a genetic linkage map in orange-spotted grouper (Epinephelus coioides) using a regression mapping algorithm. The genetic map contained 24 linkage groups (LGs) spanning a total genetic distance of 1231.98 cM. Twenty-seven significant growth-related QTLs were identified. Furthermore, we identified 17 genes (fez2, alg3, ece2, arvcf, sla27a4, sgk223, camk2, prrc2b, mchr1, sardh, pappa, syk, tert, wdrcp91, ftz-f1, mate1 and notch1) including three (tert, ftz-f1 and notch1) that have been reported to be involved in fish growth. To summarize, we mapped growth-related QTLs in the orange-spotted grouper. These QTLs will be useful in marker-assisted selection (MAS) efforts to improve growth-related traits in this economically important fish. PMID:27058532

  3. A User-Friendly Method for Teaching Restriction Enzyme Mapping.

    Science.gov (United States)

    Ehrman, Patrick

    1990-01-01

    Presented is a teaching progression that enhances learning through low-cost, manipulative transparencies. Discussed is instruction about restriction enzymes, plasmids, cutting plasmids, plasmid maps, recording data, and mapping restriction sites. Mapping wheels for student use is included. (CW)

  4. MmoSTI restriction endonuclease, isolated from Morganella morganii infecting a tropical moth, Actias selene, cleaving 5'-|CCNGG-3' sequences.

    Science.gov (United States)

    Skowron, Marta A; Zebrowska, Joanna; Wegrzyn, Grzegorz; Skowron, Piotr M

    2016-02-01

    A type II restriction endonuclease, MmoSTI, from the pathogenic bacterium Morganella morganii infecting a tropical moth, Actias selene, has been detected and biochemically characterized, as a potential etiological differentiation factor. The described REase recognizes interrupted palindromes, i.e., 5'-CCNGG-3' sequences and cleaves DNA leaving 5-nucleotide (nt) long, single-stranded (ss), 5'-cohesive ends, which was determined by three complementary methods: (i) cleavage of custom and standard DNA substrates, (ii) run-off sequencing of cleavage products, and (iii) shotgun cloning and sequencing of bacteriophage lambda (λ) DNA digested with MmoSTI. MmoSTI, the first 5'-CCNGG-3' REase characterized from M. morganii, is a neoschizomer of ScrFI, which cleaves DNA leaving 1-nt long, ss, 5'-cohesive ends. It is a high-frequency cutter and can be isolated from easily cultured bacteria, thus it can potentially serve as a tool for DNA manipulations.

  5. Leptin gene polymorphism in Indian Sahiwal cattle by single strand ...

    African Journals Online (AJOL)

    These leptin gene variants can be sequenced and screened in the entire population to develop single nucleotide polymorphisms (SNPs) for association studies with different productive and reproductive performances and marker assisted selection. Keywords: Leptin gene, PCR-SSCP, genetic variability, dairy cattle

  6. The Restriction Fragment Map of Rat-Liver Mitochondrial DNA : A Reconsideration

    NARCIS (Netherlands)

    Pepe, G.; Bakker, H.; Holtrop, M.; Bollen, J.E.; Bruggen, E.F.J. van; Cantatore, P.; Terpstra, P.; Saccone, C.

    1977-01-01

    1. Rat-liver mitochondrial DNA (mtDNA) contains at least 8 cleavage sites for the restriction endonuclease Eco RI, 6 for the restriction endonuclease Hind III, 2 for the restriction endonuclease Bam HI and 11 for the restriction endonuclease Hap II. 2. The physical map of the restriction fragments

  7. Restrictions and Proportionality

    DEFF Research Database (Denmark)

    Werlauff, Erik

    2009-01-01

    The article discusses three central aspects of the freedoms under European Community law, namely 1) the prohibition against restrictions as an important extension of the prohibition against discrimination, 2) a prohibition against exit restrictions which is just as important as the prohibition...... against host country restrictions, but which is often not recognised to the same extent by national law, and 3) the importance of also identifying and recognising an exit restriction, so that it is possible to achieve the required test of appropriateness and proportionality in relation to the rule...

  8. New restriction endonucleases from Acetobacter aceti and Bacillus aneurinolyticus.

    Science.gov (United States)

    Sugisaki, H; Maekawa, Y; Kanazawa, S; Takanami, M

    1982-10-11

    Two restriction endonucleases with new sequence specificities have been isolated from Acetobacter aceti IFO 3281 and Bacillus aneurinolyticus IAM 1077 and named AatII and BanII, respectively. Based on analysis of the sequences around the restriction sites, the recognition sequences and cleavage sites of these endonucleases were deduced as below: (formula; see text)

  9. New restriction endonucleases from Acetobacter aceti and Bacillus aneurinolyticus.

    OpenAIRE

    Sugisaki, H; Maekawa, Y; Kanazawa, S; Takanami, M

    1982-01-01

    Two restriction endonucleases with new sequence specificities have been isolated from Acetobacter aceti IFO 3281 and Bacillus aneurinolyticus IAM 1077 and named AatII and BanII, respectively. Based on analysis of the sequences around the restriction sites, the recognition sequences and cleavage sites of these endonucleases were deduced as below: (formula; see text)

  10. Restricting wolves risks escape

    Science.gov (United States)

    Mech, L. David; Ballard, Warren; Bangs, Ed; Ream, Bob

    2010-01-01

    Implementing the proposal set forth by Licht and colleagues (BioScience 60: 147–153) requires restricting wolves to tiny "islands," areas that are magnitudes smaller than the ranges of most wolf populations. Wolves naturally have large ranges; restricting their spatial needs increases the risk of wolves escaping, exacerbating public relations and political and legal problems.

  11. An investigation of the structural requirements for ATP hydrolysis and DNA cleavage by the EcoKI Type I DNA restriction and modification enzyme

    Science.gov (United States)

    Roberts, Gareth A.; Cooper, Laurie P.; White, John H.; Su, Tsueu-Ju; Zipprich, Jakob T.; Geary, Paul; Kennedy, Cowan; Dryden, David T. F.

    2011-01-01

    Type I DNA restriction/modification systems are oligomeric enzymes capable of switching between a methyltransferase function on hemimethylated host DNA and an endonuclease function on unmethylated foreign DNA. They have long been believed to not turnover as endonucleases with the enzyme becoming inactive after cleavage. Cleavage is preceded and followed by extensive ATP hydrolysis and DNA translocation. A role for dissociation of subunits to allow their reuse has been proposed for the EcoR124I enzyme. The EcoKI enzyme is a stable assembly in the absence of DNA, so recycling was thought impossible. Here, we demonstrate that EcoKI becomes unstable on long unmethylated DNA; reuse of the methyltransferase subunits is possible so that restriction proceeds until the restriction subunits have been depleted. We observed that RecBCD exonuclease halts restriction and does not assist recycling. We examined the DNA structure required to initiate ATP hydrolysis by EcoKI and find that a 21-bp duplex with single-stranded extensions of 12 bases on either side of the target sequence is sufficient to support hydrolysis. Lastly, we discuss whether turnover is an evolutionary requirement for restriction, show that the ATP hydrolysis is not deleterious to the host cell and discuss how foreign DNA occasionally becomes fully methylated by these systems. PMID:21685455

  12. The design of artificial retroviral restriction factors

    International Nuclear Information System (INIS)

    Yap, Melvyn W.; Mortuza, Gulnahar B.; Taylor, Ian A.; Stoye, Jonathan P.

    2007-01-01

    In addition to the ability to bind the retroviral capsid protein, the retroviral restriction factors Fv1, Trim5α and Trim5-CypA share the common property of containing sequences that promote self-association. Otherwise Fv1 and Trim5α appear unrelated. Mutational analyses showed that restriction was invariably lost when changes designed to disrupt the sequences responsible for multimerization were introduced. A novel restriction protein could be obtained by substituting sequences from the self-associating domain of Fv1 for the Trim5 sequences in Trim5-CypA. Similarly, a fusion protein containing cyclophilin A joined to arfaptin2, a protein known to form extended dimers, was also shown to restrict HIV-1. Hence, multimerization of a capsid-binding domain could be the common minimum design feature for capsid-dependent retroviral restriction factors. However, not all domains that promote multimerization can substitute for the N-terminal domains of Fv1 and Trim5α. Moreover, only CypA can provide a capsid-binding site with different N-terminal domains. It is suggested that the spatial relationship between the multiple target binding sites may be important for restriction

  13. Energy restriction and potential energy restriction mimetics.

    Science.gov (United States)

    Nikolai, Sibylle; Pallauf, Kathrin; Huebbe, Patricia; Rimbach, Gerald

    2015-12-01

    Energy restriction (ER; also known as caloric restriction) is the only nutritional intervention that has repeatedly been shown to increase lifespan in model organisms and may delay ageing in humans. In the present review we discuss current scientific literature on ER and its molecular, metabolic and hormonal effects. Moreover, criteria for the classification of substances that might induce positive ER-like changes without having to reduce energy intake are summarised. Additionally, the putative ER mimetics (ERM) 2-deoxy-d-glucose, metformin, rapamycin, resveratrol, spermidine and lipoic acid and their suggested molecular targets are discussed. While there are reports on these ERM candidates that describe lifespan extension in model organisms, data on longevity-inducing effects in higher organisms such as mice remain controversial or are missing. Furthermore, some of these candidates produce detrimental side effects such as immunosuppression or lactic acidosis, or have not been tested for safety in long-term studies. Up to now, there are no known ERM that could be recommended without limitations for use in humans.

  14. Determination of genotype differences through restriction ...

    African Journals Online (AJOL)

    Tyrosinase gene or C locus has long been implicated in the coat colour determination. This gene a copper-containing enzyme located on chromosome 11q14.3 is expressed in melanocytes and controls the major steps in pigment production. In camel, C locus a restriction site provoked by the T variant of the mutation was ...

  15. Late gestational nutrient restriction

    DEFF Research Database (Denmark)

    Tygesen, Malin Plumhoff; Nielsen, Mette Olaf; Nørgaard, Peder

    2008-01-01

    We investigated the effect of 50% nutrient restriction during the last 6 weeks of gestation on twin-pregnant ewes' plasma glucose, non-esterified fatty acid, ß-hydroxybutyrate, insulin, IGF-1 and leptin concentrations and the effects on lamb birth weight and ewes' lactation performance. Plasma...... metabolite and hormone concentrations in restricted ewes suggest that maternal tissues were being mobilised. Despite the ewes' adaptations their lambs weighed significantly less at birth. Furthermore, colostrum and milk yields were markedly reduced up until the latest measurement at 3 weeks post partum...... despite adlibitum access to feed. Reduced milk yields coincided with reduced plasma IGF-1 concentration pre partum in nutrient restricted ewes indicating, that mammary gland development may have been compromised. The present data suggest that leptin is not involved in the regulation of early lactation...

  16. Protein restriction and cancer.

    Science.gov (United States)

    Yin, Jie; Ren, Wenkai; Huang, Xingguo; Li, Tiejun; Yin, Yulong

    2018-03-26

    Protein restriction without malnutrition is currently an effective nutritional intervention known to prevent diseases and promote health span from yeast to human. Recently, low protein diets are reported to be associated with lowered cancer incidence and mortality risk of cancers in human. In murine models, protein restriction inhibits tumor growth via mTOR signaling pathway. IGF-1, amino acid metabolic programing, FGF21, and autophagy may also serve as potential mechanisms of protein restriction mediated cancer prevention. Together, dietary intervention aimed at reducing protein intake can be beneficial and has the potential to be widely adopted and effective in preventing and treating cancers. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Training Restricted Boltzmann Machines

    DEFF Research Database (Denmark)

    Fischer, Asja

    Restricted Boltzmann machines (RBMs) are probabilistic graphical models that can also be interpreted as stochastic neural networks. Training RBMs is known to be challenging. Computing the likelihood of the model parameters or its gradient is in general computationally intensive. Thus, training...

  18. Type I restriction endonucleases are true catalytic enzymes.

    Science.gov (United States)

    Bianco, Piero R; Xu, Cuiling; Chi, Min

    2009-06-01

    Type I restriction endonucleases are intriguing, multifunctional complexes that restrict DNA randomly, at sites distant from the target sequence. Restriction at distant sites is facilitated by ATP hydrolysis-dependent, translocation of double-stranded DNA towards the stationary enzyme bound at the recognition sequence. Following restriction, the enzymes are thought to remain associated with the DNA at the target site, hydrolyzing copious amounts of ATP. As a result, for the past 35 years type I restriction endonucleases could only be loosely classified as enzymes since they functioned stoichiometrically relative to DNA. To further understand enzyme mechanism, a detailed analysis of DNA cleavage by the EcoR124I holoenzyme was done. We demonstrate for the first time that type I restriction endonucleases are not stoichiometric but are instead catalytic with respect to DNA. Further, the mechanism involves formation of a dimer of holoenzymes, with each monomer bound to a target sequence and, following cleavage, each dissociates in an intact form to bind and restrict subsequent DNA molecules. Therefore, type I restriction endonucleases, like their type II counterparts, are true enzymes. The conclusion that type I restriction enzymes are catalytic relative to DNA has important implications for the in vivo function of these previously enigmatic enzymes.

