WorldWideScience

Sample records for single-stranded hairpin substrate

  1. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop.

    Science.gov (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S

    2009-05-01

    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  2. Substrate-assisted 2D DNA lattices and algorithmic lattices from single-stranded tiles.

    Science.gov (United States)

    Kim, Junghoon; Ha, Tai Hwan; Park, Sung Ha

    2015-08-07

    We present a simple route to circumvent kinetic traps which affect many types of DNA nanostructures in their self-assembly process. Using this method, a new 2D DNA lattice made up of short, single-stranded tile (SST) motifs was created. Previously, the growth of SST DNA assemblies was restricted to 1D (tubes and ribbons) or finite-sized 2D (molecular canvases). By utilizing the substrate-assisted growth method, sets of SSTs were designed as unit cells to self-assemble into periodic and aperiodic 2D lattices which continuously grow both along and orthogonal to the helical axis. Notably, large-scale (∼1 μm(2)) fully periodic 2D lattices were fabricated using a minimum of just 2 strand species. Furthermore, the ability to create 2D lattices from a few motifs enables certain rules to be encoded into these SSTs to carry out algorithmic self-assembly. A set of these motifs was designed to execute simple 1-input 1-output COPY and NOT algorithms, the space-time manifestations which were aperiodic 2D algorithmic SST lattices. The methodology presented here can be straightforwardly applied to other motifs which fall into this type of kinetic trap to create novel DNA crystals.

  3. scid cells efficiently integrate hairpin and linear DNA substrates.

    Science.gov (United States)

    Staunton, J E; Weaver, D T

    1994-01-01

    The scid mouse mutation affects V(D)J rearrangement and double-strand break repair. scid V(D)J rearrangement is characterized by defective coding joint formation which prevents the development of mature B and T cells. Hairpin DNA has been implicated in the formation of V(D)J coding joints. We found scid cells to be proficient in hairpin processing in the context of DNA integration. In addition, we found that the scid defect did not impair integration of linear DNA via nonhomologous recombination. Therefore, hairpin processing and integration of DNA into the genome are distinct from hypersensitivity to ionizing radiation and the defect in V(D)J recombination. Images PMID:8196630

  4. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.

    1978-01-01

    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  5. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    Science.gov (United States)

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  6. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  7. Programmable autonomous synthesis of single-stranded DNA

    Science.gov (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

    2018-02-01

    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  8. Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages.

    Science.gov (United States)

    Kodaira, K; Godson, N G; Taketo, A

    1995-01-25

    The minus origins for complementary strand DNA synthesis (-ori) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, phi K, alpha 3, and St-1 closely resemble each other in DNA structure and contain two potential secondary hairpin loops (I and II) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the -ori regions of phi K and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the phi K mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several phi K and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway.

  9. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.

    1983-01-01

    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  10. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.

    1985-01-01

    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  11. Effect of secondary structure on the thermodynamics and kinetics of PNA hybridization to DNA hairpins

    DEFF Research Database (Denmark)

    Kushon, S A; Jordan, J P; Seifert, J L

    2001-01-01

    structures in both target and probe molecules are shown to depress the melting temperatures and free energies of the probe-target duplexes. Kinetic analysis of hybridization yields reaction rates that are up to 160-fold slower than hybridization between two unstructured strands. The thermodynamic and kinetic......-DNA and DNA-DNA duplexes can be formed with these target hairpins, even when the melting temperatures for the resulting duplexes are up to 50 degrees C lower than that of the hairpin target. Both hairpin/single-stranded and hairpin/hairpin interactions are considered in the scope of these studies. Secondary...

  12. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.

    1985-01-01

    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  13. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)

    student

    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  14. Improved single-strand DNA sizing accuracy in capillary electrophoresis.

    OpenAIRE

    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B

    1997-01-01

    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  15. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  16. Short hairpin-loop-structured oligodeoxynucleotides reduce HSV-1 replication

    Directory of Open Access Journals (Sweden)

    Heinrich Jochen

    2009-04-01

    Full Text Available Abstract The Herpes simplex virus (HSV is known as an infectious agent and widespread in the human population. The symptoms of HSV infections can range from mild to life threatening, especially in immune-compromised individuals. HSV infections are commonly treated with the guanosine analogue Aciclovir, but reports of resistance are increasing. Efforts are made to establish single-stranded antisense oligodeoxynucleotides (as and small interfering ribonucleic acids (siRNAs for antiviral treatment. Recently, another class of short interfering nucleic acids, partially double-stranded hairpin loop-structured 54 mer oligodeoxynucleotides (ODNs, was shown to allow hydrolysis of HIV RNA by binding to the viral RNA. This leads to a substrate for the viral RNase H. To assess the potential of such ODNs for inhibition of HSV-1 replication, five partially double-stranded ODNs were designed based on the sequences of known siRNAs against HSV-1 with antiviral activity. Three of them are directed against early and two against leaky late genes. Primary human lung fibroblasts, MRC-5, and African green monkey kidney cells, Vero, were transfected with ODNs and subsequently infected. The effect on HSV-1 replication was determined by analyzing the virus titer in cell culture supernatants by quantitative PCR and plaque assays. An inhibitory effect was observed with all five selected ODNs, with two cases showing statistical significance in both cell types. The observed effect was sequence-specific and dose dependent. In one case the ODN was more efficient than a previously described siRNA directed against the same target site in the mRNA of UL5, a component of the helicase/primase complex. HSV-1 virions and ODNs can be applied simultaneously without transfection reagent, but at a 50-fold higher concentration to Vero cells with similar efficiencies. The results underline the potential of partially double-stranded hairpin loop-structured ODNs as antiviral agents.

  17. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  18. Elastic properties of alternative versus single-stranded leveling archwires.

    Science.gov (United States)

    Rucker, Brian K; Kusy, Robert P

    2002-11-01

    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  19. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.

    1976-02-01

    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  20. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong

    2011-04-01

    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  1. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.

    1984-01-01

    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  2. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  3. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela

    2010-01-01

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  4. Genetic evidence for single-strand lesions initiating Nbs1-dependent homologous recombination in diversification of Ig v in chicken B lymphocytes.

    Directory of Open Access Journals (Sweden)

    Makoto Nakahara

    2009-01-01

    Full Text Available Homologous recombination (HR is initiated by DNA double-strand breaks (DSB. However, it remains unclear whether single-strand lesions also initiate HR in genomic DNA. Chicken B lymphocytes diversify their Immunoglobulin (Ig V genes through HR (Ig gene conversion and non-templated hypermutation. Both types of Ig V diversification are initiated by AID-dependent abasic-site formation. Abasic sites stall replication, resulting in the formation of single-stranded gaps. These gaps can be filled by error-prone DNA polymerases, resulting in hypermutation. However, it is unclear whether these single-strand gaps can also initiate Ig gene conversion without being first converted to DSBs. The Mre11-Rad50-Nbs1 (MRN complex, which produces 3' single-strand overhangs, promotes the initiation of DSB-induced HR in yeast. We show that a DT40 line expressing only a truncated form of Nbs1 (Nbs1(p70 exhibits defective HR-dependent DSB repair, and a significant reduction in the rate--though not the fidelity--of Ig gene conversion. Interestingly, this defective gene conversion was restored to wild type levels by overproduction of Escherichia coli SbcB, a 3' to 5' single-strand-specific exonuclease, without affecting DSB repair. Conversely, overexpression of chicken Exo1 increased the efficiency of DSB-induced gene-targeting more than 10-fold, with no effect on Ig gene conversion. These results suggest that Ig gene conversion may be initiated by single-strand gaps rather than by DSBs, and, like SbcB, the MRN complex in DT40 may convert AID-induced lesions into single-strand gaps suitable for triggering HR. In summary, Ig gene conversion and hypermutation may share a common substrate-single-stranded gaps. Genetic analysis of the two types of Ig V diversification in DT40 provides a unique opportunity to gain insight into the molecular mechanisms underlying the filling of gaps that arise as a consequence of replication blocks at abasic sites, by HR and error

  5. Development of an Interaction Assay between Single-Stranded Nucleic Acids Trapped with Silica Particles and Fluorescent Compounds

    Directory of Open Access Journals (Sweden)

    R. Maeda

    2012-09-01

    Full Text Available Biopolymers are easily denatured by heating, a change in pH or chemical substances when they are immobilized on a substrate. To prevent denaturation of biopolymers, we developed a method to trap a polynucleotide on a substrate by hydrogen bonding using silica particles with surfaces modified by aminoalkyl chains ([A-AM silane]/SiO2. [A-AM silane]/SiO2 was synthesized by silane coupling reaction of N-2-(aminoethyl-3-aminopropyltrimethoxysilane (A-AM silane with SiO2 particles with a diameter of 5 μm at 100 °C for 20 min. The surface chemical structure of [A-AM silane]/SiO2 was characterized by Fourier transform infrared spectroscopy and molecular orbital calculations. The surface of the silica particles was modified with A-AM silane and primary amine groups were formed. [A-AM silane]/SiO2 was trapped with single-stranded nucleic acids [(Poly-X; X = A (adenine, G (guanine and C (cytosine] in PBS solution at 37 °C for 1 h. The single-stranded nucleic acids were trapped on the surface of the [A-AM silane]/SiO2 by hydrogen bonding to form conjugated materials. The resulting complexes were further conjugated by derivatives of acridine orange (AO as fluorescent labels under the same conditions to form [AO:Poly-X:A-AM silane]/SiO2 complexes. Changes in the fluorescence intensity of these complexes originating from interactions between the single-stranded nucleic acid and aromatic compounds were also evaluated. The change in intensity displayed the order [AO: Poly-G: A-AM silane]/SiO2 > [AO:Poly-A:A-AM silane]/SiO2 >> [AO:Poly-C:A-AM silane]/SiO2. This suggests that the single-stranded nucleic acids conjugated with aminoalkyl chains on the surfaces of SiO2 particles and the change in fluorescence intensity reflected the molecular interaction between AO and the nucleic-acid base in a polynucleotide.

