WorldWideScience

Sample records for single-stranded nucleic acid-like

  1. Development of an Interaction Assay between Single-Stranded Nucleic Acids Trapped with Silica Particles and Fluorescent Compounds

    Directory of Open Access Journals (Sweden)

    R. Maeda

    2012-09-01

    Full Text Available Biopolymers are easily denatured by heating, a change in pH or chemical substances when they are immobilized on a substrate. To prevent denaturation of biopolymers, we developed a method to trap a polynucleotide on a substrate by hydrogen bonding using silica particles with surfaces modified by aminoalkyl chains ([A-AM silane]/SiO2. [A-AM silane]/SiO2 was synthesized by silane coupling reaction of N-2-(aminoethyl-3-aminopropyltrimethoxysilane (A-AM silane with SiO2 particles with a diameter of 5 μm at 100 °C for 20 min. The surface chemical structure of [A-AM silane]/SiO2 was characterized by Fourier transform infrared spectroscopy and molecular orbital calculations. The surface of the silica particles was modified with A-AM silane and primary amine groups were formed. [A-AM silane]/SiO2 was trapped with single-stranded nucleic acids [(Poly-X; X = A (adenine, G (guanine and C (cytosine] in PBS solution at 37 °C for 1 h. The single-stranded nucleic acids were trapped on the surface of the [A-AM silane]/SiO2 by hydrogen bonding to form conjugated materials. The resulting complexes were further conjugated by derivatives of acridine orange (AO as fluorescent labels under the same conditions to form [AO:Poly-X:A-AM silane]/SiO2 complexes. Changes in the fluorescence intensity of these complexes originating from interactions between the single-stranded nucleic acid and aromatic compounds were also evaluated. The change in intensity displayed the order [AO: Poly-G: A-AM silane]/SiO2 > [AO:Poly-A:A-AM silane]/SiO2 >> [AO:Poly-C:A-AM silane]/SiO2. This suggests that the single-stranded nucleic acids conjugated with aminoalkyl chains on the surfaces of SiO2 particles and the change in fluorescence intensity reflected the molecular interaction between AO and the nucleic-acid base in a polynucleotide.

  2. Highly stable triple helix formation by homopyrimidine (l)-acyclic threoninol nucleic acids with single stranded DNA and RNA

    DEFF Research Database (Denmark)

    Kumar, Vipin; Kesavan, Venkitasamy; Gothelf, Kurt Vesterager

    2015-01-01

    Acyclic (l)-threoninol nucleic acid (aTNA) containing thymine, cytosine and adenine nucleobases were synthesized and shown to form surprisingly stable triplexes with complementary single stranded homopurine DNA or RNA targets. The triplex structures consist of two (l)-aTNA strands and one DNA...... or RNA, and these triplexes are significantly stronger than the corresponding DNA or RNA duplexes as shown in competition experiments. As a unique property the (l)-aTNAs exclusively form triplex structures with DNA and RNA and no duplex structures are observed by gel electrophoresis. The results were...... compared to the known enantiomer (d)-aTNA, which forms much weaker triplexes depending upon temperature and time. It was demonstrated that (l)-aTNA triplexes are able to stop primer extension on a DNA template, showing the potential of (l)-aTNA for antisense applications....

  3. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family.

    Science.gov (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław

    2017-05-01

    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  4. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.

    1978-01-01

    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  5. Ex vivo gene editing of the dystrophin gene in muscle stem cells mediated by peptide nucleic acid single stranded oligodeoxynucleotides induces stable expression of dystrophin in a mouse model for Duchenne muscular dystrophy.

    Science.gov (United States)

    Nik-Ahd, Farnoosh; Bertoni, Carmen

    2014-07-01

    Duchenne muscular dystrophy (DMD) is a fatal disease caused by mutations in the dystrophin gene, which result in the complete absence of dystrophin protein throughout the body. Gene correction strategies hold promise to treating DMD. Our laboratory has previously demonstrated the ability of peptide nucleic acid single-stranded oligodeoxynucleotides (PNA-ssODNs) to permanently correct single-point mutations at the genomic level. In this study, we show that PNA-ssODNs can target and correct muscle satellite cells (SCs), a population of stem cells capable of self-renewing and differentiating into muscle fibers. When transplanted into skeletal muscles, SCs transfected with correcting PNA-ssODNs were able to engraft and to restore dystrophin expression. The number of dystrophin-positive fibers was shown to significantly increase over time. Expression was confirmed to be the result of the activation of a subpopulation of SCs that had undergone repair as demonstrated by immunofluorescence analyses of engrafted muscles using antibodies specific to full-length dystrophin transcripts and by genomic DNA analysis of dystrophin-positive fibers. Furthermore, the increase in dystrophin expression detected over time resulted in a significant improvement in muscle morphology. The ability of transplanted cells to return into quiescence and to activate upon demand was confirmed in all engrafted muscles following injury. These results demonstrate the feasibility of using gene editing strategies to target and correct SCs and further establish the therapeutic potential of this approach to permanently restore dystrophin expression into muscle of DMD patients. © 2014 AlphaMed Press.

  6. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)

    student

    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  7. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase.

    Science.gov (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias

    2017-06-02

    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Intercalation of single-strand oligonucleotides between nucleolipid anionic membranes: a neutron diffraction study.

    Science.gov (United States)

    Milani, Silvia; Berti, Debora; Dante, Silvia; Hauss, Thomas; Baglioni, Piero

    2009-04-07

    This contribution presents a neutron diffraction investigation of anionic lamellar phases composed of mixtures of 1-palmitoyl, 2-oleoyl phosphatidyl-nucleosides (POPN, where N is either adenosine or uridine), and POPC (1-palmitoyl,2-oleoyl-phosphatidyl-choline). Their behavior is studied for two different mole ratios and in the presence of nucleic acids. The samples are formed by the evaporation of liposomal dispersions prepared in water or in solutions containing single-strand oligonucleotides. Previous small angle X-ray scattering (SAXS) experiments on the system POPA/polyU (polyuridylic acid, high degree of polymerization, synthetic ribonucleic acid) proved that the insertion and ordering of the biopolymer in the phospholipid lamellae were driven by molecular recognition. In the present study, we extend the previous investigation to single-strand monodisperse oligonucleotides (50-mers). Structural details of the membranes were obtained from the analysis of the neutron diffraction scattering length density profiles. The evidence of direct and specific interactions, driven by molecular recognition between the nucleic polar heads of the nucleolipid and the single-strand nucleic acid, is strengthened by the comparison with identically charged bilayers formed by POPG/POPC. These results contribute to the understanding of the parameters governing the interactions between nucleolipid membranes and oligonucleotides, providing a novel strategy for the design of lipid-based vehicles for nucleic acids.

  9. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    Science.gov (United States)

    Hong, Ka Lok

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  10. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  11. Ion assisted structural collapse of a single stranded DNA: A molecular dynamics approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Soumadwip; Dixit, Himanshu; Chakrabarti, Rajarshi, E-mail: rajarshi@chem.iitb.ac.in

    2015-09-28

    Highlights: • The dynamics of a single-stranded DNA in presence of different concentrations of Mg{sup 2+} is investigated. • The initial DNA chain collapse is characterized by the formation of non-sequentially stacked base pairs. • The DNA chain re-swells at high concentrations of Mg{sup 2+} as a consequence of overcharging. - Abstract: The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counterions. It is well known that the structural collapse of DNA is favoured in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl{sub 2}) single stranded DNA with base sequence 5′-CGCGAATTCGCG-3′ (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  12. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    Science.gov (United States)

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  13. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian

    2012-07-06

    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  14. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.

    1985-01-01

    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  15. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    Science.gov (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.

    1987-01-01

    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  17. Improved single-strand DNA sizing accuracy in capillary electrophoresis.

    OpenAIRE

    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B

    1997-01-01

    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  18. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  19. Programmable autonomous synthesis of single-stranded DNA

    Science.gov (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

    2018-02-01

    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  20. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples.

    Science.gov (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J

    2006-03-01

    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  1. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    Science.gov (United States)

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  2. Elastic properties of alternative versus single-stranded leveling archwires.

    Science.gov (United States)

    Rucker, Brian K; Kusy, Robert P

    2002-11-01

    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  3. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.

    1976-02-01

    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  4. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol

    2010-05-01

    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  5. Single stranded loops of quadruplex DNA as key benchmark for testing nucleic acids force fields

    Czech Academy of Sciences Publication Activity Database

    Fadrná, E.; Špačková, Naďa; Sarzynska, J.; Koča, J.; Orozco, M.; Cheatham III, T.E.; Kulinski, T.; Šponer, Jiří

    2009-01-01

    Roč. 5, č. 9 (2009), s. 2514-2530 ISSN 1549-9618 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802 Grant - others:GA ČR(CZ) GA203/09/1476 Program:GA Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA quadruplex * MD simulation * force fields Subject RIV: BO - Biophysics Impact factor: 4.804, year: 2009

  6. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.

    1984-01-01

    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  7. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  8. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela

    2010-01-01

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  9. End-joining long nucleic acid polymers

    NARCIS (Netherlands)

    Van den Hout, M.; Hage, S.; Dekker, C.; Dekker, N.H.

    2008-01-01

    Many experiments involving nucleic acids require the hybridization and ligation of multiple DNA or RNA molecules to form a compound molecule. When one of the constituents is single stranded, however, the efficiency of ligation can be very low and requires significant individually tailored

  10. A high throughput system for the preparation of single stranded templates grown in microculture.

    Science.gov (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M

    1994-01-01

    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  11. Complex shapes self-assembled from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng

    2012-05-30

    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  12. The Adsorption of Short Single-Stranded DNA Oligomers on Mineral Surfaces

    Science.gov (United States)

    Kopstein, M.; Sverjensky, D. A.; Hazen, R. M.; Cleaves, H. J.

    2009-12-01

    Previous studies have described feasible pathways for the synthesis of simple organic building blocks such as formaldehyde and hydrogen cyanide, and their reaction to form more complex biomolecules such as nucleotide bases, amino acids and sugars (Miller and Orgel 1974, Miller and Cleaves 2006). However, the polymerization of monomers into a useful genetic material remains problematic (Orgel 2004). Organic building blocks were unlikely to polymerize from very dilute aqueous solution in the primitive oceans. Mineral surface adsorption has been suggested as a possible mechanism for concentrating the necessary building blocks (Bernal 1951). This study focused on the adsorption behavior of single-stranded DNA homo-oligomers of adenine and thymine (including the monomers, dimers, tetramers, hexamers, octomers, and decamers) with five different mineral surfaces (pyrite, rutile, hematite, olivine and calcite). Adsorption was studied in 0.1 M pH 8.1 KHCO3 with0.05 M NaCl as background electrolyte. Solutions were mixed for 24 hours at room temperature, centrifuged and the supernatants analyzed by UV/visible spectrophotometry. Equilibrium solution concentrations were measured and used to determine the number of moles adsorbed per square meter. Langmuir isotherms were constructed using the experimental data. It was found that adenine-containing molecules tend to bind much more strongly than thymine-containing molecules. It was also found that the number of moles adsorbed at saturation tends to fall with increasing chain length, while adsorption affinity tends to rise. Oligomer length appears to affect adsorption more than the mineral type. These results may have implications for the primordial organization of the first nucleic acid molecules as the persistence of extra-cellular nucleic acids in the environment. References Bernal, J. D. (1951) The Physical Basis of Life (Routledge, London). Miller S.L. and Cleaves, H.J. (2006) Prebiotic chemistry on the primitive Earth. In

  13. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids.

    Science.gov (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R

    2015-04-08

    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  14. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2003-01-01

    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  15. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.

    OpenAIRE

    Barany, F; Boeke, J D

    1983-01-01

    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  16. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  17. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi

    1990-01-01

    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  18. Locked nucleic acid (LNA): High affinity targeting of RNA for diagnostics and therapeutics

    DEFF Research Database (Denmark)

    Kauppinen, S.; Vester, Birte; Wengel, Jesper

    2005-01-01

    Locked nucleic acid (LNA) is a nucleic acid analogue containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA mimicking sugar conformation. This conformational restriction results in unprecedented hybridization affinity towards complementary single stranded RN...

  19. Capillary electrophoresis ribosomal RNA single-stranded conformation polymorphism: a new approach for characterization of low-diversity microbial communities.

    Science.gov (United States)

    Nai, Yi H; Zemb, Oliver; Gutierrez-Zamora, Maria-Luisa; Manefield, Mike; Powell, Shane M; Breadmore, Michael C

    2012-10-01

    Capillary electrophoresis (CE) has been the principle system for nucleic acid analysis since the early 1990s due to its inherent advantages such as fast analysis time, high resolution and efficiency, minimal sample requirement, high detection sensitivity, and automation. In the past few decades, microbial community fingerprinting methods such as terminal restriction fragment length polymorphism and single-stranded conformation polymorphism (SSCP) have migrated to CE to utilize its advantages over conventional slab gel electrophoresis. Recently, a gel-based direct rRNA fingerprint method was demonstrated. Different from other existing microbial community characterization approaches, this novel approach is polymerase chain reaction free and capable of providing information on the relative abundance of rRNA from individual phylotypes in low-diversity samples. As a gel-based method, it has a long analysis time and relatively large reagent and sample requirements. Here, we addressed these limitations by transferring the RNA fingerprint approach to the CE platform. Analysis time significantly improved from 24 h to 60 min, and the use of a fluorescently labeled hybridization probe as the detection strategy decreased the sample requirement by ten-fold. The combination of fast analysis time, low sample requirement, and sensitive fluorescence detection makes CE-RNA-SSCP an appealing new approach for characterizing low-diversity microbial communities.

  20. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der

    1988-01-01

    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  1. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.

    2002-01-01

    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit...

  2. Dynamics of RecA filaments on single-stranded DNA

    NARCIS (Netherlands)

    Van Loenhout, M.T.J.; Van der Heijden, T.; Kanaar, R.; Wyman, C.; Dekker, C.

    2009-01-01

    RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on

  3. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2001-01-01

    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  4. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP

    1996-01-01

    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  5. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  6. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket.

    Science.gov (United States)

    Pham, Hanh T; Bergoin, Max; Tijssen, Peter

    2013-03-14

    The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  7. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket

    OpenAIRE

    Pham, Hanh T.; Bergoin, Max; Tijssen, Peter

    2013-01-01

    International audience; The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  8. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.

    1983-01-01

    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  9. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B

    2006-01-01

    by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  10. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  11. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud

    2012-06-01

    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  12. Synthesis of a wild-type and three mutant Cucurbita maxima trypsin inhibitor-encoding genes by a single-strand approach.

    Science.gov (United States)

    Botes, D P; Qobose, M D; Corfield, V A

    1991-09-15

    A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.

  13. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.

    1985-01-01

    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  14. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.

    1982-01-01

    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  15. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification

    OpenAIRE

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-01-01

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen...

  16. In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides

    International Nuclear Information System (INIS)

    Oppenheim, Amos B.; Rattray, Alison J.; Bubunenko, Mikhail; Thomason, Lynn C.; Court, Donald L.

    2004-01-01

    We demonstrate that the bacteriophage λ Red functions efficiently recombine linear DNA or single-strand oligonucleotides (ss-oligos) into bacteriophage λ to create specific changes in the viral genome. Point mutations, deletions, and gene replacements have been created. While recombineering with oligonucleotides, we encountered other mutations accompanying the desired point mutational change. DNA sequence analysis suggests that these unwanted mutations are mainly frameshift deletions introduced during oligonucleotide synthesis

  17. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis.

    Science.gov (United States)

    Olszewski, Marcin; Mickiewicz, Małgorzata; Kur, Józef

    2008-07-01

    The thermophilic bacterium Thermoanaerobacter tengcongensis has two single-stranded DNA-binding (SSB) proteins, designated TteSSB2 and TteSSB3. In a SSB complementation assay in Escherichia coli, only TteSSB3 took over the in vivo function of EcoSSB. We have cloned the ssb genes obtained by PCR and have developed E. coli overexpression systems. The TteSSB2 and TteSSB3 consist of 153 and 150 amino acids with a calculated molecular mass of 17.29 and 16.96 kDa, respectively. They are the smallest known bacterial SSB proteins. The homology between amino acid sequences of these proteins is 40% identity and 53% similarity. They are functional as homotetramers, with each monomer encoding one single-stranded DNA binding domain (OB-fold). In fluorescence titrations with poly(dT), both proteins bind single-stranded DNA with a binding site size of about 40 nt per homotetramer. Thermostability with half-life of about 30 s at 95 degrees C makes TteSSB3 similar to the known SSB of Thermus aquaticus (TaqSSB). The TteSSB2 was fully active even after 6 h incubation at 100 degrees C. Here, we show for the first time paralogous thermostable homotetrameric SSBs, which could be an attractive alternative for known homodimeric thermostable SSB proteins in their applications for molecular biology methods and analytical purposes.

  18. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana.

    Science.gov (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L

    2005-04-01

    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  19. Stretching and controlled motion of single-stranded DNA in locally heated solid-state nanopores.

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B; Aksimentiev, Aleksei

    2013-08-27

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4-8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA.

  20. Repair of ultraviolet light damage in Saccharomyces cerevisiae as studied with double- and single-stranded incoming DNAs

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, D.; Hieda, K.

    1992-01-01

    Purified double- and single-stranded DNAs of the autonomously replicating vector M13RK9-T were irradiated with ultraviolet light (UV) in vitro and introduced into competent whole cells of Saccharomyces cerevisiae. Incoming double-stranded DNA was more sensitive to UV in excision repair-deficient rad2-1 cells than in proficient repair RAD + cells, while single-stranded DNA exhibited high sensitivity in both host cells. The results indicate that in yeast there is no effective rescue of UV-incoming single-stranded DNA by excision repair or other constitutive dark repair processes

  1. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks.

    Science.gov (United States)

    Pachkowski, Brian; Nakamura, Jun

    2013-01-01

    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  2. Assessing single-stranded oligonucleotide drug-induced effects in vitro reveals key risk factors for thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Sabine Sewing

    Full Text Available Single-stranded oligonucleotides (ON comprise a promising therapeutic platform that enables selective modulation of currently undruggable targets. The development of novel ON drug candidates has demonstrated excellent efficacy, but in certain cases also some safety liabilities were reported. Among them are events of thrombocytopenia, which have recently been evident in late stage trials with ON drugs. The underlying mechanisms are poorly understood and the risk for ON candidates causing such events cannot be sufficiently assessed pre-clinically. We investigated potential thrombocytopenia risk factors of ONs and implemented a set of in vitro assays to assess these risks. Our findings support previous observations that phosphorothioate (PS-ONs can bind to platelet proteins such as platelet collagen receptor glycoprotein VI (GPVI and activate human platelets in vitro to various extents. We also show that these PS-ONs can bind to platelet factor 4 (PF4. Binding to platelet proteins and subsequent activation correlates with ON length and connected to this, the number of PS in the backbone of the molecule. Moreover, we demonstrate that locked nucleic acid (LNA ribosyl modifications in the wings of the PS-ONs strongly suppress binding to GPVI and PF4, paralleled by markedly reduced platelet activation. In addition, we provide evidence that PS-ONs do not directly affect hematopoietic cell differentiation in culture but at higher concentrations show a pro-inflammatory potential, which might contribute to platelet activation. Overall, our data confirm that certain molecular attributes of ONs are associated with a higher risk for thrombocytopenia. We propose that applying the in vitro assays discussed here during the lead optimization phase may aid in deprioritizing ONs with a potential to induce thrombocytopenia.

  3. Alpha-Helical Fragaceatoxin C Nanopore Engineered for Double-Stranded and Single-Stranded Nucleic Acid Analysis

    NARCIS (Netherlands)

    Wloka, Carsten; Mutter, Natalie Lisa; Soskine, Misha; Maglia, Giovanni

    2016-01-01

    Nanopores are used in single-molecule DNA analysis and sequencing. Herein, we show that Fragaceatoxin C (FraC), an α-helical pore-forming toxin from an actinoporin protein family, can be reconstituted in sphingomyelin-free standard planar lipid bilayers. We engineered FraC for DNA analysis and show

  4. Nucleic acid detection system and method for detecting influenza

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Hong; Song, Jian

    2015-03-17

    The invention provides a rapid, sensitive and specific nucleic acid detection system which utilizes isothermal nucleic acid amplification in combination with a lateral flow chromatographic device, or DNA dipstick, for DNA-hybridization detection. The system of the invention requires no complex instrumentation or electronic hardware, and provides a low cost nucleic acid detection system suitable for highly sensitive pathogen detection. Hybridization to single-stranded DNA amplification products using the system of the invention provides a sensitive and specific means by which assays can be multiplexed for the detection of multiple target sequences.

  5. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.

    1980-01-01

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  6. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth

    2014-01-01

    . We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices......Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells...

  7. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela

    2015-01-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  8. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted

    2014-01-01

    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  9. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams

    2014-01-01

    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  10. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng

    2015-05-08

    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  11. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora.

    Science.gov (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E

    2003-08-01

    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  12. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Science.gov (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  13. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification.

    Science.gov (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-10-07

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  14. Empirical model for matching spectrophotometric reflectance of yarn windings and multispectral imaging reflectance of single strands of yarns.

    Science.gov (United States)

    Luo, Lin; Shen, Hui-Liang; Shao, Si-Jie; Xin, John

    2015-08-01

    The state-of-the-art multispectral imaging system can directly acquire the reflectance of a single strand of yarn that is impossible for traditional spectrophotometers. Instead, the spectrophotometric reflectance of a yarn winding, which is constituted by yarns wound on a background card, is regarded as the yarn reflectance in textile. While multispectral imaging systems and spectrophotometers can be separately used to acquire the reflectance of a single strand of yarn and corresponding yarn winding, the quantitative relationship between them is not yet known. In this paper, the relationship is established based on models that describe the spectral response of a spectrophotometer to a yarn winding and that of a multispectral imaging system to a single strand of yarn. The reflectance matching function from a single strand of yarn to corresponding yarn winding is derived to be a second degree polynomial function, which coefficients are the solutions of a constrained nonlinear optimization problem. Experiments on 100 pairs of samples show that the proposed approach can reduce the color difference between yarn windings and single strands of yarns from 2.449 to 1.082 CIEDE2000 units. The coefficients of the optimal reflection matching function imply that the reflectance of a yarn winding measured by a spectrophotometer consists of not only the intrinsic reflectance of yarn but also the nonignorable interreflection component between yarns.

  15. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  16. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan

    2015-01-01

    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  17. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik

    1992-04-01

    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  18. Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Gust, I.D.; Feinstone, S.M.; Purcell, R.H.; Alter, H.J.

    1980-01-01

    A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

  19. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata).

    Science.gov (United States)

    Jackson, Elliot W; Bistolas, Kalia S I; Button, Jason B; Hewson, Ian

    2016-01-01

    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates.

  20. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.

    1980-01-01

    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  1. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux

    2016-12-01

    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  2. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  3. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif

    Science.gov (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  4. Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1

    DEFF Research Database (Denmark)

    Yang, Jay; Bachrati, Csanad Z; Ou, Jiongwen

    2010-01-01

    -passage mechanism. We generated single-stranded catenanes that resemble the proposed dissolution intermediate recognized by human topoisomerase IIIalpha. We demonstrate that human topoisomerase IIIalpha is a single-stranded DNA decatenase that is specifically stimulated by the BLM-RMI1 pair. In addition, RMI1......Human topoisomerase IIIalpha is a type IA DNA topoisomerase that functions with BLM and RMI1 to resolve DNA replication and recombination intermediates. BLM, human topoisomerase IIIalpha, and RMI1 catalyze the dissolution of double Holliday junctions into noncrossover products via a strand...

  5. Recent Advances in Chemical Modification of Peptide Nucleic Acids

    Directory of Open Access Journals (Sweden)

    Eriks Rozners

    2012-01-01

    Full Text Available Peptide nucleic acid (PNA has become an extremely powerful tool in chemistry and biology. Although PNA recognizes single-stranded nucleic acids with exceptionally high affinity and sequence selectivity, there is considerable ongoing effort to further improve properties of PNA for both fundamental science and practical applications. The present paper discusses selected recent studies that improve on cellular uptake and binding of PNA to double-stranded DNA and RNA. The focus is on chemical modifications of PNA's backbone and heterocyclic nucleobases. The paper selects representative recent studies and does not attempt to provide comprehensive coverage of the broad and vibrant field of PNA modification.

  6. Methods of introducing nucleic acids into cellular DNA

    Energy Technology Data Exchange (ETDEWEB)

    Lajoie, Marc J.; Gregg, Christopher J.; Mosberg, Joshua A.; Church, George M.

    2017-06-27

    A method of introducing a nucleic acid sequence into a cell is provided where the cell has impaired or inhibited or disrupted DnaG primase activity or impaired or inhibited or disrupted DnaB helicase activity, or larger or increased gaps or distance between Okazaki fragments or lowered or reduced frequency of Okazaki fragment initiation, or the cell has increased single stranded DNA (ssDNA) on the lagging strand of the replication fork including transforming the cell through recombination with a nucleic acid oligomer.

  7. Selection and Characterization of Single-Stranded DNA Aptamers Binding Human B-Cell Surface Protein CD20 by Cell-SELEX

    Directory of Open Access Journals (Sweden)

    Mansoureh Haghighi

    2018-03-01

    Full Text Available The B-lymphocyte antigen (CD20 is a suitable target for single-stranded (ss nucleic acid oligomer (aptamers. The aim of study was selection and characterization of a ssDNA aptamer against CD20 using Cell-Systematic Evolution of Ligands by Exponential Enrichment (Cell-SELEX. The cDNA clone of CD20 (pcDNA-CD20 was transfected to human embryonic kidney (HEK293T cells. Ten rounds of Cell-SELEX was performed on recombinant HEK-CD20 cells. The final eluted ssDNA pool was amplified and ligated in T/A vector for cloning. The plasmids of positive clones were extracted, sequenced and the secondary structures of the aptamers predicted using DNAMAN® software. The sequencing results revealed 10 different types; three of them had the highest thermodynamic stability, named AP-1, AP-2 and AP-3. The AP-1 aptamer was the most thermodynamically stable one (ΔGAP-1 = −10.87 kcal/mol with the highest binding affinity to CD20 (96.91 ± 4.5 nM. Since, the CD20 is a suitable target for recognition of B-Cell. The selected aptamers could be comparable to antibodies with many advantages. The AP-1, AP-2 and AP-3 could be candidate instead of antibodies for diagnostic and therapeutic applications in immune deficiency, autoimmune diseases, leukemia and lymphoma.

  8. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    Science.gov (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system.

    Science.gov (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus

    2011-04-06

    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  10. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.

    1988-01-01

    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  11. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.

    2012-01-01

    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  12. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues

    Science.gov (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak

    2006-01-01

    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  13. Elastic Properties of Nucleic Acids by Single-Molecule Force Spectroscopy.

    Science.gov (United States)

    Camunas-Soler, Joan; Ribezzi-Crivellari, Marco; Ritort, Felix

    2016-07-05

    We review the current knowledge on the use of single-molecule force spectroscopy techniques to extrapolate the elastic properties of nucleic acids. We emphasize the lesser-known elastic properties of single-stranded DNA. We discuss the importance of accurately determining the elastic response in pulling experiments, and we review the simplest models used to rationalize the experimental data as well as the experimental approaches used to pull single-stranded DNA. Applications used to investigate DNA conformational transitions and secondary structure formation are also highlighted. Finally, we provide an overview of the effects of salt and temperature and briefly discuss the effects of contour length and sequence dependence.

  14. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes

    Science.gov (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.

    2015-01-01

    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  15. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos

    2015-09-01

    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  16. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair

    Science.gov (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.

    2009-01-01

    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  17. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-05

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity*

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.

    2015-01-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  19. Substrate-assisted 2D DNA lattices and algorithmic lattices from single-stranded tiles.

    Science.gov (United States)

    Kim, Junghoon; Ha, Tai Hwan; Park, Sung Ha

    2015-08-07

    We present a simple route to circumvent kinetic traps which affect many types of DNA nanostructures in their self-assembly process. Using this method, a new 2D DNA lattice made up of short, single-stranded tile (SST) motifs was created. Previously, the growth of SST DNA assemblies was restricted to 1D (tubes and ribbons) or finite-sized 2D (molecular canvases). By utilizing the substrate-assisted growth method, sets of SSTs were designed as unit cells to self-assemble into periodic and aperiodic 2D lattices which continuously grow both along and orthogonal to the helical axis. Notably, large-scale (∼1 μm(2)) fully periodic 2D lattices were fabricated using a minimum of just 2 strand species. Furthermore, the ability to create 2D lattices from a few motifs enables certain rules to be encoded into these SSTs to carry out algorithmic self-assembly. A set of these motifs was designed to execute simple 1-input 1-output COPY and NOT algorithms, the space-time manifestations which were aperiodic 2D algorithmic SST lattices. The methodology presented here can be straightforwardly applied to other motifs which fall into this type of kinetic trap to create novel DNA crystals.

  20. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.

    2007-01-01

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  1. Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems.

    Science.gov (United States)

    Musumeci, Domenica; Rozza, Lucia; Merlino, Antonello; Paduano, Luigi; Marzo, Tiziano; Massai, Lara; Messori, Luigi; Montesarchio, Daniela

    2015-08-21

    The interaction of the anticancer Ru(iii) complex AziRu - in comparison with its analogue NAMI-A, currently in advanced clinical trials as an antimetastatic agent - with DNA model systems, both single stranded and duplex oligonucleotides, was investigated using a combined approach, including absorption UV-vis spectroscopy, circular dichroism (CD) and electrospray mass spectrometry (ESI-MS) techniques. UV-vis absorption spectra of the Ru complexes were recorded at different times in a pseudo-physiological solution, to monitor the ligand exchange processes in the absence and in the presence of the examined oligonucleotides. CD experiments provided information on the overall conformational changes of the DNA model systems induced by these metal complexes. UV- and CD-monitored thermal denaturation studies were performed to analyse the effects of AziRu and NAMI-A on the stability of the duplex structures. ESI-MS experiments, carried out on the oligonucleotide/metal complex mixtures under investigation, allowed us to detect the formation of stable adducts between the guanine-containing oligomers and the ruthenium complexes. These data unambiguously demonstrate that both AziRu and NAMI-A can interact with the DNA model systems. Although very similar in their structures, the two metal compounds manifest a markedly different reactivity with the examined sequences, respectively, with either a naked Ru(3+) ion or a Ru(Im)(3+) (Im = imidazole) fragment being incorporated into the oligonucleotide structure via stable linkages.

  2. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop.

    Science.gov (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S

    2009-05-01

    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  3. Biophysical characterization of the association of histones with single-stranded DNA.

    Science.gov (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier

    2017-11-01

    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong

    2008-01-01

    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  5. Effect of Conformational Entropy on the Nanomechanics of Microcantilever-Based Single-Stranded DNA Sensors

    Directory of Open Access Journals (Sweden)

    Zou-Qing Tan

    2014-09-01

    Full Text Available An entropy-controlled bending mechanism is presented to study the nanomechanics of microcantilever-based single-stranded DNA (ssDNA sensors. First; the conformational free energy of the ssDNA layer is given with an improved scaling theory of thermal blobs considering the curvature effect; and the mechanical energy of the non-biological layer is described by Zhang’s two-variable method for laminated beams. Then; an analytical model for static deflections of ssDNA microcantilevers is formulated by the principle of minimum energy. The comparisons of deflections predicted by the proposed model; Utz–Begley’s model and Hagan’s model are also examined. Numerical results show that the conformational entropy effect on microcantilever deflections cannot be ignored; especially at the conditions of high packing density or long chain systems; and the variation of deflection predicted by the proposed analytical model not only accords with that observed in the related experiments qualitatively; but also appears quantitatively closer to the experimental values than that by the preexisting models. In order to improve the sensitivity of static-mode biosensors; it should be as small as possible to reduce the substrate stiffness.

  6. In vitro selection and characterization of single stranded DNA aptamers for luteolin: A possible recognition tool.

    Science.gov (United States)

    Tuma Sabah, Jinan; Zulkifli, Razauden Mohamed; Shahir, Shafinaz; Ahmed, Farediah; Abdul Kadir, Mohammed Rafiq; Zakaria, Zarita

    2018-03-06

    Distinctive bioactivities possessed by luteolin (3', 4', 5, 7-tetrahydroxy-flavone) are advantageous for sundry practical applications. This paper reports the in vitro selection and characterization of single stranded-DNA (ssDNA) aptamers, specific for luteolin (LUT). 76-mer library containing 1015 randomized ssDNA were screened via systematic evolution of ligands by exponential enrichment (SELEX). The recovered ssDNA pool from the 8th round was amplified with unlabeled primers and cloned into PSTBlue-1 vector prior to sequencing. 22 of LUT-binding aptamer variants were further classified into one of the seven groups based on their N40 random sequence regions, wherein one representative from each group was characterized. The dissociation constant of aptamers designated as LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively with high binding affinity towards LUT. Prediction analysis of the secondary structure suggested discrete features with typical loop and stem motifs. Furthermore, LUT#3 displayed higher specificity with insignificant binding toward kaempferol and quercetin despite its structural and functional similarity compared to LUT#28 and LUT#20. Further LUT#3 can detect free luteolin within 0.2-1 mM in solution. It was suggested that LUT#3 aptamer were the most suitable for LUT recognition tool at laboratory scale based on the condition tested. Copyright © 2018. Published by Elsevier Inc.

  7. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska

    2017-12-01

    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  8. Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages.

    Science.gov (United States)

    Kodaira, K; Godson, N G; Taketo, A

    1995-01-25

    The minus origins for complementary strand DNA synthesis (-ori) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, phi K, alpha 3, and St-1 closely resemble each other in DNA structure and contain two potential secondary hairpin loops (I and II) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the -ori regions of phi K and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the phi K mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several phi K and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway.

  9. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.

    1985-01-01

    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  10. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  11. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.

    1987-01-01

    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  12. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks.

    Science.gov (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P

    2012-09-01

    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  13. Metallization of Single-Stranded Polyl by Zn2+ Ions in Neutral Solutions

    Czech Academy of Sciences Publication Activity Database

    Sorokin, V. A.; Valeev, V. A.; Usenko, E. L.; Andrushchenko, Valery

    2014-01-01

    Roč. 118, č. 43 (2014), s. 12360-12365 ISSN 1520-6106 Institutional support: RVO:61388963 Keywords : nucleic acid metallization * zinc ion * differential UV spectroscopy Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.302, year: 2014

  14. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  15. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.

    1995-01-01

    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  16. Distinct circular single-stranded DNA viruses exist in different soil types.

    Science.gov (United States)

    Reavy, Brian; Swanson, Maud M; Cock, Peter J A; Dawson, Lorna; Freitag, Thomas E; Singh, Brajesh K; Torrance, Lesley; Mushegian, Arcady R; Taliansky, Michael

    2015-06-15

    The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  17. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)

    1994-09-01

    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  18. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  19. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

    Science.gov (United States)

    Richardson, Tomas T; Harran, Omar; Murray, Heath

    2016-06-16

    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

  20. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses.

    Science.gov (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn

    2011-06-01

    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  1. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  2. Electrical conduction and photoresponses of gamma-ray-irradiated single-stranded DNA/single-walled carbon nanotube composite systems

    Energy Technology Data Exchange (ETDEWEB)

    Hong, W.; Lee, E.M.; Kim, D.W.; Lee, Cheol Eui, E-mail: rscel@korea.ac.kr

    2015-04-15

    Highlights: •Effects of gamma-ray irradiation on single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. •Barrier for thermally activated conduction in the composite systems modified by the gamma-ray irradiation. •Photoresponses reveal photoexcitation and oxygen photodesorption modified by gamma-ray irradiation. -- Abstract: Effects of gamma-ray irradiation on the electrical conductivity and photoresponse have been studied for single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. The temperature-dependent electrical conductivity of the ssDNA/SWNT composite films, well described by a fluctuation-induced tunneling model, indicated modification of the barrier for thermally activated conduction by the gamma-ray irradiation. Besides, the photoresponse measurements indicated modified photoexcited charge carrier generation and oxygen photodesorption in the composite systems due to the gamma-ray irradiation.

  3. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.

    2006-01-01

    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  4. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    Science.gov (United States)

    2014-09-30

    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  5. Selective binding and reverse transcription inhibition of single-strand poly(A) RNA by metal TMPyP complexes.

    Science.gov (United States)

    Zhou, Zhu-Xin; Gao, Feng; Chen, Xing; Tian, Xiang-Jing; Ji, Liang-Nian

    2014-10-06

    Ni-, Cu-, and Zn-TMPyP are capable of binding to single-strand poly(A) RNA with high preference and affinity and inhibiting the reverse transcription of RNA by both M-MuLV and HIV-1 reverse transcriptase. With 10 nM azidothymidine, the IC50 value of M-TMPyP could be lowered to 10(-1) μM order.

  6. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.

    2013-01-01

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  7. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.

    1977-01-01

    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  8. Role of electrostatics in the assembly pathway of a single-stranded RNA virus.

    Science.gov (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M

    2014-09-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  9. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong

    2011-04-01

    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  10. Detection of hybridization of single-strand DNA PCR products in temperature change process by a novel metal-clamping piezoelectric sensor.

    Science.gov (United States)

    Chen, Qinghai; Bian, Zhiheng; Hua, Xing; Yao, Chunyan; Wu, Wei; Zhang, Xue; Zhang, Bo; Huang, Junfu; Tang, Wanli; Fu, Weiling

    2010-05-15

    Oligonucleotide probes on the sensor surface can be hybridized with single-strand DNA (ssDNA) that is formed from PCR products in ice bath after degeneration. Thus, detection of PCR products by piezoelectric sensors requires the participation of ssDNA PCR products in ice bath. When PCR products in ice bath are added into the buffer of the sensor well at room temperature, there will be a temperature change process during mixing. However, it still remains unclear whether the temperature change affects the frequency baseline stability of the sensor and the result judgment, which is the basic condition for detecting hybridization of nucleic acid. In this study, we detected the hybridization of HPV PCR products during temperature change process by a self-designed adjustable metal-clamping piezoelectric sensor. The study mainly involves sensor adjustment, probe immobilization and ice bath sample addition (at different concentrations and different volumes). The response curve of basic frequency in temperature change process showed three stages, i.e., increase, decrease to baseline, and continuous decrease to stability. The early increase of frequency and duration of the time can reach 55+/-7.4 Hz and 39 min when 40 microL sample (0-1 degrees C) was added into 110 microL buffer (25 degrees C). The frequency increase effect caused by temperature difference at early stage depends on the volume ratio of two liquids and on the temperature difference. The results indicate that we should pay more attention to possibly small volume of PCR products in ice bath and minor temperature difference of two liquids in operation. 2010 Elsevier B.V. All rights reserved.