  19. Distribution, abundance and properties of restriction enzymes On ...

    African Journals Online (AJOL)

    Distribution, abundance and properties of restriction enzymes On genomic dna of granule-bound starch synthase i and ii in Cassava ( Manihot Esculenta ... Ife Journal of Science ... Thirty-one sites of 16 restriction enzymes were evenly distributed on 721 base-pair granule-bound starch synthase I (GBSS I) genomic DNA.

  20. 25 CFR 248.9 - Camping and use restrictions.

    Science.gov (United States)

    2010-04-01

    ...-LIEU FISHING SITES § 248.9 Camping and use restrictions. All camping, picnicking, use of alcoholic... commercial purchase of fish) shall be subject to such prohibitions, restrictions, or other regulations as the... applicable; provided that no fee may be charged to any Indian or member of his family for any such use. ...

  1. Recommendations and Justifications for Modifications for Use Restrictions Established under the U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office Federal Facility Agreement and Consent Order, Revision 0

    International Nuclear Information System (INIS)

    Lynn Kidman

    2008-01-01

    This document is part of an effort to re-evaluate all FFACO URs against the current RBCA criteria (referred to in this document as the Industrial Sites [IS] RBCA process) as defined in the Industrial Sites Project Establishment of Final Action Levels (NNSA/NSO, 2006c). Based on this evaluation, the URs were sorted into the following categories: (1) Where sufficient information exists to determine that the current UR is consistent with the RCBA criteria; (2) Where sufficient information exists to determine that the current UR may be removed or downgraded based on RCBA criteria; (3) Where sufficient information does not exist to evaluate the current UR against the RCBA criteria. After reviewing all the existing FFACO URs, the 49 URs addressed in this document have sufficient information to determine that these current URs may be removed or downgraded based on RCBA criteria. This document presents recommendations on modifications to existing URs that will be consistent with the RCBA criteria

  2. Restricted and quasi-toral restricted Lie-Rinehart algebras

    Directory of Open Access Journals (Sweden)

    Sun Bing

    2015-09-01

    Full Text Available In this paper, we introduce the definition of restrictable Lie-Rinehart algebras, the concept of restrictability is by far more tractable than that of a restricted Lie-Rinehart algebra. Moreover, we obtain some properties of p-mappings and restrictable Lie-Rinehart algebras. Finally, we give some sufficient conditions for the commutativity of quasi-toral restricted Lie-Rinehart algebras and study how a quasi-toral restricted Lie-Rinehart algebra with zero center and of minimal dimension should be.

  3. Bacterial Autoimmunity Due to a Restriction-Modification System.

    Science.gov (United States)

    Pleška, Maroš; Qian, Long; Okura, Reiko; Bergmiller, Tobias; Wakamoto, Yuichi; Kussell, Edo; Guet, Călin C

    2016-02-08

    Restriction-modification (RM) systems represent a minimal and ubiquitous biological system of self/non-self discrimination in prokaryotes [1], which protects hosts from exogenous DNA [2]. The mechanism is based on the balance between methyltransferase (M) and cognate restriction endonuclease (R). M tags endogenous DNA as self by methylating short specific DNA sequences called restriction sites, whereas R recognizes unmethylated restriction sites as non-self and introduces a double-stranded DNA break [3]. Restriction sites are significantly underrepresented in prokaryotic genomes [4-7], suggesting that the discrimination mechanism is imperfect and occasionally leads to autoimmunity due to self-DNA cleavage (self-restriction) [8]. Furthermore, RM systems can promote DNA recombination [9] and contribute to genetic variation in microbial populations, thus facilitating adaptive evolution [10]. However, cleavage of self-DNA by RM systems as elements shaping prokaryotic genomes has not been directly detected, and its cause, frequency, and outcome are unknown. We quantify self-restriction caused by two RM systems of Escherichia coli and find that, in agreement with levels of restriction site avoidance, EcoRI, but not EcoRV, cleaves self-DNA at a measurable rate. Self-restriction is a stochastic process, which temporarily induces the SOS response, and is followed by DNA repair, maintaining cell viability. We find that RM systems with higher restriction efficiency against bacteriophage infections exhibit a higher rate of self-restriction, and that this rate can be further increased by stochastic imbalance between R and M. Our results identify molecular noise in RM systems as a factor shaping prokaryotic genomes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Restrictions of anthelmintic usage

    DEFF Research Database (Denmark)

    Nielsen, Martin Krarup

    2009-01-01

    in 1966. The province of Quebec in Canada, and an increasing number of European countries, have implemented prescription-only restrictions on anthelmintic drugs. Denmark introduced this legislation ten years ago, and some evidence has been generated describing potential consequences. It is without dispute...... that Danish veterinarians are now deeply involved with parasite management in equine establishments. However, little is known about the impact on levels of anthelmintic resistance and the risk of parasitic disease under these circumstances. In addition, the legislation makes huge demands on diagnosis...

  5. Temporal dynamics of methyltransferase and restriction endonuclease accumulation in individual cells after introducing a restriction-modification system

    Science.gov (United States)

    Morozova, Natalia; Sabantsev, Anton; Bogdanova, Ekaterina; Fedorova, Yana; Maikova, Anna; Vedyaykin, Alexey; Rodic, Andjela; Djordjevic, Marko; Khodorkovskii, Mikhail; Severinov, Konstantin

    2016-01-01

    Type II restriction-modification (R-M) systems encode a restriction endonuclease that cleaves DNA at specific sites, and a methyltransferase that modifies same sites protecting them from restriction endonuclease cleavage. Type II R-M systems benefit bacteria by protecting them from bacteriophages. Many type II R-M systems are plasmid-based and thus capable of horizontal transfer. Upon the entry of such plasmids into a naïve host with unmodified genomic recognition sites, methyltransferase should be synthesized first and given sufficient time to methylate recognition sites in the bacterial genome before the toxic restriction endonuclease activity appears. Here, we directly demonstrate a delay in restriction endonuclease synthesis after transformation of Escherichia coli cells with a plasmid carrying the Esp1396I type II R-M system, using single-cell microscopy. We further demonstrate that before the appearance of the Esp1396I restriction endonuclease the intracellular concentration of Esp1396I methyltransferase undergoes a sharp peak, which should allow rapid methylation of host genome recognition sites. A mathematical model that satisfactorily describes the observed dynamics of both Esp1396I enzymes is presented. The results reported here were obtained using a functional Esp1396I type II R-M system encoding both enzymes fused to fluorescent proteins. Similar approaches should be applicable to the studies of other R-M systems at single-cell level. PMID:26687717

  6. Temporal dynamics of methyltransferase and restriction endonuclease accumulation in individual cells after introducing a restriction-modification system.

    Science.gov (United States)

    Morozova, Natalia; Sabantsev, Anton; Bogdanova, Ekaterina; Fedorova, Yana; Maikova, Anna; Vedyaykin, Alexey; Rodic, Andjela; Djordjevic, Marko; Khodorkovskii, Mikhail; Severinov, Konstantin

    2016-01-29

    Type II restriction-modification (R-M) systems encode a restriction endonuclease that cleaves DNA at specific sites, and a methyltransferase that modifies same sites protecting them from restriction endonuclease cleavage. Type II R-M systems benefit bacteria by protecting them from bacteriophages. Many type II R-M systems are plasmid-based and thus capable of horizontal transfer. Upon the entry of such plasmids into a naïve host with unmodified genomic recognition sites, methyltransferase should be synthesized first and given sufficient time to methylate recognition sites in the bacterial genome before the toxic restriction endonuclease activity appears. Here, we directly demonstrate a delay in restriction endonuclease synthesis after transformation of Escherichia coli cells with a plasmid carrying the Esp1396I type II R-M system, using single-cell microscopy. We further demonstrate that before the appearance of the Esp1396I restriction endonuclease the intracellular concentration of Esp1396I methyltransferase undergoes a sharp peak, which should allow rapid methylation of host genome recognition sites. A mathematical model that satisfactorily describes the observed dynamics of both Esp1396I enzymes is presented. The results reported here were obtained using a functional Esp1396I type II R-M system encoding both enzymes fused to fluorescent proteins. Similar approaches should be applicable to the studies of other R-M systems at single-cell level. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. The Restriction Endonuclease Cleavage Map of Rat Liver Mitochondrial DNA

    NARCIS (Netherlands)

    Bakker, H.; Holtrop, M.; Terpstra, P.

    1977-01-01

    Mitochondrial DNA from rat liver contains six sites for cleavage by the restriction endonucleases Hind III and EcoRI. A large stretch of DNA, comprising about 40% of the mitochondrial genome is not cleaved by either of the enzymes; eight cleavage sites are located on a DNA stretch of 35% of the

  8. In silico analysis of evolutionary patterns in restriction endonucleases.

    Science.gov (United States)

    Singh, Tiratha Raj; Pardasani, Kamal Raj

    2009-01-01

    Restriction endonucleases represent one of the best studied examples of DNA binding proteins. Type II restriction endonucleases recognize short sequences of foreign DNA and cleave the target on both strands with remarkable sequence specificity. Type II restriction endonucleases are part of restriction modification systems. Restriction modification systems occur ubiquitously among bacteria and archaea. Restriction endonucleases are indispensable tools in molecular biology and biotechnology. They are important model system for specific protein-nucleic acid interactions and also serve as good example for investigating structural, functional and evolutionary relationships among various biomolecules. The interaction between restriction endonucleases and their recognition sequences plays a crucial role in biochemical activities like catalytic site/metal binding, DNA repair and recombination etc. We study various patterns in restriction endonucleases type II and analyzed their structural, functional and evolutionary role. Our studies support X-ray crystallographic studies, arguing for divergence and molecular evolution. Conservation patterns of the nuclease superfamily have also been analyzed by estimating site-specific evolutionary rates for the analyzed structures related to respective chains in this study.

  9. The Table Mountain Field Site

    Data.gov (United States)

    Federal Laboratory Consortium — The Table Mountain Field Site, located north of Boulder, Colorado, is designated as an area where the magnitude of strong, external signals is restricted (by State...

  10. Property Rights, Restrictions and Responsibilities

    DEFF Research Database (Denmark)

    Enemark, Stig

    more to a social, ethical commitment or attitude to environmental sustainability and good husbandry. This paper provides an overall understanding of the concept of land administration systems for dealing with rights, restrictions and responsibilities in future spatially enabled government. Finally......Land Administration Systems are the basis for conceptualizing rights, restrictions and responsibilities related to people, policies and places. Property rights are normally concerned with ownership and tenure whereas restrictions usually control use and activities on land. Responsibilities relate...

  11. Chemical repair activity of free radical scavenger edaravone: reduction reactions with dGMP hydroxyl radical adducts and suppression of base lesions and AP sites on irradiated plasmid DNA.

    Science.gov (United States)

    Hata, Kuniki; Urushibara, Ayumi; Yamashita, Shinichi; Lin, Mingzhang; Muroya, Yusa; Shikazono, Naoya; Yokoya, Akinari; Fu, Haiying; Katsumura, Yosuke

    2015-01-01

    Reactions of edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one) with deoxyguanosine monophosphate (dGMP) hydroxyl radical adducts were investigated by pulse radiolysis technique. Edaravone was found to reduce the dGMP hydroxyl radical adducts through electron transfer reactions. The rate constants of the reactions were greater than 4 × 10(8) dm(3) mol(-1) s(-1) and similar to those of the reactions of ascorbic acid, which is a representative antioxidant. Yields of single-strand breaks, base lesions, and abasic sites produced in pUC18 plasmid DNA by gamma ray irradiation in the presence of low concentrations (10-1000 μmol dm(-3)) of edaravone were also quantified, and the chemical repair activity of edaravone was estimated by a method recently developed by the authors. By comparing suppression efficiencies to the induction of each DNA lesion, it was found that base lesions and abasic sites were suppressed by the chemical repair activity of edaravone, although the suppression of single-strand breaks was not very effective. This phenomenon was attributed to the chemical repair activity of edaravone toward base lesions and abasic sites. However, the chemical repair activity of edaravone for base lesions was lower than that of ascorbic acid. © The Author 2014. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

  12. Restriction endonucleases: classification, properties, and applications.

    Science.gov (United States)

    Williams, Raymond J

    2003-03-01

    Restriction endonucleases have become a fundamental tool of molecular biology with many commercial vendors and extensive product lines. While a significant amount has been learned about restriction enzyme diversity, genomic organization, and mechanism, these continue to be active areas of research and assist in classification efforts. More recently, one focus has been their exquisite specificity for the proper recognition sequence and the lack of homology among enzymes recognizing the same DNA sequence. Some questions also remain regarding in vivo function. Site-directed mutagenesis and fusion proteins based on known endonucleases show promise for custom-designed cleavage. An understanding of the enzymes and their properties can improve their productive application by maintaining critical digest parameters and enhancing or avoiding alternative activities.