  6. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2003-01-01

    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  7. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos

    2015-09-01

    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  8. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-05

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity*

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.

    2015-01-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  10. Effect of Conformational Entropy on the Nanomechanics of Microcantilever-Based Single-Stranded DNA Sensors

    Directory of Open Access Journals (Sweden)

    Zou-Qing Tan

    2014-09-01

    Full Text Available An entropy-controlled bending mechanism is presented to study the nanomechanics of microcantilever-based single-stranded DNA (ssDNA sensors. First; the conformational free energy of the ssDNA layer is given with an improved scaling theory of thermal blobs considering the curvature effect; and the mechanical energy of the non-biological layer is described by Zhang’s two-variable method for laminated beams. Then; an analytical model for static deflections of ssDNA microcantilevers is formulated by the principle of minimum energy. The comparisons of deflections predicted by the proposed model; Utz–Begley’s model and Hagan’s model are also examined. Numerical results show that the conformational entropy effect on microcantilever deflections cannot be ignored; especially at the conditions of high packing density or long chain systems; and the variation of deflection predicted by the proposed analytical model not only accords with that observed in the related experiments qualitatively; but also appears quantitatively closer to the experimental values than that by the preexisting models. In order to improve the sensitivity of static-mode biosensors; it should be as small as possible to reduce the substrate stiffness.

  11. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.

    OpenAIRE

    Barany, F; Boeke, J D

    1983-01-01

    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  12. Functional analysis of multiple single-stranded DNA-binding proteins from Methanosarcina acetivorans and their effects on DNA synthesis by DNA polymerase BI.

    Science.gov (United States)

    Robbins, Justin B; Murphy, Mary C; White, Bryan A; Mackie, Roderick I; Ha, Taekjip; Cann, Isaac K O

    2004-02-20

    Single-stranded DNA-binding proteins and their functional homologs, replication protein A, are essential components of cellular DNA replication, repair and recombination. We describe here the isolation and characterization of multiple replication protein A homologs, RPA1, RPA2, and RPA3, from the archaeon Methanosarcina acetivorans. RPA1 comprises four single-stranded DNA-binding domains, while RPA2 and RPA3 are each composed of two such domains and a zinc finger domain. Gel filtration analysis suggested that RPA1 exists as homotetramers and homodimers in solution, while RPA2 and RPA3 form only homodimers. Unlike the multiple RPA proteins found in other Archaea and eukaryotes, each of the M. acetivorans RPAs can act as a distinct single-stranded DNA-binding protein. Fluorescence resonance energy transfer and fluorescence polarization anisotropy studies revealed that the M. acetivorans RPAs bind to as few as 10 single-stranded DNA bases. However, more stable binding is achieved with single-stranded DNA of 18-23 bases, and for such substrates the estimated Kd was 3.82 +/- 0.28 nM, 173.6 +/- 105.17 nM, and 5.92 +/- 0.23 nM, for RPA1, RPA2, and RPA3, respectively. The architectures of the M. acetivorans RPAs are different from those of hitherto reported homologs. Thus, these proteins may represent novel forms of replication protein A. Most importantly, our results show that the three RPAs and their combinations highly stimulate the primer extension capacity of M. acetivorans DNA polymerase BI. Although bacterial SSB and eukaryotic RPA have been shown to stimulate DNA synthesis by their cognate DNA polymerases, our findings provide the first in vitro biochemical evidence for the conservation of this property in an archaeon.

  13. Size estimation of complexes consisting of hairpin DNAs bound to an assembler-strand. [Abstract only

    Science.gov (United States)

    Baumann, Ulrich

    1994-01-01

    In connection with a model of a primitive translation based entirely on nucleic acids the structural requirements and interactions of small nucleic acids were studied. As shown previously hairpins bind to a complementary single-strand by base pairs of their loop nucleotides if the loop contains at least five nucleotides (Baumann et al 1987). Here, the question is approached to which degree a single-strand, the assembler-strand, is occupied with hairpin molecules. A gapless occupation would allow the close proximity necessary for the assumed peptide bond formation by hairpins bearing an amino acid at their 3'-end. Oligo(dC)(sub n), n = 12, 15, 18, and the investigated hairpins form complexes which are detectable under nondenaturing electrophoretic conditions. The size range is estimated to be 3-4 hairpin molecules to one assembler molecule when oligo(dC)(sub n), n = 15, 18, is used. Due to the limitation of the method, dependence of the migration velocity on the shape which is unique and thus limits the use of marker nucleic acids, and due to the uncertainty if the ends of the assembler form base pairs, a gapless occupation of the assembler is conceivable but not proven.

  14. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  15. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase.

    Science.gov (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias

    2017-06-02

    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses.

    Science.gov (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn

    2011-06-01

    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  17. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi

    1990-01-01

    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  18. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB).

    Science.gov (United States)

    van Loon, Barbara; Samson, Leona D

    2013-03-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  19. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der

    1988-01-01

    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  20. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.

    2002-01-01

    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit...

  1. Ion assisted structural collapse of a single stranded DNA: A molecular dynamics approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Soumadwip; Dixit, Himanshu; Chakrabarti, Rajarshi, E-mail: rajarshi@chem.iitb.ac.in

    2015-09-28

    Highlights: • The dynamics of a single-stranded DNA in presence of different concentrations of Mg{sup 2+} is investigated. • The initial DNA chain collapse is characterized by the formation of non-sequentially stacked base pairs. • The DNA chain re-swells at high concentrations of Mg{sup 2+} as a consequence of overcharging. - Abstract: The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counterions. It is well known that the structural collapse of DNA is favoured in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl{sub 2}) single stranded DNA with base sequence 5′-CGCGAATTCGCG-3′ (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  2. Dynamics of RecA filaments on single-stranded DNA

    NARCIS (Netherlands)

    Van Loenhout, M.T.J.; Van der Heijden, T.; Kanaar, R.; Wyman, C.; Dekker, C.

    2009-01-01

    RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on

  3. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2001-01-01

    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  4. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP

    1996-01-01

    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  5. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  6. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket.

    Science.gov (United States)

    Pham, Hanh T; Bergoin, Max; Tijssen, Peter

    2013-03-14

    The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  7. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket

    OpenAIRE

    Pham, Hanh T.; Bergoin, Max; Tijssen, Peter

    2013-01-01

    International audience; The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  8. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B

    2006-01-01

    by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  9. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud

    2012-06-01

    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  10. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    Science.gov (United States)

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  11. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.

    1982-01-01

    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  12. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    Science.gov (United States)

    Hong, Ka Lok

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  13. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification

    OpenAIRE

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-01-01

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen...

  14. In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides

    International Nuclear Information System (INIS)

    Oppenheim, Amos B.; Rattray, Alison J.; Bubunenko, Mikhail; Thomason, Lynn C.; Court, Donald L.

    2004-01-01

    We demonstrate that the bacteriophage λ Red functions efficiently recombine linear DNA or single-strand oligonucleotides (ss-oligos) into bacteriophage λ to create specific changes in the viral genome. Point mutations, deletions, and gene replacements have been created. While recombineering with oligonucleotides, we encountered other mutations accompanying the desired point mutational change. DNA sequence analysis suggests that these unwanted mutations are mainly frameshift deletions introduced during oligonucleotide synthesis

  15. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis.