  11. Gauging the Nanotoxicity of h2D-C2N toward Single-Stranded DNA: An in Silico Molecular Simulation Approach.

    Science.gov (United States)

    Mukhopadhyay, Titas Kumar; Bhattacharyya, Kalishankar; Datta, Ayan

    2018-04-12

    Recent toxicological assessments of graphene, graphene oxides, and some other two-dimensional (2D) materials have shown them to be substantially toxic at the nanoscale, where they inhibit and eventually disrupt biological processes. These shortfalls of graphene and analogs have resulted in a quest for novel biocompatible 2D materials with minimum cytotoxicity. In this article, we demonstrate C 2 N (h2D-C 2 N), a newly synthesized 2D porous graphene analog, to be non-nanotoxic toward genetic materials from an "in-silico" point of view through sequence-dependent binding of different polynucleotide single-stranded DNA (ssDNA) onto it. The calculated binding energy of nucleobases and the free energy of binding of polynucleotides follow the common trait, cytosine > guanine > adenine > thymine, and are well within the limits of physisorption. Ab-initio simulations completely exclude the possibility of any chemical reaction, demonstrating purely noncovalent binding of nucleobases with C 2 N through a crucial interplay between hydrogen bonding and π-stacking interactions with the surface. Further, we show that the extent of distortion inflicted upon ssDNA by C 2 N is negligible. Analysis of the density of states of the nucleobase-C 2 N hybrids confirms minimum electronic perturbation of the bases after adsorption. Most importantly, we demonstrate the potency of C 2 N in nucleic acid transportation via reversible binding of ssDNA. The plausible use of C 2 N as a template for DNA repair is illustrated through an example of C 2 N-assisted complementary ssDNA winding.

  12. Nucleic acid-binding glycoproteins which solubilize nucleic acids in dilute acid: re-examination of the Ustilago maydis glycoproteins

    Energy Technology Data Exchange (ETDEWEB)

    Unrau, P.; Champ, D.R.; Young, J.L.; Grant, C.E.

    1980-01-01

    Holloman reported the isolation from Ustilago maydis of a glycoprotein which prevented the precipitation of nucleic acids in cold 5% trichloroacetic acid. Two glycoprotein fractions from U. maydis with this nucleic acid-solubilizing activity were isolated in our laboratory using improved purification procedures. The activity was not due to nuclease contamination. The glycoproteins are distinguished by: their ability to bind to concanavalin A-Sepharose; their differential binding to double- and single-stranded deoxyribonucleic acid, and to ribonucleic acid; their molecular weights (46,000 and 69,000); and the relative amounts present in growing versus nongrowing cells. Both fractions required sulfhydryl-reducing conditions for optimal yields, specific activity, and stability. Nucleic acid binding was cooperative, the minimum number of glycoproteins required to make a native T7 DNA molecule soluble in dilute acid being estimated at 2 and 15, respectively.

  13. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes

    OpenAIRE

    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  14. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity.

    Science.gov (United States)

    Monnet, Jordan; Kozelka, Jiří

    2012-10-01

    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris

    2016-01-01

    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA-binding pro......Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...... leads to enhanced cooperative binding to DNA.Conclusions: Our findings contribute to the emerging picture that bacterial proteins, exemplified here by SsbA, undergo phosphorylation at multiple residues. This results in a complex regulation of cellular functions, and suggests that the complexity...

  16. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  17. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide

    Science.gov (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio

    1998-01-01

    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  18. Spectrofluorometric study on photochemical interaction between chlorpromazine and nucleic acids

    International Nuclear Information System (INIS)

    Fujita, H.; Hayashi, H.; Suzuki, K.

    1981-01-01

    Near-UV irradiation of a mixture of chlorpromazine and single-stranded nucleic acids produced a non-dialyzable photoproduct which emitted characteristic fluorescence at around 520 nm. The same fluorescent species was also formed by the photoreaction with purine nucleotides but not with pyrimidine nucleotide. The highest photoreactivity was observed with GMP. Smaller amounts of the species were formed in a solution with a high salt concentration than in that with a low salt concentration. A higher rate was observed under anaerobic conditions than under aerobic conditions. (author)

  19. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism.

    Science.gov (United States)

    Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong

    2016-07-01

    A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.

  20. Characterization of the single-stranded DNA binding protein pV(VGJΦ) of VGJΦ phage from Vibrio cholerae.

    Science.gov (United States)

    Falero, Alina; Caballero, Andy; Trigueros, Sonia; Pérez, Celso; Campos, Javier; Marrero, Karen; Fando, Rafael

    2011-09-01

    pV(VGJΦ), a single-stranded DNA binding protein of the vibriophage VGJΦ was subject to biochemical analysis. Here, we show that this protein has a general affinity for single-stranded DNA (ssDNA) as documented by Electrophoretic Mobility Shift Assay (EMSA). The apparent molecular weight of the monomer is about 12.7kDa as measured by HPLC-SEC. Moreover, isoelectrofocusing showed an isoelectric point for pV(VGJΦ) of 6.82 pH units. Size exclusion chromatography in 150mM NaCl, 50mM sodium phosphate buffer, pH 7.0 revealed a major protein species of 27.0kDa, suggesting homodimeric protein architecture. Furthermore, pV(VGJΦ) binds ssDNA at extreme temperatures and the complex was stable after extended incubation times. Upon frozen storage at -20°C for a year the protein retained its integrity, biological activity and oligomericity. On the other hand, bioinformatics analysis predicted that pV(VGJΦ) protein has a disordered C-terminal, which might be involved in its functional activity. All the aforementioned features make pV(VGJΦ) interesting for biotechnological applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles.

    Science.gov (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng

    2015-11-21

    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  2. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  3. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.

    1978-01-01

    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  4. A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B.

    Directory of Open Access Journals (Sweden)

    Jeffrey A DeGrasse

    Full Text Available The bacterium Staphylococcus aureus is a common foodborne pathogen capable of secreting a cocktail of small, stable, and strain-specific, staphylococcal enterotoxins (SEs. Staphylococcal food poisoning (SFP results when improperly handled food contaminated with SEs is consumed. Gastrointestinal symptoms of SFP include emesis, diarrhea and severe abdominal pain, which manifest within hours of ingesting contaminated food. Immuno-affinity based methods directly detect, identify, and quantify several SEs within a food or clinical sample. However, the success of these assays depends upon the availability of a monoclonal antibody, the development of which is non-trivial and costly. The current scope of the available immuno-affinity based methods is limited to the classical SEs and does not encompass all of the known or emergent SEs. In contrast to antibodies, aptamers are short nucleic acids that exhibit high affinity and specificity for their targets without the high-costs and ethical concerns of animal husbandry. Further, researchers may choose to freely distribute aptamers and develop assays without the proprietary issues that increase the per-sample cost of immuno-affinity assays. This study describes a novel aptamer, selected in vitro, with affinity to staphylococcal enterotoxin B (SEB that may be used in lieu of antibodies in SE detection assays. The aptamer, designated APT(SEB1, successfully isolates SEB from a complex mixture of SEs with extremely high discrimination. This work sets the foundation for future aptamer and assay development towards the entire family of SEs. The rapid, robust, and low-cost identification and quantification of all of the SEs in S. aureus contaminated food is essential for food safety and epidemiological efforts. An in vitro generated library of SE aptamers could potentially allow for the comprehensive and cost-effective analysis of food samples that immuno-affinity assays currently cannot provide.

  5. Guanine quadruplex monoclonal antibody 1H6 cross-reacts with restrained thymidine-rich single stranded DNA

    NARCIS (Netherlands)

    Kazemier, Hinke G.; Paeschke, Katrin; Lansdorp, Peter M.

    2017-01-01

    Previously we reported the production and characterization of monoclonal antibody 1H6 raised against (T(4)G(4))(2) intermolecular guanine quadruplex (G4) DNA structures (Henderson A. et al. (2014) Nucleic Acids Res., 42, 860-869; Hoffmann R. F. et al. (2016) Nucleic Acids Res., 44, 152-163). It was

  6. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail: meicun2006@163.com; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

    2016-12-01

    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  7. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  8. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample.

    Science.gov (United States)

    Cui, Lunbiao; Wu, Binyao; Zhu, Xiaojuan; Guo, Xiling; Ge, Yiyue; Zhao, Kangchen; Qi, Xian; Shi, Zhiyang; Zhu, Fengcai; Sun, Lixin; Zhou, Minghao

    2017-11-01

    Metagenomic analysis through high-throughput sequencing is a tool for detecting both known and novel viruses. Using this technique, a novel circular single-stranded DNA (ssDNA) virus genome was discovered in respiratory secretions from a febrile traveler. The virus, named human respiratory-associated PSCV-5-like virus (HRAPLV), has a genome comprising 3,018 bases, with two major putative ORFs inversely encoding capsid (Cap) and replicase (Rep) protein and separated by two intergenic regions. One stem-loop structure was predicted in the larger intergenic region (LIR). The predicted amino acid sequences of the Cap and Rep proteins of HRAPLV showed highest identity to those of porcine stool-associated circular virus 5 isolate CP3 (PoSCV 5) (53.0% and 48.9%, respectively). The host tropism of the virus is unknown, and further study is warranted to determine whether this novel virus is associated with human disease.

  9. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Vrushali S. [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Gokhale, Suresh P.; Patil, Kashinath R. [Physical and Material Chemistry Division, National Chemical Laboratory, Pune (India); Haram, Santosh K., E-mail: haram@chem.unipune.ernet.i [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)

    2010-02-15

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 +- 2 mum and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, alpha-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k{sup 0}) and electron transfer coefficient (alpha) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  10. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    International Nuclear Information System (INIS)

    Joshi, Vrushali S.; Gokhale, Suresh P.; Patil, Kashinath R.; Haram, Santosh K.

    2010-01-01

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 ± 2 μm and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, α-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k 0 ) and electron transfer coefficient (α) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  11. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  12. Quenching of Single-Walled Carbon Nanotube Fluorescence by Dissolved Oxygen Reveals Selective Single-Stranded DNA Affinities.

    Science.gov (United States)

    Zheng, Yu; Bachilo, Sergei M; Weisman, R Bruce

    2017-05-04

    The selective interactions between short oligomers of single-stranded DNA (ssDNA) and specific structures of single-walled carbon nanotubes have been exploited in powerful methods for nanotube sorting. We report here that nanotubes coated with ssDNA also display selective interactions through the selective quenching of nanotube fluorescence by dissolved oxygen. In aqueous solutions equilibrated under 1 atm of O 2 , emission intensity from semiconducting nanotubes is reduced by between 9 and 40%, varying with the combination of ssDNA sequence and nanotube structure. This quenching reverses promptly and completely on the removal of dissolved O 2 and may be due to physisorption on nanotube surfaces. Fluorescence quenching offers a simple, nondestructive approach for studying the structure-selective interactions of ssDNA with single-walled carbon nanotubes and identifying recognition sequences.

  13. Surface treatment on amorphous InGaZnO4 thin film for single-stranded DNA biosensing

    Science.gov (United States)

    Sun, Dali; Matsui, Hiroaki; Wu, Chun-Nan; Tabata, Hitoshi

    2015-01-01

    Amorphous InGaZnO4 (aIGZO) has been widely used as a transparent semiconductor. However, no research has been found yet applying aIGZO to biosensing. This paper examined the single strand DNA (ssDNA) immobilization on aIGZO by absorption with a comparison to ITO, which is the first step for many biosensing schemas. The DNA quantification by florescence intensity shows that the absorption capacity of aIGZO film to ssDNA is 6.7 times greater than that of ITO. XPS and contact angle analysis proved the high DNA absorption affinity on aIGZO film is related to its high effectiveness to OH- attachment. A feasible method to immobilized ssDNA on aIGZO thin film is evaluated in this paper, and consequently, enables a possible approach to apply aIGZO in biosensing.

  14. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol

    2013-01-01

    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  15. Conformationally locked aryl C-nucleosides: synthesis of phosphoramidite monomers and incorporation into single-stranded DNA and LNA (locked nucleic acid)

    DEFF Research Database (Denmark)

    Babu, B. Ravindra; Prasad, Ashok K.; Trikha, Smriti

    2002-01-01

    . The phosphoramidite approach was used for automated incorporation of the LNA-type beta-configured C-aryl monomers 17a-17e into short DNA and 2'-OMe-RNA/LNA strands. It is shown that universal hybridization can be obtained with a conformationally restricted monomer as demonstrated most convincingly for the pyrene LNA...... monomer 17d, both in a DNA context and in an RNA-like context. Increased binding affinity of oligonucleotide probes for universal hybridization can be induced by combining the pyrene LNA monomer 17d with affinity-enhancing 2'-OMe-RNA/LNA monomers....

  16. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana.

    Science.gov (United States)

    Olszewski, Marcin; Grot, Anna; Wojciechowski, Marek; Nowak, Marta; Mickiewicz, Małgorzata; Kur, Józef

    2010-10-15

    In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. We report the characterization of single-stranded DNA binding proteins (SSBs) from the thermophilic bacteria Thermotoga maritima (TmaSSB) and Thermotoga neapolitana (TneSSB). They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively). They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold) in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC) the melting temperature (Tm) was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR).

  17. Charge enhancement of single-stranded DNA in negative electrospray ionization using the supercharging reagent meta-nitrobenzyl alcohol.

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1% m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1% m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  18. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  19. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB).

    Science.gov (United States)

    van Loon, Barbara; Samson, Leona D

    2013-03-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  20. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata

    2010-10-01

    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  1. Aptamer based voltammetric determination of ampicillin using a single-stranded DNA binding protein and DNA functionalized gold nanoparticles.

    Science.gov (United States)

    Wang, Jun; Ma, Kui; Yin, Huanshun; Zhou, Yunlei; Ai, Shiyun

    2017-12-20

    An aptamer based method is described for the electrochemical determination of ampicillin. It is based on the use of DNA aptamer, DNA functionalized gold nanoparticles (DNA-AuNPs), and single-stranded DNA binding protein (ssDNA-BP). When the aptamer hybridizes with the target DNA on the AuNPs, the ssDNA-BP is captured on the electrode surface via its specific interaction with ss-DNA. This results in a decreased electrochemical signal of the redox probe Fe(CN) 6 3- which is measured best at a voltage of 0.188 mV (vs. reference electrode). In the presence of ampicillin, the formation of aptamer-ampicillin conjugate blocks the further immobilization of DNA-AuNPs and ssDNA-BP, and this leads to an increased response. The method has a linear reposne that convers the 1 pM to 5 nM ampicillin concentration range, with a 0.38 pM detection limit (at an S/N ratio of 3). The assay is selective, stable and reproducible. It was applied to the determination of ampicillin in spiked milk samples where it gave recoveries ranging from 95.5 to 105.5%. Graphical abstract Schematic of a simple and sensitive electrochemical apta-biosensor for ampicillin detection. It is based on the use of gold nanoparticles (AuNPs), DNA aptamer, DNA functionalized AuNPs (DNA-AuNPs), and single-strand DNA binding protein (SSBP).

  2. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.

    1994-01-01

    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  3. Humic Acid-Like and Fulvic Acid-Like Inhibition on the Hydrolysis of Cellulose and Tributyrin

    NARCIS (Netherlands)

    Fernandes, Tania V.; van Lier, Jules B.; Zeeman, Grietje

    2015-01-01

    Enzymatic hydrolysis of complex wastes is a critical step for efficient biogas production in anaerobic digesters. Inhibition of this hydrolytic step was studied by addition of humic acid-like (HAL) and fulvic acid-like (FAL) substances, extracted from maize silage and fresh cow manure, to batch

  4. Humic Acid-Like and Fulvic Acid-Like Inhibition on the Hydrolysis of Cellulose and Tributyrin

    NARCIS (Netherlands)

    Fernandes, T.V.; Lier, van J.B.; Zeeman, Grietje

    2015-01-01

    Enzymatic hydrolysis of complex wastes is a critical step for efficient biogas production in anaerobic digesters. Inhibition of this hydrolytic step was studied by addition of humic acid-like (HAL) and fulvic acid-like (FAL) substances, extracted from maize silage and fresh cow manure, to batch

  5. Genetic evidence for single-strand lesions initiating Nbs1-dependent homologous recombination in diversification of Ig v in chicken B lymphocytes.

    Directory of Open Access Journals (Sweden)

    Makoto Nakahara

    2009-01-01

    Full Text Available Homologous recombination (HR is initiated by DNA double-strand breaks (DSB. However, it remains unclear whether single-strand lesions also initiate HR in genomic DNA. Chicken B lymphocytes diversify their Immunoglobulin (Ig V genes through HR (Ig gene conversion and non-templated hypermutation. Both types of Ig V diversification are initiated by AID-dependent abasic-site formation. Abasic sites stall replication, resulting in the formation of single-stranded gaps. These gaps can be filled by error-prone DNA polymerases, resulting in hypermutation. However, it is unclear whether these single-strand gaps can also initiate Ig gene conversion without being first converted to DSBs. The Mre11-Rad50-Nbs1 (MRN complex, which produces 3' single-strand overhangs, promotes the initiation of DSB-induced HR in yeast. We show that a DT40 line expressing only a truncated form of Nbs1 (Nbs1(p70 exhibits defective HR-dependent DSB repair, and a significant reduction in the rate--though not the fidelity--of Ig gene conversion. Interestingly, this defective gene conversion was restored to wild type levels by overproduction of Escherichia coli SbcB, a 3' to 5' single-strand-specific exonuclease, without affecting DSB repair. Conversely, overexpression of chicken Exo1 increased the efficiency of DSB-induced gene-targeting more than 10-fold, with no effect on Ig gene conversion. These results suggest that Ig gene conversion may be initiated by single-strand gaps rather than by DSBs, and, like SbcB, the MRN complex in DT40 may convert AID-induced lesions into single-strand gaps suitable for triggering HR. In summary, Ig gene conversion and hypermutation may share a common substrate-single-stranded gaps. Genetic analysis of the two types of Ig V diversification in DT40 provides a unique opportunity to gain insight into the molecular mechanisms underlying the filling of gaps that arise as a consequence of replication blocks at abasic sites, by HR and error

  6. Nanopore sensors for nucleic acid analysis

    International Nuclear Information System (INIS)

    Nakane, Jonathan J; Akeson, Mark; Marziali, Andre

    2003-01-01

    In the past decade, nanometre-scale pores have been explored as the basis for technologies to analyse and sequence single nucleic acid molecules. Most approaches involve using such a pore to localize single macromolecules and interact with them to garner some information on their composition. Though nanopore sensors cannot yet claim success at deoxyribonucleic acid (DNA) sequencing, nanopore-based technologies offer one of the most promising approaches to single molecule detection and analysis. The majority of experimental work with nanopore detection of nucleic acids has involved the α-haemolysin (alpha-HL) ion channel a heptameric protein with a ∼2 nm diameter inner pore which allows translocation of single-stranded DNA. Analysis of externally induced ion current through the pore during its interaction with DNA can provide information about the DNA molecule, including length and base composition. This review focuses on alpha-HL and its applications to single-molecule detection. Modified alpha-HL and other biological and synthetic pores for macromolecule detection are also discussed, along with a brief summary of relevant theoretical work and numerical modelling of polymer-pore interaction. (topical review)

  7. Identification and characterization of single-stranded DNA-binding protein from the facultative psychrophilic bacteria Pseudoalteromonas haloplanktis.

    Science.gov (United States)

    Olszewski, Marcin; Nowak, Marta; Cyranka-Czaja, Anna; Kur, Józef

    2014-01-01

    Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism such as DNA replication, repair, and recombination, and is essential for cell survival. This study reports on the ssb-like gene cloning, gene expression and characterization of a single-stranded DNA-binding protein of Pseudoalteromonas haloplanktis (PhaSSB) and is the first report of such a protein from psychrophilic microorganism. PhaSSB possesses a high sequence similarity to Escherichia coli SSB (48% identity and 57% similarity) and has the longest amino acid sequence (244 amino acid residues) of all the known bacterial SSBs with one OB-fold per monomer. An analysis of purified PhaSSB by means of chemical cross-linking experiments, sedimentation analysis and size exclusion chromatography revealed a stable tetramer in solution. Using EMSA, we characterized the stoichiometry of PhaSSB complexed with a series of ssDNA homopolymers, and the size of the binding site was determined as being approximately 35 nucleotides long. In fluorescence titrations, the occluded site size of PhaSSB on poly(dT) is 34 nucleotides per tetramer under low-salt conditions (2mM NaCl), but increases to 54-64 nucleotides at higher-salt conditions (100-300mM NaCl). This suggests that PhaSSB undergoes a transition between ssDNA binding modes, which is observed for EcoSSB. The binding properties of PhaSSB investigated using SPR technology revealed that the affinity of PhaSSB to ssDNA is typical of SSB proteins. The only difference in the binding mode of PhaSSB to ssDNA is a faster association phase, when compared to EcoSSB, though compensated by faster dissociation rate. When analyzed by differential scanning calorimetry (DSC), the melting temperature (Tm) was determined as 63 °C, which is only a few degrees lower than for EcoSSB. Copyright © 2013 Elsevier GmbH. All rights reserved.

  8. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii.

    Science.gov (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten

    2012-01-01

    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  9. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der

    1978-01-01

    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  10. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.

    1982-01-01

    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  11. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

    1982-01-01

    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  12. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.

    2006-01-01

    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  13. Functional analysis of multiple single-stranded DNA-binding proteins from Methanosarcina acetivorans and their effects on DNA synthesis by DNA polymerase BI.

    Science.gov (United States)

    Robbins, Justin B; Murphy, Mary C; White, Bryan A; Mackie, Roderick I; Ha, Taekjip; Cann, Isaac K O

    2004-02-20

    Single-stranded DNA-binding proteins and their functional homologs, replication protein A, are essential components of cellular DNA replication, repair and recombination. We describe here the isolation and characterization of multiple replication protein A homologs, RPA1, RPA2, and RPA3, from the archaeon Methanosarcina acetivorans. RPA1 comprises four single-stranded DNA-binding domains, while RPA2 and RPA3 are each composed of two such domains and a zinc finger domain. Gel filtration analysis suggested that RPA1 exists as homotetramers and homodimers in solution, while RPA2 and RPA3 form only homodimers. Unlike the multiple RPA proteins found in other Archaea and eukaryotes, each of the M. acetivorans RPAs can act as a distinct single-stranded DNA-binding protein. Fluorescence resonance energy transfer and fluorescence polarization anisotropy studies revealed that the M. acetivorans RPAs bind to as few as 10 single-stranded DNA bases. However, more stable binding is achieved with single-stranded DNA of 18-23 bases, and for such substrates the estimated Kd was 3.82 +/- 0.28 nM, 173.6 +/- 105.17 nM, and 5.92 +/- 0.23 nM, for RPA1, RPA2, and RPA3, respectively. The architectures of the M. acetivorans RPAs are different from those of hitherto reported homologs. Thus, these proteins may represent novel forms of replication protein A. Most importantly, our results show that the three RPAs and their combinations highly stimulate the primer extension capacity of M. acetivorans DNA polymerase BI. Although bacterial SSB and eukaryotic RPA have been shown to stimulate DNA synthesis by their cognate DNA polymerases, our findings provide the first in vitro biochemical evidence for the conservation of this property in an archaeon.

  14. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  15. EFFECTOR OF TRANSCRIPTION2 is involved in xylem differentiation and includes a functional DNA single strand cutting domain.

    Science.gov (United States)

    Ivanov, Rumen; Tiedemann, Jens; Czihal, Andreas; Schallau, Anna; Diep, Le Hong; Mock, Hans-Peter; Claus, Bernhard; Tewes, Annegret; Bäumlein, Helmut

    2008-01-01

    EFFECTORS OF TRANSCRIPTION2 (ET) are plant-specific regulatory proteins characterized by the presence of two to five C-terminal DNA- and Zn-binding repeats, and a highly conserved cysteine pattern. We describe the structural characterization of the three member Arabidopsis thaliana ET gene family and reveal some allelic sequence polymorphisms. A mutation analysis showed that AtET2 affects the expression of various KNAT genes involved in the maintenance of the undifferentiated state of cambial meristem cells. It also plays a role in the regulation of GA5 (gibberellin 3-beta-dioxygenase) and the cell-cycle-related GASA4. A correlation was established between AtET2 expression and the cellular differentiation state. AtET-GFP fusion proteins shuttle between the cytoplasm and nucleus, with the AtET2 product prevented from entering the nucleus in non-differentiating cells. Within the nucleus, AtET2 probably acts via a single strand cutting domain. A more general regulatory role for ET factors is proposed, governing cell differentiation in cambial meristems, a crucial process for the development of plant vascular tissues.

  16. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)

    2012-04-04

    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  17. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)

    2015-04-22

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  18. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.

    1985-01-01

    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  19. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA

    Science.gov (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana

    2009-04-01

    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  20. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia

    2009-01-01

    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  1. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))

    1993-03-01

    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  2. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA.

    Science.gov (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi

    2008-03-28

    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  3. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  4. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  5. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA.

    Science.gov (United States)

    Rogers, Cody M; Bochman, Matthew L

    2017-05-13

    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold.

    Science.gov (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G

    2005-05-24

    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  7. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage

    Science.gov (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio

    1998-01-01

    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  8. Slowing single-stranded DNA translocation through a solid-state nanopore by decreasing the nanopore diameter.

    Science.gov (United States)

    Akahori, Rena; Haga, Takanobu; Hatano, Toshiyuki; Yanagi, Itaru; Ohura, Takeshi; Hamamura, Hirotaka; Iwasaki, Tomio; Yokoi, Takahide; Anazawa, Takashi

    2014-07-11

    To slow the translocation of single-stranded DNA (ssDNA) through a solid-state nanopore, a nanopore was narrowed, and the effect of the narrowing on the DNA translocation speed was investigated. In order to accurately measure the speed, long (5.3 kb) ssDNA (namely, ss-poly(dA)) with uniform length (±0.4 kb) was synthesized. The diameters of nanopores fabricated by a transmission electron microscope were controlled by atomic-layer deposition. Reducing the nanopore diameter from 4.5 to 2.3 nm slowed down the translocation of ssDNA by more than 16 times (to 0.18 μs base(-1)) when 300 mV was applied across the nanopore. It is speculated that the interaction between the nanopore and the ssDNA dominates the translocation speed. Unexpectedly, the translocation speed of ssDNA through the 4.5 nm nanopore is more than two orders of magnitude higher than that of double-stranded DNA (dsDNA) through a nanopore of almost the same size. The cause of such a faster translocation of ssDNA can be explained by the weaker drag force inside the nanopore. Moreover, the measured translocation speeds of ssDNA and dsDNA agree well with those calculated by molecular-dynamics (MD) simulation. The MD simulation predicted that reducing the nanopore diameter to almost the same as that of ssDNA (i.e. 1.4 nm) decreases the translocation speed (to 1.4 μs base(-1)). Narrowing the nanopore is thus an effective approach for accomplishing nanopore DNA sequencing.

  9. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  10. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler

    2007-12-01

    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  11. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines.

    Science.gov (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao

    2017-07-01

    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  12. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA.

    Science.gov (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee

    2011-03-24

    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  13. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis.

    Science.gov (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J

    2012-01-01

    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  15. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.

    1992-01-01

    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  16. BIOPHYSICAL PROPERTIES OF NUCLEIC ACIDS AT SURFACES RELEVANT TO MICROARRAY PERFORMANCE

    Science.gov (United States)

    Rao, Archana N.; Grainger, David W.

    2014-01-01

    Both clinical and analytical metrics produced by microarray-based assay technology have recognized problems in reproducibility, reliability and analytical sensitivity. These issues are often attributed to poor understanding and control of nucleic acid behaviors and properties at solid-liquid interfaces. Nucleic acid hybridization, central to DNA and RNA microarray formats, depends on the properties and behaviors of single strand (ss) nucleic acids (e.g., probe oligomeric DNA) bound to surfaces. ssDNA’s persistence length, radius of gyration, electrostatics, conformations on different surfaces and under various assay conditions, its chain flexibility and curvature, charging effects in ionic solutions, and fluorescent labeling all influence its physical chemistry and hybridization under assay conditions. Nucleic acid (e.g., both RNA and DNA) target interactions with immobilized ssDNA strands are highly impacted by these biophysical states. Furthermore, the kinetics, thermodynamics, and enthalpic and entropic contributions to DNA hybridization reflect global probe/target structures and interaction dynamics. Here we review several biophysical issues relevant to oligomeric nucleic acid molecular behaviors at surfaces and their influences on duplex formation that influence microarray assay performance. Correlation of biophysical aspects of single and double-stranded nucleic acids with their complexes in bulk solution is common. Such analysis at surfaces is not commonly reported, despite its importance to microarray assays. We seek to provide further insight into nucleic acid-surface challenges facing microarray diagnostic formats that have hindered their clinical adoption and compromise their research quality and value as genomics tools. PMID:24765522

  17. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  18. Synthesis of a gene for the HIV transactivator protein TAT by a novel single stranded approach involving in vivo gap repair.

    OpenAIRE

    Adams, S E; Johnson, I D; Braddock, M; Kingsman, A J; Kingsman, S M; Edwards, R M

    1988-01-01

    The synthesis of a gene for the HIV TAT protein is described using a novel approach that capitalises on the ability to synthesise oligonucleotides of greater than 100 bp in length. It involves the synthesis of large oligomers covering one strand of the desired gene in its entirety and the use of small complementary bridging and adapter oligonucleotides to direct the assembly and cloning of the large oligomers. After ligation to the cloning vector the partially single stranded intermediate is ...

  19. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers

    OpenAIRE

    Antolin, M. F.; Bosio, C. F.; Cotton, J.; Sweeney, W.; Strand, M. R.; Black-IV, W. C.

    1996-01-01

    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  20. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr

    2015-01-01

    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single- strand ed DNA -binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  1. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.

    1979-10-01

    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  2. Escherichia coli Single-Stranded DNA-Binding Protein: NanoESI-MS Studies of Salt-Modulated Subunit Exchange and DNA Binding Transactions

    Science.gov (United States)

    Mason, Claire E.; Jergic, Slobodan; Lo, Allen T. Y.; Wang, Yao; Dixon, Nicholas E.; Beck, Jennifer L.

    2013-02-01

    Single-stranded DNA-binding proteins (SSBs) are ubiquitous oligomeric proteins that bind with very high affinity to single-stranded DNA and have a variety of essential roles in DNA metabolism. Nanoelectrospray ionization mass spectrometry (nanoESI-MS) was used to monitor subunit exchange in full-length and truncated forms of the homotetrameric SSB from Escherichia coli. Subunit exchange in the native protein was found to occur slowly over a period of hours, but was significantly more rapid in a truncated variant of SSB from which the eight C-terminal residues were deleted. This effect is proposed to result from C-terminus mediated stabilization of the SSB tetramer, in which the C-termini interact with the DNA-binding cores of adjacent subunits. NanoESI-MS was also used to examine DNA binding to the SSB tetramer. Binding of single-stranded oligonucleotides [one molecule of (dT)70, one molecule of (dT)35, or two molecules of (dT)35] was found to prevent SSB subunit exchange. Transfer of SSB tetramers between discrete oligonucleotides was also observed and is consistent with predictions from solution-phase studies, suggesting that SSB-DNA complexes can be reliably analyzed by ESI mass spectrometry.

  3. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  4. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.

    1992-01-01

    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  5. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  6. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: simonaclichici@yahoo.com [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)

    2012-03-15

    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  7. Bis-pyrene-modified unlocked nucleic acids: synthesis, hybridization studies, and fluorescent properties

    DEFF Research Database (Denmark)

    Perlíková, Pavla; Ejlersen, Maria; Langkjaer, Niels

    2014-01-01

    Efficient synthesis of a building block for the incorporation of a bis-pyrene-modified unlocked nucleic acid (UNA) into oligonucleotides (DNA*) was developed. The presence of bis-pyrene-modified UNA within a duplex leads to duplex destabilization that is more profound in DNA*/RNA and less distinct......)uracil:pyrene exciplex emission in the single-stranded form. Such fluorescent properties enable the application of bis-pyrene-modified UNA in the development of fluorescence probes for DNA/RNA detection and for detection of deletions at specific positions....

  8. Geometric Patterns for Neighboring Bases Near the Stacked State in Nucleic Acid Strands.

    Science.gov (United States)

    Sedova, Ada; Banavali, Nilesh K

    2017-03-14

    Structural variation in base stacking has been analyzed frequently in isolated double helical contexts for nucleic acids, but not as often in nonhelical geometries or in complex biomolecular environments. In this study, conformations of two neighboring bases near their stacked state in any environment are comprehensively characterized for single-strand dinucleotide (SSD) nucleic acid crystal structure conformations. An ensemble clustering method is used to identify a reduced set of representative stacking geometries based on pairwise distances between select atoms in consecutive bases, with multiple separable conformational clusters obtained for categories divided by nucleic acid type (DNA/RNA), SSD sequence, stacking face orientation, and the presence or absence of a protein environment. For both DNA and RNA, SSD conformations are observed that are either close to the A-form, or close to the B-form, or intermediate between the two forms, or further away from either form, illustrating the local structural heterogeneity near the stacked state. Among this large variety of distinct conformations, several common stacking patterns are observed between DNA and RNA, and between nucleic acids in isolation or in complex with proteins, suggesting that these might be stable stacking orientations. Noncanonical face/face orientations of the two bases are also observed for neighboring bases in the same strand, but their frequency is much lower, with multiple SSD sequences across categories showing no occurrences of such unusual stacked conformations. The resulting reduced set of stacking geometries is directly useful for stacking-energy comparisons between empirical force fields, prediction of plausible localized variations in single-strand structures near their canonical states, and identification of analogous stacking patterns in newly solved nucleic acid containing structures.

  9. Study of nucleic acid-gold nanorod interactions and detecting nucleic acid hybridization using gold nanorod solutions in the presence of sodium citrate.

    Science.gov (United States)

    Kanjanawarut, Roejarek; Su, Xiaodi

    2010-09-01

    In this study, the authors report that sodium citrate can aggregate hexadecyl-trimethyl-ammonium ion(+)-coated gold nanorods (AuNRs), and nucleic acids of different charge and structure properties, i.e., single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), single-stranded peptide nucleic acid (PNA), and PNA-DNA complex, can bind to the AuNRs and therefore retard the sodium citrate-induced aggregation to different extents. The discovery that hybridized dsDNA (and the PNA-DNA complex) has a more pronounced protection effect than ssDNA (and PNA) allows the authors to develop a homogeneous phase AuNRs-based UV-visible (UV-vis) spectral assay for detecting specific sequences of oligonucleotides (20 mer) with a single-base-mismatch selectivity and a limit of detection of 5 nM. This assay involves no tedious bioconjugation and on-particle hybridization. The simple "set and test" format allows for a highly efficient hybridization in a homogeneous phase and a rapid display of the results in less than a minute. By measuring the degree of reduction in AuNR aggregation in the presence of different nucleic acid samples, one can assess how different nucleic acids interact with the AuNRs to complement the knowledge of spherical gold nanoparticles. Besides UV-vis characterization, transmission electron microscopy and zeta potential measurements were conduced to provide visual evidence of the particle aggregation and to support the discussion of the assay principle.

  10. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus

    Science.gov (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.

    2016-01-01

    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  11. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy

    OpenAIRE

    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried

    2013-01-01

    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  12. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  13. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.

    1989-01-01

    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  14. A single-stranded RNA copy of the Giardia lamblia virus double-stranded RNA genome is present in the infected Giardia lamblia.

    OpenAIRE

    Furfine, E S; White, T C; Wang, A L; Wang, C C

    1989-01-01

    An isolate of Giardia lamblia infected with the double-stranded RNA virus (GLV) has two major species of RNA that are not present in an uninfected isolate. One of these species is the previously characterized double-stranded RNA genome of GLV (1). The second species of RNA appears to be a full length copy of one strand of the double-stranded RNA genome. This full length single-stranded RNA is not present in viral particles isolated from the growth medium. The cellular concentration of the sin...

  15. Locked nucleic acid

    DEFF Research Database (Denmark)

    Jepsen, Jan Stenvang; Sørensen, Mads D; Wengel, Jesper

    2004-01-01

    Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing very high affinity and excellent specificity toward complementary DNA and RNA, and LNA oligonucleotides have been applied as antisense molecules both in vitro and in vivo. In this review, we briefly describe the basic...

  16. Peptide Nucleic Acid Synthons

    DEFF Research Database (Denmark)

    2004-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary ssDNA and RNA strands more strongly than a corresponding DNA. The peptide nucleic acids generally comprise ligands such as naturally occurring DNA bases attached to a peptide backbone through a suitable linker....

  17. Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    2003-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary ssDNA and RNA strands more strongly than a corresponding DNA. The peptide nucleic acids generally comprise ligands such as naturally occurring DNA bases attached to a peptide backbone through a suitable linker....

  18. Peptide Nucleic Acids (PNA)

    DEFF Research Database (Denmark)

    2002-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary ssDNA and RNA strands more strongly than a corresponding DNA. The peptide nucleic acids generally comprise ligands such as naturally occurring DNA bases attached to a peptide backbone through a suitable linker....

  19. Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    1998-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary ssDNA and RNA strands more strongly than a corresponding DNA. The peptide nucleic acids generally comprise ligands such as naturally occurring DNA bases attached to a peptide backbone through a suitable linker....

  20. Cross-coupling reactions of nucleoside triphosphates followed by polymerase incorporation. Construction and applications of base-functionalized nucleic acids.

    Science.gov (United States)

    Hocek, Michal; Fojta, Miroslav

    2008-07-07

    Construction of functionalized nucleic acids (DNA or RNA) via polymerase incorporation of modified nucleoside triphosphates is reviewed and selected applications of the modified nucleic acids are highlighted. The classical multistep approach for the synthesis of modified NTPs by triphosphorylation of modified nucleosides is compared to the novel approach consisting of direct aqueous cross-coupling reactions of unprotected halogenated nucleoside triphosphates. The combination of cross-coupling of NTPs with polymerase incorporation gives an efficient and straightforward two-step synthesis of modified nucleic acids. Primer extension using biotinylated templates followed by separation using streptavidine-coated magnetic beads and DNA duplex denaturation is used for preparation of modified single stranded oligonucleotides. Examples of using this approach for electrochemical DNA labelling and bioanalytical applications are given.

  1. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  2. Oxidized base damage and single-strand break repair in mammalian genomes: role of disordered regions and posttranslational modifications in early enzymes.

    Science.gov (United States)

    Hegde, Muralidhar L; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic endonuclease 1 (APE1), form complexes with downstream repair (and other noncanonical) proteins via pairwise interactions. Furthermore, a unique feature of mammalian early BER/SSBR enzymes is the presence of a disordered terminal extension that is absent in their Escherichia coli prototypes. These nonconserved segments usually contain organelle-targeting signals, common interaction interfaces, and sites of posttranslational modifications that may be involved in regulating their repair function including lesion scanning. Finally, the linkage of BER/SSBR deficiency to cancer, aging, and human neurodegenerative diseases, and therapeutic targeting of BER/SSBR are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast.

    Science.gov (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A

    2010-08-05

    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  4. Isolation and characterization of a single-stranded DNA virus infecting the marine diatom Chaetoceros sp. strain SS628-11 isolated from western Japan.

    Directory of Open Access Journals (Sweden)

    Kei Kimura

    Full Text Available Diatoms are significant organisms for primary production in the earth's aquatic environment. Hence, their dynamics are an important focus area in current studies. Viruses are a great concern as potential factors of diatom mortality, along with other physical, chemical, and biological factors. We isolated and characterized a new diatom virus (Csp07DNAV that lyses the marine planktonic diatom Chaetoceros sp. strain SS628-11. This paper examines the physiological, morphological, and genomic characteristics of Csp07DNAV. The virus was isolated from a surface water sample that was collected at Hiroshima Bay, Japan. It was icosahedral, had a diameter of 34 nm, and accumulated in the nuclei of host cells. Rod-shaped virus particles also coexisted in the host nuclei. The latent period and burst size were estimated to be <12 h and 29 infectious units per host cell, respectively. Csp07DNAV had a closed circular single-stranded DNA genome (5,552 nucleotides, which included a double-stranded region and 3 open reading frames. The monophyly of Csp07DNAV and other Bacilladnavirus group single-stranded DNA viruses was supported by phylogenetic analysis that was based on the amino acid sequence of each virus protein. On the basis of these results, we considered Csp07DNAV to be a new member of the genus Bacilladnavirus.