  13. REBASE--enzymes and genes for DNA restriction and modification.

    Science.gov (United States)

    Roberts, Richard J; Vincze, Tamas; Posfai, Janos; Macelis, Dana

    2007-01-01

    REBASE is a comprehensive database of information about restriction enzymes, DNA methyltransferases and related proteins involved in the biological process of restriction-modification. It contains fully referenced information about recognition and cleavage sites, isoschizomers, neoschizomers, commercial availability, methylation sensitivity, crystal and sequence data. Experimentally characterized homing endonucleases are also included. All newly sequenced genomes are analyzed for the presence of putative restriction systems and these data are included within the REBASE. The contents or REBASE may be browsed from the web (http://rebase.neb.com/rebase/rebase.ftp.html) and selected compilations can be downloaded by ftp (ftp.neb.com). Additionally, monthly updates can be requested via email.

  14. REtools: A laboratory program for restriction enzyme work: enzyme selection and reaction condition assistance

    OpenAIRE

    Boulukos Kim E; Martin Patrick; Pognonec Philippe

    2006-01-01

    Abstract Background Restriction enzymes are one of the everyday tools used in molecular biology. The continuously expanding panel of known restriction enzymes (several thousands) renders their optimal use virtually impossible without computerized assistance. Several manufacturers propose on-line sites that assist scientists in their restriction enzyme work, however, none of these sites meet all the actual needs of laboratory workers, and they do not take into account the enzymes actually pres...

  15. Molecular motion in restricted geometries

    Indian Academy of Sciences (India)

    Molecular dynamics in restricted geometries is known to exhibit anomalous behaviour. Diffusion, translational or rotational, of molecules is altered significantly on confinement in restricted geometries. Quasielastic neutron scattering (QENS) offers a unique possibility of studying molecular motion in such systems. Both time ...

  16. Restriction glycosylases: involvement of endonuclease activities in the restriction process.

    Science.gov (United States)

    Zhang, Yingbiao; Matsuzaka, Tomoyuki; Yano, Hirokazu; Furuta, Yoshikazu; Nakano, Toshiaki; Ishikawa, Ken; Fukuyo, Masaki; Takahashi, Noriko; Suzuki, Yutaka; Sugano, Sumio; Ide, Hiroshi; Kobayashi, Ichizo

    2017-02-17

    All restriction enzymes examined are phosphodiesterases generating 3΄-OH and 5΄-P ends, but one restriction enzyme (restriction glycosylase) excises unmethylated bases from its recognition sequence. Whether its restriction activity involves endonucleolytic cleavage remains unclear. One report on this enzyme, R.PabI from a hyperthermophile, ascribed the breakage to high temperature while another showed its weak AP lyase activity generates atypical ends. Here, we addressed this issue in mesophiles. We purified R.PabI homologs from Campylobacter coli (R.CcoLI) and Helicobacter pylori (R.HpyAXII) and demonstrated their DNA cleavage, DNA glycosylase and AP lyase activities in vitro at 37°C. The AP lyase activity is more coupled with glycosylase activity in R.CcoLI than in R.PabI. R.CcoLI/R.PabI expression caused restriction of incoming bacteriophage/plasmid DNA and endogenous chromosomal DNA within Escherichia coli at 37°C. The R.PabI-mediated restriction was promoted by AP endonuclease action in vivo or in vitro. These results reveal the role of endonucleolytic DNA cleavage in restriction and yet point to diversity among the endonucleases. The cleaved ends are difficult to repair in vivo, which may indicate their biological significance. These results support generalization of the concept of restriction–modification system to the concept of self-recognizing epigenetic system, which combines any epigenetic labeling and any DNA damaging.

  17. Sequence specific inhibition of DNA restriction enzyme cleavage by PNA

    DEFF Research Database (Denmark)

    Nielsen, P.E.; Egholm, M.; Berg, R.H.

    1993-01-01

    Plasmids containing double-stranded 10-mer PNA (peptide nucleic acid chimera) targets proximally flanked by two restriction enzyme sites were challenged with the complementary PNA or PNAs having one or two mismatches, and the effect on the restriction enzyme cleavage of the flanking sites...... was assayed. The following PNAs were used: T10-LysNH2, T5CT4-LysNH2 and T2CT2CT4-LysNH2 and the corresponding targets cloned into pUC 19 were flanked by BamH1, Sal1 or Pstl sites, respectively. In all cases it was found that complete inhibition of restriction enzyme cleavage was obtained...

  18. Aging, adiposity, and calorie restriction.

    Science.gov (United States)

    Fontana, Luigi; Klein, Samuel

    2007-03-07

    Excessive calorie intake and subsequent obesity increases the risk of developing chronic disease and decreases life expectancy. In rodent models, calorie restriction with adequate nutrient intake decreases the risk of developing chronic disease and extends maximum life span. To evaluate the physiological and clinical implications of calorie restriction with adequate nutrient intake. Search of PubMed (1966-December 2006) using terms encompassing various aspects of calorie restriction, dietary restriction, aging, longevity, life span, adiposity, and obesity; hand search of journals that focus on obesity, geriatrics, or aging; and search of reference lists of pertinent research and review articles and books. Reviewed reports (both basic science and clinical) included epidemiologic studies, case-control studies, and randomized controlled trials, with quality of data assessed by taking into account publication in a peer-reviewed journal, number of animals or individuals studied, objectivity of measurements, and techniques used to minimize bias. It is not known whether calorie restriction extends maximum life span or life expectancy in lean humans. However, calorie restriction in adult men and women causes many of the same metabolic adaptations that occur in calorie-restricted rodents and monkeys, including decreased metabolic, hormonal, and inflammatory risk factors for diabetes, cardiovascular disease, and possibly cancer. Excessive calorie restriction causes malnutrition and has adverse clinical effects. Calorie restriction in adult men and women causes beneficial metabolic, hormonal, and functional changes, but the precise amount of calorie intake or body fat mass associated with optimal health and maximum longevity in humans is not known. In addition, it is possible that even moderate calorie restriction may be harmful in specific patient populations, such as lean persons who have minimal amounts of body fat.

  19. Towards the molecular characterisation of parasitic nematode assemblages: an evaluation of terminal-restriction fragment length polymorphism (T-RFLP) analysis.

    Science.gov (United States)

    Lott, M J; Hose, G C; Power, M L

    2014-09-01

    Identifying factors which regulate temporal and regional structuring within parasite assemblages requires the development of non-invasive techniques which facilitate both the rapid discrimination of individual parasites and the capacity to monitor entire parasite communities across time and space. To this end, we have developed and evaluated a rapid fluorescence-based method, terminal restriction fragment length polymorphism (T-RFLP) analysis, for the characterisation of parasitic nematode assemblages in macropodid marsupials. The accuracy with which T-RFLP was capable of distinguishing between the constituent taxa of a parasite community was assessed by comparing sequence data from two loci (the ITS+ region of nuclear ribosomal DNA and the mitochondrial CO1) across ∼20 species of nematodes (suborder Strongylida). Our results demonstrate that with fluorescent labelling of the forward and reverse terminal restriction fragments (T-RFs) of the ITS+ region, the restriction enzyme Hinf1 was capable of generating species specific T-RFLP profiles. A notable exception was within the genus Cloacina, in which closely related species often shared identical T-RFs. This may be a consequence of the group's comparatively recent evolutionary radiation. While the CO1 displayed higher sequence diversity than the ITS+, the subsequent T-RFLP profiles were taxonomically inconsistent and could not be used to further differentiate species within Cloacina. Additionally, several of the ITS+ derived T-RFLP profiles exhibited unexpected secondary peaks, possibly as a consequence of the restriction enzymes inability to cleave partially single stranded amplicons. These data suggest that the question of T-RFLPs utility in monitoring parasite communities cannot be addressed without considering the ecology and unique evolutionary history of the constituent taxa. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Structure of a protein L23-RNA complex located at the A-site domain of the ribosomal peptidyl transferase centre

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1984-01-01

    and sequencing the RNA binding site of protein L23; it consists of two main fragments of 25 and 105 nucleotides that strongly interact and are separated by 172 nucleotides in the primary sequence. The higher-order structure of the RNA moiety was probed by chemical reagents, and by single-strand and double...... implicating a large proportion of the RNA structure in the protein binding. The sites were located mainly at the extremities of the helices and at nucleotides that were putatively bulged out from the helices. The RNA moiety and an adjacent excised fragment contain several highly conserved sequences...... and a modified adenosine. Such sequences constitute important functional domains of the RNA and may contribute to the putative role of this RNA region in the peptidyl transferase centre....

  1. SCORCHED EARTH: THE USE OF RESTRICTIVE COVENANTS TO STIFLE COMPETITION

    OpenAIRE

    Bruce Ziff; Ken Jiang

    2012-01-01

    Restrictive covenants running with freehold land are sometimes used as a means of impeding commercial competition. For example, when a firm elects to relocate a retail operation and sell the existing site, a covenant may be placed on the title to that site designed to prohibit a competing retail business from operating on those lands. It is known, for example, that the multinational grocery chain Safeway has adopted this practice extensively in Edmonton. Likewise, the practice is found in oth...

  2. Mechanistic insights into type III restriction enzymes.

    Science.gov (United States)

    Raghavendra, Nidhanapati K; Bheemanaik, Shivakumara; Rao, Desirazu N

    2012-01-01

    Type III restriction-modification (R-M) enzymes need to interact with two separate unmethylated DNA sequences in indirectly repeated, head-to-head orientations for efficient cleavage to occur at a defined location next to only one of the two sites. However, cleavage of sites that are not in head-to-head orientation have been observed to occur under certain reaction conditions in vitro. ATP hydrolysis is required for the long-distance communication between the sites prior to cleavage. Type III R-M enzymes comprise two subunits, Res and Mod that form a homodimeric Mod2 and a heterotetrameric Res2Mod2 complex. The Mod subunit in M2 or R2M2 complex recognizes and methylates DNA while the Res subunit in R2M2 complex is responsible for ATP hydrolysis, DNA translocation and cleavage. A vast majority of biochemical studies on Type III R-M enzymes have been undertaken using two closely related enzymes, EcoP1I and EcoP15I. Divergent opinions about how the long-distance interaction between the recognition sites exist and at least three mechanistic models based on 1D- diffusion and/or 3D- DNA looping have been proposed.

  3. ssDNA Pairing Accuracy Increases When Abasic Sites Divide Nucleotides into Small Groups.

    Directory of Open Access Journals (Sweden)

    Alexandra Peacock-Villada

    Full Text Available Accurate sequence dependent pairing of single-stranded DNA (ssDNA molecules plays an important role in gene chips, DNA origami, and polymerase chain reactions. In many assays accurate pairing depends on mismatched sequences melting at lower temperatures than matched sequences; however, for sequences longer than ~10 nucleotides, single mismatches and correct matches have melting temperature differences of less than 3°C. We demonstrate that appropriately grouping of 35 bases in ssDNA using abasic sites increases the difference between the melting temperature of correct bases and the melting temperature of mismatched base pairings. Importantly, in the presence of appropriately spaced abasic sites mismatches near one end of a long dsDNA destabilize the annealing at the other end much more effectively than in systems without the abasic sites, suggesting that the dsDNA melts more uniformly in the presence of appropriately spaced abasic sites. In sum, the presence of appropriately spaced abasic sites allows temperature to more accurately discriminate correct base pairings from incorrect ones.

  4. Liposome as nanocarrier: Site targeted delivery in lung cancer

    Directory of Open Access Journals (Sweden)

    Najeeb Ullah

    2017-08-01

    Full Text Available Lung cancer is fatal and spreading rapidly worldwide. Different clinical strategies are applied to stop this cancer. As the lung is a delicate organ, special clinical applications must be used and nanodrugs delivery systems are the most important applications of all. This review discusses the lung problems such as lung cancer, lung inflammation and bronchi constrictions followed by repetitive intake of some drugs. The objective of this review is to study how nanodrug delivery systems were synthesized and used in lung disorder treatment especially in lung cancer. The authors studied some articles from 1989 to 2015. Liposome encapsulation was done in various ways for the delivery of different drugs such as metaproterenol into liposomes caused bronchodilation, immunoliposomes bearing antibodies for doxorubicin reduced 50% inhibitory effects, radioliposomes with high penetrating ability to peripheral airways, aerosol delivery systems with deep pulmonary deposition, polymeric drug delivery having potential to improve beneficial index of drug, solid lipid liposomes, liposomal gentamicin with altered different clinical susceptibilities of resistance, transferrin conjugated liposomes to deliver cytostatic drugs to site of lungs, anti-inflammatory drugs with mannosylated liposomes, liposomal suspensions with single stranded RNAs and peptide encapsulation of liposomes. This review indicates that many animals perished with intravenous administration of drugs but survived in liposomal targeting groups.