    Science.gov (United States)

    Olszewski, Marcin; Mickiewicz, Małgorzata; Kur, Józef

    2008-07-01

    The thermophilic bacterium Thermoanaerobacter tengcongensis has two single-stranded DNA-binding (SSB) proteins, designated TteSSB2 and TteSSB3. In a SSB complementation assay in Escherichia coli, only TteSSB3 took over the in vivo function of EcoSSB. We have cloned the ssb genes obtained by PCR and have developed E. coli overexpression systems. The TteSSB2 and TteSSB3 consist of 153 and 150 amino acids with a calculated molecular mass of 17.29 and 16.96 kDa, respectively. They are the smallest known bacterial SSB proteins. The homology between amino acid sequences of these proteins is 40% identity and 53% similarity. They are functional as homotetramers, with each monomer encoding one single-stranded DNA binding domain (OB-fold). In fluorescence titrations with poly(dT), both proteins bind single-stranded DNA with a binding site size of about 40 nt per homotetramer. Thermostability with half-life of about 30 s at 95 degrees C makes TteSSB3 similar to the known SSB of Thermus aquaticus (TaqSSB). The TteSSB2 was fully active even after 6 h incubation at 100 degrees C. Here, we show for the first time paralogous thermostable homotetrameric SSBs, which could be an attractive alternative for known homodimeric thermostable SSB proteins in their applications for molecular biology methods and analytical purposes.

  16. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana.

    Science.gov (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L

    2005-04-01

    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  17. Intercalation of single-strand oligonucleotides between nucleolipid anionic membranes: a neutron diffraction study.

    Science.gov (United States)

    Milani, Silvia; Berti, Debora; Dante, Silvia; Hauss, Thomas; Baglioni, Piero

    2009-04-07

    This contribution presents a neutron diffraction investigation of anionic lamellar phases composed of mixtures of 1-palmitoyl, 2-oleoyl phosphatidyl-nucleosides (POPN, where N is either adenosine or uridine), and POPC (1-palmitoyl,2-oleoyl-phosphatidyl-choline). Their behavior is studied for two different mole ratios and in the presence of nucleic acids. The samples are formed by the evaporation of liposomal dispersions prepared in water or in solutions containing single-strand oligonucleotides. Previous small angle X-ray scattering (SAXS) experiments on the system POPA/polyU (polyuridylic acid, high degree of polymerization, synthetic ribonucleic acid) proved that the insertion and ordering of the biopolymer in the phospholipid lamellae were driven by molecular recognition. In the present study, we extend the previous investigation to single-strand monodisperse oligonucleotides (50-mers). Structural details of the membranes were obtained from the analysis of the neutron diffraction scattering length density profiles. The evidence of direct and specific interactions, driven by molecular recognition between the nucleic polar heads of the nucleolipid and the single-strand nucleic acid, is strengthened by the comparison with identically charged bilayers formed by POPG/POPC. These results contribute to the understanding of the parameters governing the interactions between nucleolipid membranes and oligonucleotides, providing a novel strategy for the design of lipid-based vehicles for nucleic acids.

  18. Stretching and controlled motion of single-stranded DNA in locally heated solid-state nanopores.

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B; Aksimentiev, Aleksei

    2013-08-27

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4-8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA.

  19. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  20. Repair of ultraviolet light damage in Saccharomyces cerevisiae as studied with double- and single-stranded incoming DNAs

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, D.; Hieda, K.

    1992-01-01

    Purified double- and single-stranded DNAs of the autonomously replicating vector M13RK9-T were irradiated with ultraviolet light (UV) in vitro and introduced into competent whole cells of Saccharomyces cerevisiae. Incoming double-stranded DNA was more sensitive to UV in excision repair-deficient rad2-1 cells than in proficient repair RAD + cells, while single-stranded DNA exhibited high sensitivity in both host cells. The results indicate that in yeast there is no effective rescue of UV-incoming single-stranded DNA by excision repair or other constitutive dark repair processes

  1. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks.

    Science.gov (United States)

    Pachkowski, Brian; Nakamura, Jun

    2013-01-01

    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  2. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)

    2012-04-04

    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  3. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)

    2015-04-22

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  4. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.

    1980-01-01

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  5. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth

    2014-01-01

    . We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices......Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells...

  6. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela

    2015-01-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  7. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted

    2014-01-01

    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  8. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams

    2014-01-01

    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  9. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng

    2015-05-08

    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  10. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    Science.gov (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora.

    Science.gov (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E

    2003-08-01

    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  12. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Science.gov (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  13. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification.

    Science.gov (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-10-07

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  14. Empirical model for matching spectrophotometric reflectance of yarn windings and multispectral imaging reflectance of single strands of yarns.

    Science.gov (United States)

    Luo, Lin; Shen, Hui-Liang; Shao, Si-Jie; Xin, John

    2015-08-01

    The state-of-the-art multispectral imaging system can directly acquire the reflectance of a single strand of yarn that is impossible for traditional spectrophotometers. Instead, the spectrophotometric reflectance of a yarn winding, which is constituted by yarns wound on a background card, is regarded as the yarn reflectance in textile. While multispectral imaging systems and spectrophotometers can be separately used to acquire the reflectance of a single strand of yarn and corresponding yarn winding, the quantitative relationship between them is not yet known. In this paper, the relationship is established based on models that describe the spectral response of a spectrophotometer to a yarn winding and that of a multispectral imaging system to a single strand of yarn. The reflectance matching function from a single strand of yarn to corresponding yarn winding is derived to be a second degree polynomial function, which coefficients are the solutions of a constrained nonlinear optimization problem. Experiments on 100 pairs of samples show that the proposed approach can reduce the color difference between yarn windings and single strands of yarns from 2.449 to 1.082 CIEDE2000 units. The coefficients of the optimal reflection matching function imply that the reflectance of a yarn winding measured by a spectrophotometer consists of not only the intrinsic reflectance of yarn but also the nonignorable interreflection component between yarns.

  15. Design of a new hairpin DNAzyme: The activity controlled by TMPyP ...

    African Journals Online (AJOL)

    The catalytic activity of the 10-23 hairpin DNAzyme decreased and even inactivated due to the enhanced stability of G-quadruplex structure by TMPyP4 molecules. This DNAzyme is controllable to cleavage substrate and has some potential significance in gene therapy. Key words: 10-23 DNAzyme, hairpin DNAzyme, ...

  16. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  17. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan

    2015-01-01

    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  18. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik

    1992-04-01

    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  19. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.

    1987-01-01

    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  20. Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Gust, I.D.; Feinstone, S.M.; Purcell, R.H.; Alter, H.J.

    1980-01-01

    A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

  1. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata).

    Science.gov (United States)

    Jackson, Elliot W; Bistolas, Kalia S I; Button, Jason B; Hewson, Ian

    2016-01-01

    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates.

  2. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.

    1980-01-01

    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  3. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux

    2016-12-01

    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  4. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  5. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif

    Science.gov (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  6. Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1

    DEFF Research Database (Denmark)

    Yang, Jay; Bachrati, Csanad Z; Ou, Jiongwen

    2010-01-01

    -passage mechanism. We generated single-stranded catenanes that resemble the proposed dissolution intermediate recognized by human topoisomerase IIIalpha. We demonstrate that human topoisomerase IIIalpha is a single-stranded DNA decatenase that is specifically stimulated by the BLM-RMI1 pair. In addition, RMI1......Human topoisomerase IIIalpha is a type IA DNA topoisomerase that functions with BLM and RMI1 to resolve DNA replication and recombination intermediates. BLM, human topoisomerase IIIalpha, and RMI1 catalyze the dissolution of double Holliday junctions into noncrossover products via a strand...

  7. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.

    1988-01-01

    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  8. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.

    2012-01-01

    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  9. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues

    Science.gov (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak

    2006-01-01

    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  10. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes

    Science.gov (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.

    2015-01-01

    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  11. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair

    Science.gov (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.

    2009-01-01

    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  12. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol

    2010-05-01

    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  13. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.

    2007-01-01

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  14. Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems.

    Science.gov (United States)

    Musumeci, Domenica; Rozza, Lucia; Merlino, Antonello; Paduano, Luigi; Marzo, Tiziano; Massai, Lara; Messori, Luigi; Montesarchio, Daniela

    2015-08-21

    The interaction of the anticancer Ru(iii) complex AziRu - in comparison with its analogue NAMI-A, currently in advanced clinical trials as an antimetastatic agent - with DNA model systems, both single stranded and duplex oligonucleotides, was investigated using a combined approach, including absorption UV-vis spectroscopy, circular dichroism (CD) and electrospray mass spectrometry (ESI-MS) techniques. UV-vis absorption spectra of the Ru complexes were recorded at different times in a pseudo-physiological solution, to monitor the ligand exchange processes in the absence and in the presence of the examined oligonucleotides. CD experiments provided information on the overall conformational changes of the DNA model systems induced by these metal complexes. UV- and CD-monitored thermal denaturation studies were performed to analyse the effects of AziRu and NAMI-A on the stability of the duplex structures. ESI-MS experiments, carried out on the oligonucleotide/metal complex mixtures under investigation, allowed us to detect the formation of stable adducts between the guanine-containing oligomers and the ruthenium complexes. These data unambiguously demonstrate that both AziRu and NAMI-A can interact with the DNA model systems. Although very similar in their structures, the two metal compounds manifest a markedly different reactivity with the examined sequences, respectively, with either a naked Ru(3+) ion or a Ru(Im)(3+) (Im = imidazole) fragment being incorporated into the oligonucleotide structure via stable linkages.