  5. Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library.

    Directory of Open Access Journals (Sweden)

    Sumate Pengpumkiat

    Full Text Available Chemical synthesis of oligonucleotides is a widely used tool in the field of biochemistry. Several methods for gene synthesis have been introduced in the growing area of genomics. In this paper, a novel method of constructing dsDNA is proposed. Short (28-mer oligo fragments from a library were assembled through successive annealing and ligation processes, followed by PCR. First, two oligo fragments annealed to form a dsDNA molecule. The double-stranded oligo was immobilized onto magnetic beads (solid support via streptavidin-biotin binding. Next, single-stranded oligo fragments were added successively through ligation to form the complete DNA molecule. The synthesized DNA was amplified through PCR and gel electrophoresis was used to characterize the product. Sanger sequencing showed that more than 97% of the nucleotides matched the expected sequence. Extending the length of the DNA molecule by adding single-stranded oligonucleotides from a basis set (library via ligation enables a more convenient and rapid mechanism for the design and synthesis of oligonucleotides on the go. Coupled with an automated dispensing system and libraries of short oligo fragments, this novel DNA synthesis method would offer an efficient and cost-effective method for producing dsDNA.

  6. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  7. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H

    2012-02-22

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  8. On-site detection of Phytophthora spp.—single-stranded target DNA as the limiting factor to improve on-chip hybridization

    International Nuclear Information System (INIS)

    Schwenkbier, Lydia; Pollok, Sibyll; Popp, Jürgen; Weber, Karina; König, Stephan; Wagner, Stefan; Werres, Sabine; Weber, Jörg; Hentschel, Martin

    2014-01-01

    We report on a lab-on-a-chip approach for on-site detection of Phytophthora species that allows visual signal readout. The results demonstrate the significance of single-stranded DNA (ssDNA) generation in terms of improving the intensity of the hybridization signal and to improve the reliability of the method. Conventional PCR with subsequent heat denaturation, sodium hydroxide-based denaturation, lambda exonuclease digestion and two asymmetric PCR methods were investigated for the species P. fragariae, P. kernoviae, and P. ramorum. The positioning of the capture probe within the amplified yeast GTP-binding protein (YPT1) target DNA was also of interest because it significantly influences the intensity of the signal. Statistical tests were used to validate the impact of the ssDNA generation methods and the capture-target probe position. The single-stranded target DNA generated by Linear-After-The-Exponential PCR (LATE-PCR) was found to produce signal intensities comparable to post-PCR exonuclease treatment. The LATE-PCR is the best method for the on-site detection of Phytophthora because the enzymatic digestion after PCR is more laborious and time-consuming. (author)

  9. Nucleic acid-based fluorescent probes and their analytical potential.

    Science.gov (United States)

    Juskowiak, Bernard

    2011-03-01

    It is well known that nucleic acids play an essential role in living organisms because they store and transmit genetic information and use that information to direct the synthesis of proteins. However, less is known about the ability of nucleic acids to bind specific ligands and the application of oligonucleotides as molecular probes or biosensors. Oligonucleotide probes are single-stranded nucleic acid fragments that can be tailored to have high specificity and affinity for different targets including nucleic acids, proteins, small molecules, and ions. One can divide oligonucleotide-based probes into two main categories: hybridization probes that are based on the formation of complementary base-pairs, and aptamer probes that exploit selective recognition of nonnucleic acid analytes and may be compared with immunosensors. Design and construction of hybridization and aptamer probes are similar. Typically, oligonucleotide (DNA, RNA) with predefined base sequence and length is modified by covalent attachment of reporter groups (one or more fluorophores in fluorescence-based probes). The fluorescent labels act as transducers that transform biorecognition (hybridization, ligand binding) into a fluorescence signal. Fluorescent labels have several advantages, for example high sensitivity and multiple transduction approaches (fluorescence quenching or enhancement, fluorescence anisotropy, fluorescence lifetime, fluorescence resonance energy transfer (FRET), and excimer-monomer light switching). These multiple signaling options combined with the design flexibility of the recognition element (DNA, RNA, PNA, LNA) and various labeling strategies contribute to development of numerous selective and sensitive bioassays. This review covers fundamentals of the design and engineering of oligonucleotide probes, describes typical construction approaches, and discusses examples of probes used both in hybridization studies and in aptamer-based assays.

  10. RNA binding to APOBEC3G induces the disassembly of functional deaminase complexes by displacing single-stranded DNA substrates

    Science.gov (United States)

    Polevoda, Bogdan; McDougall, William M.; Tun, Bradley N.; Cheung, Michael; Salter, Jason D.; Friedman, Alan E.; Smith, Harold C.

    2015-01-01

    APOBEC3G (A3G) DNA deaminase activity requires a holoenzyme complex whose assembly on nascent viral reverse transcripts initiates with A3G dimers binding to ssDNA followed by formation of higher-order A3G homo oligomers. Catalytic activity is inhibited when A3G binds to RNA. Our prior studies suggested that RNA inhibited A3G binding to ssDNA. In this report, near equilibrium binding and gel shift analyses showed that A3G assembly and disassembly on ssDNA was an ordered process involving A3G dimers and multimers thereof. Although, fluorescence anisotropy showed that A3G had similar nanomolar affinity for RNA and ssDNA, RNA stochastically dissociated A3G dimers and higher-order oligomers from ssDNA, suggesting a different modality for RNA binding. Mass spectrometry mapping of A3G peptides cross-linked to nucleic acid suggested ssDNA only bound to three peptides, amino acids (aa) 181–194 in the N-terminus and aa 314–320 and 345–374 in the C-terminus that were part of a continuous exposed surface. RNA bound to these peptides and uniquely associated with three additional peptides in the N- terminus, aa 15–29, 41–52 and 83–99, that formed a continuous surface area adjacent to the ssDNA binding surface. The data predict a mechanistic model of RNA inhibition of ssDNA binding to A3G in which competitive and allosteric interactions determine RNA-bound versus ssDNA-bound conformational states. PMID:26424853

  11. Neutron Nucleic Acid Crystallography.

    Science.gov (United States)

    Chatake, Toshiyuki

    2016-01-01

    The hydration shells surrounding nucleic acids and hydrogen-bonding networks involving water molecules and nucleic acids are essential interactions for the structural stability and function of nucleic acids. Water molecules in the hydration shells influence various conformations of DNA and RNA by specific hydrogen-bonding networks, which often contribute to the chemical reactivity and molecular recognition of nucleic acids. However, X-ray crystallography could not provide a complete description of structural information with respect to hydrogen bonds. Indeed, X-ray crystallography is a powerful tool for determining the locations of water molecules, i.e., the location of the oxygen atom of H2O; however, it is very difficult to determine the orientation of the water molecules, i.e., the orientation of the two hydrogen atoms of H2O, because X-ray scattering from the hydrogen atom is very small.Neutron crystallography is a specialized tool for determining the positions of hydrogen atoms. Neutrons are not diffracted by electrons, but are diffracted by atomic nuclei; accordingly, neutron scattering lengths of hydrogen and its isotopes are comparable to those of non-hydrogen atoms. Therefore, neutron crystallography can determine both of the locations and orientations of water molecules. This chapter describes the current status of neutron nucleic acid crystallographic research as well as the basic principles of neutron diffraction experiments performed on nucleic acid crystals: materials, crystallization, diffraction experiments, and structure determination.

  12. Characterization of a crosslinked nucleic acid - helix destabilizing protein complex

    Energy Technology Data Exchange (ETDEWEB)

    Karpel, R.L.; Levin, V.Y.; Haley, B.E.

    1986-05-01

    They have enzymatically synthesized /sup 3/H- and /sup 32/P-poly(A,8N/sub 3/A) from 8-N/sub 3/ADP and radiolabeled ADP, and have used this polynucleotide to photoaffinity label T4 gene 32 protein, as well as several other helix-destabilizing proteins (HDPs). Irradiation of /sup 32/P-/sup 3/H-poly(A,N/sub 3/A) mixtures for short durations produces a covalent complex, seen as a high molecular weight, radioactive band on SDS-polyacrylamide gels. Preliminary experiments on other HDPs, from prokaryotic, eukaryotic and animal viral sources, show analogous results. Several successful control experiments indicate that this system is suitable for binding site localization on /sup 32/P. Single-stranded nucleic acids competitively inhibit photolabeling. The effect of NaCl on photolabeling parallels the salt-dependence of /sup 32/P-poly(A,N/sub 3/A) binding. Photolabeling reaches a plateau after approx.1 min, and the formation of the high molecular weight complex parallels the reduction of free /sup 32/P on SDS gels. Staph. nuclease digestion of crosslinked complexes produces a diffuse, radioactive band on SDS gels, migrating just behind free /sup 32/P. When these digested complexes are subjected to reverse-phase HPLC on a C3 Ultrapore column, the nucleic acid /sup 32/P-label is seen to coelute with protein. They are currently employing RP-HPLC methods to locate the label on tryptic peptides of nuclease-digested complexes.

  13. The casein genes in goat breeds from different Continents: analysis by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP

    Directory of Open Access Journals (Sweden)

    A. Caroli

    2010-04-01

    Full Text Available A screening of casein gene variability was carried out by Polymerase Chain Reaction – Single Strand Conformation Polymorphism in 8 goat breeds from Sudan (Nubian goat, Turkey (Angora Goat Lalahan Tiftic, Angora Goat Yerkoy, Hair goat and India (Jammu, Maharashtra, Rajasthan, South Goat. A total of 16 different alleles or groups of alleles were found, showing conspicuous differences among breeds. The allele frequencies were submitted to cluster analysis in order to highlight differences between breeds, also including data from Red Sokoto, West African Dwarf Nigeria, West African Dwarf Cameroon, and Borno Goat. The tree obtained from the cluster analysis showed two main lineages. The West African goat clustered together, the Indian and Turkish breeds were in the other group. Nubian goat was found in an intermediate position.

  14. Investigation of single-strand conformational polymorphism of the TP53 gene in women with a family history of breast cancer

    Directory of Open Access Journals (Sweden)

    R.R. Burbano

    2000-11-01

    Full Text Available Breast cancer in families with germ line mutations in the TP53 gene has been described in the medical literature. Mutation screening for susceptibility genes should allow effective prophylactic and preventive measures. Using single-strand conformational polymorphism, we screened for mutations in exons 5, 6, 7 and 8 of gene TP53 in the peripheral blood of 8 young non-affected members (17 to 36 years old of families with a history of breast cancer. Studies of this type on young patients (mean age, 25 years are very rare in the literature. The identification of these mutations would contribute to genetic counseling of members of families with predisposition to breast cancer. The results obtained did not show any polymorphism indicating mutation. In our sample, the familial tumorigenesis is probably related to other gene etiologies.

  15. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.

    1994-01-01

    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  16. Influence of the single-strand linker composition on the structural/dynamical properties of a truncated octahedral DNA nano-cage family.

    Science.gov (United States)

    Iacovelli, Federico; Alves, Cassio; Falconi, Mattia; Oteri, Francesco; de Oliveira, Cristiano L P; Desideri, Alessandro

    2014-10-01

    The structural/dynamical properties of three truncated octahedral DNA nano-cages composed by identical double helices but single strand linkers with different composition, namely 7 thymidines, 7 adenines, and 7 alternated thymidines and adenines, have been investigated through classical molecular dynamics simulations. Trajectories have been analyzed to investigate the role of the linkers in defining nano-cages stability and flexibility, including possible influence on the internal cages motions. The data indicate that the cages behavior is almost identical and that the structural/dynamical parameters measured along the trajectories are not particularly affected by the presence of different bases. These results demonstrate that the constraints imposed by the nano-structure geometry are the main factor in modulating these properties

  17. Localization of specific sequences and DNA single-strand breaks in individual UV-A-irradiated human lymphocytes by COMET FISH

    Science.gov (United States)

    Bock, Claudia; Rapp, Alexander; Dittmar, Heike; Monajembashi, Shamci; Greulich, Karl-Otto

    1999-01-01

    The COMET assay, a single cell electrophoresis technique which allows to separate electrophoretically fractionated DNA according to size has been combined with fluorescence in situ hybridization (FISH) which allows to localize specific genes or gene regions. This combination (COMET FISH) allows the detection of DNA single strand breaks in specific regions of the genome of human lymphocytes at the single cell level. Various types of DNA probes, e.g. centromere-, (alpha) - satellite-, telomere-, whole chromosome-, single copy- and region specific DNA probes have been used to investigate whether the UV-A induced DNA single strand breaks are distributed randomly all over the human genome or induced at specific sites ('hot spots'). In the investigated human peripheral blood lymphocytes all but one centromere reveal low sensitivity for UV-A irradiation (500 kJ/m2), while telomeres are randomly distributed over COMET heads and tails. The human chromosome 1 is fractionated by irradiation, but remains in the COMET head, indicating an only moderate degree of fractionation. Among three tested single copy probes, c- myc, p53 and p58, the p53 gene located on chromosome 17p13.1 and the p58 gene (1p36) appear to be located in UV-A stable regions of the human genome in 95% of 65 investigated lymphocytes. In contrast, the c-myc proto-oncogene (8q24) is found in the COMET tail in 90% of the 27 investigated lymphocytes and thus appears to be more sensitive to UV-A irradiation.

  18. Evidence that single-stranded DNA breaks are a normal feature of koala sperm chromatin, while double-stranded DNA breaks are indicative of DNA damage.

    Science.gov (United States)

    Zee, Yeng Peng; López-Fernández, Carmen; Arroyo, F; Johnston, Stephen D; Holt, William V; Gosalvez, Jaime

    2009-08-01

    In this study, we have used single and double comet assays to differentiate between single- and double-stranded DNA damage in an effort to refine the interpretation of DNA damage in mature koala spermatozoa. We have also investigated the likelihood that single-stranded DNA breakage is part of the natural spermiogenic process in koalas, where its function would be the generation of structural bends in the DNA molecule so that appropriate packaging and compaction can occur. Koala spermatozoa were examined using the sperm chromatin dispersion test (SCDt) and comet assays to investigate non-orthodox double-stranded DNA. Comet assays were conducted under 1) neutral conditions; and 2) neutral followed by alkaline conditions (double comet assay); the latter technique enabled simultaneous visualisation of both single-stranded and double-stranded DNA breaks. Following the SCDt, there was a continuum of nuclear morphotypes, ranging from no apparent DNA fragmentation to those with highly dispersed and degraded chromatin. Dispersion morphotypes were mirrored by a similar diversity of comet morphologies that could be further differentiated using the double comet assay. The majority of koala spermatozoa had nuclei with DNA abasic-like residues that produced single-tailed comets following the double comet assay. The ubiquity of these residues suggests that constitutive alkali-labile sites are part of the structural configuration of the koala sperm nucleus. Spermatozoa with 'true' DNA fragmentation exhibited a continuum of comet morphologies, ranging from a more severe form of alkaline-susceptible DNA with a diffuse single tail to nuclei that exhibited both single- and double-stranded breaks with two comet tails.

  19. Functional roles of the N- and C-terminal regions of the human mitochondrial single-stranded DNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Marcos T Oliveira

    2010-10-01

    Full Text Available Biochemical studies of the mitochondrial DNA (mtDNA replisome demonstrate that the mtDNA polymerase and the mtDNA helicase are stimulated by the mitochondrial single-stranded DNA-binding protein (mtSSB. Unlike Escherichia coli SSB, bacteriophage T7 gp2.5 and bacteriophage T4 gp32, mtSSBs lack a long, negatively charged C-terminal tail. Furthermore, additional residues at the N-terminus (notwithstanding the mitochondrial presequence are present in the sequence of species across the animal kingdom. We sought to analyze the functional importance of the N- and C-terminal regions of the human mtSSB in the context of mtDNA replication. We produced the mature wild-type human mtSSB and three terminal deletion variants, and examined their physical and biochemical properties. We demonstrate that the recombinant proteins adopt a tetrameric form, and bind single-stranded DNA with similar affinities. They also stimulate similarly the DNA unwinding activity of the human mtDNA helicase (up to 8-fold. Notably, we find that unlike the high level of stimulation that we observed previously in the Drosophila system, stimulation of DNA synthesis catalyzed by human mtDNA polymerase is only moderate, and occurs over a narrow range of salt concentrations. Interestingly, each of the deletion variants of human mtSSB stimulates DNA synthesis at a higher level than the wild-type protein, indicating that the termini modulate negatively functional interactions with the mitochondrial replicase. We discuss our findings in the context of species-specific components of the mtDNA replisome, and in comparison with various prokaryotic DNA replication machineries.

  20. Mechanism of thermal renaturation and hybridization of nucleic acids: Kramers' process and universality in Watson-Crick base pairing.

    Science.gov (United States)

    Sikorav, Jean-Louis; Orland, Henri; Braslau, Alan

    2009-03-26

    Renaturation and hybridization reactions lead to the pairing of complementary single-stranded nucleic acids. We present here a theoretical investigation of the mechanism of these reactions in vitro under thermal conditions (dilute solutions of single-stranded chains, in the presence of molar concentrations of monovalent salts and at elevated temperatures). The mechanism follows a Kramers' process, whereby the complementary chains overcome a potential barrier through Brownian motion. The barrier originates from a single rate-limiting nucleation event in which the first complementary base pairs are formed. The reaction then proceeds through a fast growth of the double helix. For the DNA of bacteriophages T7, T4, and phiX174, as well as for Escherichia coli DNA, the bimolecular rate k2 of the reaction increases as a power law of the average degree of polymerization of the reacting single-strands: k2 is proportional to alpha. This relationship holds for 100 < or = 50,000 with an experimentally determined exponent alpha = 0.51 +/- 0.01. The length dependence results from a thermodynamic excluded-volume effect. The reacting single-stranded chains are predicted to be in universal good solvent conditions, and the scaling law is determined by the relevant equilibrium monomer contact probability. The value theoretically predicted for the exponent is alpha = 1 - nutheta2, where nu is Flory's swelling exponent (nu approximately equal 0.588), and theta2 is a critical exponent introduced by des Cloizeaux (theta2 approximately equal 0.82), yielding alpha = 0.52 +/- 0.01, in agreement with the experimental results.

  1. Nucleic acid binding and other biomedical properties of artificial oligolysines

    Directory of Open Access Journals (Sweden)

    Roviello GN

    2016-11-01

    Full Text Available Giovanni N Roviello,1 Caterina Vicidomini,1 Vincenzo Costanzo,1 Valentina Roviello2 1CNR Istituto di Biostrutture e Bioimmagini, Via Mezzocannone site and Headquarters, 2Centro Regionale di Competenza (CRdC Tecnologie, Via Nuova Agnano, Napoli, Italy Abstract: In the present study, we report the interaction of an artificial oligolysine (referred to as AOL realized in our laboratory with targets of biomedical importance. These included polyinosinic acid (poly rI and its complex with polycytidylic acid (poly I:C, RNAs with well-known interferon-inducing ability, and double-stranded (ds DNA. The ability of the peptide to bind both single-stranded poly rI and ds poly I:C RNAs emerged from our circular dichroism (CD and ultraviolet (UV studies. In addition, we found that AOL forms complexes with dsDNA, as shown by spectroscopic binding assays and UV thermal denaturation experiments. These findings are encouraging for the possible use of AOL in biomedicine for nucleic acid targeting and oligonucleotide condensation, with the latter being a key step preceding their clinical application. Moreover, we tested the ability of AOL to bind to proteins, using serum albumin as a model protein. We demonstrated the oligolysine–protein binding by CD experiments which suggested that AOL, positively charged under physiological conditions, binds to the protein regions rich in anionic residues. Finally, the morphology characterization of the solid oligolysine, performed by scanning electron microscopy, showed different crystal forms including cubic-shaped crystals confirming the high purity of AOL. Keywords: nucleic acid binding, polyinosinic acid, double-stranded nucleic acids, oligolysine, circular dichroism

  2. Terbium fluorescence as a sensitive, inexpensive probe for UV-induced damage in nucleic acids

    International Nuclear Information System (INIS)

    El-Yazbi, Amira F.; Loppnow, Glen R.

    2013-01-01

    Graphical abstract: -- Highlights: •Simple, inexpensive, mix-and-read assay for positive detection of DNA damage. •Recognition of undamaged DNA via hybridization to a hairpin probe. •Terbium(III) fluorescence reports the amount of damage by binding to ssDNA. •Tb/hairpin is a highly selective and sensitive fluorescent probe for DNA damage. -- Abstract: Much effort has been focused on developing methods for detecting damaged nucleic acids. However, almost all of the proposed methods consist of multi-step procedures, are limited, require expensive instruments, or suffer from a high level of interferences. In this paper, we present a novel simple, inexpensive, mix-and-read assay that is generally applicable to nucleic acid damage and uses the enhanced luminescence due to energy transfer from nucleic acids to terbium(III) (Tb 3+ ). Single-stranded oligonucleotides greatly enhance the Tb 3+ emission, but duplex DNA does not. With the use of a DNA hairpin probe complementary to the oligonucleotide of interest, the Tb 3+ /hairpin probe is applied to detect ultraviolet (UV)-induced DNA damage. The hairpin probe hybridizes only with the undamaged DNA. However, the damaged DNA remains single-stranded and enhances the intrinsic fluorescence of Tb 3+ , producing a detectable signal directly proportional to the amount of DNA damage. This allows the Tb 3+ /hairpin probe to be used for sensitive quantification of UV-induced DNA damage. The Tb 3+ /hairpin probe showed superior selectivity to DNA damage compared to conventional molecular beacons probes (MBs) and its sensitivity is more than 2.5 times higher than MBs with a limit of detection of 4.36 ± 1.2 nM. In addition, this probe is easier to synthesize and more than eight times cheaper than MBs, which makes its use recommended for high-throughput, quantitative analysis of DNA damage

  3. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide

    2015-10-01

    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  4. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2016-05-28

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  5. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy

    2008-01-01

    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  6. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray.

    Science.gov (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino

    2008-08-25

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  7. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Science.gov (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino

    2008-01-01

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  8. A biomarker model of sublethal genotoxicity (DNA single-strand breaks and adducts) using the sentinel organism Aporrectodea longa in spiked soil

    International Nuclear Information System (INIS)

    Martin, Francis L.; Piearce, Trevor G.; Hewer, Alan; Phillips, David H.; Semple, Kirk T.

    2005-01-01

    There is a need to develop risk biomarkers during the remediation of contaminated land. We employed the earthworm, Aporrectodea longa (Ude), to determine whether genotoxicity measures could be applied to this organism's intestinal tissues. Earthworms were added, for 24 h or 7 days, to soil samples spiked with benzo[a]pyrene (B[a]P) and/or lindane. After exposure, intestinal tissues (crop/gizzard or intestine) were removed prior to the measurement in disaggregated cells of DNA single-strand breaks (SSBs) by the alkaline comet assay. Damage was quantified by comet tail length (CTL, μm). B[a]P 24-h exposure induced dose-related increases (P 32 P-postlabelling, showed a two-adduct-spot pattern. This preliminary investigation suggests that earthworm tissues may be incorporated into genotoxicity assays to facilitate hazard identification within terrestrial ecosystems. - Sublethal genotoxicity in the sentinel organism A. longa can be used to monitor the effects of contaminants in soil

  9. Conformation effects of CpG methylation on single-stranded DNA oligonucleotides: analysis of the opioid peptide dynorphin-coding sequences.

    Directory of Open Access Journals (Sweden)

    Malik Mumtaz Taqi

    Full Text Available Single-stranded DNA (ssDNA is characterized by high conformational flexibility that allows these molecules to adopt a variety of conformations. Here we used native polyacrylamide gel electrophoresis (PAGE, circular dichroism (CD spectroscopy and nuclear magnetic resonance (NMR spectroscopy to show that cytosine methylation at CpG sites affects the conformational flexibility of short ssDNA molecules. The CpG containing 37-nucleotide PDYN (prodynorphin fragments were used as model molecules. The presence of secondary DNA structures was evident from differences in oligonucleotide mobilities on PAGE, from CD spectra, and from formation of A-T, G-C, and non-canonical G-T base pairs observed by NMR spectroscopy. The oligonucleotides displayed secondary structures at 4°C, and some also at 37°C. Methylation at CpG sites prompted sequence-dependent formation of novel conformations, or shifted the equilibrium between different existing ssDNA conformations. The effects of methylation on gel mobility and base pairing were comparable in strength to the effects induced by point mutations in the DNA sequences. The conformational effects of methylation may be relevant for epigenetic regulatory events in a chromatin context, including DNA-protein or DNA-DNA recognition in the course of gene transcription, and DNA replication and recombination when double-stranded DNA is unwinded to ssDNA.

  10. Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Krzysztof Lepek

    2015-01-01

    Full Text Available Monitoring and control of infections are key parts of surveillance systems and epidemiological risk prevention. In the case of influenza A viruses (IAVs, which show high variability, a wide range of hosts, and a potential of reassortment between different strains, it is essential to study not only people, but also animals living in the immediate surroundings. If understated, the animals might become a source of newly formed infectious strains with a pandemic potential. Special attention should be focused on pigs, because of the receptors specific for virus strains originating from different species, localized in their respiratory tract. Pigs are prone to mixed infections and may constitute a reservoir of potentially dangerous IAV strains resulting from genetic reassortment. It has been reported that a quadruple reassortant, A(H1N1pdm09, can be easily transmitted from humans to pigs and serve as a donor of genetic segments for new strains capable of infecting humans. Therefore, it is highly desirable to develop a simple, cost-effective, and rapid method for evaluation of IAV genetic variability. We describe a method based on multitemperature single-strand conformational polymorphism (MSSCP, using a fragment of the hemagglutinin (HA gene, for detection of coinfections and differentiation of genetic variants of the virus, difficult to identify by conventional diagnostic.

  11. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS.

    Science.gov (United States)

    Pachkowski, Brian F; Tano, Keizo; Afonin, Valeriy; Elder, Rhoderick H; Takeda, Shunichi; Watanabe, Masami; Swenberg, James A; Nakamura, Jun

    2009-12-01

    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase beta.

  12. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against the Pesticide Fipronil and Sensitive Detection in River Water

    Directory of Open Access Journals (Sweden)

    Ka L. Hong

    2017-12-01

    Full Text Available Fipronil is a commonly used insecticide that has been shown to have environmental and human health risks. The current standard methods of detection for fipronil and its metabolites, such as GC-MS, are time consuming and labor intensive. In this study, a variant of systematic evolution of ligands by exponential enrichment (SELEX, was utilized to identify the first single-stranded DNA (ssDNA molecular recognition element (MRE that binds to fipronil with high affinity (Kd = 48 ± 8 nM. The selected MRE displayed low cross binding activity on various environmentally relevant, structurally unrelated herbicides and pesticides, in addition to broad-spectrum binding activity on major metabolites of fipronil and a structurally similar pesticide in prepared river samples. Additionally, a proof-of-principle fluorescent detection assay was developed by using the selected ssDNA MRE as a signal-reporting element, with a limit of detection of 105 nM in a prepared river water sample.

  13. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Boye, E.; Johansen, I.; Brustad, T.

    1976-01-01

    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 2 0 C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 2 0 C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  14. Clonal origin of multiple lung cancers: K-ras and p53 mutations determined by nonradioisotopic single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Lau, D H; Yang, B; Hu, R; Benfield, J R

    1997-08-01

    Disease stage is the most important factor in determining prognosis and treatment of lung cancer. Staging of lung cancer is complicated by presentation of multiple pulmonary malignant lesions with a similar histology. It is a dilemma to decide if these lesions are synchronous primaries arising from different malignant clones or metastases from a single clone. Lung cancer is associated with multiple genetic abnormalities including mutations of K-ras and p53, which are believed to occur prior to onset of metastasis. To determine the clonal origin of multiple pulmonary malginant nodules, we analyzed point-mutations of K-ras and p53 by microdissection, polymerase chain reactions (PCR), nonradioisotopic single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. Each pulmonary lesion was microdissected from paraffin slides. Genomic DNA was amplified by two sequential PCRs followed by electrophoresis in a minigel and silver staining. Deoxyribonucleic acid sequencing was performed if necessary to confirm a mutation found upon SSCP analysis. Applying this molecular approach, we were able to differentiate the clonal origins of multiple malignant nodules of the lung as exemplified by the two cases presented.

  15. Simultaneous identification of seven foodborne pathogens and Escherichia coli (pathogenic and nonpathogenic) using capillary electrophoresis-based single-strand conformation polymorphism coupled with multiplex PCR.

    Science.gov (United States)

    Oh, Mi-Hwa; Paek, Se-Hee; Shin, Gi Won; Kim, Hae-Yeong; Jung, Gyoo Yeol; Oh, Sangsuk

    2009-06-01

    The objective of this study was to develop a novel technique for parallel analysis of eight important foodborne microbes using capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) coupled with multiplex PCR. Specific primers for multiplex PCR amplification of the 16S rRNA gene were designed, corresponding to eight species of bacteria, including Escherichia coli, Clostridium perfringens, Campylobacter jejuni, Salmonella enterica, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Bacillus cereus, for the species-specific identification and optimal separation of their PCR products in subsequent analysis by CE-SSCP. Multiplex PCR conditions including annealing temperature, extension time, the number of PCR cycles, and primer concentrations were then optimized for simultaneous detection of all target foodborne bacteria. The diagnostic system using CE-SSCP combined with multiplex PCR developed here can be used for rapid investigation of causative agents of foodborne illness. The simplicity and high sensitivity of the method may lead to improved management of safety and illness related to food.

  16. Integrative modelling coupled with ion mobility mass spectrometry reveals structural features of the clamp loader in complex with single-stranded DNA binding protein.

    Science.gov (United States)

    Politis, Argyris; Park, Ah Young; Hall, Zoe; Ruotolo, Brandon T; Robinson, Carol V

    2013-11-29

    DNA polymerase III, a decameric 420-kDa assembly, simultaneously replicates both strands of the chromosome in Escherichia coli. A subassembly of this holoenzyme, the seven-subunit clamp loader complex, is responsible for loading the sliding clamp (β2) onto DNA. Here, we use structural information derived from ion mobility mass spectrometry (IM-MS) to build three-dimensional models of one form of the full clamp loader complex, γ3δδ'ψχ (254 kDa). By probing the interaction between the clamp loader and a single-stranded DNA (ssDNA) binding protein (SSB4) and by identifying two distinct conformational states, with and without ssDNA, we assemble models of ψχ-SSB4 (108 kDa) and the clamp loader-SSB4 (340 kDa) consistent with IM data. A significant increase in measured collision cross-section (~10%) of the clamp loader-SSB4 complex upon DNA binding suggests large conformational rearrangements. This DNA bound conformation represents the active state and, along with the presence of ψχ, stabilises the clamp loader-SSB4 complex. Overall, this study of a large heteromeric complex analysed by IM-MS, coupled with integrative modelling, highlights the potential of such an approach to reveal structural features of previously unknown complexes of high biological importance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Electrochemistry of nucleic acids

    Czech Academy of Sciences Publication Activity Database

    Paleček, Emil; Bartošík, Martin

    2012-01-01

    Roč. 112, č. 6 (2012), s. 3427-3481 ISSN 0009-2665 R&D Projects: GA ČR(CZ) GAP301/11/2055; GA MŠk(CZ) ME09038; GA MŠk(CZ) LC06035 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : nucleic acids electrochemistry * DNA biosensors * DNA damage Subject RIV: BO - Biophysics Impact factor: 41.298, year: 2012

  18. porphyrin with single strand DNAs

    Indian Academy of Sciences (India)

    for organization of porphyrin molecules into extended assemblies, providing opportunities for construction of supramolecular structures.6–8 Among the porphyrin .... and consequently the mono- and bi-exponential nature of the decays were judged by the reduced chi-square. (χ2) values and distribution of the weighted ...

  19. What controls the hybridization thermodynamics of spherical nucleic acids?

    Science.gov (United States)

    Randeria, Pratik S; Jones, Matthew R; Kohlstedt, Kevin L; Banga, Resham J; Olvera de la Cruz, Monica; Schatz, George C; Mirkin, Chad A

    2015-03-18

    The hybridization of free oligonucleotides to densely packed, oriented arrays of DNA modifying the surfaces of spherical nucleic acid (SNA)-gold nanoparticle conjugates occurs with negative cooperativity; i.e., each binding event destabilizes subsequent binding events. DNA hybridization is thus an ever-changing function of the number of strands already hybridized to the particle. Thermodynamic quantification of this behavior reveals a 3 orders of magnitude decrease in the binding constant for the capture of a free oligonucleotide by an SNA conjugate as the fraction of pre-hybridized strands increases from 0 to ∼30%. Increasing the number of pre-hybridized strands imparts an increasing enthalpic penalty to hybridization that makes binding more difficult, while simultaneously decreasing the entropic penalty to hybridization, which makes binding more favorable. Hybridization of free DNA to an SNA is thus governed by both an electrostatic barrier as the SNA accumulates charge with additional binding events and an effect consistent with allostery, where hybridization at certain sites on an SNA modify the binding affinity at a distal site through conformational changes to the remaining single strands. Leveraging these insights allows for the design of conjugates that hybridize free strands with significantly higher efficiencies, some of which approach 100%.

  20. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA.

    Science.gov (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S

    2000-09-20

    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  1. Flow cytometry analysis of single-strand DNA damage in neuroblastoma cell lines using the F7-26 monoclonal antibody.

    Science.gov (United States)

    Grigoryan, Rita S; Yang, Bo; Keshelava, Nino; Barnhart, Jerry R; Reynolds, C Patrick

    2007-11-01

    The F7-26 monoclonal antibody (Mab) has been reported to be specific for single-strand DNA damage (ssDNA) and to also identify cells in apoptosis. We carriedout studies to determine if F7-26 binding measured by flow cytometry was able to specifically identify exogenous ssDNA as opposed to DNA damage from apoptosis. Neuroblastoma cells were treated with melphalan (L-PAM), fenretinide, 4-hydroperoxycyclophosphamide (4-HC)+/-pan-caspase inhibitor BOC-d-fmk, topotecan or with 10Gy gamma radiation+/-hydrogen peroxide (H2O2) and fixed immediately postradiation. Cytotoxicity was measured by DIMSCAN digital imaging fluorescence assay. The degree of ssDNA damage was analyzed by flow cytometry using Mab F7-26, with DNA visualized by propidium iodide counterstaining. Flow cytometry was used to measure apoptosis detected by terminal deoxynucleotidyltransferase (TUNEL) assay and reactive oxygen species (ROS) by carboxy-dichlorofluorescein diacetate. Irradiated and immediately fixed neuroblastoma cells showed increased ssDNA, but not apoptosis by TUNEL (TUNEL-negative). 4-HC or L-PAM+/-BOC-d-fmk increased ssDNA (F7-26-positive), but BOC-d-fmk prevented TUNEL staining. Fenretinide increased apoptosis by TUNEL but not ssDNA damage detected with F7-26. Enhanced ssDNA in neuroblastoma cells treated with radiation+H2O2 was associated with increased ROS. Topotecan increased both ssDNA and cytotoxicity in 4-HC-treated cells. These data demonstrate that Mab F7-26 recognized ssDNA due to exogenous DNA damage, rather than apoptosis. This assay should be useful to characterize the mechanism of action of antineoplastic drugs. Copyright (c) 2007 International Society for Analytical Cytology.

  2. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani

    2006-09-01

    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  3. Detection of p53 mutations by single-strand conformation polymorphisms (SSCP) gel electrophoresis. A comparative study of radioactive and nonradioactive silver-stained SSCP analysis.

    Science.gov (United States)

    Bosari, S; Marchetti, A; Buttitta, F; Graziani, D; Borsani, G; Loda, M; Bevilacqua, G; Coggi, G

    1995-12-01

    p53 mutations are the most common genetic abnormality in humans tumors, but their clinical significance remains to be precisely elucidated. Conventional single-strand conformation polymorphism (SSCP) analysis, a well-established technique for detecting p53 mutations, uses radioactively labeled polymerase chain reaction (PCR) products, which migrate abnormally in the presence of mutations. We performed radioactive PCR-SSCP analysis in a series of 30 formalin-fixed, paraffin-embedded ovarian carcinomas and two cell lines (SW480 and Caov4) harboring known homozygous p53 mutations and compared the results with nonradioactive silver-stained SSCP. The purpose was to assess whether nonradioactive SSCP is suitable for detecting p53 mutations in a rapid, sensitive, cost-effective fashion, without the need of radioactive isotopes. We accomplished PCR amplification of p53 exons 5 through 8 in 26 carcinomas, and radioactive SSCP detected p53 mutations in 13 tumors; three mutations were localized in exon 5, six in exon 6, two in exon 7, and two in exon 8. All mutations were correctly identified with nonradioactive SSCP, except for one exon 8 mutation. To establish the sensitivity of nonradioactive SSCP, DNA samples of SW480 and Caov4 were mixed with increasing amounts (0-90%) of normal DNA and subjected to PCR-SSCP analysis. Mutations were detected until the concentration of SW480 and Caov4 was 15% and 10%, respectively, of the total sample. The results of our investigation demonstrate that nonradioactive silver-stained SSCP is a sensitive, rapid, and simple technique to detect p53 mutations, even in formalin-fixed tissues, and could be easily used to investigate large series of patients to assess the clinical significance of p53 mutations in human tumors.

  4. Ampelomyces mycoparasites from apple powdery mildew identified as a distinct group based on single-stranded conformation polymorphism analysis of the rDNA ITS region.

    Science.gov (United States)

    Szentiványi, Orsolya; Kiss, Levente; Russell, John C; Kovács, Gábor M; Varga, Krisztina; Jankovics, Tünde; Lesemann, Silke; Xu, Xiang-Ming; Jeffries, Peter

    2005-04-01

    Pycnidial fungi belonging to the genus Ampelomyces are the most common natural antagonists of powdery mildews worldwide. During a study of the interactions between apple powdery mildew (Podosphaera leucotricha) and Ampelomyces mycoparasites, 52 new Ampelomyces isolates were obtained from P. leucotricha and, in addition, 13 new isolates from other species of the Erysiphaceae in four European countries. Their genetic diversity was screened using single-stranded conformation polymorphism (SSCP) analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). For comparison, 24 isolates obtained from genetic resource collections or other sources were included in this study. Based on the ITS-SSCP patterns, the isolates were placed in eight groups. The isolates belonged to two types based on their growth in culture. The faster-growing and the slower-growing isolates were included in different SSCP groups. A phylogenetic analysis of the ITS sequences of representatives of these groups confirmed the results obtained with the SSCP method, and showed that the faster-growing isolates do not belong to Ampelomyces as suggested by earlier studies. All the isolates from P. leucotricha fell into a distinct SSCP group of genetically homogeneous isolates. This suggests that Ampelomyces mycoparasites which occur in apple powdery mildew are slightly different from the other Ampelomyces groups which contain mycoparasites from various powdery mildew species. This may be because the main growth period of Ampelomyces mycoparasites in apple powdery mildew is isolated in time from that of Ampelomyces isolates that occur in other species of the Erysiphaceae. P. leucotricha starts its life-cycle early in the season, usually in March-April, while most powdery mildews are active in the same environments only late in the year.