  5. Cleavage of mispaired heteroduplex DNA substrates by numerous restriction enzymes.

    Science.gov (United States)

    Langhans, Mark T; Palladino, Michael J

    2009-01-01

    The utility of restriction endonucleases as a tool in molecular biology is in large part due to the high degree of specificity with which they cleave well-characterized DNA recognition sequences. The specificity of restriction endonucleases is not absolute, yet many commonly used assays of biological phenomena and contemporary molecular biology techniques rely on the premise that restriction enzymes will cleave only perfect cognate recognition sites. In vitro, mispaired heteroduplex DNAs are commonly formed, especially subsequent to polymerase chain reaction amplification. We investigated a panel of restriction endonucleases to determine their ability to cleave mispaired heteroduplex DNA substrates. Two straightforward, non-radioactive assays are used to evaluate mispaired heteroduplex DNA cleavage: a PCR amplification method and an oligonucleotide-based assay. These assays demonstrated that most restriction endonucleases are capable of site-specific double-strand cleavage with heteroduplex mispaired DNA substrates, however, certain mispaired substrates do effectively abrogate cleavage to undetectable levels. These data are consistent with mispaired substrate cleavage previously reported for Eco RI and, importantly, extend our knowledge of mispaired heteroduplex substrate cleavage to 13 additional enzymes.

  6. Restriction enzyme-mediated DNA family shuffling.

    Science.gov (United States)

    Behrendorff, James B Y H; Johnston, Wayne A; Gillam, Elizabeth M J

    2014-01-01

    DNA shuffling is an established recombinatorial method that was originally developed to increase the speed of directed evolution experiments beyond what could be accomplished using error-prone PCR alone. To achieve this, mutated copies of a protein-coding sequence are fragmented with DNase I and the fragments are then reassembled in a PCR without primers. The fragments anneal where there is sufficient sequence identity, resulting in full-length variants of the original gene that have inherited mutations from multiple templates. Subsequent studies demonstrated that directed evolution could be further accelerated by shuffling similar native protein-coding sequences from the same gene family, rather than mutated variants of a single gene. Generally at least 65-75 % global identity between parental sequences is required in DNA family shuffling, with recombination mostly occurring at sites with at least five consecutive nucleotides of local identity. Since DNA shuffling was originally developed, many variations on the method have been published. In particular, the use of restriction enzymes in the fragmentation step allows for greater customization of fragment lengths than DNase I digestion and avoids the risk that parental sequences may be over-digested into unusable very small fragments. Restriction enzyme-mediated fragmentation also reduces the occurrence of undigested parental sequences that would otherwise reduce the number of unique variants in the resulting library. In the current chapter, we provide a brief overview of the alternative methods currently available for DNA shuffling as well as a protocol presented here that improves on several previous implementations of restriction enzyme-mediated DNA family shuffling, in particular with regard to purification of DNA fragments for reassembly.

  7. Gentile statistics and restricted partitions

    Indian Academy of Sciences (India)

    In a recent paper (Tran et al, Ann. Phys. 311, 204 (2004)), some asymptotic number theoretical results on the partitioning of an integer were derived exploiting its connection to the quantum density of states of a many-particle system. We generalise these results to obtain an asymptotic formula for the restricted or coloured ...

  8. Gentile statistics and restricted partitions

    Indian Academy of Sciences (India)

    We generalise these results to obtain an asymptotic formula for the restricted or coloured partitions p k s ( n ) , which is the number of partitions of an integer into the summand of th powers of integers such that each power of a given integer may occur utmost times. While the method is not rigorous, it reproduces the ...

  9. Restrictive dermopathy and fetal behaviour

    NARCIS (Netherlands)

    Mulder, EJH; Beemer, FA; Stoutenbeek, P

    We report three siblings from consecutive pregnancies affected with restrictive dermopathy (RD). During the second pregnancy, fetal behavioural development and growth were studied extensively using ultrasound at 1-4 week intervals. Dramatic and sudden changes occurred in fetal body movements and

  10. Pacifier restriction and exclusive breastfeeding.

    Science.gov (United States)

    Kair, Laura R; Kenron, Daniel; Etheredge, Konnette; Jaffe, Arthur C; Phillipi, Carrie A

    2013-04-01

    We tested the hypothesis that removing pacifiers from routine distribution in our mother-baby unit (MBU) would be associated with greater breastfeeding initiation or exclusivity during the birth hospitalization. We retrospectively compared exclusive breastfeeding, breastfeeding plus supplemental formula feeding, and exclusive formula feeding rates for 2249 infants admitted to the MBU at our university teaching hospital during the 5 months before and 8 months after restriction of routine pacifier distribution. Formula supplementation, if not medically indicated, was discouraged per standard practice, but access to formula was not restricted. Of the 2249 infants, 79% were exclusively breastfed from July through November 2010, when pacifiers were routinely distributed. During the 8-month period after pacifier restriction, this proportion decreased significantly to 68% (P pacifier distribution during the newborn hospitalization without also restricting access to formula was associated with decreased exclusive breastfeeding, increased supplemental formula feeding, and increased exclusive formula feeding. Because high-quality, prospective medical literature addressing pacifier use and breastfeeding does not conclusively show an adverse relationship in women who are motivated to breastfeed, more studies are needed to help determine what effect, if any, pacifiers have on breastfeeding initiation and exclusivity in the immediate newborn period.

  11. Site-specific oxidation at GG and GGG sequences in double-stranded DNA by benzoyl peroxide as a tumor promoter.

    Science.gov (United States)

    Kawanishi, S; Oikawa, S; Murata, M; Tsukitome, H; Saito, I

    1999-12-21

    Benzoyl peroxide (BzPO), a free-radical generator, has tumor-promoting activity. As a method for approaching the mechanism of tumor promoter function, the ability of oxidative DNA damage by BzPO was investigated by using (32)P-labeled DNA fragments obtained from the human p53 tumor suppressor gene and c-Ha-ras-1 protooncogene. BzPO induced piperidine-labile sites at the 5'-site guanine of GG and GGG sequences of double-stranded DNA in the presence of Cu(I), whereas the damage occurred at single guanine residues of single-stranded DNA. Both methional and dimethyl sulfoxide (DMSO) inhibited DNA damage induced by BzPO and Cu(I), but typical hydroxyl radical ((*)OH) scavengers, superoxide dismutase (SOD) and catalase, did not inhibit it. On the other hand, H(2)O(2) induced piperidine-labile sites at cytosine and thymine residues of double-stranded DNA in the presence of Cu(I). Phenylhydrazine, which is known to produce phenyl radicals, induced Cu(I)-dependent damage at thymine residues but not at guanine residues. These results suggest that the BzPO-derived reactive species causing DNA damage is different from (*)OH and phenyl radicals generated from benzoyloxyl radicals. BzPO/Cu(I) induced 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) formation in double-stranded DNA more effectively than that in single-stranded DNA. Furthermore, we observed that BzPO increased the amount of 8-oxodG in human cultured cells. Consequently, it is concluded that benzoyloxyl radicals generated by the reaction of BzPO with Cu(I) may oxidize the 5'-guanine of GG and GGG sequences in double-stranded DNA to lead to 8-oxodG formation and piperidine-labile guanine lesions, and the damage seems to be relevant to the tumor-promoting activity of BzPO.

  12. 49 CFR 215.203 - Restricted cars.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Restricted cars. 215.203 Section 215.203..., DEPARTMENT OF TRANSPORTATION RAILROAD FREIGHT CAR SAFETY STANDARDS Restricted Equipment § 215.203 Restricted cars. (a) This section restricts the operation of any railroad freight car that is— (1) More than 50...

  13. A physical map of human Alu repeats cleavage by restriction endonucleases

    Directory of Open Access Journals (Sweden)

    Chernukhin Valery A

    2008-06-01

    Full Text Available Abstract Background Alu repetitive elements are the abundant sequences in human genome. Diversity of DNA sequences of these elements makes difficult the construction of theoretical patterns of Alu repeats cleavage by restriction endonucleases. We have proposed a method of restriction analysis of Alu repeats sequences in silico. Results Simple software to analyze Alu repeats database has been suggested and Alu repeats digestion patterns for several restriction enzymes' recognition sites have been constructed. Restriction maps of Alu repeats cleavage for corresponding restriction enzymes have been calculated and plotted. Theoretical data have been compared with experimental results on DNA hydrolysis with restriction enzymes, which we obtained earlier. Conclusion Alu repeats digestions provide the main contribution to the patterns of human chromosomal DNA cleavage. This corresponds to the experimental data on total human DNA hydrolysis with restriction enzymes.

  14. Caloric restriction and its mimetics

    Directory of Open Access Journals (Sweden)

    Shin-Hae Lee

    2013-04-01

    Full Text Available Caloric restriction is the most reliable intervention to preventage-related disorders and extend lifespan. The reduction ofcalories by 10-30% compared to an ad libitum diet is known toextend the longevity of various species from yeast to rodents.The underlying mechanisms by which the benefits of caloricrestriction occur have not yet been clearly defined. However,many studies are being conducted in an attempt to elucidatethese mechanisms, and there are indications that the benefits ofcaloric restriction are related to alteration of the metabolic rateand the accumulation of reactive oxygen species. Duringmolecular signaling, insulin/insulin-like growth factor signaling,target of rapamycin pathway, adenosine monophosphateactivated protein kinase signaling, and Sirtuin are focused asunderlying pathways that mediate the benefits of caloricrestriction. Here, we will review the current status of caloricrestriction. [BMB Reports 2013; 46(4: 181-187

  15. Type III restriction-modification enzymes: a historical perspective.

    Science.gov (United States)

    Rao, Desirazu N; Dryden, David T F; Bheemanaik, Shivakumara

    2014-01-01

    Restriction endonucleases interact with DNA at specific sites leading to cleavage of DNA. Bacterial DNA is protected from restriction endonuclease cleavage by modifying the DNA using a DNA methyltransferase. Based on their molecular structure, sequence recognition, cleavage position and cofactor requirements, restriction-modification (R-M) systems are classified into four groups. Type III R-M enzymes need to interact with two separate unmethylated DNA sequences in inversely repeated head-to-head orientations for efficient cleavage to occur at a defined location (25-27 bp downstream of one of the recognition sites). Like the Type I R-M enzymes, Type III R-M enzymes possess a sequence-specific ATPase activity for DNA cleavage. ATP hydrolysis is required for the long-distance communication between the sites before cleavage. Different models, based on 1D diffusion and/or 3D-DNA looping, exist to explain how the long-distance interaction between the two recognition sites takes place. Type III R-M systems are found in most sequenced bacteria. Genome sequencing of many pathogenic bacteria also shows the presence of a number of phase-variable Type III R-M systems, which play a role in virulence. A growing number of these enzymes are being subjected to biochemical and genetic studies, which, when combined with ongoing structural analyses, promise to provide details for mechanisms of DNA recognition and catalysis.

  16. A gamma-herpesvirus deficient in replication establishes chronic infection in vivo and is impervious to restriction by adaptive immune cells.

    Science.gov (United States)

    Tibbetts, Scott A; Suarez, Felipe; Steed, Ashley L; Simmons, Jacob A; Virgin, Herbert W

    2006-09-15

    Chronic gamma-herpesvirus infection is a dynamic process involving latent infection, reactivation from latency, and low level persistent replication. The gamma-herpesviruses maintain latent infection in restricted subsets of hematopoietic cells as a result of an intricate balance between host factors that suppress infection and viral factors that facilitate evasion of the immune response. Immune effectors limit reactivation and subsequent replication events, and the adaptive immune response ultimately restricts infection to a level compatible with life-long infection. However, it has not been possible to determine whether the immune system constrains chronic infection by directly targeting latently infected cells in vivo due to the complex nature of chronic infection. To begin to address this issue, we generated a murine gamma-herpesvirus 68 (gammaHV68) deficient in its ability to replicate or undergo reactivation from latency via a mutation in the single-stranded DNA binding protein encoded by ORF6. Even in the absence of lytic replication, this virus established long-term infection in peritoneal cells of wild-type mice at levels identical to that of wild-type gammaHV68, and generated an immune response that was sufficient to protect against secondary challenge with wild-type gammaHV68. Nevertheless, the number of latently infected cells was not significantly altered in mice deficient in T cells or both T cells and B cells, demonstrating that the adaptive immune system is incapable of altering infection with a virus lacking the capacity for lytic replication and reactivation from latency. Thus, these data support the conclusion that latency is immunologically silent.