  15. Biophysical characterization of the association of histones with single-stranded DNA.

    Science.gov (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier

    2017-11-01

    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong

    2008-01-01

    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  17. In vitro selection and characterization of single stranded DNA aptamers for luteolin: A possible recognition tool.

    Science.gov (United States)

    Tuma Sabah, Jinan; Zulkifli, Razauden Mohamed; Shahir, Shafinaz; Ahmed, Farediah; Abdul Kadir, Mohammed Rafiq; Zakaria, Zarita

    2018-03-06

    Distinctive bioactivities possessed by luteolin (3', 4', 5, 7-tetrahydroxy-flavone) are advantageous for sundry practical applications. This paper reports the in vitro selection and characterization of single stranded-DNA (ssDNA) aptamers, specific for luteolin (LUT). 76-mer library containing 1015 randomized ssDNA were screened via systematic evolution of ligands by exponential enrichment (SELEX). The recovered ssDNA pool from the 8th round was amplified with unlabeled primers and cloned into PSTBlue-1 vector prior to sequencing. 22 of LUT-binding aptamer variants were further classified into one of the seven groups based on their N40 random sequence regions, wherein one representative from each group was characterized. The dissociation constant of aptamers designated as LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively with high binding affinity towards LUT. Prediction analysis of the secondary structure suggested discrete features with typical loop and stem motifs. Furthermore, LUT#3 displayed higher specificity with insignificant binding toward kaempferol and quercetin despite its structural and functional similarity compared to LUT#28 and LUT#20. Further LUT#3 can detect free luteolin within 0.2-1 mM in solution. It was suggested that LUT#3 aptamer were the most suitable for LUT recognition tool at laboratory scale based on the condition tested. Copyright © 2018. Published by Elsevier Inc.

  18. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska

    2017-12-01

    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  19. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.

    1985-01-01

    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  20. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  1. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.

    1987-01-01

    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  2. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks.

    Science.gov (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P

    2012-09-01

    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  3. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  4. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.

    1995-01-01

    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  5. Distinct circular single-stranded DNA viruses exist in different soil types.

    Science.gov (United States)

    Reavy, Brian; Swanson, Maud M; Cock, Peter J A; Dawson, Lorna; Freitag, Thomas E; Singh, Brajesh K; Torrance, Lesley; Mushegian, Arcady R; Taliansky, Michael

    2015-06-15

    The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  6. A high throughput system for the preparation of single stranded templates grown in microculture.

    Science.gov (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M

    1994-01-01

    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  7. Complex shapes self-assembled from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng

    2012-05-30

    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  8. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)

    1994-09-01

    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  9. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  10. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

    Science.gov (United States)

    Richardson, Tomas T; Harran, Omar; Murray, Heath

    2016-06-16

    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

  11. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  12. Electrical conduction and photoresponses of gamma-ray-irradiated single-stranded DNA/single-walled carbon nanotube composite systems

    Energy Technology Data Exchange (ETDEWEB)

    Hong, W.; Lee, E.M.; Kim, D.W.; Lee, Cheol Eui, E-mail: rscel@korea.ac.kr

    2015-04-15

    Highlights: •Effects of gamma-ray irradiation on single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. •Barrier for thermally activated conduction in the composite systems modified by the gamma-ray irradiation. •Photoresponses reveal photoexcitation and oxygen photodesorption modified by gamma-ray irradiation. -- Abstract: Effects of gamma-ray irradiation on the electrical conductivity and photoresponse have been studied for single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. The temperature-dependent electrical conductivity of the ssDNA/SWNT composite films, well described by a fluctuation-induced tunneling model, indicated modification of the barrier for thermally activated conduction by the gamma-ray irradiation. Besides, the photoresponse measurements indicated modified photoexcited charge carrier generation and oxygen photodesorption in the composite systems due to the gamma-ray irradiation.

  13. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.

    2006-01-01

    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  14. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    Science.gov (United States)

    2014-09-30

    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  15. Selective binding and reverse transcription inhibition of single-strand poly(A) RNA by metal TMPyP complexes.

    Science.gov (United States)

    Zhou, Zhu-Xin; Gao, Feng; Chen, Xing; Tian, Xiang-Jing; Ji, Liang-Nian

    2014-10-06

    Ni-, Cu-, and Zn-TMPyP are capable of binding to single-strand poly(A) RNA with high preference and affinity and inhibiting the reverse transcription of RNA by both M-MuLV and HIV-1 reverse transcriptase. With 10 nM azidothymidine, the IC50 value of M-TMPyP could be lowered to 10(-1) μM order.

  16. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.

    2013-01-01

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  17. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.

    1977-01-01

    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  18. The Adsorption of Short Single-Stranded DNA Oligomers on Mineral Surfaces

    Science.gov (United States)

    Kopstein, M.; Sverjensky, D. A.; Hazen, R. M.; Cleaves, H. J.

    2009-12-01

    Previous studies have described feasible pathways for the synthesis of simple organic building blocks such as formaldehyde and hydrogen cyanide, and their reaction to form more complex biomolecules such as nucleotide bases, amino acids and sugars (Miller and Orgel 1974, Miller and Cleaves 2006). However, the polymerization of monomers into a useful genetic material remains problematic (Orgel 2004). Organic building blocks were unlikely to polymerize from very dilute aqueous solution in the primitive oceans. Mineral surface adsorption has been suggested as a possible mechanism for concentrating the necessary building blocks (Bernal 1951). This study focused on the adsorption behavior of single-stranded DNA homo-oligomers of adenine and thymine (including the monomers, dimers, tetramers, hexamers, octomers, and decamers) with five different mineral surfaces (pyrite, rutile, hematite, olivine and calcite). Adsorption was studied in 0.1 M pH 8.1 KHCO3 with0.05 M NaCl as background electrolyte. Solutions were mixed for 24 hours at room temperature, centrifuged and the supernatants analyzed by UV/visible spectrophotometry. Equilibrium solution concentrations were measured and used to determine the number of moles adsorbed per square meter. Langmuir isotherms were constructed using the experimental data. It was found that adenine-containing molecules tend to bind much more strongly than thymine-containing molecules. It was also found that the number of moles adsorbed at saturation tends to fall with increasing chain length, while adsorption affinity tends to rise. Oligomer length appears to affect adsorption more than the mineral type. These results may have implications for the primordial organization of the first nucleic acid molecules as the persistence of extra-cellular nucleic acids in the environment. References Bernal, J. D. (1951) The Physical Basis of Life (Routledge, London). Miller S.L. and Cleaves, H.J. (2006) Prebiotic chemistry on the primitive Earth. In

  19. Role of electrostatics in the assembly pathway of a single-stranded RNA virus.

    Science.gov (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M

    2014-09-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  20. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids.

    Science.gov (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R

    2015-04-08

    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  1. RNA binding to APOBEC3G induces the disassembly of functional deaminase complexes by displacing single-stranded DNA substrates

    Science.gov (United States)

    Polevoda, Bogdan; McDougall, William M.; Tun, Bradley N.; Cheung, Michael; Salter, Jason D.; Friedman, Alan E.; Smith, Harold C.

    2015-01-01

    APOBEC3G (A3G) DNA deaminase activity requires a holoenzyme complex whose assembly on nascent viral reverse transcripts initiates with A3G dimers binding to ssDNA followed by formation of higher-order A3G homo oligomers. Catalytic activity is inhibited when A3G binds to RNA. Our prior studies suggested that RNA inhibited A3G binding to ssDNA. In this report, near equilibrium binding and gel shift analyses showed that A3G assembly and disassembly on ssDNA was an ordered process involving A3G dimers and multimers thereof. Although, fluorescence anisotropy showed that A3G had similar nanomolar affinity for RNA and ssDNA, RNA stochastically dissociated A3G dimers and higher-order oligomers from ssDNA, suggesting a different modality for RNA binding. Mass spectrometry mapping of A3G peptides cross-linked to nucleic acid suggested ssDNA only bound to three peptides, amino acids (aa) 181–194 in the N-terminus and aa 314–320 and 345–374 in the C-terminus that were part of a continuous exposed surface. RNA bound to these peptides and uniquely associated with three additional peptides in the N- terminus, aa 15–29, 41–52 and 83–99, that formed a continuous surface area adjacent to the ssDNA binding surface. The data predict a mechanistic model of RNA inhibition of ssDNA binding to A3G in which competitive and allosteric interactions determine RNA-bound versus ssDNA-bound conformational states. PMID:26424853

  2. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    Science.gov (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system.

    Science.gov (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus

    2011-04-06

    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  4. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes

    OpenAIRE

    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  5. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity.

    Science.gov (United States)

    Monnet, Jordan; Kozelka, Jiří

    2012-10-01

    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris

    2016-01-01

    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA-binding pro......Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...... leads to enhanced cooperative binding to DNA.Conclusions: Our findings contribute to the emerging picture that bacterial proteins, exemplified here by SsbA, undergo phosphorylation at multiple residues. This results in a complex regulation of cellular functions, and suggests that the complexity...