  5. Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody: a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody.

    Science.gov (United States)

    Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua

    2018-02-01

    Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.

  6. Variabilidad genética de Aedes aegypti en algunas áreas del Perú usando Single Stranded Conformational Polymorphism (SSCP

    Directory of Open Access Journals (Sweden)

    Nélida Leiva G

    2004-07-01

    Full Text Available Aedes aegypti es el vector responsable de la transmisión del virus del dengue, su distribución geográfica se ha ampliado rápidamente debido principalmente a la intervención de los seres humanos. Objetivo: Analizar la variabilidad genética de este mosquito mediante la comparación del Segundo Espaciador Transcrito Interno (ITS 2 perteneciente al ADN ribosomal (rADN. Materiales y Métodos: Se analizaron muestras de ocho localidades (Jaén, Tingo María, Iquitos, Lambayeque, el distrito de El Rimac, Sullana y Zarumilla y uno de la provincia de Huaquillas (Ecuador. El análisis de la variabilidad se determinó usando la técnica conocida como SSCP (Single Stranded Conformation Polymorphism. Resultados: El estudio muestra que existe variabilidad genética entre las poblaciones analizadas, principalmente entre las muestras localizadas en la costa del Perú (Zarumilla, El Rímac, Sullana y Huaquillas y las muestras del nororiente (Tingo María, Iquitos, Jaén y Lambayeque Conclusión: Se determinaron dos variantes genéticas entre las poblaciones de Aedes aegypti: Costeña y Nororiental, que probablemente provienen de dos ancestros diferentes y cuyo ancestro común sufrió de aislamiento por distancia. Se observó que no existe relación entre las distancias genéticas y las distancias geográficas indicando que la migración de estas poblaciones es el resultado de la intervención de los seres humanos que diseminan al vector y no por la migración activa del mosquito. Se plantea el papel de la Cordillera de los Andes en la migración y separación de las poblaciones de Aedes.

  7. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms.

    Science.gov (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A

    2012-05-01

    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    Science.gov (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W

    2009-12-23

    Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation

  11. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  12. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  13. Contribution of single-strand breaks and alkali-labile bonds to the loss of infectivity of γ-irradiated phiX174 RF-DNA in E. coli cells mutant in various repair functions

    International Nuclear Information System (INIS)

    McKee, R.H.

    1975-01-01

    Twenty-one radiation sensitive mutants have been examined for their capacity to support gamma-irradiated phiX174 RF-DNA. The survival of phiX174 RF-DNA was reduced in essentially all of the sensitive mutants. The irradiated phiX174 RF-DNA was then separated into populations containing either single-strand breaks or alkali-labile bonds to examine the capacity of the mutants to repair each of the classes of lesions. It was found that all E. coli strains are unable to repair 22 percent of the single-strand breaks and all sensitive mutants are unable to repair an additional 10 percent of the breaks. All the repair functions examined are involved in single-strand break repair and none are more or less necessary than any of the others. PhiX174 RF-DNA is also inactivated by alkali-labile bonds. In the normal strains the inactivation efficiency is 0.16 lethal events per lesion with a threshold dose of 15 to 20 krads. The mutants are divided into two classes by their sensitivity to alkali-labile bonds. Both classes of mutants are also inactivated by alkali-labile bonds with efficiencies of about 0.17 and 0.29 lethal events per lesion, respectively. It is proposed that the differences seen in survival curves of phiX174 measured in the sensitive mutants is due to this difference. Although in normal cells the efficiency of inactivation of phiX174 by single-strand breaks is 50 percent greater than by alkali-labile bonds, alkali-labile bonds are produced at approximately twice the rate of single-strand breaks so alkali-labile bonds account for about 61 percent of the overall inactivation. In the mutants of least sensitivity alkali-labile bonds account for about 54 percent of the inactivating events and in the most sensitive about 67 percent

  14. Origin of nucleic acids

    International Nuclear Information System (INIS)

    Prieur, B.E.

    1995-01-01

    The appearance of nucleic acids is the first event after the birth of membranes which made it possible to assure the perenniality of information. The complexity of these molecules has led some scientists to propose that they were not prebiotic but rather derived a more simple and achiral primitive ancestor. This hypothesis suggests that ribose possesses properties that allowed the formation of certain polysaccharides which evolved to RNA. The first step of the hypothesis is the selection and concentration of ribofuranose. This sugar has chelating properties and its alpha-ribofuranose is favoured in the chelating position. The density of the sugar with a heavy cation is greater than water and thus the complex can escape the UV radiation at the surface of the ocean. The particularity of ribose is to be able to form a homochiral regular array of these basic chelating structures with pyrophosphite. These arrays evolve towards the formation of polysaccharides (poly ribose phosphate) which have a very organized structure. These polysaccharides in turn evolve to RNA by binding of adenine and deoxyguanine which are HCN derivatives that can react with the polysaccharides. The primitive RNA is methylated and oxidized to form prebiotic RNA with adenosine, cytidine, 7methyl-guanosine and ribothymidine as nucleic bases. The pathway of biosynthesis of DNA form RNA will be studied. I suggest that the appearance of DNA results form the interaction between prebiotic double stranded RNA and proteins. DNA could be a product of RNA degradation by proteins. The catabolism of RNA to DNA requires a source of free radicals, protons and hydrides. RNA cannot produce free radicals, which are provided by the phenol group of the amino acid tyrosien. Protons are provided by the medium and hydrides are provided by 7-methyl-guanosine which can fix hydrides coming from hydrogen gas and donate them for the transformation of a riboside to a deoxyriboside. This pathway suggests that DNA appeared at

  15. Characterization of a Novel Megabirnavirus from Sclerotinia sclerotiorum Reveals Horizontal Gene Transfer from Single-Stranded RNA Virus to Double-Stranded RNA Virus.

    Science.gov (United States)

    Wang, Minghong; Wang, Yong; Sun, Xiangzhong; Cheng, Jiasen; Fu, Yanping; Liu, Huiquan; Jiang, Daohong; Ghabrial, Said A; Xie, Jiatao

    2015-08-01

    Mycoviruses have been detected in all major groups of filamentous fungi, and their study represents an important branch of virology. Here, we characterized a novel double-stranded RNA (dsRNA) mycovirus, Sclerotinia sclerotiorum megabirnavirus 1 (SsMBV1), in an apparently hypovirulent strain (SX466) of Sclerotinia sclerotiorum. Two similarly sized dsRNA segments (L1- and L2-dsRNA), the genome of SsMBV1, are packaged in rigid spherical particles purified from strain SX466. The full-length cDNA sequence of L1-dsRNA/SsMBV1 comprises two large open reading frames (ORF1 and ORF2), which encode a putative coat protein and an RNA-dependent RNA polymerase (RdRp), respectively. Phylogenetic analysis of the RdRp domain clearly indicates that SsMBV1 is related to Rosellinia necatrix megabirnavirus 1 (RnMBV1). L2-dsRNA/SsMBV1 comprises two nonoverlapping ORFs (ORFA and ORFB) encoding two hypothetical proteins with unknown functions. The 5'-terminal regions of L1- and L2-dsRNA/SsMBV1 share strictly conserved sequences and form stable stem-loop structures. Although L2-dsRNA/SsMBV1 is dispensable for replication, genome packaging, and pathogenicity of SsMBV1, it enhances transcript accumulation of L1-dsRNA/SsMBV1 and stability of virus-like particles (VLPs). Interestingly, a conserved papain-like protease domain similar to a multifunctional protein (p29) of Cryphonectria hypovirus 1 was detected in the ORFA-encoded protein of L2-dsRNA/SsMBV1. Phylogenetic analysis based on the protease domain suggests that horizontal gene transfer may have occurred from a single-stranded RNA (ssRNA) virus (hypovirus) to a dsRNA virus, SsMBV1. Our results reveal that SsMBV1 has a slight impact on the fundamental biological characteristics of its host regardless of the presence or absence of L2-dsRNA/SsMBV1. Mycoviruses are widespread in all major fungal groups, and they possess diverse genomes of mostly ssRNA and dsRNA and, recently, circular ssDNA. Here, we have characterized a novel dsRNA virus

  16. Nucleic Acid-Based Nanoconstructs

    Science.gov (United States)

    Focuses on the design, synthesis, characterization, and development of spherical nucleic acid constructs as effective nanotherapeutic, single-entity agents for the treatment of glioblastoma multiforme and prostate cancers.

  17. Probing the transition state for nucleic acid hybridization using phi-value analysis.

    Science.gov (United States)

    Kim, Jandi; Shin, Jong-Shik

    2010-04-27

    Genetic regulation by noncoding RNA elements such as microRNA and small interfering RNA (siRNA) involves hybridization of a short single-stranded RNA with a complementary segment in a target mRNA. The physical basis of the hybridization process between the structured nucleic acids is not well understood primarily because of the lack of information about the transition-state structure. Here we use transition-state theory, inspired by phi-value analysis in protein folding studies, to provide quantitative analysis of the relationship between changes in the secondary structure stability and the activation free energy. Time course monitoring of the hybridization reaction was performed under pseudo-steady-state conditions using a single fluorophore. The phi-value analysis indicates that the native secondary structure remains intact in the transition state. The nativelike transition state was confirmed via examination of the salt dependence of the hybridization kinetics, indicating that the number of sodium ions associated with the transition state was not substantially affected by changes in the native secondary structure. These results propose that hybridization between structured nucleic acids undergoes a transition state leading to formation of a nucleation complex and then is followed by sequential displacement of preexisting base pairings involving successive small energy barriers. The proposed mechanism might provide new insight into physical processes during small RNA-mediated gene silencing, which is essential to selection of a target mRNA segment for siRNA design.

  18. Nucleic acid-binding properties of the RRM-containing protein RDM1

    International Nuclear Information System (INIS)

    Hamimes, Samia; Bourgeon, Dominique; Stasiak, Alicja Z.; Stasiak, Andrzej; Van Dyck, Eric

    2006-01-01

    RDM1 (RAD52 Motif 1) is a vertebrate protein involved in the cellular response to the anti-cancer drug cisplatin. In addition to an RNA recognition motif, RDM1 contains a small amino acid motif, named RD motif, which it shares with the recombination and repair protein, RAD52. RDM1 binds to single- and double-stranded DNA, and recognizes DNA distortions induced by cisplatin adducts in vitro. Here, we have performed an in-depth analysis of the nucleic acid-binding properties of RDM1 using gel-shift assays and electron microscopy. We show that RDM1 possesses acidic pH-dependent DNA-binding activity and that it binds RNA as well as DNA, and we present evidence from competition gel-shift experiments that RDM1 may be capable of discrimination between the two nucleic acids. Based on reported studies of RAD52, we have generated an RDM1 variant mutated in its RD motif. We find that the L 119 GF → AAA mutation affects the mode of RDM1 binding to single-stranded DNA

  19. Synthesis and optical properties of pyrrolidinyl peptide nucleic acid carrying a clicked Nile red label

    Directory of Open Access Journals (Sweden)

    Nattawut Yotapan

    2014-09-01

    Full Text Available DNA or its analogues with an environment-sensitive fluorescent label are potentially useful as a probe for studying the structure and dynamics of nucleic acids. In this work, pyrrolidinyl peptide nucleic acid (acpcPNA was labeled at its backbone with Nile red, a solvatochromic benzophenoxazine dye, by means of click chemistry. The optical properties of the Nile red-labeled acpcPNA were investigated by UV–vis and fluorescence spectroscopy in the absence and in the presence of DNA. In contrast to the usual quenching observed in Nile red-labeled DNA, the hybridization with DNA resulted in blue shifting and an enhanced fluorescence regardless of the neighboring bases. More pronounced blue shifts and fluorescence enhancements were observed when the DNA target carried a base insertion in close proximity to the Nile red label. The results indicate that the Nile red label is located in a more hydrophobic environment in acpcPNA–DNA duplexes than in the single-stranded acpcPNA. The different fluorescence properties of the acpcPNA hybrids of complementary DNA and DNA carrying a base insertion are suggestive of different interactions between the Nile red label and the duplexes.

  20. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D

    2010-01-01

    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  1. Increased type I collagen content and DNA binding activity of a single-stranded, cytosine-rich sequence in the high-salt buffer protein extract of the copper-deficient rat heart.

    Science.gov (United States)

    Zeng, Huawei; Saari, Jack T

    2004-11-01

    Dietary copper (Cu) deficiency not only causes a hypertrophic cardiomyopathy but also increases cancer risk in rodent models. However, a possible alteration in gene expression has not been fully examined. The present study was undertaken to determine the effect of Cu deficiency on protein profiles in rat heart tissue. Male Sprague-Dawley rats were fed diets that were either a Cu-adequate diet (6.0 microg Cu/g diet, n = 6) or a Cu-deficient diet (0.3 microg Cu/g diet, n = 6) for 5 weeks. The high-salt buffer (HSB) protein extract from heart tissue of Cu-deficient, but not Cu-adequate rats showed a 132 kDa protein band by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. This protein band stained pink with Coomassie Blue, suggesting the presence of collagens or other proline-rich proteins. Dot immunoblotting demonstrated that total type I collagen was increased by 110% in HSB protein extract from Cu-deficient, relative to Cu-adequate, rats. Liquid chromatography with mass spectrometry analysis indicated that the 132 kDa protein band contained a collagen alpha (I) chain precursor as well as a leucine-rich protein 130 (LRP130) in HSB protein extract from Cu-deficient but not Cu-adequate rats. A gel shift assay showed that HSB protein extract from Cu-deficient rats bound to a single-stranded cytosine-rich DNA with higher affinity than the extract of Cu-adequate rats, similar to reports of an increase in LRP130 single-stranded DNA binding activity in several types of tumor cells. Collectively, these results not only suggest an additional feature of altered collagen metabolism with Cu deficiency but also demonstrate for the first time an increase in single-stranded cytosine-rich DNA binding in Cu-deficient rat heart.

  2. Electrostatic-assembly-driven formation of supramolecular rhombus microparticles and their application for fluorescent nucleic acid detection.

    Directory of Open Access Journals (Sweden)

    Hailong Li

    Full Text Available In this paper, we report on the large-scale formation of supramolecular rhombus microparticles (SRMs driven by electrostatic assembly, carried out by direct mixing of an aqueous HAuCl(4 solution and an ethanol solution of 4,4'-bipyridine at room temperature. We further demonstrate their use as an effective fluorescent sensing platform for nucleic acid detection with a high selectivity down to single-base mismatch. The general concept used in this approach is based on adsorption of the fluorescently labeled single-stranded DNA (ssDNA probe by SRM, which is accompanied by substantial fluorescence quenching. In the following assay, specific hybridization with its target to form double-stranded DNA (dsDNA results in desorption of ssDNA from SRM surface and subsequent fluorescence recovery.

  3. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: tcheng@ntu.edu.tw [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)

    2013-02-01

    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ► To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ► ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ► PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ► The findings

  4. A general method of analysis of ligand binding to competing macromolecules using the spectroscopic signal originating from a reference macromolecule. Application to Escherichia coli replicative helicase DnaB protein nucleic acid interactions.

    Science.gov (United States)

    Jezewska, M J; Bujalowski, W

    1996-02-20

    MCT method by applying it to the binding of the Escherichia coli DnaB helicase to unmodified, nonfluorescent single-stranded nucleic acids where the interactions are not accompanied by any adequate spectroscopic signal changes. In order to analyze simultaneous binding of a ligand to different competing nucleic acid lattices, we introduced the combined application of the McGhee-von Hippel theory and the Epstein combinatorial approach for the binding of a large ligand to a linear, homogeneous nucleic acid lattice. Our approach allows one to perform a direct fit of the entire experimental isotherm for the protein binding to two competing nucleic acid lattices without resorting to complex numerical calculations.

  5. Humic Acid-Like Material from Sewage Sludge Stimulates Culture Growth of Ectomycorrhizal Fungi in Vitro

    Czech Academy of Sciences Publication Activity Database

    Hršelová, Hana; Soukupová, Lucie; Gryndler, Milan

    2007-01-01

    Roč. 52, č. 6 (2007), s. 627-630 ISSN 0015-5632 R&D Projects: GA ČR GA526/06/0540 Institutional research plan: CEZ:AV0Z50200510 Keywords : ectomycorrhizal basidiomycetes * sewage sludge * humic-acid-like materials Subject RIV: EE - Microbiology, Virology Impact factor: 0.989, year: 2007

  6. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: skim1@lsuhsc.edu [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  7. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  8. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee

    2012-01-01

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  9. Nucleic Acid Backbone Structure Variations: Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    Nielsen, Peter E.

    2010-01-01

    Synthetic analogues and mimics of the natural genetic material deoxyribonucleic acid (DNA) are potential gene therapeutic (antisense or antigene) drugs. One of these mimics, peptide nucleic acids (PNAs), are chemically closer to peptides and proteins than to DNA, but nonetheless have retained many...

  10. Histidine-Containing Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    2000-01-01

    Peptide nucleic acids containing histidine moieties are provided. These compounds have applications including diagnostics, research and potential therapeutics.......Peptide nucleic acids containing histidine moieties are provided. These compounds have applications including diagnostics, research and potential therapeutics....

  11. Molecular Structure of Nucleic Acids

    Indian Academy of Sciences (India)

    A structure for nucleic acid has already been proposed by Pauling and Corey [1]. They kindly made'their manuscript available to us in advance of publication. Their model consists of three inter-twined chains, with the phosphates near the fibre axis, and the bases on the outside. In our opinion, this structure is unsatisfactory ...

  12. Contributions of the Histidine Side Chain and the N-terminal α-Amino Group to the Binding Thermodynamics of Oligopeptides to Nucleic Acids as a Function of pH

    Science.gov (United States)

    Ballin, Jeff D.; Prevas, James P.; Ross, Christina R.; Toth, Eric A.; Wilson, Gerald M.; Record, M. Thomas

    2010-01-01

    Interactions of histidine with nucleic acid phosphates and histidine pKa shifts make important contributions to many protein-nucleic acid binding processes. To characterize these phenomena in simplified systems, we quantified binding of a histidine-containing model peptide HWKK (+NH3-His-Trp-Lys-Lys-NH2) and its lysine analog KWKK (+NH3-Lys-Trp-Lys-Lys-NH2) to a single-stranded RNA model, polyuridylate (polyU), by changes in tryptophan fluorescence as a function of salt concentration and pH. For both HWKK and KWKK, equilibrium binding constants, Kobs, and magnitudes of log-log salt derivatives SKobs ≡ (∂logKobs/∂log[Na+]), decreased with increasing pH in the manner expected for a titration curve model in which deprotonation of the histidine and α-amino groups weakens binding and reduces its salt-dependence. Fully protonated HWKK and KWKK exhibit the same Kobs and SKobs within uncertainty, and these SKobs values are consistent with limiting-law polyelectrolyte theory for +4 cationic oligopeptides binding to single-stranded nucleic acids. The pH-dependence of HWKK binding to polyU provides no evidence for pKa shifts nor any requirement for histidine protonation, in stark contrast to the thermodynamics of coupled protonation often seen for these cationic residues in the context of native protein structure where histidine protonation satisfies specific interactions (e.g., salt-bridge formation) within highly complementary binding interfaces. The absence of pKa shifts in our studies indicates that additional Coulombic interactions across the nonspecific-binding interface between RNA and protonated histidine or the α-amino group are not sufficient to promote proton uptake for these oligopeptides. We present our findings in the context of hydration models for specific versus nonspecific nucleic acid binding. PMID:20108951

  13. Screening of specific nucleic acid aptamers binding tumor markers in the serum of the lung cancer patients and identification of their activities.

    Science.gov (United States)

    Li, Kun; Xiu, Chen-Lin; Gao, Li-Ming; Liang, Hua-Gang; Xu, Shu-Feng; Shi, Ming; Li, Jian; Liu, Zhi-Wei

    2017-07-01

    Lung cancer is by far the leading cause of cancer death in the world. Despite the improvements in diagnostic methods, the status of early detection was not achieved. So, a new diagnostic method is needed. The aim of this study is to obtain the highly specific nucleic acid aptamers with strong affinity to tumor markers in the serum of the lung cancer patients for targeting the serum. Aptamers specifically binding to tumor markers in the serum of the lung cancer patients were screened from the random single-stranded DNA library with agarose beads as supports and the serum as a target by target-substituting subtractive SELEX technique and real-time quantitative polymerase chain reaction technique. Subsequently, the secondary single-stranded DNA library obtained by 10 rounds of screening was amplified to double-stranded DNA, followed by high-throughput genome sequence analysis to screen aptamers with specific affinity to tumor markers in the serum of the lung cancer patients. Finally, six aptamers obtained by 10 rounds of screening were identified with high specific affinity to tumor markers in the serum of the lung cancer patients. Compared with other five aptamers, the aptamer 43 was identified both with the highest specificity to bind target molecule and without any obvious affinity to non-specific proteins. The screened aptamers have relatively high specificity to combine tumor markers in the serum of the lung cancer patients, which provides breakthrough points for early diagnosis and treatment of lung cancer.

  14. Hybridization properties of long nucleic acid probes for detection of variable target sequences, and development of a hybridization prediction algorithm

    Science.gov (United States)

    Öhrmalm, Christina; Jobs, Magnus; Eriksson, Ronnie; Golbob, Sultan; Elfaitouri, Amal; Benachenhou, Farid; Strømme, Maria; Blomberg, Jonas

    2010-01-01

    One of the main problems in nucleic acid-based techniques for detection of infectious agents, such as influenza viruses, is that of nucleic acid sequence variation. DNA probes, 70-nt long, some including the nucleotide analog deoxyribose-Inosine (dInosine), were analyzed for hybridization tolerance to different amounts and distributions of mismatching bases, e.g. synonymous mutations, in target DNA. Microsphere-linked 70-mer probes were hybridized in 3M TMAC buffer to biotinylated single-stranded (ss) DNA for subsequent analysis in a Luminex® system. When mismatches interrupted contiguous matching stretches of 6 nt or longer, it had a strong impact on hybridization. Contiguous matching stretches are more important than the same number of matching nucleotides separated by mismatches into several regions. dInosine, but not 5-nitroindole, substitutions at mismatching positions stabilized hybridization remarkably well, comparable to N (4-fold) wobbles in the same positions. In contrast to shorter probes, 70-nt probes with judiciously placed dInosine substitutions and/or wobble positions were remarkably mismatch tolerant, with preserved specificity. An algorithm, NucZip, was constructed to model the nucleation and zipping phases of hybridization, integrating both local and distant binding contributions. It predicted hybridization more exactly than previous algorithms, and has the potential to guide the design of variation-tolerant yet specific probes. PMID:20864443

  15. In Situ Localization of Barley Yellow Dwarf Virus-PAV 17-kDa Protein and Nucleic Acids in Oats.

    Science.gov (United States)

    Nass, P H; Domier, L L; Jakstys, B P; D'Arcy, C J

    1998-10-01

    ABSTRACT Barley yellow dwarf virus strain PAV (BYDV-PAV) RNA and the 17-kDa protein were localized in BYDV-PAV-infected oat cells using in situ hybridization and in situ immunolocalization assays, respectively. The in situ hybridization assay showed labeling of filamentous material in the nucleus, cytoplasm, and virus-induced vesicles with both sense and antisense nucleic acid probes, suggesting that the filamentous material found in BYDV-PAV-infected cells contains viral RNA. BYDV-PAV negative-strand RNA was detected before virus particles were observed, which indicates that RNA replication is initiated before synthesis of viral coat protein in the cytoplasm. The 17-kDa protein was associated with filamentous material in the cytoplasm, nucleus, and virus-induced vesicles. The labeling densities observed using antibodies against the 17-kDa protein were similar in the nucleus and cytoplasm. No labeling of the 17-kDa protein was observed in plasmodesmata, but filaments in the nuclear pores occasionally were labeled. Since BYDV-PAV RNA and 17-kDa protein colocalized within infected cells, it is possible that single-stranded viral RNA is always associated with the 17-kDa protein in vivo. The 17-kDa protein may be required for viral nucleic acid filaments to traverse the nuclear membrane or other membrane systems.

  16. Evolution of Arabidopsis protection of telomeres 1 alters nucleic acid recognition and telomerase regulation.

    Science.gov (United States)

    Arora, Amit; Beilstein, Mark A; Shippen, Dorothy E

    2016-11-16

    Protection of telomeres (POT1) binds chromosome ends, recognizing single-strand telomeric DNA via two oligonucleotide/oligosaccharide binding folds (OB-folds). The Arabidopsis thaliana POT1a and POT1b paralogs are atypical: they do not exhibit telomeric DNA binding, and they have opposing roles in regulating telomerase activity. AtPOT1a stimulates repeat addition processivity of the canonical telomerase enzyme, while AtPOT1b interacts with a regulatory lncRNA that represses telomerase activity. Here, we show that OB1 of POT1a, but not POT1b, has an intrinsic affinity for telomeric DNA. DNA binding was dependent upon a highly conserved Phe residue (F65) that in human POT1 directly contacts telomeric DNA. F65A mutation of POT1a OB1 abolished DNA binding and diminished telomerase repeat addition processivity. Conversely, AtPOT1b and other POT1b homologs from Brassicaceae and its sister family, Cleomaceae, naturally bear a non-aromatic amino acid at this position. By swapping Val (V63) with Phe, AtPOT1b OB1 gained the capacity to bind telomeric DNA and to stimulate telomerase repeat addition processivity. We conclude that, in the context of DNA binding, variation at a single amino acid position promotes divergence of the AtPOT1b paralog from the ancestral POT1 protein. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Inducible Alkylation of DNA by a Quinone Methide-Peptide Nucleic Acid Conjugate†

    Science.gov (United States)

    Liu, Yang; Rokita, Steven E.

    2012-01-01

    The reversibility of alkylation by a quinone methide intermediate (QM) avoids the irreversible consumption that plagues most reagents based on covalent chemistry and allows for site specific reaction that is controlled by the thermodynamics rather than kinetics of target association. This characteristic was originally examined with an oligonucleotide QM conjugate but broad application depends on alternative derivatives that are compatible with a cellular environment. Now, a peptide nucleic acid (PNA) derivative has been constructed and shown to exhibit an equivalent ability to delivery the reactive QM in a controlled manner. This new conjugate demonstrates high selectivity for a complementary sequence of DNA even when challenged with an alternative sequence containing a single T/T mismatch. Alkylation of non-complementary sequences is only possible when a template strand is present to co-localize the conjugate and its target. For efficient alkylation in this example, a single-stranded region of the target is required adjacent to the QM conjugate. Most importantly, the intrastrand self adducts formed between the PNA and its attached QM remained active and reversible over more than eight days in aqueous solution prior to reaction with a chosen target added subsequently. PMID:22243337

  18. Peptide nucleic acid as a selective recognition element for electrochemical determination of Hg2.

    Science.gov (United States)

    Bala, Agnieszka; Górski, Łukasz

    2018-02-01

    A novel electrochemical PNA-based biosensor for the determination of Hg 2+ is described. The receptor layer, containing single strands of polythymine PNA (peptide nucleic acid), was formed at the surface of gold electrode. Due to the presence of thymine bases and peptide bonds, an interaction between Hg 2+ ion and receptor layer occurs. The influence of chain modification - PNA vs. DNA - and type of redox marker - anionic AQMS-Na (sodium salt of anthraquinone-2-sulfonic acid) and Fe II/III (potassium ferri/ferrocyanide) or cationic MB (methylene blue) and RuHex (hexaammineruthenium(III) chloride) - were studied. Proposed PNA-based biosensor with anionic AQMS-Na as a redox marker demonstrated significantly better analytical parameters, as compared to results obtained for other tested redox markers (for measurements at pH6.0). The linear response towards Hg 2+ was in the range from 5 to 500nmol·L -1 with the detection limit of 4.5nmol·L -1 . The developed sensor distinguishes itself with high selectivity towards Hg 2+ , even for solutions containing several interfering cations. Interactions between Hg 2+ and PNA receptor layer were studied using square wave voltammetry (SWV) and electrochemical impedance spectroscopy (EIS). Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Intrinsic nucleic acid dynamics modulates HIV-1 nucleocapsid protein binding to its targets.

    Directory of Open Access Journals (Sweden)

    Ali Bazzi

    Full Text Available HIV-1 nucleocapsid protein (NC is involved in the rearrangement of nucleic acids occurring in key steps of reverse transcription. The protein, through its two zinc fingers, interacts preferentially with unpaired guanines in single-stranded sequences. In mini-cTAR stem-loop, which corresponds to the top half of the cDNA copy of the transactivation response element of the HIV-1 genome, NC was found to exhibit a clear preference for the TGG sequence at the bottom of mini-cTAR stem. To further understand how this site was selected among several potential binding sites containing unpaired guanines, we probed the intrinsic dynamics of mini-cTAR using (13C relaxation measurements. Results of spin relaxation time measurements have been analyzed using the model-free formalism and completed by dispersion relaxation measurements. Our data indicate that the preferentially recognized guanine in the lower part of the stem is exempt of conformational exchange and highly mobile. In contrast, the unrecognized unpaired guanines of mini-cTAR are involved in conformational exchange, probably related to transient base-pairs. These findings support the notion that NC preferentially recognizes unpaired guanines exhibiting a high degree of mobility. The ability of NC to discriminate between close sequences through their dynamic properties contributes to understanding how NC recognizes specific sites within the HIV genome.

  20. Intrinsic Nucleic Acid Dynamics Modulates HIV-1 Nucleocapsid Protein Binding to Its Targets

    Science.gov (United States)

    Bazzi, Ali; Zargarian, Loussiné; Chaminade, Françoise; De Rocquigny, Hugues; René, Brigitte; Mély, Yves; Fossé, Philippe; Mauffret, Olivier

    2012-01-01

    HIV-1 nucleocapsid protein (NC) is involved in the rearrangement of nucleic acids occurring in key steps of reverse transcription. The protein, through its two zinc fingers, interacts preferentially with unpaired guanines in single-stranded sequences. In mini-cTAR stem-loop, which corresponds to the top half of the cDNA copy of the transactivation response element of the HIV-1 genome, NC was found to exhibit a clear preference for the TGG sequence at the bottom of mini-cTAR stem. To further understand how this site was selected among several potential binding sites containing unpaired guanines, we probed the intrinsic dynamics of mini-cTAR using 13C relaxation measurements. Results of spin relaxation time measurements have been analyzed using the model-free formalism and completed by dispersion relaxation measurements. Our data indicate that the preferentially recognized guanine in the lower part of the stem is exempt of conformational exchange and highly mobile. In contrast, the unrecognized unpaired guanines of mini-cTAR are involved in conformational exchange, probably related to transient base-pairs. These findings support the notion that NC preferentially recognizes unpaired guanines exhibiting a high degree of mobility. The ability of NC to discriminate between close sequences through their dynamic properties contributes to understanding how NC recognizes specific sites within the HIV genome. PMID:22745685

  1. Two-state model for helicase translocation and unwinding of nucleic acids

    Science.gov (United States)

    Garai, Ashok; Chowdhury, Debashish; Betterton, M. D.

    2008-06-01

    Helicases are molecular motors that unwind double-stranded nucleic acids (dsNA), such as DNA and RNA. Typically a helicase translocates along one of the NA single strands while unwinding and uses adenosine triphosphate (ATP) hydrolysis as an energy source. Here we model a helicase motor that can switch between two states, which could represent two different points in the ATP hydrolysis cycle. Our model is an extension of the earlier Betterton-Jülicher model of helicases to incorporate switching between two states. The main predictions of the model are the speed of unwinding of the dsNA and fluctuations around the average unwinding velocity. Motivated by a recent claim that the NS3 helicase of Hepatitis C virus follows a flashing-ratchet mechanism, we have compared the experimental results for the NS3 helicase with a special limit of our model which corresponds to the flashing-ratchet scenario. Our model accounts for one key feature of the experimental data on NS3 helicase. However, contradictory observations in experiments carried out under different conditions limit the ability to compare the model to experiments.

  2. Native nucleic acid electrophoresis as an efficient alternative for genotyping method of influenza virus.

    Science.gov (United States)

    Pajak, Beata; Lepek, Krzysztof

    2014-01-01

    Influenza viruses are the worldwide major causative agents of human and animal acute respiratory infections. Some of the influenza subtypes have caused epidemics and pandemics among humans. The varieties of methods are available for the rapid isolation and identification of influenza viruses in clinical and environmental samples. Since nucleic acids amplification techniques such as RT-PCR have been adapted, fast and sensitive influenza type and subtype determination is possible. However, in some ambiguous cases other, more detailed assay might be desired. The genetic material of influenza virus is highly unstable and constantly mutates. It is known that single nucleotide polymorphisms (SNPs) results in resistance to commercially available anti-viral drugs. The genetic drift of the virus could also result in weakening of immune response to infection. Finally, in a substantial number of patients co-infection with various virus strains or types has been confirmed. Although the detection of co-infection or presence of minor genetic variants within flu-infected patients is not a routine procedure, a rapid and wide spectrum diagnostics of influenza virus infections could reveal an accurate picture of the disease and more importantly, is crucial for choosing the appropriate therapeutics and virus monitoring. Herein we present the evidences that native gel electrophoresis and MSSCP--a method based on multitemperature single strand conformation polymorphism could furnish a useful technique for minor variants, which escape discovery by conventional diagnostic assays.

  3. Screen printing of nucleic acid detecting carbon electrodes.

    Science.gov (United States)

    Dequaire, Murielle; Heller, Adam

    2002-09-01

    A large fraction of the presently mass-manufactured (> 10(8) units/year) electrochemical biosensors, used mostly by diabetic people to monitor their blood glucose levels, have screen-printed carbon working electrodes. An earlier study (Campbell, C. N., et al. Anal. Chem. 2002, 74, 158-162) showed that nucleic acids can be assayed at 1 nM concentrations by a sandwich-type amperometric method. The assay was performed with vitreous carbon working electrodes on which an electron-conducting polycationic redox polymer and avidin were coelectrodeposited. Because the rate of the electrodeposition increases with the surface density of the polycationic redox polymer, its practicality depends on pretreatment of the surface, which adds anionic functions. (Gao, Z., et al. Angew. Chem. Int. Ed. 2002, 41, 810-813). Here it is shown that the required conducting redox polymer films can be electrodeposited on potentially mass manufacturable electrodes made by screen-printing hydrophilic carbon inks on polyester sheets. The modified electrodes are made in two steps. First a polycationic electron-conducting redox polymer is cross-linked and electrodeposited by applying a negative potential. Next, an amine-terminated 20-base single-stranded oligonucleotide is electrodeposited by ligand-exchange. Both steps involve exchange of a labile inner sphere chloride ligand of the polymer-bound osmium-complex: Cross-linking and electrodeposition of the redox polymer result when inner-sphere chloride anions of the osmium complexes are exchanged by imidazole functions of neighboring chains. Incorporation of the oligonucleotide in the redox polymer results in the formation of a coordinative bond between the terminal amine (attached through a spacer to the oligonucleotide) and the osmium complex. In testing for the presence of a 38-base oligonucleotide, the analyte, in a 15- or 25-microL droplet of hybridization solution, is hybridized with and captured by the 20-base electrode-bound sequence; then

  4. Understanding nucleic acid-ion interactions.

    Science.gov (United States)

    Lipfert, Jan; Doniach, Sebastian; Das, Rhiju; Herschlag, Daniel

    2014-01-01

    Ions surround nucleic acids in what is referred to as an ion atmosphere. As a result, the folding and dynamics of RNA and DNA and their complexes with proteins and with each other cannot be understood without a reasonably sophisticated appreciation of these ions' electrostatic interactions. However, the underlying behavior of the ion atmosphere follows physical rules that are distinct from the rules of site binding that biochemists are most familiar and comfortable with. The main goal of this review is to familiarize nucleic acid experimentalists with the physical concepts that underlie nucleic acid-ion interactions. Throughout, we provide practical strategies for interpreting and analyzing nucleic acid experiments that avoid pitfalls from oversimplified or incorrect models. We briefly review the status of theories that predict or simulate nucleic acid-ion interactions and experiments that test these theories. Finally, we describe opportunities for going beyond phenomenological fits to a next-generation, truly predictive understanding of nucleic acid-ion interactions.

  5. Uses of Nucleic Acid Analogues in the Inhibition of Nucleic Acid Amplification

    DEFF Research Database (Denmark)

    1999-01-01

    The present invention relates to the use of nucleic acid analogues in blocking nucleic acid ampli?cation procedures and to diagnostic and analytical techniques based thereon. Also included are kits for use in the conduct of nucleic acid ampli?cation reactions....

  6. Interfacial transduction of nucleic acid hybridization using immobilized quantum dots as donors in fluorescence resonance energy transfer.

    Science.gov (United States)

    Algar, W Russ; Krull, Ulrich J

    2009-01-06

    Fluorescence resonance energy transfer (FRET) using immobilized quantum dots (QDs) as energy donors was explored as a transduction method for the detection of nucleic acid hybridization at an interface. This research was motivated by the success of the QD-FRET-based transduction of nucleic acid hybridization in solution-phase assays. This new work represents a fundamental step toward the assembly of a biosensor, where immobilization of the selective chemistry on a surface is desired. After immobilizing QD-probe oligonucleotide conjugates on optical fibers, a demonstration of the retention of selectivity was achieved by the introduction of acceptor (Cy3)-labeled single-stranded target oligonucleotides. Hybridization generated the proximity required for FRET, and the resulting fluorescence spectra provided an analytical signal proportional to the amount of target. This research provides an important framework for the future development of nucleic acid biosensors based on QDs and FRET. The most important findings of this work are that (1) a QD-FRET solid-phase hybridization assay is viable and (2) a passivating layer of denatured bovine serum albumin alleviates nonspecific adsorption, ultimately resulting in (3) the potential for a reusable assay format and mismatch discrimination. In this, the first incarnation of a solid-phase QD-FRET hybridization assay, the limit of detection was found to be 5 nM, and the dynamic range was almost 2 orders of magnitude. Selective discrimination of the target was shown using a three-base-pairs mismatch from a fully complementary sequence. Despite a gradual loss of signal, reuse of the optical fibers over multiple cycles of hybridization and dehybridization was possible. Directions for further improvement of the analytical performance by optimizing the design of the QD-probe oligonucleotide interface are identified.

  7. DimaSense™: A Novel Nucleic Acid Detection System

    Energy Technology Data Exchange (ETDEWEB)

    Stadler, A.