  17. Restriction enzyme body doubles and PCR cloning: on the general use of type IIs restriction enzymes for cloning.

    Science.gov (United States)

    Tóth, Eszter; Huszár, Krisztina; Bencsura, Petra; Kulcsár, Péter István; Vodicska, Barbara; Nyeste, Antal; Welker, Zsombor; Tóth, Szilvia; Welker, Ervin

    2014-01-01

    The procedure described here allows the cloning of PCR fragments containing a recognition site of the restriction endonuclease (Type IIP) used for cloning in the sequence of the insert. A Type IIS endonuclease--a Body Double of the Type IIP enzyme--is used to generate the same protruding palindrome. Thus, the insert can be cloned to the Type IIP site of the vector without digesting the PCR product with the same Type IIP enzyme. We achieve this by incorporating the recognition site of a Type IIS restriction enzyme that cleaves the DNA outside of its recognition site in the PCR primer in such a way that the cutting positions straddle the desired overhang sequence. Digestion of the PCR product by the Body Double generates the required overhang. Hitherto the use of Type IIS restriction enzymes in cloning reactions has only been used for special applications, the approach presented here makes Type IIS enzymes as useful as Type IIP enzymes for general cloning purposes. To assist in finding Body Double enzymes, we summarised the available Type IIS enzymes which are potentially useful for Body Double cloning and created an online program (http://group.szbk.u-szeged.hu/welkergr/body_double/index.html) for the selection of suitable Body Double enzymes and the design of the appropriate primers.

  18. Restriction Enzyme Body Doubles and PCR Cloning: On the General Use of Type IIS Restriction Enzymes for Cloning

    Science.gov (United States)

    Tóth, Eszter; Huszár, Krisztina; Bencsura, Petra; Kulcsár, Péter István; Vodicska, Barbara; Nyeste, Antal; Welker, Zsombor; Tóth, Szilvia; Welker, Ervin

    2014-01-01

    The procedure described here allows the cloning of PCR fragments containing a recognition site of the restriction endonuclease (Type IIP) used for cloning in the sequence of the insert. A Type IIS endonuclease - a Body Double of the Type IIP enzyme - is used to generate the same protruding palindrome. Thus, the insert can be cloned to the Type IIP site of the vector without digesting the PCR product with the same Type IIP enzyme. We achieve this by incorporating the recognition site of a Type IIS restriction enzyme that cleaves the DNA outside of its recognition site in the PCR primer in such a way that the cutting positions straddle the desired overhang sequence. Digestion of the PCR product by the Body Double generates the required overhang. Hitherto the use of Type IIS restriction enzymes in cloning reactions has only been used for special applications, the approach presented here makes Type IIS enzymes as useful as Type IIP enzymes for general cloning purposes. To assist in finding Body Double enzymes, we summarised the available Type IIS enzymes which are potentially useful for Body Double cloning and created an online program (http://group.szbk.u-szeged.hu/welkergr/body_double/index.html) for the selection of suitable Body Double enzymes and the design of the appropriate primers. PMID:24618593

  19. Metallization of Single-Stranded Polyl by Zn2+ Ions in Neutral Solutions

    Czech Academy of Sciences Publication Activity Database

    Sorokin, V. A.; Valeev, V. A.; Usenko, E. L.; Andrushchenko, Valery

    2014-01-01

    Roč. 118, č. 43 (2014), s. 12360-12365 ISSN 1520-6106 Institutional support: RVO:61388963 Keywords : nucleic acid metallization * zinc ion * differential UV spectroscopy Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.302, year: 2014

  20. Oligo(dT) is not a correct native PAGE marker for single-stranded DNA

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Kypr, Jaroslav; Vorlíčková, Michaela

    2007-01-01

    Roč. 353, č. 3 (2007), s. 776-779 ISSN 0006-291X R&D Projects: GA AV ČR(CZ) IAA4004201; GA AV ČR(CZ) IAA1004201 Institutional research plan: CEZ:AV0Z50040702 Keywords : polyacrylamide gel electrophoresis * DNA length markers * oligo(dT) Subject RIV: BO - Biophysics Impact factor: 2.749, year: 2007

  1. Determination of nanogram quantities of osmium-labeled single stranded DNA by differential pulse stripping voltammetry

    Czech Academy of Sciences Publication Activity Database

    Kizek, René; Havran, Luděk; Fojta, Miroslav; Paleček, Emil

    2002-01-01

    Roč. 55, 1/2 (2002), s. 199-121 ISSN 1567-5394 R&D Projects: GA ČR GV204/97/K084; GA ČR GA204/00/D049; GA AV ČR IAA4004108 Institutional research plan: CEZ:AV0Z5004920 Keywords : differential pulse stripping voltammetry * microdetermination of DNA * chemical modification of DNA Subject RIV: BO - Biophysics Impact factor: 1.463, year: 2002

  2. Single stranded loops of quadruplex DNA as key benchmark for testing nucleic acids force fields

    Czech Academy of Sciences Publication Activity Database

    Fadrná, E.; Špačková, Naďa; Sarzynska, J.; Koča, J.; Orozco, M.; Cheatham III, T.E.; Kulinski, T.; Šponer, Jiří

    2009-01-01

    Roč. 5, č. 9 (2009), s. 2514-2530 ISSN 1549-9618 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802 Grant - others:GA ČR(CZ) GA203/09/1476 Program:GA Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA quadruplex * MD simulation * force fields Subject RIV: BO - Biophysics Impact factor: 4.804, year: 2009

  3. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-01

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  4. Absorption by DNA single strands of adenine isolated in vacuo: The role of multiple chromophores

    DEFF Research Database (Denmark)

    Nielsen, L.M.; Pedersen, S.O.; Kirketerp, M.-B.S.

    2012-01-01

    to that for the adenine molecule and the dAMP mononucleotide. Desolvation has little effect on the bandwidth, which implies that inhomogenous broadening of the absorption bands in aqueous solution is of minor importance compared to, e.g., conformational disorder. Finally, at high photon energies, internal conversion...

  5. Heterochromatin Reorganization during Early Mouse Development Requires a Single-Stranded Noncoding Transcript

    Directory of Open Access Journals (Sweden)

    Miguel Casanova

    2013-09-01

    Full Text Available The equalization of pericentric heterochromatin from distinct parental origins following fertilization is essential for genome function and development. The recent implication of noncoding transcripts in this process raises questions regarding the connection between RNA and the nuclear organization of distinct chromatin environments. Our study addresses the interrelationship between replication and transcription of the two parental pericentric heterochromatin (PHC domains and their reorganization during early embryonic development. We demonstrate that the replication of PHC is dispensable for its clustering at the late two-cell stage. In contrast, using parthenogenetic embryos, we show that pericentric transcripts are essential for this reorganization independent of the chromatin marks associated with the PHC domains. Finally, our discovery that only reverse pericentric transcripts are required for both the nuclear reorganization of PHC and development beyond the two-cell stage challenges current views on heterochromatin organization.

  6. Role of Electrostatics in the assembly pathway of a single-stranded RNA virus

    NARCIS (Netherlands)

    Garmann, R.F.; Comas-Garcia, M.; Koay, M.S.T.; Cornelissen, Jeroen Johannes Lambertus Maria; Knobler, C.M.; Gelbart, W.M.

    2014-01-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318–3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of

  7. Comment on "Monomer Dynamics in Double- and Single-Stranded DNA Polymers"

    OpenAIRE

    Tothova, J.; Brutovsky, B.; Lisy, V.

    2005-01-01

    It is discussed that the kinetics observed by Shusterman et al. [Phys. Rev. Lett. 92, 048303] for long dsDNA is not the Rouse one and, in fact, the macromolecule behaves (approximately) as the Zimm polymer.

  8. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-04-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  9. Toxin MqsR Cleaves Single-Stranded mRNA with Various 5 Ends

    Science.gov (United States)

    2016-08-24

    decreases persisence about 2400- fold (Harrison et al. 2009). Another type II TA toxin, MazF, induces growth arrest that results in up to a 700- fold...Life Technologies, Waltham, MA). In brief, 25 pmol of RNA was first treated with 0.1 U of calf intestine alkaline phosphatase (CIP, 0.1 U/μL) for 1...MqsR/MqsA regulate toxin CspD. Environ. Microbiol. 12:1105–1121. Kwan, B. W., J. A. Valenta, M. J. Benedik, and T. K. Wood. 2013. Arrested protein

  10. Detection of short single-strand DNA homopolymers with ultrathin Si3N4 nanopores.

    Science.gov (United States)

    Ma, Jian; Qiu, Yinghua; Yuan, Zhishan; Zhang, Yin; Sha, Jingjie; Liu, Lei; Sun, Litao; Ni, Zhonghua; Yi, Hong; Li, Deyu; Chen, Yunfei

    2015-08-01

    A series of nanopores with diameters ranging from 2.5 to 63 nm are fabricated on a reduced Si3N4 membrane by focused ion beam and high energy electron beam. Through measuring the blocked ionic currents for DNA strands threading linearly through those solid-state nanopores, it is found that the blockade ionic current is proportional to the square of the hydrodynamic diameter of the DNA strand. With the nanopore diameter reduced to be comparable with that of DNA strands, the hydrodynamic diameter of the DNA becomes smaller, which is attributed to the size confinement effects. The duration time for the linear DNA translocation events increases monotonically with the nanopore length. By comparing the spatial configurations of DNA strands through nanopores with different diameters, it is found that the nanopore with large diameter has enough space to allow the DNA strand to translocate through with complex conformation. With the decrease of the nanopore diameter, the folded part of the DNA is prone to be straightened by the nanopore, which leads to the increase in the occurrence frequency of the linear DNA translocation events. Reducing the diameter of the nanopore to 2.5 nm allows the detection and discrimination of three nucleotide "G" and three nucleotide "T" homopolymer DNA strands based on differences in their physical dimensions.

  11. Differentiation of Short Single-Stranded DNA Homopolymers in Solid-State Nanopores

    Science.gov (United States)

    Venta, Kimberly; Shemer, Gabriel; Puster, Matthew; Rodríguez-Manzo, Julio A.; Balan, Adrian; Rosenstein, Jacob K.; Shepard, Ken; Drndić, Marija

    2013-01-01

    In the last two decades, new techniques that monitor ionic current modulations as single molecules pass through a nanoscale pore have enabled numerous single-molecule studies. While biological nanopores have recently shown the ability to resolve single nucleotides within individual DNA molecules, similar developments with solid-state nanopores have lagged, due to challenges both in fabricating stable nanopores of similar dimensions as biological nanopores and in achieving sufficiently low-noise and high-bandwidth recordings. Here we show that small silicon nitride nanopores (0.8 to 2-nm-diameter in 5 to 8-nm-thick membranes) can resolve differences between ionic current signals produced by short (30 base) ssDNA homopolymers (poly(dA), poly(dC), poly(dT)), when combined with measurement electronics that allow a signal-to-noise ratio of better than 10 to be achieved at 1 MHz bandwidth. While identifying intramolecular DNA sequences with silicon nitride nanopores will require further improvements in nanopore sensitivity and noise levels, homopolymer differentiation represents an important milestone in the development of solid-state nanopores. PMID:23621759

  12. Source-based nomenclature for single-strand homopolymers and copolymers (IUPAC Recommendations 2016)

    Czech Academy of Sciences Publication Activity Database

    Jones, R. G.; Kitayama, T.; Hellwich, K. H.; Hess, M.; Jenkins, A. D.; Kahovec, Jaroslav; Kratochvíl, Pavel; Mita, I.; Mormann, W.; Ober, C. K.; Penczek, S.; Stepto, R. F. T.; Thurlow, K.; Vohlídal, J.; Wilks, E. S.

    2016-01-01

    Roč. 88, 10-11 (2016), s. 1073-1100 ISSN 0033-4545 Institutional support: RVO:61389013 Keywords : apparent monomer * copolymer * end-groups Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.626, year: 2016

  13. Theoretical Study of the Transpore Velocity Control of Single-Stranded DNA

    Directory of Open Access Journals (Sweden)

    Weixin Qian

    2014-08-01

    Full Text Available The electrokinetic transport dynamics of deoxyribonucleic acid (DNA molecules have recently attracted significant attention in various fields of research. Our group is interested in the detailed examination of the behavior of DNA when confined in micro/nanofluidic channels. In the present study, the translocation mechanism of a DNA-like polymer chain in a nanofluidic channel was investigated using Langevin dynamics simulations. A coarse-grained bead-spring model was developed to simulate the dynamics of a long polymer chain passing through a rectangular cross-section nanopore embedded in a nanochannel, under the influence of a nonuniform electric field. Varying the cross-sectional area of the nanopore was found to allow optimization of the translocation process through modification of the electric field in the flow channel, since a drastic drop in the electric potential at the nanopore was induced by changing the cross-section. Furthermore, the configuration of the polymer chain in the nanopore was observed to determine its translocation velocity. The competition between the strength of the electric field and confinement in the small pore produces various transport mechanisms and the results of this study thus represent a means of optimizing the design of nanofluidic devices for single molecule detection.