  7. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  8. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide

    Science.gov (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio

    1998-01-01

    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  9. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism.

    Science.gov (United States)

    Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong

    2016-07-01

    A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.

  10. Characterization of the single-stranded DNA binding protein pV(VGJΦ) of VGJΦ phage from Vibrio cholerae.

    Science.gov (United States)

    Falero, Alina; Caballero, Andy; Trigueros, Sonia; Pérez, Celso; Campos, Javier; Marrero, Karen; Fando, Rafael

    2011-09-01

    pV(VGJΦ), a single-stranded DNA binding protein of the vibriophage VGJΦ was subject to biochemical analysis. Here, we show that this protein has a general affinity for single-stranded DNA (ssDNA) as documented by Electrophoretic Mobility Shift Assay (EMSA). The apparent molecular weight of the monomer is about 12.7kDa as measured by HPLC-SEC. Moreover, isoelectrofocusing showed an isoelectric point for pV(VGJΦ) of 6.82 pH units. Size exclusion chromatography in 150mM NaCl, 50mM sodium phosphate buffer, pH 7.0 revealed a major protein species of 27.0kDa, suggesting homodimeric protein architecture. Furthermore, pV(VGJΦ) binds ssDNA at extreme temperatures and the complex was stable after extended incubation times. Upon frozen storage at -20°C for a year the protein retained its integrity, biological activity and oligomericity. On the other hand, bioinformatics analysis predicted that pV(VGJΦ) protein has a disordered C-terminal, which might be involved in its functional activity. All the aforementioned features make pV(VGJΦ) interesting for biotechnological applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles.

    Science.gov (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng

    2015-11-21

    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  12. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.

    1978-01-01

    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  13. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail: meicun2006@163.com; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

    2016-12-01

    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  14. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  15. Highly stable triple helix formation by homopyrimidine (l)-acyclic threoninol nucleic acids with single stranded DNA and RNA

    DEFF Research Database (Denmark)

    Kumar, Vipin; Kesavan, Venkitasamy; Gothelf, Kurt Vesterager

    2015-01-01

    Acyclic (l)-threoninol nucleic acid (aTNA) containing thymine, cytosine and adenine nucleobases were synthesized and shown to form surprisingly stable triplexes with complementary single stranded homopurine DNA or RNA targets. The triplex structures consist of two (l)-aTNA strands and one DNA...... or RNA, and these triplexes are significantly stronger than the corresponding DNA or RNA duplexes as shown in competition experiments. As a unique property the (l)-aTNAs exclusively form triplex structures with DNA and RNA and no duplex structures are observed by gel electrophoresis. The results were...... compared to the known enantiomer (d)-aTNA, which forms much weaker triplexes depending upon temperature and time. It was demonstrated that (l)-aTNA triplexes are able to stop primer extension on a DNA template, showing the potential of (l)-aTNA for antisense applications....

  16. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample.

    Science.gov (United States)

    Cui, Lunbiao; Wu, Binyao; Zhu, Xiaojuan; Guo, Xiling; Ge, Yiyue; Zhao, Kangchen; Qi, Xian; Shi, Zhiyang; Zhu, Fengcai; Sun, Lixin; Zhou, Minghao

    2017-11-01

    Metagenomic analysis through high-throughput sequencing is a tool for detecting both known and novel viruses. Using this technique, a novel circular single-stranded DNA (ssDNA) virus genome was discovered in respiratory secretions from a febrile traveler. The virus, named human respiratory-associated PSCV-5-like virus (HRAPLV), has a genome comprising 3,018 bases, with two major putative ORFs inversely encoding capsid (Cap) and replicase (Rep) protein and separated by two intergenic regions. One stem-loop structure was predicted in the larger intergenic region (LIR). The predicted amino acid sequences of the Cap and Rep proteins of HRAPLV showed highest identity to those of porcine stool-associated circular virus 5 isolate CP3 (PoSCV 5) (53.0% and 48.9%, respectively). The host tropism of the virus is unknown, and further study is warranted to determine whether this novel virus is associated with human disease.

  17. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Vrushali S. [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Gokhale, Suresh P.; Patil, Kashinath R. [Physical and Material Chemistry Division, National Chemical Laboratory, Pune (India); Haram, Santosh K., E-mail: haram@chem.unipune.ernet.i [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)

    2010-02-15

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 +- 2 mum and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, alpha-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k{sup 0}) and electron transfer coefficient (alpha) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  18. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    International Nuclear Information System (INIS)

    Joshi, Vrushali S.; Gokhale, Suresh P.; Patil, Kashinath R.; Haram, Santosh K.

    2010-01-01

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 ± 2 μm and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, α-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k 0 ) and electron transfer coefficient (α) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  19. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  20. Quenching of Single-Walled Carbon Nanotube Fluorescence by Dissolved Oxygen Reveals Selective Single-Stranded DNA Affinities.

    Science.gov (United States)

    Zheng, Yu; Bachilo, Sergei M; Weisman, R Bruce

    2017-05-04

    The selective interactions between short oligomers of single-stranded DNA (ssDNA) and specific structures of single-walled carbon nanotubes have been exploited in powerful methods for nanotube sorting. We report here that nanotubes coated with ssDNA also display selective interactions through the selective quenching of nanotube fluorescence by dissolved oxygen. In aqueous solutions equilibrated under 1 atm of O 2 , emission intensity from semiconducting nanotubes is reduced by between 9 and 40%, varying with the combination of ssDNA sequence and nanotube structure. This quenching reverses promptly and completely on the removal of dissolved O 2 and may be due to physisorption on nanotube surfaces. Fluorescence quenching offers a simple, nondestructive approach for studying the structure-selective interactions of ssDNA with single-walled carbon nanotubes and identifying recognition sequences.

  1. Surface treatment on amorphous InGaZnO4 thin film for single-stranded DNA biosensing

    Science.gov (United States)

    Sun, Dali; Matsui, Hiroaki; Wu, Chun-Nan; Tabata, Hitoshi

    2015-01-01

    Amorphous InGaZnO4 (aIGZO) has been widely used as a transparent semiconductor. However, no research has been found yet applying aIGZO to biosensing. This paper examined the single strand DNA (ssDNA) immobilization on aIGZO by absorption with a comparison to ITO, which is the first step for many biosensing schemas. The DNA quantification by florescence intensity shows that the absorption capacity of aIGZO film to ssDNA is 6.7 times greater than that of ITO. XPS and contact angle analysis proved the high DNA absorption affinity on aIGZO film is related to its high effectiveness to OH- attachment. A feasible method to immobilized ssDNA on aIGZO thin film is evaluated in this paper, and consequently, enables a possible approach to apply aIGZO in biosensing.

  2. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol

    2013-01-01

    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  3. Structure of a Stable G-Hairpin

    Czech Academy of Sciences Publication Activity Database

    Gajarský, M.; Zivkovic, M.L.; Stadlbauer, Petr; Pagano, B.; Fiala, R.; Amato, J.; Tomáška, L´.; Šponer, Jiří; Plavec, J.; Trantírek, L.

    2017-01-01

    Roč. 139, č. 10 (2017), s. 3591-3594 ISSN 0002-7863 R&D Projects: GA ČR GA13-28310S; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : g-quadruplex structures * human telomeric dna * single-stranded- dna * g-triplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 13.858, year: 2016

  4. Hairpins under tension: RNA versus DNA.

    Science.gov (United States)

    Bercy, Mathilde; Bockelmann, Ulrich

    2015-11-16

    We use optical tweezers to control the folding and unfolding of individual DNA and RNA hairpins by force. Four hairpin molecules are studied in comparison: two DNA and two RNA ones. We observe that the conformational dynamics is slower for the RNA hairpins than for their DNA counterparts. Our results indicate that structures made of RNA are dynamically more stable. This difference might contribute to the fact that DNA and RNA play fundamentally different biological roles in spite of chemical similarity. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana.

    Science.gov (United States)

    Olszewski, Marcin; Grot, Anna; Wojciechowski, Marek; Nowak, Marta; Mickiewicz, Małgorzata; Kur, Józef

    2010-10-15

    In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. We report the characterization of single-stranded DNA binding proteins (SSBs) from the thermophilic bacteria Thermotoga maritima (TmaSSB) and Thermotoga neapolitana (TneSSB). They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively). They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold) in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC) the melting temperature (Tm) was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR).

  6. Charge enhancement of single-stranded DNA in negative electrospray ionization using the supercharging reagent meta-nitrobenzyl alcohol.

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1% m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1% m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  7. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  8. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata

    2010-10-01

    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  9. Aptamer based voltammetric determination of ampicillin using a single-stranded DNA binding protein and DNA functionalized gold nanoparticles.