    2011-05-18

    Recently, we developed a suite of methods for the rational design and fabrication of well-defined nanoparticle architectures, including clusters using bio-encoded nanoscale building blocks and layer-by-layer stepwise assembly on a solid support. In particular, the Nano-Assembly platform using Encoded Solid Supports (NAESS) allows for controlled interactions, purification of side products, modularity of design, and the construction of complex nanoparticle architectures. This approach offers several advantages over the current art of designing nanoparticle clusters, which include the high-yield synthesis of desired architectures, a 'plug-and-play' design allowing for the introduction of a variety of sensing modalities, and ease of scalability in high-throughput and synthesis yield. As a utility proof of concept, we implemented our unique cluster fabrication platform to design gold nanoparticle dimers which are linked via a single-stranded DNA oligonucleotide recognition motif. The design of this motif is such that binding of complementary nucleic acids results in specific, selective and rapid dimer dissociation, which can be monitored by dynamic light scattering (DLS). We demonstrated single level mismatch selectivity using this approach. The limit of detection was determined to be 1011 molecules of synthetic target RNA or DNA within 30 minutes of incubation at 33 C. This detection limit is determined by the dimer's concentration which can be probed by currently used standard DLS instruments. We also demonstrated a specific detection of target RNA in a solution containing competing 1,000-fold excess of non-complementary DNA fragments, 10% BSA, and endonucleases. Molecular diagnostic companies, RNA-based technology developers, and personalized medicine companies have applications that could benefit from using DimaSense{trademark}. The technology represents a platform which enables the simple and reasonably inexpensive design and fabrication of highly

  8. The Rev1 interacting region (RIR) motif in the scaffold protein XRCC1 mediates a low-affinity interaction with polynucleotide kinase/phosphatase (PNKP) during DNA single-strand break repair.

    Science.gov (United States)

    Breslin, Claire; Mani, Rajam S; Fanta, Mesfin; Hoch, Nicolas; Weinfeld, Michael; Caldecott, Keith W

    2017-09-29

    The scaffold protein X-ray repair cross-complementing 1 (XRCC1) interacts with multiple enzymes involved in DNA base excision repair and single-strand break repair (SSBR) and is important for genetic integrity and normal neurological function. One of the most important interactions of XRCC1 is that with polynucleotide kinase/phosphatase (PNKP), a dual-function DNA kinase/phosphatase that processes damaged DNA termini and that, if mutated, results in ataxia with oculomotor apraxia 4 (AOA4) and microcephaly with early-onset seizures and developmental delay (MCSZ). XRCC1 and PNKP interact via a high-affinity phosphorylation-dependent interaction site in XRCC1 and a forkhead-associated domain in PNKP. Here, we identified using biochemical and biophysical approaches a second PNKP interaction site in XRCC1 that binds PNKP with lower affinity and independently of XRCC1 phosphorylation. However, this interaction nevertheless stimulated PNKP activity and promoted SSBR and cell survival. The low-affinity interaction site required the highly conserved Rev1-interacting region (RIR) motif in XRCC1 and included three critical and evolutionarily invariant phenylalanine residues. We propose a bipartite interaction model in which the previously identified high-affinity interaction acts as a molecular tether, holding XRCC1 and PNKP together and thereby promoting the low-affinity interaction identified here, which then stimulates PNKP directly. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  10. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  11. OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

    Directory of Open Access Journals (Sweden)

    Kevin M. Bradley

    2014-08-01

    Full Text Available Synthetic biologists wishing to self-assemble large DNA (L-DNA constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson–Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS, and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting" software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

  12. The interaction of hyperthermophilic TATA-box binding protein with single-stranded DNA is entropically favorable and exhibits a large negative heat capacity change at high salt concentration.

    Science.gov (United States)

    Nagatoishi, Satoru; Tanaka, Yoshikazu; Kudou, Motonori; Tsumoto, Kouhei

    2009-09-01

    We have investigated the thermodynamics of the interaction between the TATA-box-binding protein from Pyrococcus horikoshii (PhoTBP) and its target DNA (TATA-1). The interaction between PhoTBP and double-stranded DNA (dsDNA) is entropically favorable and enthalpically unfavorable. The thermodynamic parameters for TATA-1 duplex formation in the presence of PhoTBP, that is, ternary PhoTBP-dsDNA complexation, are similar to those for TATA-1 duplex formation, which is enthalpically favorable. Surface plasmon resonance analysis indicates that the interaction between PhoTBP and single-stranded DNA (ssDNA) of TATA-1 is entropy driven and has a large negative heat capacity change (-1.19 kcal mol(-1) K(-1)) at high salt concentration (800 mM NaCl). These results suggest that the favorable entropic effect corresponding to the interaction between PhoTBP and dsDNA is due not to ternary complexation but to the interaction between PhoTBP and ssDNA. This report is the first to describe the thermodynamics of the interaction between TBP and ssDNA.

  13. Nucleic acid drugs: a novel approach

    African Journals Online (AJOL)

    Administrator

    These nucleic acids act as drugs by different mechanisms, they may bind with the synthesized proteins, and they can hybridize to a messenger RNA leading to translation arrest or may induce degradation to target RNA. In this way the nucleic acids act as drug for inhibiting gene expression or protein synthesis. This article ...

  14. Double-Stranded Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    2001-01-01

    A novel class of compounds, known as peptide nucleic acids, form double-stranded structures with one another and with ssDNA. The peptide nucleic acids generally comprise ligands such as naturally occurring DNA bases attached to a peptide backbone through a suitable linker....

  15. Synthetic Procedures for Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    2004-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary ssDNA and RNA strands more strongly than a corresponding DNA. The peptide nucleic acids generally comprise ligands such as naturally occurring DNA bases attached to a peptide backbone through a suitable linker....

  16. Interaction of humic acids and humic-acid-like polymers with herpes simplex virus type 1

    Science.gov (United States)

    Klöcking, Renate; Helbig, Björn

    The study was performed in order to compare the antiviral activity against herpes simplex virus type 1 (HSV-1) of synthetic humic-acid-like polymers to that of their low-molecular-weight basic compounds and naturally occurring humic acids (HA) in vitro. HA from peat water showed a moderate antiviral activity at a minimum effective concentration (MEC) of 20 µg/ml. HA-like polymers, i.e. the oxidation products of caffeic acid (KOP), hydrocaffeic acid (HYKOP), chlorogenic acid (CHOP), 3,4-dihydroxyphenylacetic acid (3,4-DHPOP), nordihydroguaretic acid (NOROP), gentisinic acid (GENOP), pyrogallol (PYROP) and gallic acid (GALOP), generally inhibit virus multiplication, although with different potency and selectivity. Of the substances tested, GENOP, KOP, 3,4-DHPOP and HYKOP with MEC values in the range of 2 to 10 µg/ml, proved to be the most potent HSV-1 inhibitors. Despite its lower antiviral potency (MEC 40 µg/ml), CHOP has a remarkable selectivity due to the high concentration of this polymer that is tolerated by the host cells (>640 µg/ml). As a rule, the antiviral activity of the synthetic compounds was restricted to the polymers and was not preformed in the low-molecular-weight basic compounds. This finding speaks in favour of the formation of antivirally active structures during the oxidative polymerization of phenolic compounds and, indirectly, of corresponding structural parts in different HA-type substances.

  17. Chip-based sequencing nucleic acids

    Science.gov (United States)

    Beer, Neil Reginald

    2014-08-26

    A system for fast DNA sequencing by amplification of genetic material within microreactors, denaturing, demulsifying, and then sequencing the material, while retaining it in a PCR/sequencing zone by a magnetic field. One embodiment includes sequencing nucleic acids on a microchip that includes a microchannel flow channel in the microchip. The nucleic acids are isolated and hybridized to magnetic nanoparticles or to magnetic polystyrene-coated beads. Microreactor droplets are formed in the microchannel flow channel. The microreactor droplets containing the nucleic acids and the magnetic nanoparticles are retained in a magnetic trap in the microchannel flow channel and sequenced.

  18. Nucleic acid diagnostic approaches in parasitology.

    Science.gov (United States)

    Kerttula, Anne-Marie; Lavikainen, Antti

    Nucleic acid diagnostic technologies are partly replacing traditional microscopy and antigen detection methods in parasitological diagnostics. In particular, the diagnostics of parasitic diarrhea is undergoing a transformation due to the application of polymerase chain reaction (PCR) tests. Diagnostics of malaria is still based on microscopy, but rapid nucleic acid tests are emerging. Laboratories of clinical microbiology in Finland currently provide PCR tests e.g. for intestinal protozoa, Toxoplasma and Trichomonas. Nucleic acid diagnostic methods are superior in specificity and sensitivity, but may give false positive results after a treated infection.

  19. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

    2003-01-01

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  20. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  1. A G-C-rich palindromic structural motif and a stretch of single-stranded purines are required for optimal packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA.

    Science.gov (United States)

    Jaballah, Soumeya Ali; Aktar, Suriya J; Ali, Jahabar; Phillip, Pretty Susan; Al Dhaheri, Noura Salem; Jabeen, Aayesha; Rizvi, Tahir A

    2010-09-03

    During retroviral RNA packaging, two copies of genomic RNA are preferentially packaged into the budding virus particles whereas the spliced viral RNAs and the cellular RNAs are excluded during this process. Specificity towards retroviral RNA packaging is dependent upon sequences at the 5' end of the viral genome, which at times extend into Gag sequences. It has earlier been suggested that the Mason-Pfizer monkey virus (MPMV) contains packaging sequences within the 5' untranslated region (UTR) and Gag. These studies have also suggested that the packaging determinants of MPMV that lie in the UTR are bipartite and are divided into two regions both upstream and downstream of the major splice donor. However, the precise boundaries of these discontinuous regions within the UTR and the role of the intervening sequences between these dipartite sequences towards MPMV packaging have not been investigated. Employing a combination of genetic and structural prediction analyses, we have shown that region "A", immediately downstream of the primer binding site, is composed of 50 nt, whereas region "B" is composed of the last 23 nt of UTR, and the intervening 55 nt between these two discontinuous regions do not contribute towards MPMV RNA packaging. In addition, we have identified a 14-nt G-C-rich palindromic sequence (with 100% autocomplementarity) within region A that has been predicted to fold into a structural motif and is essential for optimal MPMV RNA packaging. Furthermore, we have also identified a stretch of single-stranded purines (ssPurines) within the UTR and 8 nt of these ssPurines are duplicated in region B. The native ssPurines or its repeat in region B when predicted to refold as ssPurines has been shown to be essential for RNA packaging, possibly functioning as a potential nucleocapsid binding site. Findings from this study should enhance our understanding of the steps involved in MPMV replication including RNA encapsidation process. Copyright (c) 2010 Elsevier Ltd

  2. A single-stranded conformational polymorphism (SSCP)-derived quantitative variable to monitor the virulence of a Barley yellow dwarf virus-PAV (BYDV-PAV) isolate during adaptation to the TC14 resistant wheat line.

    Science.gov (United States)

    Delaunay, Agnes; Lacroix, Christelle; Morliere, Stephanie; Riault, Gerard; Chain, Florian; Trottet, Maxime; Jacquot, Emmanuel

    2010-09-01

    A standardized single-stranded conformational polymorphism (SSCP) procedure is proposed as an alternative to the time-consuming biological characterization of Barley yellow dwarf virus-PAV (BYDV-PAV) isolates. Using this procedure, six of 21 overlapping regions used to scan the viral genome gave patterns specific to '4E' (avirulent) or '4T' ('4E'-derived virulent) isolates. The calibration of samples and integration of SSCP patterns corresponding to the nucleotide region 1482-2023 allowed the estimation of P(T) values that reflect the proportions of a '4T'-specific band. Analysis of the biological (area under the pathogen progress curve) and molecular (P(T)) data suggested a positive linear relation between these variables. Moreover, sequence analysis of the nucleotide region 1482-2023 highlighted the presence of a nucleotide polymorphism (C/A(1835)) which can be considered as a candidate for virus-host interactions linked to the monitored virulence. According to these parameters, P(T) values associated with '4E'- and '4T'-derived populations show that: (i) long-term infection of a BYDV-PAV isolate on the 'TC14' resistant host leads to the fixation of virulent individuals in viral populations; and (ii) the introduction of susceptible hosts in successive 'TC14' infections results in the maintenance of low virulence of the populations. Thus, the presented study demonstrates that SSCP is a useful tool for monitoring viral populations during the host adaptation process. The described impact of host alternation provides new opportunities for the use of the 'TC14' resistance source in BYDV-resistant breeding programmes. This study is part of the global effort made by the scientific community to propose sustainable alternatives to the chemical control of this viral disease.

  3. Macromolecular mimicry of nucleic acid and protein

    DEFF Research Database (Denmark)

    Nautrup Pedersen, Gitte; Nyborg, Jens; Clark, Brian F

    1999-01-01

    Although proteins and nucleic acids consist of different chemical components, proteins can mimic structures and possibly also functions of nucleic acids. Recently, structural mimicry was observed between two elongation factors in bacterial protein biosynthesis leading to the introduction of the c......Although proteins and nucleic acids consist of different chemical components, proteins can mimic structures and possibly also functions of nucleic acids. Recently, structural mimicry was observed between two elongation factors in bacterial protein biosynthesis leading to the introduction...... of the concept of macromolecular mimicry. Macromolecular mimicry has further been proposed among initiation and release factors, thereby adding a new element to the description of protein synthesis in bacteria. Such mimicry has also been observed in other biological processes such as autoimmunity, DNA repair...

  4. Replica amplification of nucleic acid arrays

    Science.gov (United States)

    Church, George M.; Mitra, Robi D.

    2010-08-31

    Disclosed are improved methods of making and using immobilized arrays of nucleic acids, particularly methods for producing replicas of such arrays. Included are methods for producing high density arrays of nucleic acids and replicas of such arrays, as well as methods for preserving the resolution of arrays through rounds of replication. Also included are methods which take advantage of the availability of replicas of arrays for increased sensitivity in detection of sequences on arrays. Improved methods of sequencing nucleic acids immobilized on arrays utilizing single copies of arrays and methods taking further advantage of the availability of replicas of arrays are disclosed. The improvements lead to higher fidelity and longer read lengths of sequences immobilized on arrays. Methods are also disclosed which improve the efficiency of multiplex PCR using arrays of immobilized nucleic acids.

  5. Amplification of trace amounts of nucleic acids

    Science.gov (United States)

    Church, George M [Brookline, MA; Zhang, Kun [Brighton, MA

    2008-06-17

    Methods of reducing background during amplification of small amounts of nucleic acids employ careful analysis of sources of low level contamination. Ultraviolet light can be used to reduce nucleic acid contaminants in reagents and equipment. "Primer-dimer" background can be reduced by judicious design of primers. We have shown clean signal-to-noise with as little as starting material as one single human cell (.about.6 picogram), E. coli cell (.about.5 femtogram) or Prochlorococcus cell (.about.3 femtogram).

  6. Stability and Mismatch Discrimination of Locked Nucleic Acid–DNA Duplexes

    Science.gov (United States)

    2011-01-01

    Locked nucleic acids (LNA; symbols of bases, +A, +C, +G, and +T) are introduced into chemically synthesized oligonucleotides to increase duplex stability and specificity. To understand these effects, we have determined thermodynamic parameters of consecutive LNA nucleotides. We present guidelines for the design of LNA oligonucleotides and introduce free online software that predicts the stability of any LNA duplex oligomer. Thermodynamic analysis shows that the single strand–duplex transition is characterized by a favorable enthalpic change and by an unfavorable loss of entropy. A single LNA modification confines the local conformation of nucleotides, causing a smaller, less unfavorable entropic loss when the single strand is restricted to the rigid duplex structure. Additional LNAs adjacent to the initial modification appear to enhance stacking and H-bonding interactions because they increase the enthalpic contributions to duplex stabilization. New nearest-neighbor parameters correctly forecast the positive and negative effects of LNAs on mismatch discrimination. Specificity is enhanced in a majority of sequences and is dependent on mismatch type and adjacent base pairs; the largest discriminatory boost occurs for the central +C·C mismatch within the +T+C+C sequence and the +A·G mismatch within the +T+A+G sequence. LNAs do not affect specificity in some sequences and even impair it for many +G·T and +C·A mismatches. The level of mismatch discrimination decreases the most for the central +G·T mismatch within the +G+G+C sequence and the +C·A mismatch within the +G+C+G sequence. We hypothesize that these discrimination changes are not unique features of LNAs but originate from the shift of the duplex conformation from B-form to A-form. PMID:21928795

  7. Intrinsically Labeled Fluorescent Oligonucleotide Probes on Quantum Dots for Transduction of Nucleic Acid Hybridization.

    Science.gov (United States)

    Shahmuradyan, Anna; Krull, Ulrich J

    2016-03-15

    Quantum dots (QDs) have been widely used in chemical and biosensing due to their unique photoelectrical properties and are well suited as donors in fluorescence resonance energy transfer (FRET). Selective hybridization interactions of oligonucleotides on QDs have been determined by FRET. Typically, the QD-FRET constructs have made use of labeled targets or have implemented labeled sandwich format assays to introduce dyes in proximity to the QDs for the FRET process. The intention of this new work is to explore a method to incorporate the acceptor dye into the probe molecule. Thiazole orange (TO) derivatives are fluorescent intercalating dyes that have been used for detection of double-stranded nucleic acids. One such dye system has been reported in which single-stranded oligonucleotide probes were doubly labeled with adjacent thiazole orange derivatives. In the absence of the fully complementary (FC) oligonucleotide target, the dyes form an H-aggregate, which results in quenching of fluorescence emission due to excitonic interactions between the dyes. The hybridization of the FC target to the probe provides for dissociation of the aggregate as the dyes intercalate into the double stranded duplex, resulting in increased fluorescence. This work reports investigation of the dependence of the ratiometric signal on the type of linkage used to conjugate the dyes to the probe, the location of the dye along the length of the probe, and the distance between adjacent dye molecules. The limit of detection for 34mer and 90mer targets was found to be identical and was 10 nM (2 pmol), similar to analogous QD-FRET using labeled oligonucleotide target. The detection system could discriminate a one base pair mismatch (1BPM) target and was functional without substantial compromise of the signal in 75% serum. The 1BPM was found to reduce background signal, indicating that the structure of the mismatch affected the environment of the intercalating dyes.

  8. Mutagenesis of the Agrobacterium VirE2 single-stranded DNA-binding protein identifies regions required for self-association and interaction with VirE1 and a permissive site for hybrid protein construction.

    Science.gov (United States)

    Zhou, X R; Christie, P J

    1999-07-01

    The VirE2 single-stranded DNA-binding protein (SSB) of Agrobacterium tumefaciens is required for delivery of T-DNA to the nuclei of susceptible plant cells. By yeast two-hybrid and immunoprecipitation analyses, VirE2 was shown to self-associate and to interact with VirE1. VirE2 mutants with small deletions or insertions of a 31-residue oligopeptide (i31) at the N or C terminus or with an i31 peptide insertion at Leu236 retained the capacity to form homomultimers. By contrast, VirE2 mutants with modifications outside a central region located between residues 320 and 390 retained the capacity to interact with VirE1. These findings suggest the tertiary structure of VirE2 is important for homomultimer formation whereas a central domain mediates formation of a complex with VirE1. The capacity of VirE2 mutants to interact with full-length VirE2 in the yeast Saccharomyces cerevisiae correlated with the abundance of the mutant proteins in A. tumefaciens, suggesting that VirE2 is stabilized by homomultimerization in the bacterium. We further characterized the promoter and N- and C-terminal sequence requirements for synthesis of functional VirE2. A PvirB::virE2 construct yielded functional VirE2 protein as defined by complementation of a virE2 null mutation. By contrast, PvirE or Plac promoter constructs yielded functional VirE2 only if virE1 was coexpressed with virE2. Deletion of 10 or 9 residues from the N or C terminus of VirE2, respectively, or addition of heterologous peptides or proteins to either terminus resulted in a loss of protein function. However, an i31 peptide insertion at Tyr39 had no effect on protein function as defined by the capacity of the mutant protein to (i) interact with native VirE2, (ii) interact with VirE1, (iii) accumulate at abundant levels in A. tumefaciens, and (iv) restore wild-type virulence to a virE2 null mutant. We propose that Tyr39 of VirE2 corresponds to a permissive site for insertion of heterologous peptides or proteins of interest

  9. Binding affinity and in vitro cytotoxicity of harmaline targeting different motifs of nucleic acids: An ultimate drug designing approach.

    Science.gov (United States)

    Bhattacharjee, Paromita; Ghosh, Tapas; Sarkar, Sarita; Pandya, Prateek; Bhadra, Kakali

    2017-12-15

    The work focuses towards interaction of harmaline, with nucleic acids of different motifs by multispectroscopic and calorimetric techniques. Findings of this study suggest that binding constant varied in the order single-stranded (ss) poly(A) > double-stranded calf thymus (CT) DNA > double-stranded poly(G)·poly(C) > clover leaf tRNA Phe . Prominent structural changes of ss poly(A), CT DNA, and poly(G)· poly(C) with concomitant induction of optical activity in the bound achiral alkaloid molecule was observed, while with tRNA Phe , very weak induced circular dichroism perturbation was seen. The interaction was predominantly exothermic, enthalpy driven, and entropy favored with CT DNA and poly(G)·poly(C), while it was entropy driven with poly(A) and tRNA Phe . Intercalated state of harmaline inside poly(A), CT DNA, and poly(G)·poly(C) was shown by viscometry, ferrocyanide quenching, and molecular docking. All these findings unequivocally pointed out preference of harmaline towards ss poly(A) inducing self-structure formation. Furthermore, harmaline administration caused a significant decrease in proliferation of HeLa and HepG 2 cells with GI 50 of 28μM and 11.2μM, respectively. Nucleic acid fragmentation, cellular ultramorphological changes, decreased mitochondrial membrane potential, upregulation of p53 and caspase 3, generation of reactive oxygen species, and a significant increase in the G 2 /M population made HepG 2 more prone to apoptosis than are HeLa cells. Copyright © 2017 John Wiley & Sons, Ltd.

  10. Novel Biochip Platform for Nucleic Acid Analysis

    Directory of Open Access Journals (Sweden)

    Juan J. Diaz-Mochon

    2012-06-01

    Full Text Available This manuscript describes the use of a novel biochip platform for the rapid analysis/identification of nucleic acids, including DNA and microRNAs, with very high specificity. This approach combines a unique dynamic chemistry approach for nucleic acid testing and analysis developed by DestiNA Genomics with the STMicroelectronics In-Check platform, which comprises two microfluidic optimized and independent PCR reaction chambers, and a sequential microarray area for nucleic acid capture and identification by fluorescence. With its compact bench-top “footprint” requiring only a single technician to operate, the biochip system promises to transform and expand routine clinical diagnostic testing and screening for genetic diseases, cancers, drug toxicology and heart disease, as well as employment in the emerging companion diagnostics market.

  11. Thermodynamic Analysis of Nylon Nucleic Acids

    Science.gov (United States)

    Liu, Yu; Wang, Risheng; Ding, Liang; Sha, Ruojie; Lukeman, Philip S.

    2010-01-01

    The stability and structure of nylon nucleic acid duplexes with complementary DNA and RNA strands was examined. Thermal denaturing studies of a series of oligonucleotides containing nylon nucleic acids (1 to 5 amide linkages) revealed that the amide linkage enhanced significantly the binding affinity of nylon nucleic acids towards both complementary DNA (up to 26°C increase in the thermal transition temperature (Tm) for 5 linkages) and RNA (around 15°C increase in Tm for 5 linkages) when compared with non-amide linked precursor strands. For both DNA and RNA complements, increasing derivatization decreased the melting temperatures of uncoupled molecules relative to unmodified strands; by contrast, increasing lengths of coupled copolymer raised Tm from less to slightly greater than Tm of unmodified strands. Thermodynamic data extracted from melting curves and CD spectra of nylon nucleic acid duplexes were consistent with loss of stability due to incorporation of pendent groups on the 2′ position of ribose, and recovery of stability upon linkage of the side chains. PMID:18543259

  12. Nucleic acid secondary structure prediction and display.

    OpenAIRE

    Stüber, K

    1986-01-01

    A set of programs has been developed for the prediction and display of nucleic acid secondary structures. Information from experimental data can be used to restrict or enforce secondary structural elements. The predictions can be displayed either on normal line printers or on graphic devices like plotters or graphic terminals.

  13. Multifunctional Nucleic Acids for Tumor Cell Treatment

    DEFF Research Database (Denmark)

    Pofahl, Monika; Wengel, Jesper; Mayer, Günter

    2014-01-01

    -proliferative and antimiR function in one 37-nucleotide nucleic acid molecule. It inhibits cancer cell growth and induces gene expression that is pathologically damped by an oncomir. These findings will have a strong impact on future developments regarding aptamer- and antimiR-related applications for tumor targeting...

  14. Recent progress in nucleic acids isotachophoresis

    Czech Academy of Sciences Publication Activity Database

    Datinská, Vladimíra; Voráčová, Ivona; Schlecht, U.; Berka, J.; Foret, František

    2018-01-01

    Roč. 41, č. 1 (2018), s. 236-247 ISSN 1615-9306 R&D Projects: GA ČR(CZ) GBP206/12/G014 Institutional support: RVO:68081715 Keywords : isotachophoresis * nucleic acid s * sample preparation Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 2.557, year: 2016

  15. Chemical consequences of irradiating nucleic acids

    International Nuclear Information System (INIS)

    Ward, J.F.

    1976-01-01

    On the basis of literature data, a discussion is presented of the DNA damage which would be produced in a cellular environment and an attempt is made to place this damage in perspective as a potential hazard in food irradiation. The topics discussed are radiation damage mechanisms, OH reactions with DNA, base products, sugar products, and evaluation of damage from irradiated nucleic acids

  16. Recent progress in nucleic acids isotachophoresis

    Czech Academy of Sciences Publication Activity Database

    Datinská, Vladimíra; Voráčová, Ivona; Schlecht, U.; Berka, J.; Foret, František

    2018-01-01

    Roč. 41, č. 1 (2018), s. 236-247 ISSN 1615-9306 R&D Projects: GA ČR(CZ) GBP206/12/G014 Institutional support: RVO:68081715 Keywords : isotachophoresis * nucleic acids * sample preparation Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 2.557, year: 2016

  17. A locked nucleic Acid-based nanocrawler

    DEFF Research Database (Denmark)

    Astakhova, I Kira; Pasternak, Karol; Campbell, Meghan A

    2013-01-01

    Herein we introduce a novel fluorescent LNA/DNA machine, a nanocrawler, which reversibly moves along a directionally polar complementary road controlled by affinity-enhancing locked nucleic acid (LNA) monomers and additional regulatory strands. Polyaromatic hydrocarbon (PAH) dyes attached to 2...

  18. Detection of nucleic acids by multiple sequential invasive cleavages

    Energy Technology Data Exchange (ETDEWEB)

    Hall, Jeff G; Lyamichev, Victor I; Mast, Andrea L; Brow, Mary Ann D

    2012-10-16

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based on charge. The present invention also provides methods for the detection of non-target cleavage products via the formation of a complete and activated protein binding region. The invention further provides sensitive and specific methods for the detection of human cytomegalovirus nucleic acid in a sample.

  19. Nucleic acid protocols: Extraction and optimization

    Directory of Open Access Journals (Sweden)

    Saeed El-Ashram

    2016-12-01

    Full Text Available Yield and quality are fundamental features for any researchers during nucleic acid extraction. Here, we describe a simplified, semi-unified, effective, and toxic material free protocol for extracting DNA and RNA from different prokaryotic and eukaryotic sources exploiting the physical and chemical properties of nucleic acids. Furthermore, this protocol showed that DNA and RNA are under triple protection (i.e. EDTA, SDS and NaCl during lysis step, and this environment is improper for RNase to have DNA liberated of RNA and even for DNase to degrade the DNA. Therefore, the complete removal of RNA under RNase influence is achieved when RNase is added after DNA extraction, which gives optimal quality with any protocols. Similarly, DNA contamination in an isolated RNA is degraded by DNase to obtain high-quality RNA. Our protocol is the protocol of choice in terms of simplicity, recovery time, environmental safety, amount, purity, PCR and RT-PCR applicability.

  20. Rapid hybridization of nucleic acids using isotachophoresis

    Science.gov (United States)

    Bercovici, Moran; Han, Crystal M.; Liao, Joseph C.; Santiago, Juan G.

    2012-01-01

    We use isotachophoresis (ITP) to control and increase the rate of nucleic acid hybridization reactions in free solution. We present a new physical model, validation experiments, and demonstrations of this assay. We studied the coupled physicochemical processes of preconcentration, mixing, and chemical reaction kinetics under ITP. Our experimentally validated model enables a closed form solution for ITP-aided reaction kinetics, and reveals a new characteristic time scale which correctly predicts order 10,000-fold speed-up of chemical reaction rate for order 100 pM reactants, and greater enhancement at lower concentrations. At 500 pM concentration, we measured a reaction time which is 14,000-fold lower than that predicted for standard second-order hybridization. The model and method are generally applicable to acceleration of reactions involving nucleic acids, and may be applicable to a wide range of reactions involving ionic reactants. PMID:22733732

  1. Digital Microfluidics for Nucleic Acid Amplification

    Directory of Open Access Journals (Sweden)

    Beatriz Coelho

    2017-06-01

    Full Text Available Digital Microfluidics (DMF has emerged as a disruptive methodology for the control and manipulation of low volume droplets. In DMF, each droplet acts as a single reactor, which allows for extensive multiparallelization of biological and chemical reactions at a much smaller scale. DMF devices open entirely new and promising pathways for multiplex analysis and reaction occurring in a miniaturized format, thus allowing for healthcare decentralization from major laboratories to point-of-care with accurate, robust and inexpensive molecular diagnostics. Here, we shall focus on DMF platforms specifically designed for nucleic acid amplification, which is key for molecular diagnostics of several diseases and conditions, from pathogen identification to cancer mutations detection. Particular attention will be given to the device architecture, materials and nucleic acid amplification applications in validated settings.

  2. Digital Microfluidics for Nucleic Acid Amplification.

    Science.gov (United States)

    Coelho, Beatriz; Veigas, Bruno; Fortunato, Elvira; Martins, Rodrigo; Águas, Hugo; Igreja, Rui; Baptista, Pedro V

    2017-06-25

    Digital Microfluidics (DMF) has emerged as a disruptive methodology for the control and manipulation of low volume droplets. In DMF, each droplet acts as a single reactor, which allows for extensive multiparallelization of biological and chemical reactions at a much smaller scale. DMF devices open entirely new and promising pathways for multiplex analysis and reaction occurring in a miniaturized format, thus allowing for healthcare decentralization from major laboratories to point-of-care with accurate, robust and inexpensive molecular diagnostics. Here, we shall focus on DMF platforms specifically designed for nucleic acid amplification, which is key for molecular diagnostics of several diseases and conditions, from pathogen identification to cancer mutations detection. Particular attention will be given to the device architecture, materials and nucleic acid amplification applications in validated settings.

  3. Nucleic Acid Templated Reactions for Chemical Biology.

    Science.gov (United States)

    Di Pisa, Margherita; Seitz, Oliver

    2017-06-21

    Nucleic acid directed bioorthogonal reactions offer the fascinating opportunity to unveil and redirect a plethora of intracellular mechanisms. Nano- to picomolar amounts of specific RNA molecules serve as templates and catalyze the selective formation of molecules that 1) exert biological effects, or 2) provide measurable signals for RNA detection. Turnover of reactants on the template is a valuable asset when concentrations of RNA templates are low. The idea is to use RNA-templated reactions to fully control the biodistribution of drugs and to push the detection limits of DNA or RNA analytes to extraordinary sensitivities. Herein we review recent and instructive examples of conditional synthesis or release of compounds for in cellulo protein interference and intracellular nucleic acid imaging. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  4. Nucleic acid compositions and the encoding proteins

    Science.gov (United States)

    Preston, III, James F.; Chow, Virginia; Nong, Guang; Rice, John D.; St. John, Franz J.

    2014-09-02

    The subject invention provides at least one nucleic acid sequence encoding an aldouronate-utilization regulon isolated from Paenibacillus sp. strain JDR-2, a bacterium which efficiently utilizes xylan and metabolizes aldouronates (methylglucuronoxylosaccharides). The subject invention also provides a means for providing a coordinately regulated process in which xylan depolymerization and product assimilation are coupled in Paenibacillus sp. strain JDR-2 to provide a favorable system for the conversion of lignocellulosic biomass to biobased products. Additionally, the nucleic acid sequences encoding the aldouronate-utilization regulon can be used to transform other bacteria to form organisms capable of producing a desired product (e.g., ethanol, 1-butanol, acetoin, 2,3-butanediol, 1,3-propanediol, succinate, lactate, acetate, malate or alanine) from lignocellulosic biomass.

  5. Bioreversible Derivatives of Phenol. 2. Reactivity of Carbonate Esters with Fatty Acid-like Structures Towards Hydrolysis in Aqueous Solutions

    Directory of Open Access Journals (Sweden)

    Claus Larsen

    2007-10-01

    Full Text Available A series of model phenol carbonate ester prodrugs encompassing derivatives with fatty acid-like structures were synthesized and their stability as a function of pH (range 0.4 – 12.5 at 37°C in aqueous buffer solutions investigated. The hydrolysis rates in aqueous solutions differed widely, depending on the selected pro-moieties (alkyl and aryl substituents. The observed reactivity differences could be rationalized by the inductive and steric properties of the substituent groups when taking into account that the mechanism of hydrolysis may change when the type of pro-moiety is altered, e.g. n-alkyl vs. t-butyl. Hydrolysis of the phenolic carbonate ester 2-(phenoxycarbonyloxy-acetic acid was increased due to intramolecular catalysis, as compared to the derivatives synthesized from ω-hydroxy carboxylic acids with longer alkyl chains. The carbonate esters appear to be less reactive towards specific acid and base catalyzed hydrolysis than phenyl acetate. The results underline that it is unrealistic to expect that phenolic carbonate ester prodrugs can be utilized in ready to use aqueous formulations. The stability of the carbonate ester derivatives with fatty acid-like structures, expected to interact with the plasma protein human serum albumin, proved sufficient for further in vitro and in vivo evaluation of the potential of utilizing HSA binding in combination with the prodrug approach for optimization of drug pharmacokinetics.

  6. Interactions of nucleic acids at charged interfaces

    Czech Academy of Sciences Publication Activity Database

    Vetterl, Vladimír; Jelen, František; Hasoň, Stanislav

    2003-01-01

    Roč. 32, č. 3 (2003), s. 228 ISSN 0175-7571. [European Biophysics Congress /4./. 05.07.2003-09.07.2003, Alicante] R&D Projects: GA AV ČR IAA5004901; GA AV ČR IBS5004107 Institutional research plan: CEZ:AV0Z5004920 Keywords : single - and double- stranded DNA * nucleic acid * mercury film electrodes Subject RIV: BO - Biophysics

  7. Construction of tunable peptide nucleic acid junctions.

    Science.gov (United States)

    Duan, Tanghui; He, Liu; Tokura, Yu; Liu, Xin; Wu, Yuzhou; Shi, Zhengshuang

    2018-03-15

    We report here the construction of 3-way and 4-way peptide nucleic acid (PNA) junctions as basic structural units for PNA nanostructuring. The incorporation of amino acid residues into PNA chains makes PNA nanostructures with more structural complexity and architectural flexibility possible, as exemplified by building 3-way PNA junctions with tunable nanopores. Given that PNA nanostructures have good thermal and enzymatic stabilities, they are expected to have broad potential applications in biosensing, drug delivery and bioengineering.

  8. Optimizing the specificity of nucleic acid hybridization.

    Science.gov (United States)

    Zhang, David Yu; Chen, Sherry Xi; Yin, Peng

    2012-01-22

    The specific hybridization of complementary sequences is an essential property of nucleic acids, enabling diverse biological and biotechnological reactions and functions. However, the specificity of nucleic acid hybridization is compromised for long strands, except near the melting temperature. Here, we analytically derived the thermodynamic properties of a hybridization probe that would enable near-optimal single-base discrimination and perform robustly across diverse temperature, salt and concentration conditions. We rationally designed 'toehold exchange' probes that approximate these properties, and comprehensively tested them against five different DNA targets and 55 spurious analogues with energetically representative single-base changes (replacements, deletions and insertions). These probes produced discrimination factors between 3 and 100+ (median, 26). Without retuning, our probes function robustly from 10 °C to 37 °C, from 1 mM Mg(2+) to 47 mM Mg(2+), and with nucleic acid concentrations from 1 nM to 5 µM. Experiments with RNA also showed effective single-base change discrimination.

  9. A Paper-Based Sandwich Format Hybridization Assay for Unlabeled Nucleic Acid Detection Using Upconversion Nanoparticles as Energy Donors in Luminescence Resonance Energy Transfer.

    Science.gov (United States)

    Zhou, Feng; Noor, M Omair; Krull, Ulrich J

    2015-09-24

    Bioassays based on cellulose paper substrates are gaining increasing popularity for the development of field portable and low-cost diagnostic applications. Herein, we report a paper-based nucleic acid hybridization assay using immobilized upconversion nanoparticles (UCNPs) as donors in luminescence resonance energy transfer (LRET). UCNPs with intense green emission served as donors with Cy3 dye as the acceptor. The avidin functionalized UCNPs were immobilized on cellulose paper and subsequently bioconjugated to biotinylated oligonucleotide probes. Introduction of unlabeled oligonucleotide targets resulted in a formation of probe-target duplexes. A subsequent hybridization of Cy3 labeled reporter with the remaining single stranded portion of target brought the Cy3 dye in close proximity to the UCNPs to trigger a LRET-sensitized emission from the acceptor dye. The hybridization assays provided a limit of detection (LOD) of 146.0 fmol and exhibited selectivity for one base pair mismatch discrimination. The assay was functional even in undiluted serum samples. This work embodies important progress in developing DNA hybridization assays on paper. Detection of unlabeled targets is achieved using UCNPs as LRET donors, with minimization of background signal from paper substrates owing to the implementation of low energy near-infrared (NIR) excitation.

  10. A Paper-Based Sandwich Format Hybridization Assay for Unlabeled Nucleic Acid Detection Using Upconversion Nanoparticles as Energy Donors in Luminescence Resonance Energy Transfer

    Science.gov (United States)

    Zhou, Feng; Noor, M. Omair; Krull, Ulrich J.

    2015-01-01

    Bioassays based on cellulose paper substrates are gaining increasing popularity for the development of field portable and low-cost diagnostic applications. Herein, we report a paper-based nucleic acid hybridization assay using immobilized upconversion nanoparticles (UCNPs) as donors in luminescence resonance energy transfer (LRET). UCNPs with intense green emission served as donors with Cy3 dye as the acceptor. The avidin functionalized UCNPs were immobilized on cellulose paper and subsequently bioconjugated to biotinylated oligonucleotide probes. Introduction of unlabeled oligonucleotide targets resulted in a formation of probe-target duplexes. A subsequent hybridization of Cy3 labeled reporter with the remaining single stranded portion of target brought the Cy3 dye in close proximity to the UCNPs to trigger a LRET-sensitized emission from the acceptor dye. The hybridization assays provided a limit of detection (LOD) of 146.0 fmol and exhibited selectivity for one base pair mismatch discrimination. The assay was functional even in undiluted serum samples. This work embodies important progress in developing DNA hybridization assays on paper. Detection of unlabeled targets is achieved using UCNPs as LRET donors, with minimization of background signal from paper substrates owing to the implementation of low energy near-infrared (NIR) excitation. PMID:28347081

  11. Rapid genotyping using pyrene-perylene locked nucleic acid complexes

    DEFF Research Database (Denmark)

    Kumar, Santhosh T.; Myznikova, Anna; Samokhina, Evgeniya

    2013-01-01

    is achieved with advantages of large Stokes shift (115 nm), high fluorescence quantum yields and low limit of target detection values (HIV Pol cDNA and RNA fragments performed herein proves the possibility for broad application of the novel pyrene......We have developed an assay for single strand DNA and RNA detection which is based on novel pyrene-perylene FRET pairs attached to short LNA/DNA probes. The assay is based on ratiometric emission upon binding of target DNA/RNA by three combinations of fluorescent LNA/DNA reporter strands. Specific...