  14. Mismatched single stranded antisense oligonucleotides can induce efficient dystrophin splice switching

    Directory of Open Access Journals (Sweden)

    Kole Ryszard

    2011-10-01

    Full Text Available Abstract Background Antisense oligomer induced exon skipping aims to reduce the severity of Duchenne muscular dystrophy by redirecting splicing during pre-RNA processing such that the causative mutation is by-passed and a shorter but partially functional Becker muscular dystrophy-like dystrophin isoform is produced. Normal exons are generally targeted to restore the dystrophin reading frame however, an appreciable subset of dystrophin mutations are intra-exonic and therefore have the potential to compromise oligomer efficiency, necessitating personalised oligomer design for some patients. Although antisense oligomers are easily personalised, it remains unclear whether all patient polymorphisms within antisense oligomer target sequences will require the costly process of producing and validating patient specific compounds. Methods Here we report preclinical testing of a panel of splice switching antisense oligomers, designed to excise exon 25 from the dystrophin transcript, in normal and dystrophic patient cells. These patient cells harbour a single base insertion in exon 25 that lies within the target sequence of an oligomer shown to be effective at removing exon 25. Results It was anticipated that such a mutation would compromise oligomer binding and efficiency. However, we show that, despite the mismatch an oligomer, designed and optimised to excise exon 25 from the normal dystrophin mRNA, removes the mutated exon 25 more efficiently than the mutation-specific oligomer. Conclusion This raises the possibility that mismatched AOs could still be therapeutically applicable in some cases, negating the necessity to produce patient-specific compounds.

  15. Telomerase suppresses formation of ALT-associated single-stranded telomeric C-circles.

    Science.gov (United States)

    Plantinga, Matthew J; Pascarelli, Kara M; Merkel, Anna S; Lazar, Alexander J; von Mehren, Margaret; Lev, Dina; Broccoli, Dominique

    2013-06-01

    Telomere maintenance is an essential characteristic of cancer cells, most commonly achieved by activation of telomerase. Telomeres can also be maintained by a recombination-based mechanism, alternative lengthening of telomeres (ALT). Cells using ALT are characterized by the presence of ALT-associated promyelocytic leukemia (PML) bodies (APB), long, heterogeneously sized telomeres, extrachromosomal telomeric circular DNA, and elevated telomeric recombination. Consistent with other reports, we found that liposarcomas containing APBs, but lacking telomerase expression, always contained C-rich circles (C-circles), and these C-circles were never present in the absence of APBs, indicating a tight link between these features in ALT cells. However, a rare subgroup of tumors showing evidence of telomere maintenance by both telomerase and ALT did not contain C-circles. To test the hypothesis that telomerase expression disrupts the tight link between APBs and C-circles, we used ALT cell lines that were engineered to express telomerase. Introduction of telomerase activity in these ALT cells resulted in, on average, shorter telomeres with retention of APBs. However, at high passage, the level of C-circles was significantly reduced, which was paralleled by a switch from C-strand overhangs to G-strand overhangs. We propose that by extending critically short telomeres in these cells, telomerase is disrupting a key step in the ALT pathway necessary for production and/or maintenance of C-circles. ©2013 AACR.

  16. Electric light scattering from single-stranded DNA in linear polyacrylamide solutions.

    Science.gov (United States)

    Todorov, R; Starchev, K; Stoylov, S P

    2001-01-01

    The electric light scattering (ELS) of ssDNA (calf thymus, 10 kbp, 55 micrograms/mL) in denaturing polyacrylamide (PAA) solutions was studied as a function of applied sinusoidal electric field and polymer concentration. Electric fields of strengths up to 300 V/cm and of frequencies between 100 and 5000 Hz were applied. It was found that the ELS effect increases with the field strength and decreases at high frequencies. The dependence of the ELS effect of ssDNA on polymer concentration passes through a maximum at 1% PAA. The relaxation times of decay of the ELS effect increase with increasing polymer concentrations. It was demonstrated that ELS is a useful method for investigation of ssDNA behavior in the course of pulse-field electrophoresis in polymer solutions.

  17. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin.

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-13

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecule, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G • U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G • U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  18. Therapeutic Effect of Novel Single-Stranded RNAi Agent Targeting Periostin in Eyes with Retinal Neovascularization

    Directory of Open Access Journals (Sweden)

    Takahito Nakama

    2017-03-01

    Full Text Available Retinal neovascularization (NV due to retinal ischemia remains one of the principal causes of vision impairment in patients with ischemic retinal diseases. We recently reported that periostin (POSTN may play a role in the development of preretinal fibrovascular membranes, but its role in retinal NV has not been determined. The purpose of this study was to examine the expression of POSTN in the ischemic retinas of a mouse model of oxygen-induced retinal NV. We also studied the function of POSTN on retinal NV using Postn KO mice and human retinal endothelial cells (HRECs in culture. In addition, we used a novel RNAi agent, NK0144, which targets POSTN to determine its effect on the development of retinal NV. Our results showed that the expression of POSTN was increased in the vascular endothelial cells, pericytes, and M2 macrophages in ischemic retinas. POSTN promoted the ischemia-induced retinal NV by Akt phosphorylation through integrin αvβ3. NK0144 had a greater inhibitory effect than canonical double-stranded siRNA on preretinal pathological NV in vivo and in vitro. These findings suggest a causal relationship between POSTN and retinal NV, and indicate a potential therapeutic role of intravitreal injection of NK0144 for retinal neovascular diseases.

  19. Expansion during PCR of short single-stranded DNA fragments carrying nonselfcomplementary dinucleotide or trinucleotide repeats

    Czech Academy of Sciences Publication Activity Database

    Reichová, Naďa; Kypr, Jaroslav

    2003-01-01

    Roč. 30, č. 3 (2003), s. 155-163 ISSN 0301-4851 R&D Projects: GA ČR GA301/01/0590 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA * PCR * expansion Subject RIV: BO - Biophysics Impact factor: 0.565, year: 2003

  20. Double-stranded DNA dissociates into single strands when dragged into a poor solvent.

    Science.gov (United States)

    Cui, Shuxun; Yu, Jin; Kühner, Ferdinand; Schulten, Klaus; Gaub, Hermann E

    2007-11-28

    DNA displays a richness of biologically relevant supramolecular structures, which depend on both sequence and ambient conditions. The effect of dragging double-stranded DNA (dsDNA) from water into poor solvent on the double-stranded structure is still unclear because of condensation. Here, we employed single molecule techniques based on atomic force microscopy and molecular dynamics (MD) simulations to investigate the change in structure and mechanics of DNA during the ambient change. We found that the two strands are split apart when the dsDNA is pulled at one strand from water into a poor solvent. The findings were corroborated by MD simulations where dsDNA was dragged from water into poor solvent, revealing details of the strand separation at the water/poor solvent interface. Because the structure of DNA is of high polarity, all poor solvents show a relatively low polarity. We speculate that the principle of spontaneous unwinding/splitting of dsDNA by providing a low-polarity (in other word, hydrophobic) micro-environment is exploited as one of the catalysis mechanisms of helicases.

  1. Genomic analysis of Pseudomonas putida phage tf with localized single-strand DNA interruptions.

    Directory of Open Access Journals (Sweden)

    Anatoly S Glukhov

    Full Text Available The complete sequence of the 46,267 bp genome of the lytic bacteriophage tf specific to Pseudomonas putida PpG1 has been determined. The phage genome has two sets of convergently transcribed genes and 186 bp long direct terminal repeats. The overall genomic architecture of the tf phage is similar to that of the previously described Pseudomonas aeruginosa phages PaP3, LUZ24 and phiMR299-2, and 39 out of the 72 products of predicted tf open reading frames have orthologs in these phages. Accordingly, tf was classified as belonging to the LUZ24-like bacteriophage group. However, taking into account very low homology levels between tf DNA and that of the other phages, tf should be considered as an evolutionary divergent member of the group. Two distinguishing features not reported for other members of the group were found in the tf genome. Firstly, a unique end structure--a blunt right end and a 4-nucleotide 3'-protruding left end--was observed. Secondly, 14 single-chain interruptions (nicks were found in the top strand of the tf DNA. All nicks were mapped within a consensus sequence 5'-TACT/RTGMC-3'. Two nicks were analyzed in detail and were shown to be present in more than 90% of the phage population. Although localized nicks were previously found only in the DNA of T5-like and phiKMV-like phages, it seems increasingly likely that this enigmatic structural feature is common to various other bacteriophages.

  2. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-02-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  3. Ion Density Analysis of Single-Stranded DNA in Liquid Crystal

    Science.gov (United States)

    Iwabata, Kazuki; Seki, Yasutaka; Toizumi, Ryota; Shimada, Yuki; Furue, Hirokazu; Sakaguchi, Kengo

    2013-09-01

    With the widespread use of liquid crystals (LCs) in liquid crystal displays, we have looked into the application of liquid crystals in biotechnology. The purpose of the study described here is to investigate the physical properties of DNA using LCs. Synthetic oligonucleotide molecules were dispersed in MLC6884, the sample injected into antiparallel cells, and the amount of mobile ions was measured. The LC cell doped with oligonucleotide molecules showed a sequence-dependent, specific correlation between oligonucleotide concentration and the amount of mobile ions in the LC cells. In the framework of the Stokes model and polyacrylamide gel electrophoresis (PAGE) analysis, we speculate that this result arises from the difference in ion mobility, which is caused by the shape of the oligonucleotide molecule in the LC.

  4. A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B.

    Directory of Open Access Journals (Sweden)

    Jeffrey A DeGrasse

    Full Text Available The bacterium Staphylococcus aureus is a common foodborne pathogen capable of secreting a cocktail of small, stable, and strain-specific, staphylococcal enterotoxins (SEs. Staphylococcal food poisoning (SFP results when improperly handled food contaminated with SEs is consumed. Gastrointestinal symptoms of SFP include emesis, diarrhea and severe abdominal pain, which manifest within hours of ingesting contaminated food. Immuno-affinity based methods directly detect, identify, and quantify several SEs within a food or clinical sample. However, the success of these assays depends upon the availability of a monoclonal antibody, the development of which is non-trivial and costly. The current scope of the available immuno-affinity based methods is limited to the classical SEs and does not encompass all of the known or emergent SEs. In contrast to antibodies, aptamers are short nucleic acids that exhibit high affinity and specificity for their targets without the high-costs and ethical concerns of animal husbandry. Further, researchers may choose to freely distribute aptamers and develop assays without the proprietary issues that increase the per-sample cost of immuno-affinity assays. This study describes a novel aptamer, selected in vitro, with affinity to staphylococcal enterotoxin B (SEB that may be used in lieu of antibodies in SE detection assays. The aptamer, designated APT(SEB1, successfully isolates SEB from a complex mixture of SEs with extremely high discrimination. This work sets the foundation for future aptamer and assay development towards the entire family of SEs. The rapid, robust, and low-cost identification and quantification of all of the SEs in S. aureus contaminated food is essential for food safety and epidemiological efforts. An in vitro generated library of SE aptamers could potentially allow for the comprehensive and cost-effective analysis of food samples that immuno-affinity assays currently cannot provide.

  5. Rurality study of restricted areas

    Directory of Open Access Journals (Sweden)

    Sergio Rivaroli

    2011-02-01

    Full Text Available Two main perspectives of investigation emerge from the study of a territory’s rurality: a geographical approach and a sociological approach. The research examines the sub-regional study case of ‘Nuovo circondario imolese’. The analysis shows that the combination of traditional institutional criteria with detailed informations about the territory, generates more accurate results which determine a better comprehension of the characteristics of restricted areas’ rurality. Over the period 1991-2001, the study highlights an increase in rural areas. This result could be interpreted as an effect of urban sprawl’s intensification, that increases the competition between non-farm residences and agricultural activities.

  6. Site Features

    Data.gov (United States)

    U.S. Environmental Protection Agency — This dataset consists of various site features from multiple Superfund sites in U.S. EPA Region 8. These data were acquired from multiple sources at different times...

  7. Parenting and restrictions in childhood epilepsy

    NARCIS (Netherlands)

    Rodenburg, R.; Meijer, A.M.; Scherphof, C.; Carpay, J.A.; Augustijn, P.; Aldenkamp, A.P.; Deković, M.

    2013-01-01

    Purpose: From the overprotection literature, the predictive and interactional (moderation) effects of controlling and indulgent parenting on restrictions in children with epilepsy were examined. Methods: Parents of 73 children with epilepsy completed questionnaires on parenting, restrictions, and

  8. 9 CFR 78.5 - General restrictions.

    Science.gov (United States)

    2010-01-01

    ... INTERSTATE TRANSPORTATION OF ANIMALS (INCLUDING POULTRY) AND ANIMAL PRODUCTS BRUCELLOSIS Restrictions on Interstate Movement of Cattle Because of Brucellosis § 78.5 General restrictions. Cattle may not be moved...