    Science.gov (United States)

    Wang, Jun; Ma, Kui; Yin, Huanshun; Zhou, Yunlei; Ai, Shiyun

    2017-12-20

    An aptamer based method is described for the electrochemical determination of ampicillin. It is based on the use of DNA aptamer, DNA functionalized gold nanoparticles (DNA-AuNPs), and single-stranded DNA binding protein (ssDNA-BP). When the aptamer hybridizes with the target DNA on the AuNPs, the ssDNA-BP is captured on the electrode surface via its specific interaction with ss-DNA. This results in a decreased electrochemical signal of the redox probe Fe(CN) 6 3- which is measured best at a voltage of 0.188 mV (vs. reference electrode). In the presence of ampicillin, the formation of aptamer-ampicillin conjugate blocks the further immobilization of DNA-AuNPs and ssDNA-BP, and this leads to an increased response. The method has a linear reposne that convers the 1 pM to 5 nM ampicillin concentration range, with a 0.38 pM detection limit (at an S/N ratio of 3). The assay is selective, stable and reproducible. It was applied to the determination of ampicillin in spiked milk samples where it gave recoveries ranging from 95.5 to 105.5%. Graphical abstract Schematic of a simple and sensitive electrochemical apta-biosensor for ampicillin detection. It is based on the use of gold nanoparticles (AuNPs), DNA aptamer, DNA functionalized AuNPs (DNA-AuNPs), and single-strand DNA binding protein (SSBP).

  10. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.

    1994-01-01

    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  11. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian

    2012-07-06

    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  12. An enzyme-catalyzed multistep DNA refolding mechanism in hairpin telomere formation.

    Directory of Open Access Journals (Sweden)

    Ke Shi

    Full Text Available Hairpin telomeres of bacterial linear chromosomes are generated by a DNA cutting-rejoining enzyme protelomerase. Protelomerase resolves a concatenated dimer of chromosomes as the last step of chromosome replication, converting a palindromic DNA sequence at the junctions between chromosomes into covalently closed hairpins. The mechanism by which protelomerase transforms a duplex DNA substrate into the hairpin telomeres remains largely unknown. We report here a series of crystal structures of the protelomerase TelA bound to DNA that represent distinct stages along the reaction pathway. The structures suggest that TelA converts a linear duplex substrate into hairpin turns via a transient strand-refolding intermediate that involves DNA-base flipping and wobble base-pairs. The extremely compact di-nucleotide hairpin structure of the product is fully stabilized by TelA prior to strand ligation, which drives the reaction to completion. The enzyme-catalyzed, multistep strand refolding is a novel mechanism in DNA rearrangement reactions.

  13. Identification and characterization of single-stranded DNA-binding protein from the facultative psychrophilic bacteria Pseudoalteromonas haloplanktis.

    Science.gov (United States)

    Olszewski, Marcin; Nowak, Marta; Cyranka-Czaja, Anna; Kur, Józef

    2014-01-01

    Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism such as DNA replication, repair, and recombination, and is essential for cell survival. This study reports on the ssb-like gene cloning, gene expression and characterization of a single-stranded DNA-binding protein of Pseudoalteromonas haloplanktis (PhaSSB) and is the first report of such a protein from psychrophilic microorganism. PhaSSB possesses a high sequence similarity to Escherichia coli SSB (48% identity and 57% similarity) and has the longest amino acid sequence (244 amino acid residues) of all the known bacterial SSBs with one OB-fold per monomer. An analysis of purified PhaSSB by means of chemical cross-linking experiments, sedimentation analysis and size exclusion chromatography revealed a stable tetramer in solution. Using EMSA, we characterized the stoichiometry of PhaSSB complexed with a series of ssDNA homopolymers, and the size of the binding site was determined as being approximately 35 nucleotides long. In fluorescence titrations, the occluded site size of PhaSSB on poly(dT) is 34 nucleotides per tetramer under low-salt conditions (2mM NaCl), but increases to 54-64 nucleotides at higher-salt conditions (100-300mM NaCl). This suggests that PhaSSB undergoes a transition between ssDNA binding modes, which is observed for EcoSSB. The binding properties of PhaSSB investigated using SPR technology revealed that the affinity of PhaSSB to ssDNA is typical of SSB proteins. The only difference in the binding mode of PhaSSB to ssDNA is a faster association phase, when compared to EcoSSB, though compensated by faster dissociation rate. When analyzed by differential scanning calorimetry (DSC), the melting temperature (Tm) was determined as 63 °C, which is only a few degrees lower than for EcoSSB. Copyright © 2013 Elsevier GmbH. All rights reserved.

  14. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  15. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii.

    Science.gov (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten

    2012-01-01

    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  16. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der

    1978-01-01

    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  17. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.

    1982-01-01

    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  18. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

    1982-01-01

    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  19. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.

    2006-01-01

    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  20. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  1. EFFECTOR OF TRANSCRIPTION2 is involved in xylem differentiation and includes a functional DNA single strand cutting domain.

    Science.gov (United States)

    Ivanov, Rumen; Tiedemann, Jens; Czihal, Andreas; Schallau, Anna; Diep, Le Hong; Mock, Hans-Peter; Claus, Bernhard; Tewes, Annegret; Bäumlein, Helmut

    2008-01-01

    EFFECTORS OF TRANSCRIPTION2 (ET) are plant-specific regulatory proteins characterized by the presence of two to five C-terminal DNA- and Zn-binding repeats, and a highly conserved cysteine pattern. We describe the structural characterization of the three member Arabidopsis thaliana ET gene family and reveal some allelic sequence polymorphisms. A mutation analysis showed that AtET2 affects the expression of various KNAT genes involved in the maintenance of the undifferentiated state of cambial meristem cells. It also plays a role in the regulation of GA5 (gibberellin 3-beta-dioxygenase) and the cell-cycle-related GASA4. A correlation was established between AtET2 expression and the cellular differentiation state. AtET-GFP fusion proteins shuttle between the cytoplasm and nucleus, with the AtET2 product prevented from entering the nucleus in non-differentiating cells. Within the nucleus, AtET2 probably acts via a single strand cutting domain. A more general regulatory role for ET factors is proposed, governing cell differentiation in cambial meristems, a crucial process for the development of plant vascular tissues.

  2. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.

    1985-01-01

    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  3. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA

    Science.gov (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana

    2009-04-01

    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  4. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia

    2009-01-01

    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  5. Capillary electrophoresis ribosomal RNA single-stranded conformation polymorphism: a new approach for characterization of low-diversity microbial communities.

    Science.gov (United States)

    Nai, Yi H; Zemb, Oliver; Gutierrez-Zamora, Maria-Luisa; Manefield, Mike; Powell, Shane M; Breadmore, Michael C

    2012-10-01

    Capillary electrophoresis (CE) has been the principle system for nucleic acid analysis since the early 1990s due to its inherent advantages such as fast analysis time, high resolution and efficiency, minimal sample requirement, high detection sensitivity, and automation. In the past few decades, microbial community fingerprinting methods such as terminal restriction fragment length polymorphism and single-stranded conformation polymorphism (SSCP) have migrated to CE to utilize its advantages over conventional slab gel electrophoresis. Recently, a gel-based direct rRNA fingerprint method was demonstrated. Different from other existing microbial community characterization approaches, this novel approach is polymerase chain reaction free and capable of providing information on the relative abundance of rRNA from individual phylotypes in low-diversity samples. As a gel-based method, it has a long analysis time and relatively large reagent and sample requirements. Here, we addressed these limitations by transferring the RNA fingerprint approach to the CE platform. Analysis time significantly improved from 24 h to 60 min, and the use of a fluorescently labeled hybridization probe as the detection strategy decreased the sample requirement by ten-fold. The combination of fast analysis time, low sample requirement, and sensitive fluorescence detection makes CE-RNA-SSCP an appealing new approach for characterizing low-diversity microbial communities.

  6. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))

    1993-03-01

    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  7. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA.

    Science.gov (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi

    2008-03-28

    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  8. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  9. Assessing single-stranded oligonucleotide drug-induced effects in vitro reveals key risk factors for thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Sabine Sewing

    Full Text Available Single-stranded oligonucleotides (ON comprise a promising therapeutic platform that enables selective modulation of currently undruggable targets. The development of novel ON drug candidates has demonstrated excellent efficacy, but in certain cases also some safety liabilities were reported. Among them are events of thrombocytopenia, which have recently been evident in late stage trials with ON drugs. The underlying mechanisms are poorly understood and the risk for ON candidates causing such events cannot be sufficiently assessed pre-clinically. We investigated potential thrombocytopenia risk factors of ONs and implemented a set of in vitro assays to assess these risks. Our findings support previous observations that phosphorothioate (PS-ONs can bind to platelet proteins such as platelet collagen receptor glycoprotein VI (GPVI and activate human platelets in vitro to various extents. We also show that these PS-ONs can bind to platelet factor 4 (PF4. Binding to platelet proteins and subsequent activation correlates with ON length and connected to this, the number of PS in the backbone of the molecule. Moreover, we demonstrate that locked nucleic acid (LNA ribosyl modifications in the wings of the PS-ONs strongly suppress binding to GPVI and PF4, paralleled by markedly reduced platelet activation. In addition, we provide evidence that PS-ONs do not directly affect hematopoietic cell differentiation in culture but at higher concentrations show a pro-inflammatory potential, which might contribute to platelet activation. Overall, our data confirm that certain molecular attributes of ONs are associated with a higher risk for thrombocytopenia. We propose that applying the in vitro assays discussed here during the lead optimization phase may aid in deprioritizing ONs with a potential to induce thrombocytopenia.