  12. Luminescence resonance energy transfer-based nucleic acid hybridization assay on cellulose paper with upconverting phosphor as donors.

    Science.gov (United States)

    Zhou, Feng; Noor, M Omair; Krull, Ulrich J

    2014-03-04

    A bioassay based on DNA hybridization on cellulose paper is a promising format for gene fragment detection that may be suited for in-field and rapid diagnostic applications. We demonstrate for the first time that luminescence resonance energy transfer (LRET) associated with upconverting phosphors (UCPs) can be used to develop a paper-based DNA hybridization assay with high sensitivity, selectivity and fast response. UCPs with strong green emission were synthesized and subsequently functionalized with streptavidin (UCP-strep). UCP-strep particles were immobilized on cellulose paper, and then biotinylated single-stranded oligonucleotide probes were conjugated onto the UCPs via streptavidin-biotin linkage. The UCPs served as donors that were LRET-paired with Cy3-labeled target DNA. Selective DNA hybridization enabled the proximity required for LRET-sensitized emission from Cy3, which was used as the detection signal. Hybridization was complete within 2 min, and the limit of detection of the method was 34 fmol, which is a significant improvement in comparison to an analogous fluorescence resonance energy transfer (FRET) assay based on quantum dots. The assay exhibited excellent resistance to nonspecific adsorption of noncomplementary short/long DNA and protein. The selectivity of the assay was further evaluated by one base pair mismatched (1BPM) DNA detection, where a maximum signal ratio of 3.1:1 was achieved between fully complementary and 1BPM samples. This work represents a preliminary but significant step for the development of paper-based UCP-LRET nucleic acid hybridization assays, which offer potential for lowering the limit of detection of luminescent hybridization assays due to the negligible background signal associated with optical excitation by near-infrared (NIR) light.

  13. α,β-D-constrained nucleic acids are strong terminators of thermostable DNA polymerases in polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Olivier Martínez

    Full Text Available (S(C5', R(P α,β-D- Constrained Nucleic Acids (CNA are dinucleotide building blocks that can feature either B-type torsional angle values or non-canonical values, depending on their 5'C and P absolute stereochemistry. These CNA are modified neither on the nucleobase nor on the sugar structure and therefore represent a new class of nucleotide with specific chemical and structural characteristics. They promote marked bending in a single stranded DNA so as to preorganize it into a loop-like structure, and they have been shown to induce rigidity within oligonucleotides. Following their synthesis, studies performed on CNA have only focused on the constraints that this family of nucleotides introduced into DNA. On the assumption that bending in a DNA template may produce a terminator structure, we investigated whether CNA could be used as a new strong terminator of polymerization in PCR. We therefore assessed the efficiency of CNA as a terminator in PCR, using triethylene glycol phosphate units as a control. Analyses were performed by denaturing gel electrophoresis and several PCR products were further analysed by sequencing. The results showed that the incorporation of only one CNA was always skipped by the polymerases tested. On the other hand, two CNA units always stopped proofreading polymerases, such as Pfu DNA polymerase, as expected for a strong replication terminator. Non-proofreading enzymes, e.g. Taq DNA polymerase, did not recognize this modification as a strong terminator although it was predominantly stopped by this structure. In conclusion, this first functional use of CNA units shows that these modified nucleotides can be used as novel polymerization terminators of proofreading polymerases. Furthermore, our results lead us to propose that CNA and their derivatives could be useful tools for investigating the behaviour of different classes of polymerases.

  14. Modular Nucleic Acid Assembled p/MHC Microarrays for Multiplexed Sorting of Antigen-Specific T Cells

    Science.gov (United States)

    Kwong, Gabriel A.; Radu, Caius G.; Hwang, Kiwook; Shu, Chengyi J.; Ma, Chao; Koya, Richard C.; Comin-Anduix, Begonya; Hadrup, Sine Reker; Bailey, Ryan C.; Witte, Owen N.; Schumacher, Ton N.; Ribas, Antoni; Heath, James R.

    2009-01-01

    The human immune system consists of a large number of T cells capable of recognizing and responding to antigens derived from various sources. The development of peptide-major histocompatibility (p/MHC) tetrameric complexes has enabled the direct detection of these antigen-specific T cells. With the goal of increasing throughput and multiplexing of T cell detection, protein microarrays spotted with defined p/MHC complexes have been reported, but studies have been limited due to the inherent instability and reproducibility of arrays produced via conventional spotted methods. Herein, we report on a platform for the detection of antigen-specific T cells on glass substrates that offers significant advantages over existing surface-bound schemes. In this approach, called “Nucleic Acid Cell Sorting (NACS)”, single-stranded DNA oligomers conjugated site-specifically to p/MHC tetramers are employed to immobilize p/MHC tetramers via hybridization to a complementary-printed substrate. Fully assembled p/MHC arrays are used to detect and enumerate T cells captured from cellular suspensions, including primary human T cells collected from cancer patients. NACS arrays outperform conventional spotted arrays assessed in key criteria such as repeatability and homogeneity. The versatility of employing DNA sequences for cell sorting is exploited to enable the programmed, selective release of target populations of immobilized T cells with restriction endonucleases for downstream analysis. Because of the performance, facile and modular assembly of p/MHC tetramer arrays, NACS holds promise as a versatile platform for multiplexed T cell detection. PMID:19552409

  15. C-terminal domain modulates the nucleic acid chaperone activity of human T-cell leukemia virus type 1 nucleocapsid protein via an electrostatic mechanism.

    Science.gov (United States)

    Qualley, Dominic F; Stewart-Maynard, Kristen M; Wang, Fei; Mitra, Mithun; Gorelick, Robert J; Rouzina, Ioulia; Williams, Mark C; Musier-Forsyth, Karin

    2010-01-01

    Retroviral nucleocapsid (NC) proteins are molecular chaperones that facilitate nucleic acid (NA) remodeling events critical in viral replication processes such as reverse transcription. Surprisingly, the NC protein from human T-cell leukemia virus type 1 (HTLV-1) is an extremely poor NA chaperone. Using bulk and single molecule methods, we find that removal of the anionic C-terminal domain (CTD) of HTLV-1 NC results in a protein with chaperone properties comparable with that of other retroviral NCs. Increasing the ionic strength of the solution also improves the chaperone activity of full-length HTLV-1 NC. To determine how the CTD negatively modulates the chaperone activity of HTLV-1 NC, we quantified the thermodynamics and kinetics of wild-type and mutant HTLV-1 NC/NA interactions. The wild-type protein exhibits very slow dissociation kinetics, and removal of the CTD or mutations that eliminate acidic residues dramatically increase the protein/DNA interaction kinetics. Taken together, these results suggest that the anionic CTD interacts with the cationic N-terminal domain intramolecularly when HTLV-1 NC is not bound to nucleic acids, and similar interactions occur between neighboring molecules when NC is NA-bound. The intramolecular N-terminal domain-CTD attraction slows down the association of the HTLV-1 NC with NA, whereas the intermolecular interaction leads to multimerization of HTLV-1 NC on the NA. The latter inhibits both NA/NC aggregation and rapid protein dissociation from single-stranded DNA. These features make HTLV-1 NC a poor NA chaperone, despite its robust duplex destabilizing capability.

  16. The stabilization of tannery sludge and the character of humic acid-like during low temperature pyrolysis.

    Science.gov (United States)

    Ma, Hongrui; Gao, Mao; Hua, Li; Chao, Hao; Xu, Jing

    2015-11-01

    Tannery sludge contained plenty of organic matter, and the organic substance stability had direct impact on its derived chars' utilization. In this paper, the stabilization of tannery sludge and the variation of humic acid-like (HAL) extracted by different methods were investigated in a magnetic stirring reactor under low temperature pyrolysis of 100-400 °C. Results showed that the aromatic structure of pyrolysis chars increased with the increase of temperature and time. The char contained highly aromatic structure and relatively small dissolved organic matters (DOM) at 300 °C. The similar behaviors appeared in two HAL series by different extraction methods. The N content, H/C value, and aliphatic structures of HAL decreased with the increase of pyrolysis temperature, while the C/N value and aromatic structures increased with the rise of pyrolysis temperature. The composition and functional groups of HAL were similar with the purchased humic acid (HA). The fluorescence spectra revealed that two main peaks were found at Ex/Em = 239/363-368 nm and 283/359-368 nm in each HAL series from raw and 100 °C pyrolysis tannery sludge, representing a protein-like matter. The new peak appeared at Ex/Em = 263-283/388 nm in each HAL series from 200 °C pyrolysis tannery sludge-represented humic acid-like matter. The fluorescence intensity increased strongly compared to the other two peak intensity. Therefore, the humification of organic matter was increased by pyrolyzing. Notably, the HAL from 200 °C pyrolysis tannery sludge contained simple molecular structure, and the polycondensation increased but with a relative lower humification degree compared to soil HAL and purchased HA. Therefore, the sludge needs further oxidation. The humic substance was negligible by direct extraction when the temperature was 300 and 400 °C.

  17. Geranyl diphosphate synthase molecules, and nucleic acid molecules encoding same

    Science.gov (United States)

    Croteau, Rodney Bruce [Pullman, WA; Burke, Charles Cullen [Moscow, ID

    2008-06-24

    In one aspect, the present invention provides isolated nucleic acid molecules that each encode a geranyl diphosphate synthase protein, wherein each isolated nucleic acid molecule hybridizes to a nucleic acid molecule consisting of the sequence set forth in SEQ ID NO:1 under conditions of 5.times.SSC at 45.degree. C. for one hour. The present invention also provides isolated geranyl diphosphate synthase proteins, and methods for altering the level of expression of geranyl diphosphate synthase protein in a host cell.

  18. Extrachromosomal nucleic acids in bovine babesia

    Directory of Open Access Journals (Sweden)

    Isidro Hotzel

    1992-01-01

    Full Text Available Two kinds of small extrachromosomal nucleic acid elements were found in the bovine babesias, Babesia bovis and B. bigemina. One element with an apparent size of 5.5 kilobase pairs (kbp is a double stranded RNA related to virus like particles. Another molecule is a double stranded DNA with a molecular size of about 6.2 kbp. Southern blot comparison of restriction DNA fragments of the latter molecule, which is present in both B. bovis and B. bigemina is described.

  19. Patterning and Fabrication of Conductive Nanowires as Interconnects for Nanoelectronic Circuits Using Nucleic Acid Molecules as Templates

    National Research Council Canada - National Science Library

    Woolley, Adam T

    2005-01-01

    ...; this technique was applied in creating silver nanowires from single-stranded DNA. We further designed substrates with unique spatial addressing to allow the measurement of surface features repeatedly using complementary microscopic techniques (e.g...

  20. EGVII endoglucanase and nucleic acids encoding the same

    Energy Technology Data Exchange (ETDEWEB)

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2012-02-14

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  1. Circulating nucleic acids damage DNA of healthy cells by integrating ...

    Indian Academy of Sciences (India)

    Whether nucleic acids that circulate in blood have any patho-physiological functions in the host have not been explored. We report here that far from being inert molecules, circulating nucleic acids have significant biological activities of their own that are deleterious to healthy cells of the body. Fragmented DNA and ...

  2. Biological activity and biotechnological aspects of locked nucleic acids

    DEFF Research Database (Denmark)

    Lundin, Karin E; Højland, Torben; Hansen, Bo R.

    2013-01-01

    Locked nucleic acid (LNA) is one of the most promising new nucleic acid analogues that has been produced under the past two decades. In this chapter, we have tried to cover many of the different areas, where this molecule has been used to improve the function of synthetic oligonucleotides (ONs). ...

  3. MEANS AND METHODS FOR CLONING NUCLEIC ACID SEQUENCES

    NARCIS (Netherlands)

    Geertsma, Eric Robin; Poolman, Berend

    2008-01-01

    The invention provides means and methods for efficiently cloning nucleic acid sequences of interest in micro-organisms that are less amenable to conventional nucleic acid manipulations, as compared to, for instance, E.coli. The present invention enables high-throughput cloning (and, preferably,

  4. Peptide Nucleic Acids Having Enhanced Binding Affinity and Sequence Specificity

    DEFF Research Database (Denmark)

    1998-01-01

    A novel class of compounds, known as peptide nucleic acids, bind complementary DNA and RNA strands more strongly than a corresponding DNA strand, and exhibit increased sequence specificity and binding affinity. Methods of increasing binding affinity and sequence specificity of peptide nucleic acids...

  5. EGVI endoglucanase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2008-04-01

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  6. EGVII endoglucanase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2009-05-05

    The present invention provides an endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  7. EGVII endoglucanase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2013-07-16

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  8. EGVI endoglucanase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2006-06-06

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  9. EGVIII endoglucanase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2006-05-23

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl8, and the corresponding EGVIII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVIII, recombinant EGVIII proteins and methods for producing the same.

  10. Nucleic acid drugs: a novel approach | Jarald | African Journal of ...

    African Journals Online (AJOL)

    Nucleic acid base sequence of proteins plays a crucial role in the expression of gene. The gene is responsible for the synthesis of proteins and these proteins, which are synthesized, are responsible for the biological process and also for dreadful diseases as well. Once if the nucleic acid sequence is altered, we would be ...

  11. Locked and unlocked nucleosides in functional nucleic acids

    DEFF Research Database (Denmark)

    Doessing, Holger; Vester, Birte

    2011-01-01

    Nucleic acids are able to adopt a plethora of structures, many of which are of interest in therapeutics, bio- or nanotechnology. However, structural and biochemical stability is a major concern which has been addressed by incorporating a range of modifications and nucleoside derivatives. This rev......Nucleic acids are able to adopt a plethora of structures, many of which are of interest in therapeutics, bio- or nanotechnology. However, structural and biochemical stability is a major concern which has been addressed by incorporating a range of modifications and nucleoside derivatives....... This review summarizes the use of locked nucleic acid (LNA) and un-locked nucleic acid (UNA) monomers in functional nucleic acids such as aptamers, ribozymes, and DNAzymes....

  12. Cytosolic nucleic acid sensors and innate immune regulation.

    Science.gov (United States)

    Ori, Daisuke; Murase, Motoya; Kawai, Taro

    2017-03-04

    During viral and bacterial infections, pathogen-derived cytosolic nucleic acids are recognized by the intracellular RNA sensors retinoic acid-inducible gene I and melanoma-differentiated gene 5 and intracellular DNA sensors, including cyclic-di-GMP-AMP synthase, absent in melanoma 2, interferon (IFN)-gamma inducible protein 16, polymerase III, and so on. Binding of intracellular nucleic acids to these sensors activates downstream signaling cascades, resulting in the production of type I IFNs and pro-inflammatory cytokines to induce appropriate systematic immune responses. While these sensors also recognize endogenous nucleic acids and activate immune responses, they can discriminate between self- and non-self-nucleic acids. However, dysfunction of these sensors or failure of regulatory mechanisms causes aberrant activation of immune response and autoimmune disorders. In this review, we focus on how intracellular immune sensors recognize exogenous nucleic acids and activate the innate immune system, and furthermore, how autoimmune diseases result from dysfunction of these sensors.

  13. Nucleic Acid Aptamers for Living Cell Analysis

    Science.gov (United States)

    Xiong, Xiangling; Lv, Yifan; Chen, Tao; Zhang, Xiaobing; Wang, Kemin; Tan, Weihong

    2014-06-01

    Cells as the building blocks of life determine the basic functions and properties of a living organism. Understanding the structure and components of a cell aids in the elucidation of its biological functions. Moreover, knowledge of the similarities and differences between diseased and healthy cells is essential to understanding pathological mechanisms, identifying diagnostic markers, and designing therapeutic molecules. However, monitoring the structures and activities of a living cell remains a challenging task in bioanalytical and life science research. To meet the requirements of this task, aptamers, as “chemical antibodies,” have become increasingly powerful tools for cellular analysis. This article reviews recent advances in the development of nucleic acid aptamers in the areas of cell membrane analysis, cell detection and isolation, real-time monitoring of cell secretion, and intracellular delivery and analysis with living cell models. Limitations of aptamers and possible solutions are also discussed.

  14. Quantitative thermodynamic predication of interactions between nucleic acid and non-nucleic acid species using Microsoft excel.

    Science.gov (United States)

    Zou, Jiaqi; Li, Na

    2013-09-01

    Proper design of nucleic acid sequences is crucial for many applications. We have previously established a thermodynamics-based quantitative model to help design aptamer-based nucleic acid probes by predicting equilibrium concentrations of all interacting species. To facilitate customization of this thermodynamic model for different applications, here we present a generic and easy-to-use platform to implement the algorithm of the model with Microsoft(®) Excel formulas and VBA (Visual Basic for Applications) macros. Two Excel spreadsheets have been developed: one for the applications involving only nucleic acid species, the other for the applications involving both nucleic acid and non-nucleic acid species. The spreadsheets take the nucleic acid sequences and the initial concentrations of all species as input, guide the user to retrieve the necessary thermodynamic constants, and finally calculate equilibrium concentrations for all species in various bound and unbound conformations. The validity of both spreadsheets has been verified by comparing the modeling results with the experimental results on nucleic acid sequences reported in the literature. This Excel-based platform described here will allow biomedical researchers to rationalize the sequence design of nucleic acid probes using the thermodynamics-based modeling even without relevant theoretical and computational skills. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  15. Applications of synchrotron-based spectroscopic techniques in studying nucleic acids and nucleic acid-functionalized nanomaterials.

    Science.gov (United States)

    Wu, Peiwen; Yu, Yang; McGhee, Claire E; Tan, Li Huey; Lu, Yi

    2014-12-10

    In this review, we summarize recent progress in the application of synchrotron-based spectroscopic techniques for nucleic acid research that takes advantage of high-flux and high-brilliance electromagnetic radiation from synchrotron sources. The first section of the review focuses on the characterization of the structure and folding processes of nucleic acids using different types of synchrotron-based spectroscopies, such as X-ray absorption spectroscopy, X-ray emission spectroscopy, X-ray photoelectron spectroscopy, synchrotron radiation circular dichroism, X-ray footprinting and small-angle X-ray scattering. In the second section, the characterization of nucleic acid-based nanostructures, nucleic acid-functionalized nanomaterials and nucleic acid-lipid interactions using these spectroscopic techniques is summarized. Insights gained from these studies are described and future directions of this field are also discussed. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Nucleic acid-binding polymers as anti-inflammatory agents

    Science.gov (United States)

    Lee, Jaewoo; Sohn, Jang Wook; Zhang, Ying; Leong, Kam W.; Pisetsky, David; Sullenger, Bruce A.

    2011-01-01

    Dead and dying cells release nucleic acids. These extracellular RNAs and DNAs can be taken up by inflammatory cells and activate multiple nucleic acid-sensing toll-like receptors (TLR3, 7, 8, and 9). The inappropriate activation of these TLRs can engender a variety of inflammatory and autoimmune diseases. The redundancy of the TLR family encouraged us to seek materials that can neutralize the proinflammatory effects of any nucleic acid regardless of its sequence, structure or chemistry. Herein we demonstrate that certain nucleic acid-binding polymers can inhibit activation of all nucleic acid-sensing TLRs irrespective of whether they recognize ssRNA, dsRNA or hypomethylated DNA. Furthermore, systemic administration of such polymers can prevent fatal liver injury engendered by proinflammatory nucleic acids in an acute toxic shock model in mice. Therefore these polymers represent a novel class of anti-inflammatory agent that can act as molecular scavengers to neutralize the proinflammatory effects of various nucleic acids. PMID:21844380

  17. Customised nucleic acid libraries for enhanced aptamer selection and performance.

    Science.gov (United States)

    Pfeiffer, Franziska; Rosenthal, Malte; Siegl, Julia; Ewers, Jörg; Mayer, Günter

    2017-12-01

    Aptamers are short single-stranded oligo(deoxy)nucleotides that are selected to bind to target molecules with high affinity and specificity. Because of their sophisticated characteristics and versatile applicability, aptamers are thought to become universal molecular probes in biotechnological and therapeutic applications. However, the variety of possible interactions with a putative target molecule is limited by the chemical repertoire of the natural nucleobases. Consequently, many desired targets are not addressable by aptamers. This obstacle is overcome by broadening the chemical diversity of aptamers, mainly achieved by nucleobase-modifications and the introduction of novel bases or base pairs. We discuss these achievements and the characteristics of the respective modified aptamers, reflected by SOMAmers (slow off-rate modified aptamers), clickmers, and aptamers bearing an expanded genetic alphabet. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Methods and compositions for efficient nucleic acid sequencing

    Science.gov (United States)

    Drmanac, Radoje

    2002-01-01

    Disclosed are novel methods and compositions for rapid and highly efficient nucleic acid sequencing based upon hybridization with two sets of small oligonucleotide probes of known sequences. Extremely large nucleic acid molecules, including chromosomes and non-amplified RNA, may be sequenced without prior cloning or subcloning steps. The methods of the invention also solve various current problems associated with sequencing technology such as, for example, high noise to signal ratios and difficult discrimination, attaching many nucleic acid fragments to a surface, preparing many, longer or more complex probes and labelling more species.

  19. Towards Accurate Prediction of Protonation Equilibrium of Nucleic Acids

    OpenAIRE

    Goh, Garrett B.; Knight, Jennifer L.; Brooks, Charles L.

    2013-01-01

    The role of protonated nucleotides in modulating the pH-dependent properties of nucleic acids is one of the emerging frontiers in the field of nucleic acid biology. The recent development of a constant pH molecular dynamics simulation (CPHMDMSλD) framework for simulating nucleic acids has provided a tool for realistic simulations of pH-dependent dynamics. We enhanced the CPHMDMSλD framework with pH-based replica exchange (pH-REX), which significantly improves the sampling of both titration an...

  20. Continuously tunable nucleic acid hybridization probes.

    Science.gov (United States)

    Wu, Lucia R; Wang, Juexiao Sherry; Fang, John Z; Evans, Emily R; Pinto, Alessandro; Pekker, Irena; Boykin, Richard; Ngouenet, Celine; Webster, Philippa J; Beechem, Joseph; Zhang, David Yu

    2015-12-01

    In silico-designed nucleic acid probes and primers often do not achieve favorable specificity and sensitivity tradeoffs on the first try, and iterative empirical sequence-based optimization is needed, particularly in multiplexed assays. We present a novel, on-the-fly method of tuning probe affinity and selectivity by adjusting the stoichiometry of auxiliary species, which allows for independent and decoupled adjustment of the hybridization yield for different probes in multiplexed assays. Using this method, we achieved near-continuous tuning of probe effective free energy. To demonstrate our approach, we enforced uniform capture efficiency of 31 DNA molecules (GC content, 0-100%), maximized the signal difference for 11 pairs of single-nucleotide variants and performed tunable hybrid capture of mRNA from total RNA. Using the Nanostring nCounter platform, we applied stoichiometric tuning to simultaneously adjust yields for a 24-plex assay, and we show multiplexed quantitation of RNA sequences and variants from formalin-fixed, paraffin-embedded samples.

  1. Computational Approaches to Nucleic Acid Origami.

    Science.gov (United States)

    Jabbari, Hosna; Aminpour, Maral; Montemagno, Carlo

    2015-10-12

    Recent advances in experimental DNA origami have dramatically expanded the horizon of DNA nanotechnology. Complex 3D suprastructures have been designed and developed using DNA origami with applications in biomaterial science, nanomedicine, nanorobotics, and molecular computation. Ribonucleic acid (RNA) origami has recently been realized as a new approach. Similar to DNA, RNA molecules can be designed to form complex 3D structures through complementary base pairings. RNA origami structures are, however, more compact and more thermodynamically stable due to RNA's non-canonical base pairing and tertiary interactions. With all these advantages, the development of RNA origami lags behind DNA origami by a large gap. Furthermore, although computational methods have proven to be effective in designing DNA and RNA origami structures and in their evaluation, advances in computational nucleic acid origami is even more limited. In this paper, we review major milestones in experimental and computational DNA and RNA origami and present current challenges in these fields. We believe collaboration between experimental nanotechnologists and computer scientists are critical for advancing these new research paradigms.

  2. Isolated menthone reductase and nucleic acid molecules encoding same

    Science.gov (United States)

    Croteau, Rodney B; Davis, Edward M; Ringer, Kerry L

    2013-04-23

    The present invention provides isolated menthone reductase proteins, isolated nucleic acid molecules encoding menthone reductase proteins, methods for expressing and isolating menthone reductase proteins, and transgenic plants expressing elevated levels of menthone reductase protein.

  3. Nanopore biosensors for detection of proteins and nucleic acids

    NARCIS (Netherlands)

    Maglia, Giovanni; Soskine, Mikhael

    2014-01-01

    Described herein are nanopore biosensors based on a modified cytolysin protein. The nanopore biosensors accommodate macromoiecules including proteins and nucleic acids, and may additionally comprise ligands with selective binding properties.

  4. Dioxaphosphorinane-Constrained Nucleic Acid Dinucleotides as Tools for Structural Tuning of Nucleic Acids

    Science.gov (United States)

    Catana, Dan-Andrei; Renard, Brice-Loïc; Maturano, Marie; Payrastre, Corinne; Tarrat, Nathalie; Escudier, Jean-Marc

    2012-01-01

    We describe a rational approach devoted to modulate the sugar-phosphate backbone geometry of nucleic acids. Constraints were generated by connecting one oxygen of the phosphate group to a carbon of the sugar moiety. The so-called dioxaphosphorinane rings were introduced at key positions along the sugar-phosphate backbone allowing the control of the six-torsion angles α to ζ defining the polymer structure. The syntheses of all the members of the D-CNA family are described, and we emphasize the effect on secondary structure stabilization of a couple of diastereoisomers of α,β-D-CNA exhibiting wether B-type canonical values or not. PMID:23150809

  5. Analyzing and Building Nucleic Acid Structures with 3DNA

    OpenAIRE

    Colasanti, Andrew V.; Lu, Xiang-Jun; Olson, Wilma K.

    2013-01-01

    The 3DNA software package is a popular and versatile bioinformatics tool with capabilities to analyze, construct, and visualize three-dimensional nucleic acid structures. This article presents detailed protocols for a subset of new and popular features available in 3DNA, applicable to both individual structures and ensembles of related structures. Protocol 1 lists the set of instructions needed to download and install the software. This is followed, in Protocol 2, by the analysis of a nucleic...

  6. Nucleic acid-functionalized transition metal nanosheets for biosensing applications.

    Science.gov (United States)

    Mo, Liuting; Li, Juan; Liu, Qiaoling; Qiu, Liping; Tan, Weihong

    2017-03-15

    In clinical diagnostics, as well as food and environmental safety practices, biosensors are powerful tools for monitoring biological or biochemical processes. Two-dimensional (2D) transition metal nanomaterials, including transition metal chalcogenides (TMCs) and transition metal oxides (TMOs), are receiving growing interest for their use in biosensing applications based on such unique properties as high surface area and fluorescence quenching abilities. Meanwhile, nucleic acid probes based on Watson-Crick base-pairing rules are also being widely applied in biosensing based on their excellent recognition capability. In particular, the emergence of functional nucleic acids in the 1980s, especially aptamers, has substantially extended the recognition capability of nucleic acids to various targets, ranging from small organic molecules and metal ions to proteins and cells. Based on π-π stacking interaction between transition metal nanosheets and nucleic acids, biosensing systems can be easily assembled. Therefore, the combination of 2D transition metal nanomaterials and nucleic acids brings intriguing opportunities in bioanalysis and biomedicine. In this review, we summarize recent advances of nucleic acid-functionalized transition metal nanosheets in biosensing applications. The structure and properties of 2D transition metal nanomaterials are first discussed, emphasizing the interaction between transition metal nanosheets and nucleic acids. Then, the applications of nucleic acid-functionalized transition metal nanosheet-based biosensors are discussed in the context of different signal transducing mechanisms, including optical and electrochemical approaches. Finally, we provide our perspectives on the current challenges and opportunities in this promising field. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Fluorogenic, catalytic, photochemical reaction for amplified detection of nucleic acids.

    Science.gov (United States)

    Dutta, Subrata; Fülöp, Annabelle; Mokhir, Andriy

    2013-09-18

    Photochemical, nucleic acid-induced reactions, which are controlled by nontoxic red light, are well-suited for detection of nucleic acids in live cells, since they do not require any additives and can be spatially and temporally regulated. We have recently described the first reaction of this type, in which a phenylselenyl derivative of thymidine (5'-PhSeT-ODNa) is cleaved in the presence of singlet oxygen (Fülöp, A., Peng, X., Greenberg, M. M., Mokhir, A. (2010) A nucleic acid directed, red light-induced chemical reaction. Chem. Commun. 46, 5659-5661). The latter reagent is produced upon exposure of a photosensitizer 3'-PS-ODNb (PS = Indium(III)-pyropheophorbide-a-chloride: InPPa) to >630 nm light. In 2012 we reported on a fluorogenic version of this reaction (Dutta, S., Flottmann, B., Heilemann, M., Mokhir, A. (2012) Hybridization and reaction-based, fluorogenic nucleic acid probes. Chem. Commun. 47, 9664-9666), which is potentially applicable for the detection of nucleic acids in cells. Unfortunately, its yield does not exceed 25% and no catalytic turnover could be observed in the presence of substrate excess. This problem occurs due to the efficient, competing oxidation of the substrate containing an electron rich carbon-carbon double bonds (SCH═CHS) in the presence of singlet oxygen with formation of a noncleavable product (SCH═CHSO). Herein we describe a related, but substantially improved photochemical, catalytic transformation of a fluorogenic, organic substrate, which consists of 9,10-dialkoxyanthracene linked to fluorescein, with formation of a bright fluorescent dye. In highly dilute solution this reaction occurs only in the presence of a nucleic acid template. We developed three types of such a reaction and demonstrated that they are high yielding and generate over 7.7 catalytic turnovers, are sensitive to single mismatches in nucleic acid targets, and can be applied for determination of both the amount of nucleic acids and potentially their

  8. Scavenging nucleic acid debris to combat autoimmunity and infectious disease

    Science.gov (United States)

    Holl, Eda K.; Shumansky, Kara L.; Borst, Luke B.; Burnette, Angela D.; Sample, Christopher J.; Ramsburg, Elizabeth A.; Sullenger, Bruce A.

    2016-08-01

    Nucleic acid-containing debris released from dead and dying cells can be recognized as damage-associated molecular patterns (DAMPs) or pattern-associated molecular patterns (PAMPs) by the innate immune system. Inappropriate activation of the innate immune response can engender pathological inflammation and autoimmune disease. To combat such diseases, major efforts have been made to therapeutically target the pattern recognition receptors (PRRs) such as the Toll-like receptors (TLRs) that recognize such DAMPs and PAMPs, or the downstream effector molecules they engender, to limit inflammation. Unfortunately, such strategies can limit the ability of the immune system to combat infection. Previously, we demonstrated that nucleic acid-binding polymers can act as molecular scavengers and limit the ability of artificial nucleic acid ligands to activate PRRs. Herein, we demonstrate that nucleic acid scavengers (NASs) can limit pathological inflammation and nucleic acid-associated autoimmunity in lupus-prone mice. Moreover, we observe that such NASs do not limit an animal’s ability to combat viral infection, but rather their administration improves survival when animals are challenged with lethal doses of influenza. These results indicate that molecules that scavenge extracellular nucleic acid debris represent potentially safer agents to control pathological inflammation associated with a wide range of autoimmune and infectious diseases.

  9. Nucleic acid in-situ hybridization detection of infectious agents

    Science.gov (United States)

    Thompson, Curtis T.

    2000-04-01

    Limitations of traditional culture methods and newer polymerase chain reaction (PCR)-based methods for detection and speciation of infectious agents demonstrate the need for more rapid and better diagnostics. Nucleic acid hybridization is a detection technology that has gained wide acceptance in cancer and prenatal cytogenetics. Using a modification of the nucleic acid hybridization technique known as fluorescence in-situ hybridization, infectious agents can be detected in a variety of specimens with high sensitivity and specificity. The specimens derive from all types of human and animal sources including body fluids, tissue aspirates and biopsy material. Nucleic acid hybridization can be performed in less than one hour. The result can be interpreted either using traditional fluorescence microscopy or automated platforms such as micro arrays. This paper demonstrates proof of concept for nucleic acid hybridization detection of different infectious agents. Interpretation within a cytologic and histologic context is possible with fluorescence microscopic analysis, thereby providing confirmatory evidence of hybridization. With careful probe selection, nucleic acid hybridization promises to be a highly sensitive and specific practical diagnostic alternative to culture, traditional staining methods, immunohistochemistry and complicated nucleic acid amplification tests.

  10. Prediction of molecular alignment of nucleic acids in aligned media

    International Nuclear Information System (INIS)

    Wu Bin; Petersen, Michael; Girard, Frederic; Tessari, Marco; Wijmenga, Sybren S.

    2006-01-01

    We demonstrate - using the data base of all deposited DNA and RNA structures aligned in Pf1-medium and RDC refined - that for nucleic acids in a Pf1-medium the electrostatic alignment tensor can be predicted reliably and accurately via a simple and fast calculation based on the gyration tensor spanned out by the phosphodiester atoms. The rhombicity is well predicted over its full range from 0 to 0.66, while the alignment tensor orientation is predicted correctly for rhombicities up to ca. 0.4, for larger rhombicities it appears to deviate somewhat more than expected based on structural noise and measurement error. This simple analytical approach is based on the Debye-Huckel approximation for the electrostatic interaction potential, valid at distances sufficiently far away from a poly-ionic charged surface, a condition naturally enforced when the charge of alignment medium and solute are of equal sign, as for nucleic acids in a Pf1-phage medium. For the usual salt strengths and nucleic acid sizes, the Debye-Huckel screening length is smaller than the nucleic acid size, but large enough for the collective of Debye-Huckel spheres to encompass the whole molecule. The molecular alignment is then purely electrostatic, but it's functional form is under these conditions similar to that for steric alignment. The proposed analytical expression allows for very fast calculation of the alignment tensor and hence RDCs from the conformation of the nucleic acid molecule. This information provides opportunities for improved structure determination of nucleic acids, including better assessment of dynamics in (multi-domain) nucleic acids and the possibility to incorporate alignment tensor prediction from shape directly into the structure calculation process. The procedures are incorporated into MATLAB scripts, which are available on request

  11. Leptin gene polymorphism in Indian Sahiwal cattle by single strand ...

    African Journals Online (AJOL)

    These leptin gene variants can be sequenced and screened in the entire population to develop single nucleotide polymorphisms (SNPs) for association studies with different productive and reproductive performances and marker assisted selection. Keywords: Leptin gene, PCR-SSCP, genetic variability, dairy cattle

  12. Scaffolding along Nucleic Acid Duplexes Using 2'-Amino-Locked Nucleic Acids

    DEFF Research Database (Denmark)

    Astakhova, I Kira; Wengel, Jesper

    2014-01-01

    depends on the chemical nature of the modification, its price, its availability, and applications of the product. One of the most useful applications of the product LNA/DNA scaffolds containing 2'-amino-LNA is to detect complementary DNA and RNA targets. Examples of these applications include sensing...... of clinically important single-nucleotide polymorphisms (SNPs) and imaging of nucleic acids in vitro, in cell culture, and in vivo. According to our studies, 2'-amino-LNA scaffolds are efficient within diagnostic probes for DNA and RNA targets and as therapeutics, whereas both 2'-amino- and isomeric 2'-α......-l-amino-LNA scaffolds have promising properties for stabilization and detection of DNA nanostructures. Attachment of fluorescent groups to the 2'-amino group results in very high fluorescent quantum yields of the duplexes and remarkable sensitivity of the fluorescence signal to target binding. Notably, fluorescent LNA...

  13. Soni-removal of nucleic acids from inclusion bodies.

    Science.gov (United States)

    Neerathilingam, Muniasamy; Mysore, Sumukh; Gandham, Sai Hari A

    2014-05-23

    Inclusion bodies (IBs) are commonly formed in Escherichia coli due to over expression of recombinant proteins in non-native state. Isolation, denaturation and refolding of these IBs is generally performed to obtain functional protein. However, during this process IBs tend to form non-specific interactions with sheared nucleic acids from the genome, thus getting carried over into downstream processes. This may hinder the refolding of IBs into their native state. To circumvent this, we demonstrate a methodology termed soni-removal which involves disruption of nucleic acid-inclusion body interaction using sonication; followed by solvent based separation. As opposed to conventional techniques that use enzymes and column-based separations, soni-removal is a cost effective alternative for complete elimination of buried and/or strongly bound short nucleic acid contaminants from IBs. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Inorganic nanoparticles as nucleic acid transporters into eukaryotic cells

    Science.gov (United States)

    Amirkhanov, R. N.; Zarytova, V. F.; Zenkova, M. A.

    2017-02-01

    The review is concerned with inorganic nanoparticles (gold, titanium dioxide, silica, iron oxides, calcium phosphate) used as nucleic acid transporters into mammalian cells. Methods for the synthesis of nanoparticles and approaches to surface modification through covalent or noncovalent attachment of low- or high-molecular-weight compounds are considered. The data available from the literature on biological action of nucleic acids delivered into the cells by nanoparticles and on the effect of nanoparticles and their conjugates and complexes on the cell survival are summarized. Pathways of cellular internalization of nanoparticles and the mechanism of their excretion, as well as the ways of release of nucleic acids from their complexes with nanoparticles after the cellular uptake are described. The bibliography includes 161 references.

  15. Nucleic acid detection technologies and marker molecules in bacterial diagnostics.

    Science.gov (United States)

    Scheler, Ott; Glynn, Barry; Kurg, Ants

    2014-05-01

    There is a growing need for quick and reliable methods for microorganism detection and identification worldwide. Although traditional culture-based technologies are trustworthy and accurate at a relatively low cost, they are also time- and labor-consuming and are limited to culturable bacteria. Those weaknesses have created a necessity for alternative technologies that are capable for faster and more precise bacterial identification from medical, food or environmental samples. The most common current approach is to analyze the nucleic acid component of analyte solution and determine the bacterial composition according to the specific nucleic acid profiles that are present. This review aims to give an up-to-date overview of different nucleic acid target sequences and respective analytical technologies.

  16. Enhanced anti-HIV-1 activity of G-quadruplexes comprising locked nucleic acids and intercalating nucleic acids

    DEFF Research Database (Denmark)

    Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus

    2011-01-01

    Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1-pyrenylet......Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4......-(1-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...... of the antiviral QFOs in the present study formed more thermally stable G-quadruplexes and also high-order G-quadruplex structures which might be responsible for the increased antiviral activity observed....

  17. Pyrene-modified unlocked nucleic acids: synthesis, thermodynamic studies, and fluorescent properties

    DEFF Research Database (Denmark)

    Karlsen, Kasper K; Pasternak, Anna; Jensen, Troels B

    2012-01-01

    Two pyrene-modified UNA monomers were synthesized and incorporated into 21-mer DNA oligonucleotides. Melting temperatures and thermodynamic properties of the modified duplexes were measured, and the fluorescence properties of single strands and duplexes containing one or more pyrene...... pyrene-UNA modifications, whereas this excimer emission disappeared after hybridization to DNA. In view of both the pyrene monomer and the excimer fluorescence emission, the triply modified oligonucleotides show intriguing properties relating to the development of new DNA/RNA detection tools....