  9. Cuba: U.S. Restrictions on Travel and Remittances

    Science.gov (United States)

    2009-03-31

    that do not allow travel to visit cousins, aunts, uncles, and more- distant relatives. Another argument opposing restrictions on travel and private...office. In January 2006, OFAC suspended a South Florida travel agency, La Estrella de Cuba, from booking travel to Cuba. The agency reportedly was one...plans to conduct 25 on-site audits in 2006 at agencies that do business with Cuba.22 In addition to La Estrella de Cuba, OFAC suspended the service

  10. Revised selection criteria for candidate restriction enzymes in genome walking.

    Science.gov (United States)

    Taheri, Ali; Robinson, Stephen J; Parkin, Isobel; Gruber, Margaret Y

    2012-01-01

    A new method to improve the efficiency of flanking sequence identification by genome walking was developed based on an expanded, sequential list of criteria for selecting candidate enzymes, plus several other optimization steps. These criteria include: step (1) initially choosing the most appropriate restriction enzyme according to the average fragment size produced by each enzyme determined using in silico digestion of genomic DNA, step (2) evaluating the in silico frequency of fragment size distribution between individual chromosomes, step (3) selecting those enzymes that generate fragments with the majority between 100 bp and 3,000 bp, step (4) weighing the advantages and disadvantages of blunt-end sites vs. cohesive-end sites, step (5) elimination of methylation sensitive enzymes with methylation-insensitive isoschizomers, and step (6) elimination of enzymes with recognition sites within the binary vector sequence (T-DNA and plasmid backbone). Step (7) includes the selection of a second restriction enzyme with highest number of recognition sites within regions not covered by the first restriction enzyme. Step (8) considers primer and adapter sequence optimization, selecting the best adapter-primer pairs according to their hairpin/dimers and secondary structure. In step (9), the efficiency of genomic library development was improved by column-filtration of digested DNA to remove restriction enzyme and phosphatase enzyme, and most important, to remove small genomic fragments (enzymes, NsiI and NdeI, fit these criteria for the Arabidopsis thaliana genome. Their efficiency was assessed using 54 T(3) lines from an Arabidopsis SK enhancer population. Over 70% success rate was achieved in amplifying the flanking sequences of these lines. This strategy was also tested with Brachypodium distachyon to demonstrate its applicability to other larger genomes.

  11. The Fidelity Index provides a systematic quantitation of star activity of DNA restriction endonucleases.

    Science.gov (United States)

    Wei, Hua; Therrien, Caitlin; Blanchard, Aine; Guan, Shengxi; Zhu, Zhenyu

    2008-05-01

    Restriction endonucleases are the basic tools of molecular biology. Many restriction endonucleases show relaxed sequence recognition, called star activity, as an inherent property under various digestion conditions including the optimal ones. To quantify this property we propose the concept of the Fidelity Index (FI), which is defined as the ratio of the maximum enzyme amount showing no star activity to the minimum amount needed for complete digestion at the cognate recognition site for any particular restriction endonuclease. Fidelity indices for a large number of restriction endonucleases are reported here. The effects of reaction vessel, reaction volume, incubation mode, substrate differences, reaction time, reaction temperature and additional glycerol, DMSO, ethanol and Mn(2+) on the FI are also investigated. The FI provides a practical guideline for the use of restriction endonucleases and defines a fundamental property by which restriction endonucleases can be characterized.

  12. 21 CFR 203.20 - Sales restrictions.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Sales restrictions. 203.20 Section 203.20 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS: GENERAL PRESCRIPTION DRUG MARKETING Sales Restrictions § 203.20 Sales restrictions. Except as provided in § 203.22 or...

  13. Restrictive Imputation of Incomplete Survey Data

    NARCIS (Netherlands)

    Vink, G.

    2015-01-01

    This dissertation focuses on finding plausible imputations when there is some restriction posed on the imputation model. In these restrictive situations, current imputation methodology does not lead to satisfactory imputations. The restrictions, and the resulting missing data problems are real-life

  14. Restricted Schur polynomials and finite N counting

    International Nuclear Information System (INIS)

    Collins, Storm

    2009-01-01

    Restricted Schur polynomials have been posited as orthonormal operators for the change of basis from N=4 SYM to type IIB string theory. In this paper we briefly expound the relationship between the restricted Schur polynomials and the operators forwarded by Brown, Heslop, and Ramgoolam. We then briefly examine the finite N counting of the restricted Schur polynomials.

  15. Restriction Enzyme Mapping: A Simple Student Practical.

    Science.gov (United States)

    Higgins, Stephen J.; And Others

    1990-01-01

    An experiment that uses the recombinant plasmid pX1108 to illustrate restriction mapping is described. The experiment involves three restriction enzymes and employs single and double restriction enzyme digestions. A list of needed materials, procedures, safety precautions, results, and discussion are included. (KR)

  16. 44 CFR 402.2 - Restricted commodities.

    Science.gov (United States)

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Restricted commodities. 402.2... SHIPMENTS ON AMERICAN FLAG SHIPS AND AIRCRAFT (T-1, INT. 1) § 402.2 Restricted commodities. The restrictions of Transportation Order T-1 apply to the transportation or discharge of (a) commodities on the...

  17. Site decontamination

    International Nuclear Information System (INIS)

    Bicker, A.E.

    1981-01-01

    Among the several DOE sites that have been radiologically decontaminated under the auspices of the Nevada Operations Office are three whose physical characteristics are unique. These are the Tatum Dome Test Site (TDTS) near Hattiesburg, Mississippi; a location of mountainous terrain (Pahute Mesa) on the Nevada Test Site; and the GNOME site near Carlsbad, New Mexico. In each case the contamination, the terrain, and the climate conditions were different. This presentation includes a brief description of each site, the methods used to perform radiological surveys, the logistics required to support the decontamination (including health physics and sample analysis), and the specific techniques used to reduce or remove the contamination

  18. Site organization and site arrangement

    International Nuclear Information System (INIS)

    Boissonnet, B.; Macqueron, J.F.

    1976-01-01

    The present paper deals with criteria for the choice of a production unit or power plant site, the organization and development of a site in terms of its particular characteristics and takes into account personnel considerations in site organizations as well as the problem of integrating the architecture into the environment. (RW) [de

  19. A Traffic Restriction Scheme for Enhancing Carpooling

    Directory of Open Access Journals (Sweden)

    Dong Ding

    2017-01-01

    Full Text Available For the purpose of alleviating traffic congestion, this paper proposes a scheme to encourage travelers to carpool by traffic restriction. By a variational inequity we describe travelers’ mode (solo driving and carpooling and route choice under user equilibrium principle in the context of fixed demand and detect the performance of a simple network with various restriction links, restriction proportions, and carpooling costs. Then the optimal traffic restriction scheme aiming at minimal total travel cost is designed through a bilevel program and applied to a Sioux Fall network example with genetic algorithm. According to various requirements, optimal restriction regions and proportions for restricted automobiles are captured. From the results it is found that traffic restriction scheme is possible to enhance carpooling and alleviate congestion. However, higher carpooling demand is not always helpful to the whole network. The topology of network, OD demand, and carpooling cost are included in the factors influencing the performance of the traffic system.

  20. Sequence-specific protection of duplex DNA against restriction and methylation enzymes by pseudocomplementary PNAs

    DEFF Research Database (Denmark)

    Izvolsky, K I; Demidov, V V; Nielsen, P E

    2000-01-01

    I restriction endonuclease and dam methylase. The pcPNA-assisted protection against enzymatic methylation is more efficient when the PNA-binding site embodies the methylase-recognition site rather than overlaps it. We conclude that pcPNAs may provide the robust tools allowing to sequence-specifically manipulate...... DNA duplexes in a virtually sequence-unrestricted manner....

  1. Sites for locations of nuclear reactors

    International Nuclear Information System (INIS)

    Balcazar, M.; Huerta, M.; Lopez, A.

    2014-10-01

    A restriction on sites of nuclear energy is the history of seismic activity, in its magnitude (Richter) and intensity (Mercalli). This article delimits the areas of greatest magnitude and national seismic intensity, with restrictions of ground acceleration; the supplement areas with a low magnitude of seismic activity are shown. Potential sites for the location of these sites are introduced into a geographic information system. The set of geo-referenced data contains the location of the active volcanic manifestations; the historical record of earthquake epicenters, magnitudes and intensities; major geological faults; surface hydrology and water bodies; location of population density; protected areas; contour lines; the rock type or geology. The geographic information system allows entering normative criteria and environmental restrictions that correlate with geo-referenced data described above, forms both probable and exclusion areas for the installation of nuclear sites. (Author)

  2. Site assessment

    DEFF Research Database (Denmark)

    Villanueva, Héctor; Gómez Arranz, Paula

    This report describes the site assessment of given position in a given site, for a wind turbine with a well-defined hub height and rotor diameter. The analysis is carried out in accordance to IEC 61400-12-1 [1], and both an obstacle assessment and a terrain assessment are performed.......This report describes the site assessment of given position in a given site, for a wind turbine with a well-defined hub height and rotor diameter. The analysis is carried out in accordance to IEC 61400-12-1 [1], and both an obstacle assessment and a terrain assessment are performed....

  3. Site assessment

    DEFF Research Database (Denmark)

    Villanueva, Héctor; Vesth, Allan

    This report describes the site assessment of given position in a given site, for a wind turbine with a well-defined hub height and rotor diameter. The analysis is carried out in accordance to IEC 61400-12-1 [1], and both an obstacle assessment and a terrain assessment are performed......This report describes the site assessment of given position in a given site, for a wind turbine with a well-defined hub height and rotor diameter. The analysis is carried out in accordance to IEC 61400-12-1 [1], and both an obstacle assessment and a terrain assessment are performed...

  4. Sequence-specific protection of duplex DNA against restriction and methylation enzymes by pseudocomplementary PNAs

    DEFF Research Database (Denmark)

    Izvolsky, K I; Demidov, V V; Nielsen, P E

    2000-01-01

    of decameric pcPNAs block an access of RNA polymerase to the corresponding promoter. Here, we show that this type of PNAs protects selected DNA sites containing all four nucleobases from the action of restriction enzymes and DNA methyltransferases. We have found that pcPNAs as short as octamers form stable......I restriction endonuclease and dam methylase. The pcPNA-assisted protection against enzymatic methylation is more efficient when the PNA-binding site embodies the methylase-recognition site rather than overlaps it. We conclude that pcPNAs may provide the robust tools allowing to sequence-specifically manipulate...

  5. The Benefits of Calorie Restriction and Calorie Restriction Mimetics as Related to the Eye

    OpenAIRE

    Anekonda, T.S.

    2009-01-01

    The effects of calorie restriction without malnutrition seem to possess many beneficial effects in numerous disease states. Recently, studies related to calorie restriction mimetics that biochemically mimic the effects of calorie restriction are also becoming increasingly popular. Both calorie restriction and calorie restriction mimetics trigger an adaptive response reminiscent of mild-stress or low-dose toxic response, which is frequently referred to as hormesis in the toxicology literature....

  6. RNA aptamer inhibitors of a restriction endonuclease.

    Science.gov (United States)

    Mondragón, Estefanía; Maher, L James

    2015-09-03

    Restriction endonucleases (REases) recognize and cleave short palindromic DNA sequences, protecting bacterial cells against bacteriophage infection by attacking foreign DNA. We are interested in the potential of folded RNA to mimic DNA, a concept that might be applied to inhibition of DNA-binding proteins. As a model system, we sought RNA aptamers against the REases BamHI, PacI and KpnI using systematic evolution of ligands by exponential enrichment (SELEX). After 20 rounds of selection under different stringent conditions, we identified the 10 most enriched RNA aptamers for each REase. Aptamers were screened for binding and specificity, and assayed for REase inhibition. We obtained eight high-affinity (Kd ∼12-30 nM) selective competitive inhibitors (IC50 ∼20-150 nM) for KpnI. Predicted RNA secondary structures were confirmed by in-line attack assay and a 38-nt derivative of the best anti-KpnI aptamer was sufficient for inhibition. These competitive inhibitors presumably act as KpnI binding site analogs, but lack the primary consensus KpnI cleavage sequence and are not cleaved by KpnI, making their potential mode of DNA mimicry fascinating. Anti-REase RNA aptamers could have value in studies of REase mechanism and may give clues to a code for designing RNAs that competitively inhibit DNA binding proteins including transcription factors. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Introduction to the Hanford Site

    International Nuclear Information System (INIS)

    Cushing, C.E.

    1995-01-01

    This section of the 1994 Hanford Site Environmental Report discusses the Site mission and provides general information about the site. The U.S. DOE has established a new mission for Hanford including: Management of stored wastes, environmental restoration, research and development, and development of new technologies. The Hanford Reservation is located in south central Washington State just north of the confluence of the Snake and Yakima Rivers with the Columbia River. The approximately 1,450 square kilometers which comprises the Hanford Site, with restricted public access, provides a buffer for the smaller areas within the site which have historically been used for the production of nuclear materials, radioactive waste storage, and radioactive waste disposal

  8. Site Calibration

    DEFF Research Database (Denmark)

    Kock, Carsten Weber; Vesth, Allan

    This Site Calibration report is describing the results of a measured site calibration for a site in Denmark. The calibration is carried out by DTU Wind Energy in accordance with Ref.[3] and Ref.[4]. The measurement period is given. The site calibration is carried out before a power performance...... measurement on a given turbine to clarify the influence from the terrain on the ratio between the wind speed at the center of the turbine hub and at the met mast. The wind speed at the turbine is measured by a temporary mast placed at the foundation for the turbine. The site and measurement equipment...... is detailed described in [1] and [2]. All parts of the sensors and the measurement system have been installed by DTU Wind Energy....