  10. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA.

    Science.gov (United States)

    Rogers, Cody M; Bochman, Matthew L

    2017-05-13

    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold.

    Science.gov (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G

    2005-05-24

    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  12. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage

    Science.gov (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio

    1998-01-01

    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  13. Slowing single-stranded DNA translocation through a solid-state nanopore by decreasing the nanopore diameter.

    Science.gov (United States)

    Akahori, Rena; Haga, Takanobu; Hatano, Toshiyuki; Yanagi, Itaru; Ohura, Takeshi; Hamamura, Hirotaka; Iwasaki, Tomio; Yokoi, Takahide; Anazawa, Takashi

    2014-07-11

    To slow the translocation of single-stranded DNA (ssDNA) through a solid-state nanopore, a nanopore was narrowed, and the effect of the narrowing on the DNA translocation speed was investigated. In order to accurately measure the speed, long (5.3 kb) ssDNA (namely, ss-poly(dA)) with uniform length (±0.4 kb) was synthesized. The diameters of nanopores fabricated by a transmission electron microscope were controlled by atomic-layer deposition. Reducing the nanopore diameter from 4.5 to 2.3 nm slowed down the translocation of ssDNA by more than 16 times (to 0.18 μs base(-1)) when 300 mV was applied across the nanopore. It is speculated that the interaction between the nanopore and the ssDNA dominates the translocation speed. Unexpectedly, the translocation speed of ssDNA through the 4.5 nm nanopore is more than two orders of magnitude higher than that of double-stranded DNA (dsDNA) through a nanopore of almost the same size. The cause of such a faster translocation of ssDNA can be explained by the weaker drag force inside the nanopore. Moreover, the measured translocation speeds of ssDNA and dsDNA agree well with those calculated by molecular-dynamics (MD) simulation. The MD simulation predicted that reducing the nanopore diameter to almost the same as that of ssDNA (i.e. 1.4 nm) decreases the translocation speed (to 1.4 μs base(-1)). Narrowing the nanopore is thus an effective approach for accomplishing nanopore DNA sequencing.

  14. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  15. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler

    2007-12-01

    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  16. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines.

    Science.gov (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao

    2017-07-01

    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  17. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA.

    Science.gov (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee

    2011-03-24

    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  18. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Ultrafast Unzipping of a Beta-Hairpin Peptide

    NARCIS (Netherlands)

    Zinth, W.; Schrader, T.E.; Schreier, W.J.; Koller, F.O.; Cordes, T.; Babitzki, G.; Denschlag, R.; Tavan, P.; Löweneck, M.; Dong, Shou-Liang; Moroder, L.; Renner, C.; Corkum, Paul; Jonas, David M.; Miller, R.J. Dwayne; Weiner, Andrew M.

    2007-01-01

    Light induced switching of a beta-hairpin structure is investigated by femtosecond IR spectroscopy. While the unzipping process comprises ultrafast kinetics and is finished within 1 ns, the folding into the hairpin structure is a much slower process.

  20. Substrate rescue of DNA polymerase β containing a catastrophic L22P mutation.

    Science.gov (United States)

    Kirby, Thomas W; Derose, Eugene F; Beard, William A; Shock, David D; Wilson, Samuel H; London, Robert E

    2014-04-15

    DNA polymerase (pol) β is a multidomain enzyme with two enzymatic activities that plays a central role in the overlapping base excision repair and single-strand break repair pathways. The high frequency of pol β variants identified in tumor-derived tissues suggests a possible role in the progression of cancer, making the determination of the functional consequences of these variants of interest. Pol β containing a proline substitution for leucine 22 in the lyase domain (LD), identified in gastric tumors, has been reported to exhibit severe impairment of both lyase and polymerase activities. Nuclear magnetic resonance (NMR) spectroscopic evaluations of both pol β and the isolated LD containing the L22P mutation demonstrate destabilization sufficient to result in LD-selective unfolding with minimal structural perturbations to the polymerase domain. Unexpectedly, addition of single-stranded or hairpin DNA resulted in partial refolding of the mutated lyase domain, both in isolation and for the full-length enzyme. Further, formation of an abortive ternary complex using Ca(2+) and a complementary dNTP indicates that the fraction of pol β(L22P) containing the folded LD undergoes conformational activation similar to that of the wild-type enzyme. Kinetic characterization of the polymerase activity of L22P pol β indicates that the L22P mutation compromises DNA binding, but nearly wild-type catalytic rates can be observed at elevated substrate concentrations. The organic osmolyte trimethylamine N-oxide (TMAO) is similarly able to induce folding and kinetic activation of both polymerase and lyase activities of the mutant. Kinetic data indicate synergy between the TMAO cosolvent and substrate binding. NMR data indicate that the effect of the DNA results primarily from interaction with the folded LD(L22P), while the effect of the TMAO results primarily from destabilization of the unfolded LD(L22P). These studies illustrate that substrate-induced catalytic activation of pol

  1. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis.

    Science.gov (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J

    2012-01-01

    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  2. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.

    1992-01-01

    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  3. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  4. Synthesis of a gene for the HIV transactivator protein TAT by a novel single stranded approach involving in vivo gap repair.

    OpenAIRE

    Adams, S E; Johnson, I D; Braddock, M; Kingsman, A J; Kingsman, S M; Edwards, R M

    1988-01-01

    The synthesis of a gene for the HIV TAT protein is described using a novel approach that capitalises on the ability to synthesise oligonucleotides of greater than 100 bp in length. It involves the synthesis of large oligomers covering one strand of the desired gene in its entirety and the use of small complementary bridging and adapter oligonucleotides to direct the assembly and cloning of the large oligomers. After ligation to the cloning vector the partially single stranded intermediate is ...

  5. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers

    OpenAIRE

    Antolin, M. F.; Bosio, C. F.; Cotton, J.; Sweeney, W.; Strand, M. R.; Black-IV, W. C.

    1996-01-01

    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  6. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr

    2015-01-01

    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single- strand ed DNA -binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  7. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.

    1979-10-01

    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  8. Escherichia coli Single-Stranded DNA-Binding Protein: NanoESI-MS Studies of Salt-Modulated Subunit Exchange and DNA Binding Transactions

    Science.gov (United States)

    Mason, Claire E.; Jergic, Slobodan; Lo, Allen T. Y.; Wang, Yao; Dixon, Nicholas E.; Beck, Jennifer L.

    2013-02-01

    Single-stranded DNA-binding proteins (SSBs) are ubiquitous oligomeric proteins that bind with very high affinity to single-stranded DNA and have a variety of essential roles in DNA metabolism. Nanoelectrospray ionization mass spectrometry (nanoESI-MS) was used to monitor subunit exchange in full-length and truncated forms of the homotetrameric SSB from Escherichia coli. Subunit exchange in the native protein was found to occur slowly over a period of hours, but was significantly more rapid in a truncated variant of SSB from which the eight C-terminal residues were deleted. This effect is proposed to result from C-terminus mediated stabilization of the SSB tetramer, in which the C-termini interact with the DNA-binding cores of adjacent subunits. NanoESI-MS was also used to examine DNA binding to the SSB tetramer. Binding of single-stranded oligonucleotides [one molecule of (dT)70, one molecule of (dT)35, or two molecules of (dT)35] was found to prevent SSB subunit exchange. Transfer of SSB tetramers between discrete oligonucleotides was also observed and is consistent with predictions from solution-phase studies, suggesting that SSB-DNA complexes can be reliably analyzed by ESI mass spectrometry.

  9. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  10. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.

    1992-01-01

    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  11. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  12. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: simonaclichici@yahoo.com [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)

    2012-03-15

    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  13. Design and function of triplex hairpin ribozymes.

    Science.gov (United States)

    Aquino-Jarquin, Guillermo; Rojas-Hernández, Ramiro; Alvarez-Salas, Luis Marat

    2010-01-01

    Triplex ribozymes allow for the individual activity of multiple trans-acting ribozymes producing higher target cleavage relative to tandem-expressed RZs. A triplex expression system based on a single hairpin ribozyme for the multiple expression (multiplex) vectors can be engineered to target RNAs with single or multiple antisense-accessible sites. System construction relies on triplex expression modules consisting of hairpin ribozyme cassettes flanked by ribozymes lacking catalytic domains. Multiplex vectors can be generated with single or multiple specificity by tandem cloning of triplex expression modules. Triplex ribozymes are initially tested in vitro using cis- and trans-cleavage assays against radioactive-labeled targets. In addition, triplex ribozymes are tested for cis and trans cleavage in vivo by transfection in cultured cells followed by ribonuclease protection assays (RPAs) and RT-PCR. The use of triplex configurations with multiplex ribozymes will provide the basis for the development of future RZ-based therapies and technologies.