  18. Biomimetic High Density Lipoprotein Nanoparticles For Nucleic Acid Delivery

    Science.gov (United States)

    McMahon, Kaylin M.; Mutharasan, R. Kannan; Tripathy, Sushant; Veliceasa, Dorina; Bobeica, Mariana; Shumaker, Dale K.; Luthi, Andrea J.; Helfand, Brian T.; Ardehali, Hossein; Mirkin, Chad A.; Volpert, Olga; Thaxton, C. Shad

    2014-01-01

    We report a gold nanoparticle-templated high density lipoprotein (HDL AuNP) platform for gene therapy which combines lipid-based nucleic acid transfection strategies with HDL biomimicry. For proof-of-concept, HDL AuNPs are shown to adsorb antisense cholesterylated DNA. The conjugates are internalized by human cells, can be tracked within cells using transmission electron microscopy (TEM), and regulate target gene expression. Overall, the ability to directly image the AuNP core within cells, the chemical tailorability of the HDL AuNP platform, and the potential for cell-specific targeting afforded by HDL biomimicry make this platform appealing for nucleic acid delivery. PMID:21319839

  19. Spherical Nucleic Acids as Intracellular Agents for Nucleic Acid Based Therapeutics

    Science.gov (United States)

    Hao, Liangliang

    Recent functional discoveries on the noncoding sequences of human genome and transcriptome could lead to revolutionary treatment modalities because the noncoding RNAs (ncRNAs) can be applied as therapeutic agents to manipulate disease-causing genes. To date few nucleic acid-based therapeutics have been translated into the clinic due to challenges in the delivery of the oligonucleotide agents in an effective, cell specific, and non-toxic fashion. Unmodified oligonucleotide agents are destroyed rapidly in biological fluids by enzymatic degradation and have difficulty crossing the plasma membrane without the aid of transfection reagents, which often cause inflammatory, cytotoxic, or immunogenic side effects. Spherical nucleic acids (SNAs), nanoparticles consisting of densely organized and highly oriented oligonucleotides, pose one possible solution to circumventing these problems in both the antisense and RNA interference (RNAi) pathways. The unique three dimensional architecture of SNAs protects the bioactive oligonucleotides from unspecific degradation during delivery and supports their targeting of class A scavenger receptors and endocytosis via a lipid-raft-dependent, caveolae-mediated pathway. Owing to their unique structure, SNAs are able to cross cell membranes and regulate target genes expression as a single entity, without triggering the cellular innate immune response. Herein, my thesis has focused on understanding the interactions between SNAs and cellular components and developing SNA-based nanostructures to improve therapeutic capabilities. Specifically, I developed a novel SNA-based, nanoscale agent for delivery of therapeutic oligonucleotides to manipulate microRNAs (miRNAs), the endogenous post-transcriptional gene regulators. I investigated the role of SNAs involving miRNAs in anti-cancer or anti-inflammation responses in cells and in in vivo murine disease models via systemic injection. Furthermore, I explored using different strategies to construct

  20. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    Science.gov (United States)

    Nasarabadi, Shanavaz [Livermore, CA

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

  1. The association between low-grade inflammation, iron status and nucleic acid oxidation in the elderly

    DEFF Research Database (Denmark)

    Broedbaek, Kasper; Siersma, Volkert Dirk; Andersen, Jon T

    2011-01-01

    markers of nucleic acid oxidation between cases and controls were found and multivariable linear regression analysis showed no association between urinary markers of nucleic acid oxidation and inflammatory markers. Post-hoc multivariable linear regression analysis showed significant associations between...

  2. Karyotype and nucleic acid content in Zantedeschia aethiopica Spr ...

    African Journals Online (AJOL)

    Analysis of karyotype, nucleic deoxyribonucleic acid (DNA) content and sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) were performed in Zantedeschia aethiopica and Zantedeschia elliottiana. Mitotic metaphase in both species showed 2n=32. The chromosomes of both species were quite similar ...

  3. A nucleic acid dependent chemical photocatalysis in live human cells

    DEFF Research Database (Denmark)

    Arian, Dumitru; Cló, Emiliano; Gothelf, Kurt V

    2010-01-01

    Only two nucleic acid directed chemical reactions that are compatible with live cells have been reported to date. Neither of these processes generate toxic species from nontoxic starting materials. Reactions of the latter type could be applied as gene-specific drugs, for example, in the treatment...

  4. Watson-Crick hydrogen bonding of unlocked nucleic acids

    DEFF Research Database (Denmark)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-01-01

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against...

  5. A DNA origami nanorobot controlled by nucleic acid hybridization.

    Science.gov (United States)

    Torelli, Emanuela; Marini, Monica; Palmano, Sabrina; Piantanida, Luca; Polano, Cesare; Scarpellini, Alice; Lazzarino, Marco; Firrao, Giuseppe

    2014-07-23

    A prototype for a DNA origami nanorobot is designed, produced, and tested. The cylindrical nanorobot (diameter of 14 nm and length of 48 nm) with a switchable flap, is able to respond to an external stimulus and reacts by a physical switch from a disarmed to an armed configuration able to deliver a cellular compatible message. In the tested design the robot weapon is a nucleic acid fully contained in the inner of the tube and linked to a single point of the internal face of the flap. Upon actuation the nanorobot moves the flap extracting the nucleic acid that assembles into a hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme catalyzing a colorimetric reaction or chemiluminescence generation. The actuation switch is triggered by an external nucleic acid (target) that interacts with a complementary nucleic acid that is beard externally by the nanorobot (probe). Hybridization of probe and target produces a localized structural change that results in flap opening. The flap movement is studied on a two-dimensional prototype origami using Förster resonance energy transfer and is shown to be triggered by a variety of targets, including natural RNAs. The nanorobot has potential for in vivo biosensing and intelligent delivery of biological activators. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Nucleic acid amplification: Alternative methods of polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Md Fakruddin

    2013-01-01

    Full Text Available Nucleic acid amplification is a valuable molecular tool not only in basic research but also in application oriented fields, such as clinical medicine development, infectious diseases diagnosis, gene cloning and industrial quality control. A comperehensive review of the literature on the principles, applications, challenges and prospects of different alternative methods of polymerase chain reaction (PCR was performed. PCR was the first nucleic acid amplification method. With the advancement of research, a no of alternative nucleic acid amplification methods has been developed such as loop mediated isothermal amplification, nucleic acid sequence based amplification, strand displacement amplification, multiple displacement amplification. Most of the alternative methods are isothermal obviating the need for thermal cyclers. Though principles of most of the alternate methods are relatively complex than that of PCR, they offer better applicability and sensitivity in cases where PCR has limitations. Most of the alternate methods still have to prove themselves through extensive validation studies and are not available in commercial form; they pose the potentiality to be used as replacements of PCR. Continuous research is going on in different parts of the world to make these methods viable technically and economically.

  7. Mosaic protein and nucleic acid vaccines against hepatitis C virus

    Science.gov (United States)

    Yusim, Karina; Korber, Bette T. M.; Kuiken, Carla L.; Fischer, William M.

    2013-06-11

    The invention relates to immunogenic compositions useful as HCV vaccines. Provided are HCV mosaic polypeptide and nucleic acid compositions which provide higher levels of T-cell epitope coverage while minimizing the occurrence of unnatural and rare epitopes compared to natural HCV polypeptides and consensus HCV sequences.

  8. Modulating gene function with peptide nucleic acids (PNA)

    DEFF Research Database (Denmark)

    Nielsen, Peter E.; Crooke, Stanley T.

    2008-01-01

    A review on peptide nucleic acid (PNA) oligomers as modulators of gene expression ranging from gene silencing at the mRNAor the dsDNA (antigene) level, and redirection of mRNA splicing to gene activation through transcription bubble mimicking. PNA chem., anti-infective agents, cellular delivery...

  9. Circulating nucleic acids as a new diagnostic tool

    Czech Academy of Sciences Publication Activity Database

    Urbanová, Markéta; Plzák, J.; Strnad, Hynek; Betka, J.

    2010-01-01

    Roč. 15, č. 2 (2010), s. 242-259 ISSN 1425-8153 R&D Projects: GA MŠk 2B06106 Institutional research plan: CEZ:AV0Z50520514 Keywords : circulating nucleic acids * diagnostics * cancer Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.455, year: 2010

  10. Nucleic acid therapy for lifespan prolongation: Present and future

    Indian Academy of Sciences (India)

    This was demonstrated by a database search on PubMed and Web of Science, from which only seven studies published between 2000 and 2010 were found to directly touch on the development of nucleic acid therapy for anti-aging and/or longevity enhancing purposes. In light of this, the objective of this article is to ...

  11. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same

    Science.gov (United States)

    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo

    2012-10-16

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  12. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo

    2016-08-09

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  13. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo

    2017-09-05

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  14. Karyotype and nucleic acid content in Zantedeschia aethiopica Spr ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-07-03

    Jul 3, 2012 ... Analysis of karyotype, nucleic deoxyribonucleic acid (DNA) content and sodium dodecyl sulfate polyacrylamide ... base pairs) for Z. aethiopica and 1144.26 ± 0.05 picograms (equivalent to 1144.26 mega base pairs) for Z. elliottiana. ... ml ice-cold nuclei-isolation buffer A of the Partec high resolution. DNA kit ...

  15. Nucleic acid detection with surface plasmon resonance using cationic latex

    NARCIS (Netherlands)

    de Vries, E.F.A.; Schasfoort, Richardus B.M.; van der Plas, J.; Greve, Jan

    1994-01-01

    An affinity sensor based on Surface Plasmon Resonance (SPR) was used to detect nucleic acids. SPR is an optical technique that is able to detect small changes in the refractive index of the immediate vicinity of a metal surface. After a specific amplification of DNA, achieved using the polymerase

  16. A DNA origami nanorobot controlled by nucleic acid hybridization

    KAUST Repository

    Torelli, Emanuela

    2014-03-20

    A prototype for a DNA origami nanorobot is designed, produced, and tested. The cylindrical nanorobot (diameter of 14 nm and length of 48 nm) with a switchable flap, is able to respond to an external stimulus and reacts by a physical switch from a disarmed to an armed configuration able to deliver a cellular compatible message. In the tested design the robot weapon is a nucleic acid fully contained in the inner of the tube and linked to a single point of the internal face of the flap. Upon actuation the nanorobot moves the flap extracting the nucleic acid that assembles into a hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme catalyzing a colorimetric reaction or chemiluminescence generation. The actuation switch is triggered by an external nucleic acid (target) that interacts with a complementary nucleic acid that is beard externally by the nanorobot (probe). Hybridization of probe and target produces a localized structural change that results in flap opening. The flap movement is studied on a two-dimensional prototype origami using Förster resonance energy transfer and is shown to be triggered by a variety of targets, including natural RNAs. The nanorobot has potential for in vivo biosensing and intelligent delivery of biological activators. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Assessment for Melting Temperature Measurement of Nucleic Acid by HRM

    Directory of Open Access Journals (Sweden)

    Jing Wang

    2016-01-01

    Full Text Available High resolution melting (HRM, with a high sensitivity to distinguish the nucleic acid species with small variations, has been widely applied in the mutation scanning, methylation analysis, and genotyping. For the aim of extending HRM for the evaluation of thermal stability of nucleic acid secondary structures on sequence dependence, we investigated effects of the dye of EvaGreen, metal ions, and impurities (such as dNTPs on melting temperature (Tm measurement by HRM. The accuracy of HRM was assessed as compared with UV melting method, and little difference between the two methods was found when the DNA Tm was higher than 40°C. Both insufficiency and excessiveness of EvaGreen were found to give rise to a little bit higher Tm, showing that the proportion of dye should be considered for precise Tm measurement of nucleic acids. Finally, HRM method was also successfully used to measure Tms of DNA triplex, hairpin, and RNA duplex. In conclusion, HRM can be applied in the evaluation of thermal stability of nucleic acid (DNA or RNA or secondary structural elements (even when dNTPs are present.

  18. Circulating nucleic acids as a diagnostic and prognostic marker in ...

    African Journals Online (AJOL)

    Elevated levels of circulating nucleic acids have been found in a variety of benign and malignant pathological conditions. The ability to detect and quantitate specific DNA, RNA and micro-RNA sequences in serum/ plasma has opened up the possibilities of non-invasive diagnosis and monitoring of diseases. Circulating ...

  19. Surface plasmon resonance sensing of nucleic acids: A review

    Czech Academy of Sciences Publication Activity Database

    Šípová, Hana; Homola, Jiří

    -, č. 773 (2013), s. 9-23 ISSN 0003-2670 R&D Projects: GA MŠk(CZ) LH11102 Institutional support: RVO:67985882 Keywords : Surface plasmon resonance * Nucleic acid * Biosensor Subject RIV: JB - Sensors, Measurment, Regulation Impact factor: 4.517, year: 2013

  20. Web-based bioinformatic resources for protein and nucleic acids ...

    African Journals Online (AJOL)

    The advent of the Internet and the World Wide Web (WWW) has substantially increased the availability of information and computational resources available to experimental biologists. This review will describe the current on-line resources available, including protein and nucleic acids sequence alignment. Key words: ...

  1. Predicting nucleic acid binding interfaces from structural models of proteins.

    Science.gov (United States)

    Dror, Iris; Shazman, Shula; Mukherjee, Srayanta; Zhang, Yang; Glaser, Fabian; Mandel-Gutfreund, Yael

    2012-02-01

    The function of DNA- and RNA-binding proteins can be inferred from the characterization and accurate prediction of their binding interfaces. However, the main pitfall of various structure-based methods for predicting nucleic acid binding function is that they are all limited to a relatively small number of proteins for which high-resolution three-dimensional structures are available. In this study, we developed a pipeline for extracting functional electrostatic patches from surfaces of protein structural models, obtained using the I-TASSER protein structure predictor. The largest positive patches are extracted from the protein surface using the patchfinder algorithm. We show that functional electrostatic patches extracted from an ensemble of structural models highly overlap the patches extracted from high-resolution structures. Furthermore, by testing our pipeline on a set of 55 known nucleic acid binding proteins for which I-TASSER produces high-quality models, we show that the method accurately identifies the nucleic acids binding interface on structural models of proteins. Employing a combined patch approach we show that patches extracted from an ensemble of models better predicts the real nucleic acid binding interfaces compared with patches extracted from independent models. Overall, these results suggest that combining information from a collection of low-resolution structural models could be a valuable approach for functional annotation. We suggest that our method will be further applicable for predicting other functional surfaces of proteins with unknown structure. Copyright © 2011 Wiley Periodicals, Inc.

  2. Delivery Systems for In Vivo use of Nucleic Acid Drugs

    Directory of Open Access Journals (Sweden)

    Resende R.R

    2007-01-01

    Full Text Available The notorious biotechnological advance of the last few decades has allowed the development of experimental methods for understanding molecular mechanisms of genes and new therapeutic approaches. Gene therapy is maturing into a viable, practical method with the potential to cure a variety of human illnesses. Some nucleic-acid-based drugs are now available for controlling the progression of genetic diseases by inhibiting gene expression or the activity of their gene products. New therapeutic strategies employ a wide range of molecular tools such as bacterial plasmids containing transgenic inserts, RNA interference aptamers. A nucleic-acid based constitution confers a lower immunogenic potential and as result of the high stringency selection of large molecular variety, these drugs have high affi nity and selectivity for their targets. However, nucleic acids have poor biostability thus requiring chemical modifications and delivery systems to maintain their activity and ease their cellular internalization. This review discusses some of the mechanisms of action and the application of therapies based on nucleic acids such as aptamers and RNA interference as well as platforms for cellular uptake and intracellular delivery of therapeutic oligonucleotides and their trade-offs.

  3. A simple and rapid nucleic acid preparation method for reverse ...

    African Journals Online (AJOL)

    USER

    2010-03-29

    Mar 29, 2010 ... In order to shorten and facilitate the preparation of nucleic acid (without using tuber slicer, santurugation, vacuum devices and nanocalorimeter (NCM)) for reverse transcription polymerase chain reaction (RT-PCR), pieces of tuber were placed directly into eppendorf tubes containing 30 µl of detergent (0.5% ...

  4. Peptide nucleic acids and their potential applications in biotechnology

    DEFF Research Database (Denmark)

    Buchardt, O.; Egholm, M.; Berg, R.H.

    1993-01-01

    Peptide nucleic acids (PNAs) are novel DNA mimics in which the sugar-phosphate backbone has been replaced with a backbone based on amino acids1-3. PNAs exhibit sequence-specific binding to DNA and RNA with higher affinities and specificities than unmodified DNA. They,are resistant to nuclease...

  5. "Clickable" LNA/DNA probes for fluorescence sensing of nucleic acids and autoimmune antibodies

    DEFF Research Database (Denmark)

    Jørgensen, Anna S; Gupta, Pankaj; Wengel, Jesper

    2013-01-01

    Herein we describe fluorescent oligonucleotides prepared by click chemistry between novel alkyne-modified locked nucleic acid (LNA) strands and a series of fluorescent azides for homogeneous (all-in-solution) detection of nucleic acids and autoimmune antibodies.......Herein we describe fluorescent oligonucleotides prepared by click chemistry between novel alkyne-modified locked nucleic acid (LNA) strands and a series of fluorescent azides for homogeneous (all-in-solution) detection of nucleic acids and autoimmune antibodies....

  6. DMPD: Nucleic acid-sensing TLRs as modifiers of autoimmunity. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 17082566 Nucleic acid-sensing TLRs as modifiers of autoimmunity. Deane JA, Bolland ...S. J Immunol. 2006 Nov 15;177(10):6573-8. (.png) (.svg) (.html) (.csml) Show Nucleic acid-sensing TLRs as modifiers of auto...immunity. PubmedID 17082566 Title Nucleic acid-sensing TLRs as modifiers of autoimmunity. Aut

  7. Selected topics in photochemistry of nucleic acids. Recent results and perspectives

    International Nuclear Information System (INIS)

    Loeber, G.; Kittler, L.

    1977-01-01

    Recent results on the following photoreactions of nucleic acids are reported: photochemistry of aza-bases and minor bases, formation of photoproducts of the non-cyclobutane type, formations of furocoumarin-pyrimidine photoadducts, fluorescence of dye-nucleic acid complexes and their role in chromosomal fluorescence staining, and mechanisms of the photochemical reaction. Results are discussed with respect to: (i) photobiological relevance of light-induced defects in nucleic acids; (ii) possibilities of achieving higher selectivity of light-induced defects in nucleic acids; (iii) the use of nucleic acid photochemistry to analyze genetic material. An extensive bibliography is included. (author)

  8. Universal nucleic acids sample preparation method for cells, spores and their mixture

    Science.gov (United States)

    Bavykin, Sergei [Darien, IL

    2011-01-18

    The present invention relates to a method for extracting nucleic acids from biological samples. More specifically the invention relates to a universal method for extracting nucleic acids from unidentified biological samples. An advantage of the presently invented method is its ability to effectively and efficiently extract nucleic acids from a variety of different cell types including but not limited to prokaryotic or eukaryotic cells and/or recalcitrant organisms (i.e. spores). Unlike prior art methods which are focused on extracting nucleic acids from vegetative cell or spores, the present invention effectively extracts nucleic acids from spores, multiple cell types or mixtures thereof using a single method. Important that the invented method has demonstrated an ability to extract nucleic acids from spores and vegetative bacterial cells with similar levels effectiveness. The invented method employs a multi-step protocol which erodes the cell structure of the biological sample, isolates, labels, fragments nucleic acids and purifies labeled samples from the excess of dye.

  9. Immune Activation in the Liver by Nucleic Acids.

    Science.gov (United States)

    Sun, Qian; Wang, Qingde; Scott, Melanie J; Billiar, Timothy R

    2016-06-28

    Viral infection in the liver, including hepatitis B virus (HBV) and hepatitis C virus (HCV) infection, is a major health problem worldwide, especially in developing countries. The infection triggers a pro-inflammatory response in patients that is crucial for host defense. Recent studies have identified multiple transmembrane and cytosolic receptors that recognize pathogen-derived nucleic acids, and these receptors are essential for driving immune activation in the liver. In addition to sensing DNA/RNA from pathogens, these intracellular receptors can be activated by nucleic acids of host origin in response to sterile injuries. In this review, we discuss the expanding roles of these receptors in both immune and nonimmune cells in the liver.

  10. Devices, systems, and methods for detecting nucleic acids using sedimentation

    Energy Technology Data Exchange (ETDEWEB)

    Koh, Chung-Yan; Schaff, Ulrich Y.; Sommer, Gregory J.

    2017-10-24

    Embodiments of the present invention are directed toward devices, systems, and method for conducting nucleic acid purification and quantification using sedimentation. In one example, a method includes generating complexes which bind to a plurality of beads in a fluid sample, individual ones of the complexes comprising a nucleic acid molecule such as DNA or RNA and a labeling agent. The plurality of beads including the complexes may be transported through a density media, wherein the density media has a density lower than a density of the beads and higher than a density of the fluid sample, and wherein the transporting occurs, at least in part, by sedimentation. Signal may be detected from the labeling agents of the complexes.

  11. Surface plasmon resonance sensing of nucleic acids: A review

    Energy Technology Data Exchange (ETDEWEB)

    Šípová, Hana [Institute of Photonics and Electronics, Academy of Sciences of the Czech Republic, Chaberská 57, Prague (Czech Republic); Homola, Jiří, E-mail: homola@ufe.cz [Institute of Photonics and Electronics, Academy of Sciences of the Czech Republic, Chaberská 57, Prague (Czech Republic)

    2013-04-22

    Highlights: ► Advances of nucleic acid (NA) surface plasmon resonance (SPR) sensors are presented. ► Bioanalytical applications of NA SPR biosensors are reviewed. ► Applications for study of molecular interactions involving NAs are also discussed. -- Abstract: Biosensors based on surface plasmon resonance (SPR) have become a central tool for the investigation and quantification of biomolecules and their interactions. Nucleic acids (NAs) play a vital role in numerous biological processes and therefore have been one of the major groups of biomolecules targeted by the SPR biosensors. This paper discusses the advances of NA SPR biosensor technology and reviews its applications both in the research of molecular interactions involving NAs (NA–NA, NA–protein, NA–small molecule), as well as for the field of bioanalytics in the areas of food safety, medical diagnosis and environmental monitoring.

  12. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    Science.gov (United States)

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-02

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.

  13. Nucleic Acid Engineering: RNA Following the Trail of DNA.

    Science.gov (United States)

    Kim, Hyejin; Park, Yongkuk; Kim, Jieun; Jeong, Jaepil; Han, Sangwoo; Lee, Jae Sung; Lee, Jong Bum

    2016-02-08

    The self-assembly feature of the naturally occurring biopolymer, DNA, has fascinated researchers in the fields of materials science and bioengineering. With the improved understanding of the chemical and structural nature of DNA, DNA-based constructs have been designed and fabricated from two-dimensional arbitrary shapes to reconfigurable three-dimensional nanodevices. Although DNA has been used successfully as a building block in a finely organized and controlled manner, its applications need to be explored. Hence, with the myriad of biological functions, RNA has recently attracted considerable attention to further the application of nucleic acid-based structures. This Review categorizes different approaches of engineering nucleic acid-based structures and introduces the concepts, principles, and applications of each technique, focusing on how DNA engineering is applied as a guide to RNA engineering.

  14. Chemical Modifications of Nucleic Acid Aptamers for Therapeutic Purposes

    Directory of Open Access Journals (Sweden)

    Shuaijian Ni

    2017-08-01

    Full Text Available Nucleic acid aptamers have minimal immunogenicity, high chemical synthesis production, low cost and high chemical stability when compared with antibodies. However, the susceptibility to nuclease degradation, rapid excretion through renal filtration and insufficient binding affinity hindered their development as drug candidates for therapeutic applications. In this review, we will discuss methods to conquer these challenges and highlight recent developments of chemical modifications and technological advances that may enable early aptamers to be translated into clinical therapeutics.

  15. Developing nucleic acid-based electrical detection systems

    Directory of Open Access Journals (Sweden)

    Gabig-Ciminska Magdalena

    2006-03-01

    Full Text Available Abstract Development of nucleic acid-based detection systems is the main focus of many research groups and high technology companies. The enormous work done in this field is particularly due to the broad versatility and variety of these sensing devices. From optical to electrical systems, from label-dependent to label-free approaches, from single to multi-analyte and array formats, this wide range of possibilities makes the research field very diversified and competitive. New challenges and requirements for an ideal detector suitable for nucleic acid analysis include high sensitivity and high specificity protocol that can be completed in a relatively short time offering at the same time low detection limit. Moreover, systems that can be miniaturized and automated present a significant advantage over conventional technology, especially if detection is needed in the field. Electrical system technology for nucleic acid-based detection is an enabling mode for making miniaturized to micro- and nanometer scale bio-monitoring devices via the fusion of modern micro- and nanofabrication technology and molecular biotechnology. The electrical biosensors that rely on the conversion of the Watson-Crick base-pair recognition event into a useful electrical signal are advancing rapidly, and recently are receiving much attention as a valuable tool for microbial pathogen detection. Pathogens may pose a serious threat to humans, animal and plants, thus their detection and analysis is a significant element of public health. Although different conventional methods for detection of pathogenic microorganisms and their toxins exist and are currently being applied, improvements of molecular-based detection methodologies have changed these traditional detection techniques and introduced a new era of rapid, miniaturized and automated electrical chip detection technologies into pathogen identification sector. In this review some developments and current directions in

  16. System for portable nucleic acid testing in low resource settings

    Science.gov (United States)

    Lu, Hsiang-Wei; Roskos, Kristina; Hickerson, Anna I.; Carey, Thomas; Niemz, Angelika

    2013-03-01

    Our overall goal is to enable timely diagnosis of infectious diseases through nucleic acid testing at the point-of-care and in low resource settings, via a compact system that integrates nucleic acid sample preparation, isothermal DNA amplification, and nucleic acid lateral flow (NALF) detection. We herein present an interim milestone, the design of the amplification and detection subsystem, and the characterization of thermal and fluidic control and assay execution within this system. Using an earlier prototype of the amplification and detection unit, comprised of a disposable cartridge containing flexible pouches, passive valves, and electrolysis-driven pumps, in conjunction with a small heater, we have demonstrated successful execution of an established and clinically validated isothermal loop-mediated amplification (LAMP) reaction targeting Mycobacterium tuberculosis (M.tb) DNA, coupled to NALF detection. The refined design presented herein incorporates miniaturized and integrated electrolytic pumps, novel passive valves, overall design changes to facilitate integration with an upstream sample preparation unit, and a refined instrument design that automates pumping, heating, and timing. Nucleic acid amplification occurs in a two-layer pouch that facilitates fluid handling and appropriate thermal control. The disposable cartridge is manufactured using low-cost and scalable techniques and forms a closed system to prevent workplace contamination by amplicons. In a parallel effort, we are developing a sample preparation unit based on similar design principles, which performs mechanical lysis of mycobacteria and DNA extraction from liquefied and disinfected sputum. Our next step is to combine sample preparation, amplification, and detection in a final integrated cartridge and device, to enable fully automated sample-in to answer-out diagnosis of active tuberculosis in primary care facilities of low-resource and high-burden countries.

  17. Solid-state NMR studies of nucleic acid components

    Czech Academy of Sciences Publication Activity Database

    Dračínský, Martin; Hodgkinson, P.

    2015-01-01

    Roč. 5, č. 16 (2015), s. 12300-12310 ISSN 2046-2069 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : NMR spectroscopy * nucleic acids * solid-state NMR Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 3.289, year: 2015 http://pubs.rsc.org/en/content/articlepdf/2015/ra/c4ra14404j

  18. Preparative concentration of nucleic acids fragments by capillary isotachophoretic analyzer

    Czech Academy of Sciences Publication Activity Database

    Datinská, Vladimíra; Voráčová, Ivona; Berka, J.; Foret, František

    2018-01-01

    Roč. 1548 (2018), s. 100-103 ISSN 0021-9673 R&D Projects: GA MŠk(CZ) LQ1601; GA ČR(CZ) GBP206/12/G014; GA MŠk(CZ) 8F17003 Institutional support: RVO:68081715 Keywords : DNA * isotachophoresis * nucleic acids * sample preparation Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 3.981, year: 2016

  19. Caged molecular beacons: controlling nucleic acid hybridization with light.

    Science.gov (United States)

    Wang, Chunming; Zhu, Zhi; Song, Yanling; Lin, Hui; Yang, Chaoyong James; Tan, Weihong

    2011-05-28

    We have constructed a novel class of light-activatable caged molecular beacons (cMBs) that are caged by locking two stems with a photo-labile biomolecular interaction or covalent bond. With the cMBs, the nucleic acid hybridization process can be easily controlled with light, which offers the possibility for a high spatiotemporal resolution study of intracellular mRNAs. © The Royal Society of Chemistry 2011

  20. Assays for urinary biomarkers of oxidatively damaged nucleic acids

    DEFF Research Database (Denmark)

    Weimann, Allan; Broedbaek, Kasper; Henriksen, Trine

    2012-01-01

    Abstract The analysis of oxidized nucleic acid metabolites can be performed by a variety of methodologies: liquid chromatography coupled with electrochemical or mass-spectrometry detection, gas chromatography coupled with mass spectrometry, capillary electrophoresis and ELISA (Enzyme......-linked immunosorbent assay). The major analytical challenge is specificity. The best combination of selectivity and speed of analysis can be obtained by liquid chromatography coupled with tandem mass spectrometric detection. This, however, is also the most demanding technique with regard to price, complexity...

  1. Silicon Dioxide Thin Film Mediated Single Cell Nucleic Acid Isolation

    Science.gov (United States)

    Bogdanov, Evgeny; Dominova, Irina; Shusharina, Natalia; Botman, Stepan; Kasymov, Vitaliy; Patrushev, Maksim

    2013-01-01

    A limited amount of DNA extracted from single cells, and the development of single cell diagnostics make it necessary to create a new highly effective method for the single cells nucleic acids isolation. In this paper, we propose the DNA isolation method from biomaterials with limited DNA quantity in sample, and from samples with degradable DNA based on the use of solid-phase adsorbent silicon dioxide nanofilm deposited on the inner surface of PCR tube. PMID:23874571

  2. Development of Sorbents for Extraction and Stabilization of Nucleic Acids

    Science.gov (United States)

    2016-09-13

    Unlimited 40 Brandy J. White 202-404-6100 Organosilicate RNA Capacity Transport DNA Stability Field sampling...biological, environmental, forensics, and food safety, drive the need for preservation of nucleic acid integrity during sample collection, transportation ...169 0.26 63 CF2M2B Alkylammonium groups on mesostructured cellular foam (TMOS) 143 0.18 93 CF-BT BSA and trehalose adsorbed on mesostructured

  3. Peptide nucleic acid probes with charged photocleavable mass markers

    Science.gov (United States)

    Ball, Rachel J; Green, Philip S; Gale, Nittaya; Langley, G John

    2010-01-01

    Halogen-labelled peptide organic acid (HPOA) monomers have been synthesised and incorporated into sequence-specific peptide nucleic acid (PNA) probes. Three different types of probe have been prepared; the unmodified PNA probe, the PNA probe with a mass marker, and the PNA probe with photocleavable mass marker. All three types of probe have been used in model studies to develop a mass spectrometry-based hybridisation assay for detection of point mutations in DNA. PMID:21687524

  4. Locked nucleic acid: modality, diversity, and drug discovery

    DEFF Research Database (Denmark)

    Hagedorn, Peter H.; Persson, Robert; Funder, Erik D.

    2017-01-01

    Over the past 20 years, the field of RNA-targeted therapeutics has advanced based on discoveries of modified oligonucleotide chemistries, and an ever-increasing understanding of how to apply cellular assays to identify oligonucleotides with pharmacological properties in vivo. Locked nucleic acid ...... structural differences between oligonucleotides can often lead to substantial differences in their pharmacological properties. Here, we outline new principles for drug discovery exploiting oligonucleotide diversity to identify rare molecules with unique pharmacological properties....

  5. Development of Sorbents for Extraction and Stabilization of Nucleic Acids

    Science.gov (United States)

    2016-09-13

    Storage of Environmental Samples for Guaranteeing Nucleic Acid Yields for Molecular Microbiological Studies,” Applied Microbiology and Biotechnology...Detection of mRNA by RT-PCR from Preserved Prokaryotic Samples,” FEMS Microbiology Letters 201, 127–132 (2001). 25. S.D. Blacksell, S. Khounsy, and H.A...anhydrobiosis could be applied to RNA preservation [20]. While in the dry state, the matrix components form a thermo-stable barrier around the DNA

  6. Interaction of nucleic acids with carbon nanotubes and dendrimers

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... mechanism of the adsorption of single- and double-strand DNA (ssDNA and dsDNA) on CNT and graphene. The nucleic acid–CNT ..... weaken the binding between the DNA and dendrimer. As mentioned earlier, excessive penetration of DNA inside the. (a). G5. 0 ns. 12 ns. 24 ns. (b). G4. 0 ns. 14 ns. 24 ns.

  7. pH- and ligand-induced release of loads from DNA–acrylamide hydrogel microcapsules† †Electronic supplementary information (ESI) available: Nucleic acid sequences; characterization of nucleic acid-modified copolymers; SEM images, confocal images of microcapsules; calibration curves of TMR-D, TR-D, and DOX-D; synthesis of DOX-D; CD spectra of pH-responsive hydrogel; characterization of hydrogel membranes. See DOI: 10.1039/c6sc04770j Click here for additional data file.

    Science.gov (United States)

    Liao, Wei-Ching; Lilienthal, Sivan; Kahn, Jason S.; Riutin, Marianna; Sohn, Yang Sung; Nechushtai, Rachel

    2017-01-01

    Herein, a method to construct stimuli-responsive DNA–acrylamide-based hydrogel microcapsules has been presented. This method involves the use of polyacrylamide chains modified with predesigned nucleic acid hairpin units and optionally single-strand tethers that provide the required hybridization and recognition functions to yield substrate-loaded stimuli-responsive hydrogel-based microcapsules. The synthesis of the microcapsules involves the loading of CaCO3 microparticles with the respective load substrates and the functionalization of the CaCO3 template particles with nucleic acid promoter units. In the presence of the hairpin-modified acrylamide chains, the promoter units induce the hybridization chain reaction (HCR), which leads to the formation of a hydrogel coating, which, after the dissociation of the CaCO3 cores, yields substrate-loaded stimuli-responsive hydrogel microcapsules. One of the microcapsule systems includes, in the hairpin-modified acrylamide constructs, and in the subsequent HCR-generated hydrogel shells, the caged sequences of anti-ATP or anti-cocaine aptamers. In the presence of ATP or cocaine, the duplex-caged aptamer sequences are separated via the formation of ATP- or cocaine–aptamer complexes, which results in the partial separation of the microcapsules and the release of the loads. The second type of microcapsule is cooperatively stabilized by bridges generated by HCR and pH-sensitive duplex units. Under acidic conditions, the pH-sensitive bridges dissociate via the formation of i-motif structures, which results in an increase in the fluidity of the microcapsule shells and the release of the loads. Preliminary studies indicate that ATP- or pH-responsive microcapsules loaded with the anticancer drug, doxorubicin, have a selective cytotoxic effect on MDA-MB-231 cancer cells. PMID:28507706

  8. Immune activation by nucleic acids: A role in pregnancy complications.

    Science.gov (United States)

    Konečná, B; Lauková, L; Vlková, B

    2018-04-01

    Cell-free self-DNA or RNA may induce an immune response by activating specific sensing receptors. During pregnancy, placental nucleic acids present in the maternal circulation further activate these receptors due to the presence of unmethylated CpG islands. A higher concentration of cell-free foetal DNA is associated with pregnancy complications and a higher risk for foetal rejection. Cell-free foetal DNA originates from placental trophoblasts. It appears in different forms: free, bound to histones in nucleosomes, in neutrophil extracellular traps (NETs) and in extracellular vesicles (EVs). In several pregnancy complications, cell-free foetal DNA triggers the production of proinflammatory cytokines, and this production results in a cellular and humoral immune response. This review discusses preeclampsia, systemic lupus erythematosus, foetal growth restriction, gestational diabetes, rheumatoid arthritis and obesity in pregnancy from an immunological point of view and closely examines the different pathways that result in maternal inflammation. Understanding the role of cell-free nucleic acids, as well as the biogenesis of NETs and EVs, will help us to specify their functions or targets, which seem to be important in pregnancy complications. It is still not clear whether higher concentrations of cell-free nucleic acids in the maternal circulation are the cause or consequence of various complications. Therefore, further clinical studies and, even more importantly, animal experiments that focus on the involved immunological pathways are needed. © 2018 The Foundation for the Scandinavian Journal of Immunology.

  9. Molecular modeling of nucleic Acid structure: electrostatics and solvation.

    Science.gov (United States)

    Bergonzo, Christina; Galindo-Murillo, Rodrigo; Cheatham, Thomas E

    2014-12-19

    This unit presents an overview of computer simulation techniques as applied to nucleic acid systems, ranging from simple in vacuo molecular modeling techniques to more complete all-atom molecular dynamics treatments that include an explicit representation of the environment. The third in a series of four units, this unit focuses on critical issues in solvation and the treatment of electrostatics. UNITS 7.5 & 7.8 introduced the modeling of nucleic acid structure at the molecular level. This included a discussion of how to generate an initial model, how to evaluate the utility or reliability of a given model, and ultimately how to manipulate this model to better understand its structure, dynamics, and interactions. Subject to an appropriate representation of the energy, such as a specifically parameterized empirical force field, the techniques of minimization and Monte Carlo simulation, as well as molecular dynamics (MD) methods, were introduced as a way of sampling conformational space for a better understanding of the relevance of a given model. This discussion highlighted the major limitations with modeling in general. When sampling conformational space effectively, difficult issues are encountered, such as multiple minima or conformational sampling problems, and accurately representing the underlying energy of interaction. In order to provide a realistic model of the underlying energetics for nucleic acids in their native environments, it is crucial to include some representation of solvation (by water) and also to properly treat the electrostatic interactions. These subjects are discussed in detail in this unit. Copyright © 2014 John Wiley & Sons, Inc.

  10. Ion-pair chromatography of nucleic acid derivatives

    International Nuclear Information System (INIS)

    Perrone, P.A.; Brown, P.R.

    1985-01-01

    Little work has been done on the ion-pair chromatography of nucleic acid constituents, although there is a great potential for the use of this technique in the field. Since the classic work in 1949, nucleotides, as well as nucleosides and bases, have been separated by ion-exchange chromatography. However, ion exchange is a difficult mode and most researchers prefer the use of reversed-phase whenever possible. Although reversed-phase is now the method of choice, ionic compounds like nucleotides and some of the more polar bases are not adequately retained by many systems of this type. In addition, it is difficult to analyze simultaneously members of all three classes of nucleic acid compounds (bases, nucleosides, and nucleotides) using a reversed-phase system, even with gradient elution. Ion pairing can be a useful technique because, theoretically, the separation of nonionic bases and nucleosides along with the ionic nucleotides can be achieved. Additionally, each group of compounds may be separated isocratically. In this chapter, they will discuss ion-pair chromatography as applied to nucleic acid constituents. The current theories, advantages and disadvantages, a limited number of applications, and potential for future work are presented

  11. Recent Developments in Peptide-Based Nucleic Acid Delivery

    Directory of Open Access Journals (Sweden)

    Tobias Restle

    2008-07-01

    Full Text Available Despite the fact that non-viral nucleic acid delivery systems are generally considered to be less efficient than viral vectors, they have gained much interest in recent years due to their superior safety profile compared to their viral counterpart. Among these synthetic vectors are cationic polymers, branched dendrimers, cationic liposomes and cellpenetrating peptides (CPPs. The latter represent an assortment of fairly unrelated sequences essentially characterised by a high content of basic amino acids and a length of 10-30 residues. CPPs are capable of mediating the cellular uptake of hydrophilic macromolecules like peptides and nucleic acids (e.g. siRNAs, aptamers and antisenseoligonucleotides, which are internalised by cells at a very low rate when applied alone. Up to now, numerous sequences have been reported to show cell-penetrating properties and many of them have been used to successfully transport a variety of different cargos into mammalian cells. In recent years, it has become apparent that endocytosis is a major route of internalisation even though the mechanisms underlying the cellular translocation of CPPs are poorly understood and still subject to controversial discussions. In this review, we will summarise the latest developments in peptide-based cellular delivery of nucleic acid cargos. We will discuss different mechanisms of entry, the intracellular fate of the cargo, correlation studies of uptake versus biological activity of the cargo as well as technical problems and pitfalls.