  9. Efficient DNA subcloning through selective restriction endonuclease digestion.

    Science.gov (United States)

    Spear, M A

    2000-04-01

    Described here is a selective restriction endonuclease digestion method that eliminates the electrophoresis step that is usually used during the subcloning of new DNA sequences into typical E. coli-based plasmids. The method increases yield while decreasing laboratory resource and time utilization. By using donor and acceptor sequences that contain unique restriction sites found only outside of the intended recombination sequences, the initial digestion products can be directly combined without electrophoresis if the ligation step is followed by a selective digestion using the unique restriction enzymes before transformation. This system is based on the several order of magnitude decrease in transformation efficiency of linearized compared to circular plasmids. As an example, this method was used to obtain recombinants between a 3.6 kb acceptor plasmid and 3.0 kb insert following one ligation reaction after the failure of nine standard reactions using similar amounts of input DNA. It is particularly applicable to situations in which low subcloning efficiencies are expected. The technique can be extended to a large percentage of planned recombinations by using nonidentical compatible cohesive or blunt-ended fragments, or site-directed mutagenesis.

  10. Hanford land disposal restrictions plan for mixed wastes

    Energy Technology Data Exchange (ETDEWEB)

    1990-10-01

    Since the early 1940s, the Hanford Site has been involved in the production and purification of nuclear defense materials. These production activities have resulted in the generation of large quantities of liquid and solid radioactive mixed waste. This waste is subject to regulation under authority of both the Resource Conservation and Recovery Act of 1976 (RCRA) and the Atomic Energy Act. The State of Washington Department of Ecology (Ecology), the US Environmental Protection Agency (EPA), and the US Department of Energy (DOE) have entered into an agreement, the Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) to bring Hanford Site Operations into compliance with dangerous waste regulations. The Tri-Party Agreement was amended to require development of the Hanford Land Disposal Restrictions Plan for Mixed Wastes (this plan) to comply with land disposal restrictions requirements for radioactive mixed waste. The Tri-Party Agreement requires, and the this plan provides, the following sections: Waste Characterization Plan, Storage Report, Treatment Report, Treatment Plan, Waste Minimization Plan, a schedule, depicting the events necessary to achieve full compliance with land disposal restriction requirements, and a process for establishing interim milestones. 34 refs., 28 figs., 35 tabs.

  11. Assessing restrictiveness of national alcohol marketing policies.

    Science.gov (United States)

    Esser, Marissa B; Jernigan, David H

    2014-01-01

    To develop an approach for monitoring national alcohol marketing policies globally, an area of the World Health Organization's (WHO) Global Alcohol Strategy. Data on restrictiveness of alcohol marketing policies came from the 2002 and 2008 WHO Global Surveys on Alcohol and Health. We included four scales in a sensitivity analysis to determine optimal weights to score countries on their marketing policies and applied the selected scale to assess national marketing policy restrictiveness. Nearly, 36% of countries had no marketing restrictions. The overall restrictiveness levels were not significantly different between 2002 and 2008. The number of countries with strict marketing regulations did not differ across years. This method of monitoring alcohol marketing restrictiveness helps track progress towards implementing WHO'S Global Alcohol Strategy. Findings indicate a consistent lack of restrictive policies over time, making this a priority area for national and global action. © The Author 2014. Medical Council on Alcohol and Oxford University Press. All rights reserved.

  12. Placental Adaptations in Growth Restriction

    Directory of Open Access Journals (Sweden)

    Song Zhang

    2015-01-01

    Full Text Available The placenta is the primary interface between the fetus and mother and plays an important role in maintaining fetal development and growth by facilitating the transfer of substrates and participating in modulating the maternal immune response to prevent immunological rejection of the conceptus. The major substrates required for fetal growth include oxygen, glucose, amino acids and fatty acids, and their transport processes depend on morphological characteristics of the placenta, such as placental size, morphology, blood flow and vascularity. Other factors including insulin-like growth factors, apoptosis, autophagy and glucocorticoid exposure also affect placental growth and substrate transport capacity. Intrauterine growth restriction (IUGR is often a consequence of insufficiency, and is associated with a high incidence of perinatal morbidity and mortality, as well as increased risk of cardiovascular and metabolic diseases in later life. Several different experimental methods have been used to induce placental insufficiency and IUGR in animal models and a range of factors that regulate placental growth and substrate transport capacity have been demonstrated. While no model system completely recapitulates human IUGR, these animal models allow us to carefully dissect cellular and molecular mechanisms to improve our understanding and facilitate development of therapeutic interventions.

  13. Cardiac MRI in restrictive cardiomyopathy

    Energy Technology Data Exchange (ETDEWEB)

    Gupta, A. [Department of Cardiovascular Radiology, All India Institute of Medical Sciences, Ansari Nagar, Delhi (India); Singh Gulati, G., E-mail: gulatigurpreet@rediffmail.com [Department of Cardiovascular Radiology, All India Institute of Medical Sciences, Ansari Nagar, Delhi (India); Seth, S. [Department of Cardiology, All India Institute of Medical Sciences, Ansari Nagar, Delhi (India); Sharma, S. [Department of Cardiovascular Radiology, All India Institute of Medical Sciences, Ansari Nagar, Delhi (India)

    2012-02-15

    Restrictive cardiomyopathy (RCM) is a specific group of heart muscle disorders characterized by inadequate ventricular relaxation during diastole. This leads to diastolic dysfunction with relative preservation of systolic function. Although short axis systolic function is usually preserved in RCM, the long axis systolic function may be severely impaired. Confirmation of diagnosis and information regarding aetiology, extent of myocardial damage, and response to treatment requires imaging. Importantly, differentiation from constrictive pericarditis (CCP) is needed, as only the latter is managed surgically. Echocardiography is the initial cardiac imaging technique but cannot reliably suggest a tissue diagnosis; although recent advances, especially tissue Doppler imaging and spectral tracking, have improved its ability to differentiate RCM from CCP. Cardiac catheterization is the reference standard, but is invasive, two-dimensional, and does not aid myocardial characterization. Cardiac magnetic resonance (CMR) is a versatile technique providing anatomical, morphological and functional information. In recent years, it has been shown to provide important information regarding disease mechanisms, and also been found useful to guide treatment, assess its outcome and predict patient prognosis. This review describes the CMR features of RCM, appearances in various diseases, its overall role in patient management, and how it compares with other imaging techniques.

  14. Measuring Regulatory Restrictions in Logistics Services

    OpenAIRE

    Claire HOLLWEG; Marn-Heong WONG

    2009-01-01

    This study measures the extent of restrictions on trade in logistics services in the ASEAN+6 economies by constructing a logistics regulatory restrictiveness index for each economy that quantifies the extent of government regulations faced by logistics service providers. This is the first study of its kind to construct a regulatory index of the entire logistics sector, which includes the main modes of international transport and customs restrictions. The indices show that large differences ex...

  15. Antenatal risk factor for intrauterine growth restriction

    Directory of Open Access Journals (Sweden)

    N. D. Guliyev

    2015-01-01

    Full Text Available Objective: to study pregnancy and delivery characteristics in mothers who have given birth to infants with intrauterine growth restriction. Pregnancy and delivery outcomes were studied in 315 mothers who had given birth to infants with intrauterine growth restriction (a study group. The studies have shown that toxemia, anemia, and preeclampsia prevent physiological pregnancy that concurrent with placental insufficiency leads to serious metabolic disturbances in the mother-placenta-fetus system and eventually lead to intrauterine growth restriction. A set of pathological factors of pregnancy required surgical delivery in mothers with fetal growth restriction.

  16. Curves of restricted type in euclidean spaces

    Directory of Open Access Journals (Sweden)

    Bengü Kılıç Bayram

    2014-01-01

    Full Text Available Submanifolds of restricted type were introduced in [7]. In the present study we consider restricted type of curves in Em. We give some special examples. We also show that spherical curve in S2(r C E3 is of restricted type if and only if either ƒ(s is constant or a linear function of s of the form ƒ(s = ±s + b and every closed W - curve of rank k and of length 2(r in E2k is of restricted type.

  17. Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

    KAUST Repository

    Shirbini, Afnan

    2017-05-01

    Single-molecule DNA flow-stretching assays have been a powerful approach to study various aspects on the mechanism of DNA replication for more than a decade. This technique depends on flow-induced force on a bead attached to a surface-tethered DNA. The difference in the elastic property between double-strand DNA (long) and single-strand DNA (short) at low regime force allows the observation of the beads motion when the dsDNA is converted to ssDNA by the replisome machinery during DNA replication. Here, I aim to develop an assay to track in real-time the encounter of the bacteriophage T7 replisome with abasic lesion site inserted on the leading strand template. I optimized methods to construct the DNA substrate that contains the abasic site and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image the encounter of the T7 replisome with abasic site and to characterize how the interactions between the helicase and the polymerase could influence the polymerase proofreading ability and its direct bypass of this highly common DNA damage type.

  18. Cofactor requirement of HpyAV restriction endonuclease.

    Directory of Open Access Journals (Sweden)

    Siu-Hong Chan

    Full Text Available BACKGROUND: Helicobacter pylori is the etiologic agent of common gastritis and a risk factor for gastric cancer. It is also one of the richest sources of Type II restriction-modification (R-M systems in microorganisms. PRINCIPAL FINDINGS: We have cloned, expressed and purified a new restriction endonuclease HpyAV from H. pylori strain 26695. We determined the HpyAV DNA recognition sequence and cleavage site as CCTTC 6/5. In addition, we found that HpyAV has a unique metal ion requirement: its cleavage activity is higher with transition metal ions than in Mg(++. The special metal ion requirement of HpyAV can be attributed to the presence of a HNH catalytic site similar to ColE9 nuclease instead of the canonical PD-X-D/EXK catalytic site found in many other REases. Site-directed mutagenesis was carried out to verify the catalytic residues of HpyAV. Mutation of the conserved metal-binding Asn311 and His320 to alanine eliminated cleavage activity. HpyAV variant H295A displayed approximately 1% of wt activity. CONCLUSIONS/SIGNIFICANCE: Some HNH-type endonucleases have unique metal ion cofactor requirement for optimal activities. Homology modeling and site-directed mutagenesis confirmed that HpyAV is a member of the HNH nuclease family. The identification of catalytic residues in HpyAV paved the way for further engineering of the metal binding site. A survey of sequenced microbial genomes uncovered 10 putative R-M systems that show high sequence similarity to the HpyAV system, suggesting lateral transfer of a prototypic HpyAV-like R-M system among these microorganisms.

  19. Cofactor requirement of HpyAV restriction endonuclease.

    Science.gov (United States)

    Chan, Siu-Hong; Opitz, Lars; Higgins, Lauren; O'loane, Diana; Xu, Shuang-Yong

    2010-02-05

    Helicobacter pylori is the etiologic agent of common gastritis and a risk factor for gastric cancer. It is also one of the richest sources of Type II restriction-modification (R-M) systems in microorganisms. We have cloned, expressed and purified a new restriction endonuclease HpyAV from H. pylori strain 26695. We determined the HpyAV DNA recognition sequence and cleavage site as CCTTC 6/5. In addition, we found that HpyAV has a unique metal ion requirement: its cleavage activity is higher with transition metal ions than in Mg(++). The special metal ion requirement of HpyAV can be attributed to the presence of a HNH catalytic site similar to ColE9 nuclease instead of the canonical PD-X-D/EXK catalytic site found in many other REases. Site-directed mutagenesis was carried out to verify the catalytic residues of HpyAV. Mutation of the conserved metal-binding Asn311 and His320 to alanine eliminated cleavage activity. HpyAV variant H295A displayed approximately 1% of wt activity. Some HNH-type endonucleases have unique metal ion cofactor requirement for optimal activities. Homology modeling and site-directed mutagenesis confirmed that HpyAV is a member of the HNH nuclease family. The identification of catalytic residues in HpyAV paved the way for further engineering of the metal binding site. A survey of sequenced microbial genomes uncovered 10 putative R-M systems that show high sequence similarity to the HpyAV system, suggesting lateral transfer of a prototypic HpyAV-like R-M system among these microorganisms.

  20. Site development

    International Nuclear Information System (INIS)

    Noack, J.

    1975-01-01

    The subject of this paper is a general view over all necessary considerations to develop the site after it has been chosen and before starting with the construction of a nuclear power plant. (orig./RW) [de