  12. Selenium Derivatization of Nucleic Acids for Phase and Structure Determination in Nucleic Acid X-ray Crystallography

    Directory of Open Access Journals (Sweden)

    Zhen Huang

    2008-03-01

    Full Text Available Selenium derivatization (via selenomethionine of proteins for crystal structure determination via MAD phasing has revolutionized protein X-ray crystallography. It is estimated that over two thirds of all new crystal structures of proteins have been determined via Se-Met derivatization. Similarly, selenium functionalities have also been successfully incorporated into nucleic acids to facilitate their structure studies and it has been proved that this Se-derivatization has advantages over halogen strategy, which was usually used as a traditional method in this field. This review reports the development of site-specific selenium derivatization of nucleic acids for phase determination since the year of 2001 (mainly focus on the 2’-position of the ribose. All the synthesis of 2’-SeMe modified phosphoramidite building blocks (U, C, T, A, G and the according oligonucleotides are included. In addition, several structures of selenium contained nucleic acid are also described in this paper.

  13. Nucleic Acid Aptamers as Novel Class of Therapeutics to Mitigate Alzheimer's Disease Pathology

    DEFF Research Database (Denmark)

    K. Tannenberg, Rudi; Al. Shamaileh, Hadi; Lauridsen, Lasse Holm

    2013-01-01

    Deposition of amyloid-beta (A beta) peptides in the brain is a central event in the pathogenesis of Alzheimer's disease (AD), which makes A beta peptides a crucial target for therapeutic intervention. Significant efforts have been made towards the development of ligands that bind to A beta peptides...... with a goal of early detection of amyloid aggregation and the neutralization of A toxicity. Short single-stranded oligonucleotide aptamers bind with high affinity and specificity to their targets. Aptamers that specifically bind to A beta monomers, specifically the 40 and 42 amino acid species (A beta(1...

  14. Evolution of Arabidopsis protection of telomeres 1 alters nucleic acid recognition and telomerase regulation

    OpenAIRE

    Arora, Amit; Beilstein, Mark A.; Shippen, Dorothy E.

    2016-01-01

    Protection of telomeres (POT1) binds chromosome ends, recognizing single-strand telomeric DNA via two oligonucleotide/oligosaccharide binding folds (OB-folds). The Arabidopsis thaliana POT1a and POT1b paralogs are atypical: they do not exhibit telomeric DNA binding, and they have opposing roles in regulating telomerase activity. AtPOT1a stimulates repeat addition processivity of the canonical telomerase enzyme, while AtPOT1b interacts with a regulatory lncRNA that represses telomerase activit...

  15. Detection of Chrysanthemum stunt viroid (CSV) by nucleic acid spot hybridization

    International Nuclear Information System (INIS)

    Bothma, G.C.

    1985-01-01

    Chrysanthemum stunt viroid (CSV) was extracted from Chrysanthemum stunt viroid-infected Chrysanthemum plants. The CSV was then purified to homogenicity from this extract by one cycle of non-denaturating vertical slab gel electrophoresis and was followed by one cycle of denaturating vertical slab gel electrophoresis. No pure circular CSV was obtained. The 3' terminal of purified ASBV was polyadenylated using poly (A) polymerase. The polyadenylated ASBV was used as a template to synthesise radioactively labelled single stranded ASBV cDNA using reverse transcriptase. The radioactively labelled recombinant DNA was hybridised to crude extracts from avocado leaves and chrysanthemum leaves. Autoradiography was employed to detect cDNA-RNA hybrids

  16. Polymerin and lignimerin, as humic acid-like sorbents from vegetable waste, for the potential remediation of waters contaminated with heavy metals, herbicides, or polycyclic aromatic hydrocarbons.

    Science.gov (United States)

    Capasso, Renato; De Martino, Antonio

    2010-10-13

    Polymerin is a humic acid-like polymer, which we previously recovered for the first time from olive oil mill waste waters (OMWW) only, and chemically and physicochemically characterized. We also previously investigated its versatile sorption capacity for toxic inorganic and organic compounds. Therefore, a review is presented on the removal, from simulated polluted waters, of cationic heavy metals [Cu(II), Zn, Cr(III)] and anionic ones [Cr(VI)) and As(V)] by sorption on this natural organic sorbent in comparison with its synthetic derivatives, K-polymerin, a ferrihydrite-polymerin complex and with ferrihydrite. An overview is also performed of the removal of ionic herbicides (2,4-D, paraquat, MCPA, simazine, and cyhalofop) by sorption on polymerin, ferrihydrite, and their complex and of the removal of phenanthrene, as a representative of polycyclic aromatic hydrocarbons, by sorption on this sorbent and its complexes with micro- or nanoparticles of aluminum oxide, pointing out the employment of all these sorbents in biobed systems, which might allow the remediation of water and protection of surface and groundwater. In addition, a short review is also given on the removal of Cu(II) and Zn from simulated contaminated waters, by sorption on the humic acid-like organic fraction, named lignimerin, which we previously isolated for the first time, in collaboration with a Chilean group, from cellulose mill Kraft waste waters (KCMWW) only. More specifically, the production methods and the characterization of the two natural sorbents (polymerin and lignimerin) and their derivatives (K-polymerin ferrihydrite-polymerin, polymerin-microAl(2)O(3) and -nanoAl(2)O(3), and H-lignimerin, respectively) as well as their sorption data and mechanism are reviewed. Published and original results obtained by the cyclic sorption on all of the considered sorbents for the removal of the above-mentioned toxic compounds from simulated waste waters are also reported. Moreover, sorption capacity

  17. Photochemical reactions of nucleic acids and their constituents of photobiological relevance

    International Nuclear Information System (INIS)

    Saito, I.; Sugiyama, H.; Matsuura, T.

    1983-01-01

    A review is given of the papers published from 1977 to May 1983 on the UV-induced photochemical reactions of nucleic acids and their constituents of photobiological relevance where the structures of photoproducts have been fully characterized. Among the topics discussed are photoadditions relevant to nucleic acid-protein photocrosslinking, photoreactions with psoralens and nucleic acids and photochemical reactions of polynucleotides. (U.K.)

  18. Highly simplified lateral flow-based nucleic acid sample preparation and passive fluid flow control

    Energy Technology Data Exchange (ETDEWEB)

    Cary, Robert B.

    2018-04-17

    Highly simplified lateral flow chromatographic nucleic acid sample preparation methods, devices, and integrated systems are provided for the efficient concentration of trace samples and the removal of nucleic acid amplification inhibitors. Methods for capturing and reducing inhibitors of nucleic acid amplification reactions, such as humic acid, using polyvinylpyrrolidone treated elements of the lateral flow device are also provided. Further provided are passive fluid control methods and systems for use in lateral flow assays.

  19. Highly simplified lateral flow-based nucleic acid sample preparation and passive fluid flow control

    Science.gov (United States)

    Cary, Robert E.

    2015-12-08

    Highly simplified lateral flow chromatographic nucleic acid sample preparation methods, devices, and integrated systems are provided for the efficient concentration of trace samples and the removal of nucleic acid amplification inhibitors. Methods for capturing and reducing inhibitors of nucleic acid amplification reactions, such as humic acid, using polyvinylpyrrolidone treated elements of the lateral flow device are also provided. Further provided are passive fluid control methods and systems for use in lateral flow assays.

  20. Phytoagents for Cancer Management: Regulation of Nucleic Acid Oxidation, ROS, and Related Mechanisms

    OpenAIRE

    Lee, Wai-Leng; Huang, Jing-Ying; Shyur, Lie-Fen

    2013-01-01

    Accumulation of oxidized nucleic acids causes genomic instability leading to senescence, apoptosis, and tumorigenesis. Phytoagents are known to reduce the risk of cancer development; whether such effects are through regulating the extent of nucleic acid oxidation remains unclear. Here, we outlined the role of reactive oxygen species in nucleic acid oxidation as a driving force in cancer progression. The consequential relationship between genome instability and cancer progression highlights th...

  1. Templated Synthesis of Peptide Nucleic Acids via Sequence-Selective Base-Filling Reactions

    OpenAIRE

    Heemstra, Jennifer M.; Liu, David R.

    2009-01-01

    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either re...

  2. Efficient liposome fusion mediated by lipid-nucleic acid conjugates

    DEFF Research Database (Denmark)

    Ries, O; Löffler, P M G; Rabe, A

    2017-01-01

    The fusion of biomembranes with release of encapsulated content in a controlled way is crucial for cell signaling, endo- and exocytosis and intracellular trafficking. Programmable fusion of liposomes and an efficient mixing of their contents have the potential to enable the study of chemical...... and enzymatic processes in a confined environment and under crowded conditions outside biological systems. We report on DNA-controlled fusion of lipid bilayer membranes using lipid-nucleic acid conjugates (LiNAs) to mediate lipid and content mixing of liposomes. Screening of different membrane anchor and linker...

  3. Nucleic acid constructs containing orthogonal site selective recombinases (OSSRs)

    Energy Technology Data Exchange (ETDEWEB)

    Gilmore, Joshua M.; Anderson, J. Christopher; Dueber, John E.

    2017-08-29

    The present invention provides for a recombinant nucleic acid comprising a nucleotide sequence comprising a plurality of constructs, wherein each construct independently comprises a nucleotide sequence of interest flanked by a pair of recombinase recognition sequences. Each pair of recombinase recognition sequences is recognized by a distinct recombinase. Optionally, each construct can, independently, further comprise one or more genes encoding a recombinase capable of recognizing the pair of recombinase recognition sequences of the construct. The recombinase can be an orthogonal (non-cross reacting), site-selective recombinase (OSSR).

  4. Structure and function analysis of protein-nucleic acid complexes

    Science.gov (United States)

    Kuznetsova, S. A.; Oretskaya, T. S.

    2016-05-01

    The review summarizes published data on the results and achievements in the field of structure and function analysis of protein-nucleic acid complexes by means of main physical and biochemical methods, including X-ray diffraction, nuclear magnetic resonance spectroscopy, electron and atomic force microscopy, small-angle X-ray and neutron scattering, footprinting and cross-linking. Special attention is given to combined approaches. The advantages and limitations of each method are considered, and the prospects of their application for wide-scale structural studies in vivo are discussed. The bibliography includes 145 references.

  5. Advances in nucleic acid-based diagnostics of bacterial infections

    DEFF Research Database (Denmark)

    Barken, Kim Bundvig; Haagensen, Janus Anders Juul; Tolker-Nielsen, Tim

    2007-01-01

    Methods for rapid detection of infectious bacteria and antimicrobial-resistant pathogens have evolved significantly over the last decade. Many of the new procedures are nucleic acid-based and replace conventional diagnostic methods like culturing which is time consuming especially with fastidious...... of these pathogens is important to isolate patients and prevent further spreading of the diseases. Newly developed diagnostic procedures are superior with respect to turnaround time, sensitivity and specificity. Methods like multiplex real time PCR and different array-based technologies offer the possibility...

  6. Boronic acid-based autoligation of nucleic acids

    DEFF Research Database (Denmark)

    Barbeyron, R.; Vasseur, J.-J.; Smietana, M.

    2013-01-01

    Abstract: The development of synthetic systems displaying dynamic and adaptive characteristics is a formidable challenge with wide applications from biotechnology to therapeutics. Recently, we described a dynamic and programmable nucleic acid-based system relying on the formation of reversible...... boronate internucleosidic linkages. The DNA- or RNA-templated system comprises a 5′-ended boronic acid probe connecting a 3′-ended ribonucleosidic oligonucleotide partner. To explore the dominant factors that control the reversible linkage, we synthesized a series of 3′-end modified ribonucleotidic strands...

  7. Nucleic Acid-based approaches for detection of viral hepatitis.

    Science.gov (United States)

    Behzadi, Payam; Ranjbar, Reza; Alavian, Seyed Moayed

    2015-01-01

    To determining suitable nucleic acid diagnostics for individual viral hepatitis agent, an extensive search using related keywords was done in major medical library and data were collected, categorized, and summarized in different sections. Various types of molecular biology tools can be used to detect and quantify viral genomic elements and analyze the sequences. These molecular assays are proper technologies for rapidly detecting viral agents with high accuracy, high sensitivity, and high specificity. Nonetheless, the application of each diagnostic method is completely dependent on viral agent. Despite rapidity, automation, accuracy, cost-effectiveness, high sensitivity, and high specificity of molecular techniques, each type of molecular technology has its own advantages and disadvantages.

  8. Versatile phosphoramidation reactions for nucleic acid conjugations with peptides, proteins, chromophores, and biotin derivatives.

    Science.gov (United States)

    Wang, Tzu-Pin; Chiou, Yi-Jang; Chen, Yi; Wang, Eng-Chi; Hwang, Long-Chih; Chen, Bing-Hung; Chen, Yen-Hsu; Ko, Chun-Han

    2010-09-15

    Chemical conjugations of nucleic acids with macromolecules or small molecules are common approaches to study nucleic acids in chemistry and biology and to exploit nucleic acids for medical applications. The conjugation of nucleic acids such as oligonucleotides with peptides is especially useful to circumvent cell delivery and specificity problems of oligonucleotides as therapeutic agents. However, current approaches are limited and inefficient in their ability to afford peptide-oligonucleotide conjugates (POCs). Here, we report an effective and reproducible approach to prepare POCs and other nucleic acid conjugates based on a newly developed nucleic acid phosphoramidation method. The development of a new nucleic acid phosphoramidation reaction was achieved by our successful synthesis of a novel amine-containing biotin derivative used to systematically optimize the reactions. The improved phosphoramidation reactions dramatically increased yields of nucleic acid-biotin conjugates up to 80% after 3 h reaction. Any nucleic acids with a terminal phosphate group are suitable reactants in phosphoramidation reactions to conjugate with amine-containing molecules such as biotin and fluorescein derivatives, proteins, and, most importantly, peptides to enable the synthesis of POCs for therapeutic applications. Polymerase chain reactions (PCRs) to study incorporation of biotin or fluorescein-tagged DNA primers into the reaction products demonstrated that appropriate controls of nucleic acid phosphoramidation reactions incur minimum adverse effects on inherited base-pairing characteristics of nucleotides in nucleic acids. The phosphoramidation approach preserves the integrity of hybridization specificity in nucleic acids when preparing POCs. By retaining integrity of the nucleic acids, their effectiveness as therapeutic reagents for gene silencing, gene therapy, and RNA interference is ensured. The potential for POC use was demonstrated by two-step phosphoramidation reactions to

  9. Ionizing radiation induced attachment reactions of nucleic acids and their components

    International Nuclear Information System (INIS)

    Myers, L.S. Jr.

    1975-01-01

    An extensive bibliographic review is given of experimental and theoretical data on radiation-induced attachment reactions of nucleic acids and their components. Mechanisms of these reactions are reviewed. The reactions with water, formate, and alcohols, with amines and other small molecules, and with radiation sensitizers and nucleic acid-nucleic acid reactions are discussed. Studies of the reaction mechanisms show that many of the reactions occur by radical-molecule reactions, but radical-radical reactions also occur. Radiation modifiers become attached to nucleic acids in vitro and in vivo and there are indications that attachment may be necessary for the action of some sensitizers. (U.S.)

  10. Procedure for normalization of cDNA libraries

    Science.gov (United States)

    Bonaldo, Maria DeFatima; Soares, Marcelo Bento

    1997-01-01

    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

  11. Nucleic acid helix structure determination from NMR proton chemical shifts

    International Nuclear Information System (INIS)

    Werf, Ramon M. van der; Tessari, Marco; Wijmenga, Sybren S.

    2013-01-01

    We present a method for de novo derivation of the three-dimensional helix structure of nucleic acids using non-exchangeable proton chemical shifts as sole source of experimental restraints. The method is called chemical shift de novo structure derivation protocol employing singular value decomposition (CHEOPS) and uses iterative singular value decomposition to optimize the structure in helix parameter space. The correct performance of CHEOPS and its range of application are established via an extensive set of structure derivations using either simulated or experimental chemical shifts as input. The simulated input data are used to assess in a defined manner the effect of errors or limitations in the input data on the derived structures. We find that the RNA helix parameters can be determined with high accuracy. We finally demonstrate via three deposited RNA structures that experimental proton chemical shifts suffice to derive RNA helix structures with high precision and accuracy. CHEOPS provides, subject to further development, new directions for high-resolution NMR structure determination of nucleic acids.

  12. Molecular polarization potential maps of the nucleic acid bases

    International Nuclear Information System (INIS)

    Alkorta, I.; Perez, J.J.

    1996-01-01

    Ab initio calculations at the SCF level were carried out to compute the polarization potential map NM of the nucleic acid bases: cytosine, thymine, uracil, adedine, and guanine. For this purpose, the Dunning's 9s5p basis set contracted to a split-valence, was selected to perform the calculations. The molecular polarization potential (MPP) at each point was evaluated by the difference between the interaction energy of the molecule with a unit point charge and the molecular electrostatic potential (MEP) at that point. MEPS and MPPS for the different molecules were computed with a density of 5 points/Angstrom 2 on the van der Waals surface of each molecule, defined using the van der Waals radii. Due to the symmetry of the molecules, only half the points were computed. The total number of points calculated was 558 for cytosine, 621 for thymine, 526 for uracil, 666 for adenine, and 699 for guanine. The results of these calculations are analyzed in terms of their implications on the molecular interactions between pairs of nucleic acid bases. 23 refs., 5 figs., 1 tab

  13. Functional nucleic acids as in vivo metabolite and ion biosensors.

    Science.gov (United States)

    Alsaafin, Alaa; McKeague, Maureen

    2017-08-15

    Characterizing the role of metabolites, metals, and proteins is required to understand normal cell function, and ultimately, elucidate the mechanism of disease. Metabolite concentration and transformation results collected from cell lysates or fixed-cells conceal important dynamic information and differences between individual cells that often have profound functional consequences. Functional nucleic acid-based biosensors are emerging tools that are capable of monitoring ions and metabolites in cell populations or whole animals. Functional nucleic acids (FNAs) are a class of biomolecules that can exhibit either ligand binding or enzymatic activity. Unlike their protein analogues or the use of instrument-based analysis, FNA-based biosensors are capable of entering cells without disruption to the cellular environment and can report on the concentration, dynamics, and spatial localization of molecules in cells. Here, we review the types of FNAs that have been used as in vivo biosensors, and how FNAs can be coupled to transduction systems and delivered inside cells. We also provide examples from the literature that demonstrate their impact in practical applications. Finally, we comment on the critical limitations that need to be addressed to enable their use for single-cell dynamic tracking of metabolites and ions in vivo. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  14. Ligand-dependent and -independent regulation of human hepatic sphingomyelin phosphodiesterase acid-like 3A expression by pregnane X receptor and crosstalk with liver X receptor.

    Science.gov (United States)

    Jeske, Judith; Bitter, Andreas; Thasler, Wolfgang E; Weiss, Thomas S; Schwab, Matthias; Burk, Oliver

    2017-07-15

    Pregnane X receptor (PXR) mainly regulates xenobiotic metabolism and detoxification. Additionally, it exerts pleiotropic effects on liver physiology, which in large parts depend on transrepression of other liver-enriched transcription factors. Based on the hypothesis that lower expression levels of PXR may reduce the extent of this inhibition, an exploratory genome-wide transcriptomic profiling was performed using HepG2 cell clones with different expression levels of PXR. This screen and confirmatory real-time RT-PCR identified sphingomyelin phosphodiesterase acid-like (SMPDL) 3A, a novel nucleotide phosphodiesterase and phosphoramidase, as being up-regulated by PXR-deficiency. Transient siRNA-mediated knock-down of PXR in HepG2 cells and primary human hepatocytes similarly induced mRNA up-regulation, which translated into increased intracellular and secreted extracellular protein levels. Interestingly, ligand-dependent PXR activation also induced SMPDL3A in HepG2 cells and primary human hepatocytes. Electrophoretic mobility shift assays and chromatin immunoprecipitation demonstrated binding of PXR to the previously identified liver X receptor (LXR)-binding DR4 motif as well as to an adjacent ER8 motif in intron 1 of SMPDL3A. Constitutive binding of the unliganded receptor to the intron 1 chromatin indicated ligand-independent repression of SMPDL3A by PXR. Transient transfection and reporter gene analysis confirmed the specific role of these motifs in PXR- and LXR-dependent activation of the SMPDL3A intronic enhancer. PXR inhibited LXR mainly by competition for binding sites. In conclusion, this study describes that a decrease in PXR expression levels and ligand-dependent activation of PXR and LXR increase hepatic SMPDL3A levels, which possibly connects these receptors to hepatic purinergic signaling and phospholipid metabolism and may result in drug-drug interactions with phosphoramidate pro-drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. BGL4 beta-glucosidase and nucleic acids encoding the same

    Energy Technology Data Exchange (ETDEWEB)

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2011-12-06

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl4, and the corresponding BGL4 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL4, recombinant BGL4 proteins and methods for producing the same.

  16. BGL3 beta-glucosidase and nucleic acids encoding the same

    Energy Technology Data Exchange (ETDEWEB)

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2011-06-14

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  17. Bis-Pyrene-Modified Unlocked Nucleic Acids: Synthesis, Hybridization Studies, and Fluorescent Properties

    Czech Academy of Sciences Publication Activity Database

    Perlíková, Pavla; Ejlersen, M.; Langkjaer, N.; Wengel, J.

    2014-01-01

    Roč. 9, č. 9 (2014), s. 2120-2127 ISSN 1860-7179 Grant - others:European Research Council(XE) FP7-268776 Institutional support: RVO:61388963 Keywords : fluorescence * nucleic acid hybridization * oligonucleotides * pyrenes * unlocked nucleic acids Subject RIV: CC - Organic Chemistry Impact factor: 2.968, year: 2014

  18. Nucleic acids encoding mosaic clade M human immunodeficiency virus type 1 (HIV-1) envelope immunogens

    Science.gov (United States)

    Korber, Bette T; Fischer, William; Liao, Hua-Xin; Haynes, Barton F; Letvin, Norman; Hahn, Beatrice H

    2015-04-21

    The present invention relates to nucleic acids encoding mosaic clade M HIV-1 Env polypeptides and to compositions and vectors comprising same. The nucleic acids of the invention are suitable for use in inducing an immune response to HIV-1 in a human.

  19. BGL6 beta-glucosidase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel [Los Gatos, CA; Ward, Michael [San Francisco, CA

    2009-09-01

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  20. BGL3 beta-glucosidase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2008-04-01

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  1. Archive of Samples for Long-Term Preservation of RNA and Other Nucleic Acids

    Science.gov (United States)

    2016-05-15

    policy or decision unless so designated by other documentation. - 1- Table of Contents 1. Introduction...the development of a scalable all ambient temperature biological sample workflow preserving nucleic acids for molecular analysis. This ambient ...achieved the final Phase II milestone of processing 500 samples n a week. 1S. SUBJECT TERMS Nucleic Acid Preservation , Cost Reduction , Ambient

  2. BGL5 .beta.-glucosidase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2008-03-18

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl5, and the corresponding BGL5 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL5, recombinant BGL5 proteins and methods for producing the same.

  3. BGL3 beta-glucosidase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2012-10-30

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  4. BGL5 .beta.-glucosidase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2006-02-28

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl5, and the corresponding BGL5 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL5, recombinant BGL5 proteins and methods for producing the same.

  5. BGL4 .beta.-glucosidase and nucleic acids encoding the same

    Science.gov (United States)

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2006-05-16

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl4, and the corresponding BGL4 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL4, recombinant BGL4 proteins and methods for producing the same.

  6. Covering all the bases : Coarse-grained model design and application for nucleic acids

    NARCIS (Netherlands)

    Uusitalo, Jaakko Juhani

    2016-01-01

    Nucleic acids play a crucial role in the storage, transportation and expression of our genetic information. They have also become an interesting tool for many applications in nanotechnology. Studying biomolecular systems containing nucleic acids using experimental and imaging techniques has its

  7. Nucleic Acids Research annual Database Issue and the NAR online Molecular Biology Database Collection in 2009.

    Science.gov (United States)

    Galperin, Michael Y; Cochrane, Guy R

    2009-01-01

    The current issue of Nucleic Acids Research includes descriptions of 179 databases, of which 95 are new. These databases (along with several molecular biology databases described in other journals) have been included in the Nucleic Acids Research online Molecular Biology Database Collection, bringing the total number of databases in the collection to 1170. In this introductory comment, we briefly describe some of these new databases and review the principles guiding the selection of databases for inclusion in the Nucleic Acids Research annual Database Issue and the Nucleic Acids Research online Molecular Biology Database Collection. The complete database list and summaries are available online at the Nucleic Acids Research web site (http://nar.oxfordjournals.org/).

  8. Extracellular Nucleic Acids in Blood of Patients with Chronic Obstructive Pulmonary Disease

    Directory of Open Access Journals (Sweden)

    Larissa E. Muravlyova

    2013-01-01

    Full Text Available The concentrations of extracellular nucleic acids and acid-soluble precursors of nucleic acids in blood of patients with different forms and severity of chronic obstructive pulmonary disease (COPD were evaluated. The significant increase of the content of extracellular RNA and acid-soluble precursors of nucleic acids in plasma of patients with COPD was detected. The decrease of extracellular RNA in plasma of patients with COPD worsening was diagnosed. Extracellular DNA in plasma and red blood cells of patients didn’t change significantly. The article examines the mechanisms of extracellular nucleic acids increase in blood of COPD patients, studies the possible role of extracellular RNA in development of coagulation disorders in COPD patients. The further research of the role of extracellular nucleic acids and their precursors in COPD progression is required

  9. RIG-I detects infection with live Listeria by sensing secreted bacterial nucleic acids

    Science.gov (United States)

    Abdullah, Zeinab; Schlee, Martin; Roth, Susanne; Mraheil, Mobarak Abu; Barchet, Winfried; Böttcher, Jan; Hain, Torsten; Geiger, Sergej; Hayakawa, Yoshihiro; Fritz, Jörg H; Civril, Filiz; Hopfner, Karl-Peter; Kurts, Christian; Ruland, Jürgen; Hartmann, Gunther; Chakraborty, Trinad; Knolle, Percy A

    2012-01-01

    Immunity against infection with Listeria monocytogenes is not achieved from innate immune stimulation by contact with killed but requires viable Listeria gaining access to the cytosol of infected cells. It has remained ill-defined how such immune sensing of live Listeria occurs. Here, we report that efficient cytosolic immune sensing requires access of nucleic acids derived from live Listeria to the cytoplasm of infected cells. We found that Listeria released nucleic acids and that such secreted bacterial RNA/DNA was recognized by the cytosolic sensors RIG-I, MDA5 and STING thereby triggering interferon β production. Secreted Listeria nucleic acids also caused RIG-I-dependent IL-1β-production and inflammasome activation. The signalling molecule CARD9 contributed to IL-1β production in response to secreted nucleic acids. In conclusion, cytosolic recognition of secreted bacterial nucleic acids by RIG-I provides a mechanistic explanation for efficient induction of immunity by live bacteria. PMID:23064150

  10. Revealing Nucleic Acid Mutations Using Förster Resonance Energy Transfer-Based Probes

    Directory of Open Access Journals (Sweden)

    Nina P. L. Junager

    2016-07-01

    Full Text Available Nucleic acid mutations are of tremendous importance in modern clinical work, biotechnology and in fundamental studies of nucleic acids. Therefore, rapid, cost-effective and reliable detection of mutations is an object of extensive research. Today, Förster resonance energy transfer (FRET probes are among the most often used tools for the detection of nucleic acids and in particular, for the detection of mutations. However, multiple parameters must be taken into account in order to create efficient FRET probes that are sensitive to nucleic acid mutations. In this review; we focus on the design principles for such probes and available computational methods that allow for their rational design. Applications of advanced, rationally designed FRET probes range from new insights into cellular heterogeneity to gaining new knowledge of nucleic acid structures directly in living cells.

  11. Compatible solute influence on nucleic acids: Many questions but few answers

    Science.gov (United States)

    Kurz, Matthias

    2008-01-01

    Compatible solutes are small organic osmolytes including but not limited to sugars, polyols, amino acids, and their derivatives. They are compatible with cell metabolism even at molar concentrations. A variety of organisms synthesize or take up compatible solutes for adaptation to extreme environments. In addition to their protective action on whole cells, compatible solutes display significant effects on biomolecules in vitro. These include stabilization of native protein and nucleic acid structures. They are used as additives in polymerase chain reactions to increase product yield and specificity, but also in other nucleic acid and protein applications. Interactions of compatible solutes with nucleic acids and protein-nucleic acid complexes are much less understood than the corresponding interactions of compatible solutes with proteins. Although we may begin to understand solute/nucleic acid interactions there are only few answers to the many questions we have. I summarize here the current state of knowledge and discuss possible molecular mechanisms and thermodynamics. PMID:18522725

  12. [Progress of improving blood donor screening by nucleic acid technology].

    Science.gov (United States)

    Cai, Li-Na; Chen, Bao-An

    2014-08-01

    With increasing application of blood transfusion, the research of side-effects such as transfusion-transmitted infections (TTIs) became more and more important. Up to the 90's of the 20th century, the first blood donor screening for pathogens transfected from blood transfusion entirely depended on serological test. At this time, the detection of virus were performed mainly by using method of detecting antibody, except hepatitis B virus (HBV) can be detected by hepatitis B surface antigen (HBsAg). Now, the molecular technologies, such as the polymerase chain reaction (PCR), have been used in clinic. These technologic methods can provide capability of detection for blood donor screening and reduced possibility of infection from blood transfusion. This review summarises the development of nucleic acid amplification technology and describes its current state.

  13. Peptide nucleic acid (PNA) antisense effects in Escherichia coli

    DEFF Research Database (Denmark)

    Good, L; Nielsen, P E

    1999-01-01

    Antisense peptide nucleic acid (PNA) can be used to control cell growth, gene expression and growth phenotypes in the bacteria Escherichia coli. PNAs targeted to the RNA components of the ribosome can inhibit translation and cell growth, and PNAs targeted to mRNA can limit gene expression with gene...... and sequence specificity. In an E. coli cell extract, efficient inhibition is observed when using PNA concentrations in the nanomolar range, whereas micromolar concentrations are required for inhibition in growing cells. A mutant strain of E. coli that is more permeable to antibiotics also is more susceptible...... to antisense PNAs than the wild type. This chapter details methods for testing the antisense activities of PNA in E. coli. As an example of the specific antisense inhibition possible, we show the effects of an anti-beta-galactosidase PNA in comparison to control PNAs. With improvements in cell uptake...

  14. Multi-chamber nucleic acid amplification and detection device

    Energy Technology Data Exchange (ETDEWEB)

    Dugan, Lawrence

    2017-10-25

    A nucleic acid amplification and detection device includes an amplification cartridge with a plurality of reaction chambers for containing an amplification reagent and a visual detection reagent, and a plurality of optically transparent view ports for viewing inside the reaction chambers. The cartridge also includes a sample receiving port which is adapted to receive a fluid sample and fluidically connected to distribute the fluid sample to the reaction chamber, and in one embodiment, a plunger is carried by the cartridge for occluding fluidic communication to the reaction chambers. The device also includes a heating apparatus having a heating element which is activated by controller to generate heat when a trigger event is detected. The heating apparatus includes a cartridge-mounting section which positioned a cartridge in thermal communication with the heating element so that visual changes to the contents of the reaction chambers are viewable through the view ports.

  15. Nucleic acid and peptide aptamers: fundamentals and bioanalytical aspects.

    Science.gov (United States)

    Mascini, Marco; Palchetti, Ilaria; Tombelli, Sara

    2012-02-06

    In recent years new nucleic acid and protein-based combinatorial molecules have attracted the attention of researchers working in various areas of science, ranging from medicine to analytical chemistry. These molecules, called aptamers, have been proposed as alternatives to antibodies in many different applications. The aim of this Review is to illustrate the peculiarities of these combinatorial molecules which have initially been explored for their importance in molecular medicine, but have enormous potential in other biotechnological fields historically dominated by antibodies, such as bioassays. A description of these molecules is given, and the methods for their selection and production are also summarized. Moreover, critical aspects related to these molecules are discussed. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Availability: A Metric for Nucleic Acid Strand Displacement Systems

    Science.gov (United States)

    2016-01-01

    DNA strand displacement systems have transformative potential in synthetic biology. While powerful examples have been reported in DNA nanotechnology, such systems are plagued by leakage, which limits network stability, sensitivity, and scalability. An approach to mitigate leakage in DNA nanotechnology, which is applicable to synthetic biology, is to introduce mismatches to complementary fuel sequences at key locations. However, this method overlooks nuances in the secondary structure of the fuel and substrate that impact the leakage reaction kinetics in strand displacement systems. In an effort to quantify the impact of secondary structure on leakage, we introduce the concepts of availability and mutual availability and demonstrate their utility for network analysis. Our approach exposes vulnerable locations on the substrate and quantifies the secondary structure of fuel strands. Using these concepts, a 4-fold reduction in leakage has been achieved. The result is a rational design process that efficiently suppresses leakage and provides new insight into dynamic nucleic acid networks. PMID:26875531

  17. Nucleic acid probes in the diagnosis of human microbial pathogens

    International Nuclear Information System (INIS)

    Hyypia, T.; Huovinen, P.; Holmberg, M.; Pettersson, U.

    1989-01-01

    The development of effective vaccines and antimicrobial drugs against infectious diseases has been among the most successful achievements in modern medicine. The control of these diseases requires efficient diagnostic methods for the evaluation of the prevalence of diseases and for initiation of specific treatment. Virtually all known microbes can be specifically identified today but in many cases further development is needed for more accurate, rapid, easy-to-use, and inexpensive diagnostic assays. Cell culture facilities are needed for the isolation of viruses in clinical specimens. Any gene of any known microorganism can be cloned in a vector and produced in large amounts economically and then used in diagnostic assays for the identification of the pathogen. The application of the nucleic acid hybridization methods in detection of human pathogens has received considerable attention during the past few years. This paper presents examples of this application of gene technology

  18. Nucleic Acid-Based Approaches for Detection of Viral Hepatitis

    Science.gov (United States)

    Behzadi, Payam; Ranjbar, Reza; Alavian, Seyed Moayed

    2014-01-01

    Context: To determining suitable nucleic acid diagnostics for individual viral hepatitis agent, an extensive search using related keywords was done in major medical library and data were collected, categorized, and summarized in different sections. Results: Various types of molecular biology tools can be used to detect and quantify viral genomic elements and analyze the sequences. These molecular assays are proper technologies for rapidly detecting viral agents with high accuracy, high sensitivity, and high specificity. Nonetheless, the application of each diagnostic method is completely dependent on viral agent. Conclusions: Despite rapidity, automation, accuracy, cost-effectiveness, high sensitivity, and high specificity of molecular techniques, each type of molecular technology has its own advantages and disadvantages. PMID:25789132

  19. Design of peptide-targeted liposomes containing nucleic acids.

    Science.gov (United States)

    Santos, Adriana O; da Silva, Lígia C Gomes; Bimbo, Luís M; de Lima, Maria C Pedroso; Simões, Sérgio; Moreira, João N

    2010-03-01

    Anticancer systemic gene silencing therapy has been so far limited by the inexistence of adequate carrier systems that ultimately provide an efficient intracellular delivery into target tumor cells. In this respect, one promising strategy involves the covalent attachment of internalizing-targeting ligands at the extremity of PEG chains grafted onto liposomes. Therefore, the present work aims at designing targeted liposomes containing nucleic acids, with small size, high encapsulation efficiency and able to be actively internalized by SCLC cells, using a hexapeptide (antagonist G) as a targeting ligand. For this purpose, the effect of the liposomal preparation method, loading material (ODN versus siRNA) and peptide-coupling procedure (direct coupling versus post-insertion) on each of the above-mentioned parameters was assessed. Post-insertion of DSPE-PEG-antagonist G conjugates into preformed liposomes herein named as stabilized lipid particles, resulted in targeted vesicles with a mean size of about 130 nm, encapsulation efficiency close to 100%, and a loading capacity of approximately 5 nmol siRNA/mumol of total lipid. In addition, the developed targeted vesicles showed increased internalization in SCLC cells, as well as in other tumor cells and HMEC-1 microvascular endothelial cells. The improved cellular association, however, did not correlate with enhanced downregulation of the target protein (Bcl-2) in SCLC cells. These results indicate that additional improvements need to be performed in the future, namely by ameliorating the access of the nucleic acids to the cytoplasm of the tumor cells following receptor-mediated endocytosis. Copyright 2009 Elsevier B.V. All rights reserved.

  20. Sensitive determination of nucleic acids using organic nanoparticle fluorescence probes

    Science.gov (United States)

    Zhou, Yunyou; Bian, Guirong; Wang, Leyu; Dong, Ling; Wang, Lun; Kan, Jian

    2005-06-01

    This paper describes the preparation of organic nanoparticles by reprecipitation method under sonication and vigorous stirring. Transmission electron microscopy (TEM) was used to characterize the size and size distribution of the luminescent nanoparticles. Their average diameter was about 25 nm with a size variation of ±18%. The fluorescence decay lifetime of the nanoparticles also was determined on a self-equipped fluorospectrometer with laser light source. The lifetime (˜0.09 μs) of nanoparticles is about three times long as that of the monomer. The nanoparticles were in abundant of hydrophilic groups, which increased their miscibility in aqueous solution. These organic nanoparticles have high photochemical stability, excellent resistance to chemical degradation and photodegradation, and a good fluorescence quantum yield (25%). The fluorescence can be efficiently quenched by nucleic acids. Based on the fluorescence quenching of nanoparticles, a fluorescence quenching method was developed for determination of microamounts of nucleic acids by using the nanoparticles as a new fluorescent probe. Under optimal conditions, maximum fluorescence quenching is produced, with maximum excitation and emission wavelengths of 345 and 402 nm, respectively. Under optimal conditions, the calibration graphs are linear over the range 0.4-19.0 μg ml -1 for calf thymus DNA (ct-DNA) and 0.3-19.0 μg ml -1 for fish sperm DNA (fs-DNA). The corresponding detection limits are 0.25 μg ml -1 for ct-DNA and 0.17 μg ml -1 for fs-DNA. The relative standard deviation of six replicate measurements is 1.3-2.1%. The method is simple, rapid and sensitive with wide linear range. The recovery and relative standard deviation are very satisfactory.