  14. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus

    Science.gov (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.

    2016-01-01

    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  15. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy

    OpenAIRE

    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried

    2013-01-01

    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  16. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  17. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.

    1989-01-01

    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  18. A single-stranded RNA copy of the Giardia lamblia virus double-stranded RNA genome is present in the infected Giardia lamblia.

    OpenAIRE

    Furfine, E S; White, T C; Wang, A L; Wang, C C

    1989-01-01

    An isolate of Giardia lamblia infected with the double-stranded RNA virus (GLV) has two major species of RNA that are not present in an uninfected isolate. One of these species is the previously characterized double-stranded RNA genome of GLV (1). The second species of RNA appears to be a full length copy of one strand of the double-stranded RNA genome. This full length single-stranded RNA is not present in viral particles isolated from the growth medium. The cellular concentration of the sin...

  19. How hairpin vortices emerge from exact invariant solutions

    Science.gov (United States)

    Schneider, Tobias M.; Farano, Mirko; de Palma, Pietro; Robinet, Jean-Christoph; Cherubini, Stefania

    2017-11-01

    Hairpin vortices are among the most commonly observed flow structures in wall-bounded shear flows. However, within the dynamical system approach to turbulence, those structures have not yet been described. They are not captured by known exact invariant solutions of the Navier-Stokes equations nor have other state-space structures supporting hairpins been identified. We show that hairpin structures are observed along an optimally growing trajectory leaving a well known exact traveling wave solution of plane Poiseuille flow. The perturbation triggering hairpins does not correspond to an unstable mode of the exact traveling wave but lies in the stable manifold where non-normality causes strong transient amplification.

  20. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  1. Oxidized base damage and single-strand break repair in mammalian genomes: role of disordered regions and posttranslational modifications in early enzymes.

    Science.gov (United States)

    Hegde, Muralidhar L; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic endonuclease 1 (APE1), form complexes with downstream repair (and other noncanonical) proteins via pairwise interactions. Furthermore, a unique feature of mammalian early BER/SSBR enzymes is the presence of a disordered terminal extension that is absent in their Escherichia coli prototypes. These nonconserved segments usually contain organelle-targeting signals, common interaction interfaces, and sites of posttranslational modifications that may be involved in regulating their repair function including lesion scanning. Finally, the linkage of BER/SSBR deficiency to cancer, aging, and human neurodegenerative diseases, and therapeutic targeting of BER/SSBR are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples.

    Science.gov (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J

    2006-03-01

    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  3. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast.

    Science.gov (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A

    2010-08-05

    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  4. Isolation and characterization of a single-stranded DNA virus infecting the marine diatom Chaetoceros sp. strain SS628-11 isolated from western Japan.

    Directory of Open Access Journals (Sweden)

    Kei Kimura

    Full Text Available Diatoms are significant organisms for primary production in the earth's aquatic environment. Hence, their dynamics are an important focus area in current studies. Viruses are a great concern as potential factors of diatom mortality, along with other physical, chemical, and biological factors. We isolated and characterized a new diatom virus (Csp07DNAV that lyses the marine planktonic diatom Chaetoceros sp. strain SS628-11. This paper examines the physiological, morphological, and genomic characteristics of Csp07DNAV. The virus was isolated from a surface water sample that was collected at Hiroshima Bay, Japan. It was icosahedral, had a diameter of 34 nm, and accumulated in the nuclei of host cells. Rod-shaped virus particles also coexisted in the host nuclei. The latent period and burst size were estimated to be <12 h and 29 infectious units per host cell, respectively. Csp07DNAV had a closed circular single-stranded DNA genome (5,552 nucleotides, which included a double-stranded region and 3 open reading frames. The monophyly of Csp07DNAV and other Bacilladnavirus group single-stranded DNA viruses was supported by phylogenetic analysis that was based on the amino acid sequence of each virus protein. On the basis of these results, we considered Csp07DNAV to be a new member of the genus Bacilladnavirus.

  5. Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library.

    Directory of Open Access Journals (Sweden)

    Sumate Pengpumkiat

    Full Text Available Chemical synthesis of oligonucleotides is a widely used tool in the field of biochemistry. Several methods for gene synthesis have been introduced in the growing area of genomics. In this paper, a novel method of constructing dsDNA is proposed. Short (28-mer oligo fragments from a library were assembled through successive annealing and ligation processes, followed by PCR. First, two oligo fragments annealed to form a dsDNA molecule. The double-stranded oligo was immobilized onto magnetic beads (solid support via streptavidin-biotin binding. Next, single-stranded oligo fragments were added successively through ligation to form the complete DNA molecule. The synthesized DNA was amplified through PCR and gel electrophoresis was used to characterize the product. Sanger sequencing showed that more than 97% of the nucleotides matched the expected sequence. Extending the length of the DNA molecule by adding single-stranded oligonucleotides from a basis set (library via ligation enables a more convenient and rapid mechanism for the design and synthesis of oligonucleotides on the go. Coupled with an automated dispensing system and libraries of short oligo fragments, this novel DNA synthesis method would offer an efficient and cost-effective method for producing dsDNA.

  6. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  7. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H

    2012-02-22

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  8. On-site detection of Phytophthora spp.—single-stranded target DNA as the limiting factor to improve on-chip hybridization

    International Nuclear Information System (INIS)

    Schwenkbier, Lydia; Pollok, Sibyll; Popp, Jürgen; Weber, Karina; König, Stephan; Wagner, Stefan; Werres, Sabine; Weber, Jörg; Hentschel, Martin

    2014-01-01

    We report on a lab-on-a-chip approach for on-site detection of Phytophthora species that allows visual signal readout. The results demonstrate the significance of single-stranded DNA (ssDNA) generation in terms of improving the intensity of the hybridization signal and to improve the reliability of the method. Conventional PCR with subsequent heat denaturation, sodium hydroxide-based denaturation, lambda exonuclease digestion and two asymmetric PCR methods were investigated for the species P. fragariae, P. kernoviae, and P. ramorum. The positioning of the capture probe within the amplified yeast GTP-binding protein (YPT1) target DNA was also of interest because it significantly influences the intensity of the signal. Statistical tests were used to validate the impact of the ssDNA generation methods and the capture-target probe position. The single-stranded target DNA generated by Linear-After-The-Exponential PCR (LATE-PCR) was found to produce signal intensities comparable to post-PCR exonuclease treatment. The LATE-PCR is the best method for the on-site detection of Phytophthora because the enzymatic digestion after PCR is more laborious and time-consuming. (author)

  9. Exquisite allele discrimination by toehold hairpin primers

    Science.gov (United States)

    Byrom, Michelle; Bhadra, Sanchita; Jiang, Yu Sherry; Ellington, Andrew D.

    2014-01-01

    The ability to detect and monitor single nucleotide polymorphisms (SNPs) in biological samples is an enabling research and clinical tool. We have developed a surprising, inexpensive primer design method that provides exquisite discrimination between SNPs. The field of DNA computation is largely reliant on using so-called toeholds to initiate strand displacement reactions, leading to the execution of kinetically trapped circuits. We have now similarly found that the short toehold sequence to a target of interest can initiate both strand displacement within the hairpin and extension of the primer by a polymerase, both of which will further stabilize the primer:template complex. However, if the short toehold does not bind, neither of these events can readily occur and thus amplification should not occur. Toehold hairpin primers were used to detect drug resistance alleles in two genes, rpoB and katG, in the Mycobacterium tuberculosis genome, and ten alleles in the Escherichia coli genome. During real-time PCR, the primers discriminate between mismatched templates with Cq delays that are frequently so large that the presence or absence of mismatches is essentially a ‘yes/no’ answer. PMID:24990378

  10. Effect of DNA hairpin loops on the twist of planar DNA origami tiles.

    Science.gov (United States)

    Li, Zhe; Wang, Lei; Yan, Hao; Liu, Yan

    2012-01-31

    The development of scaffolded DNA origami, a technique in which a long single-stranded viral genome is folded into arbitrary shapes by hundreds of short synthetic oligonucleotides, represents an important milestone in DNA nanotechnology. Recent findings have revealed that two-dimensional (2D) DNA origami structures based on the original design parameters adopt a global twist with respect to the tile plane, which may be because the conformation of the constituent DNA (10.67 bp/turn) deviates from the natural B-type helical twist (10.4 bp/turn). Here we aim to characterize the effects of DNA hairpin loops on the overall curvature of the tile and explore their ability to control, and ultimately eliminate any unwanted curvature. A series of dumbbell-shaped DNA loops were selectively displayed on the surface of DNA origami tiles with the expectation that repulsive interactions among the neighboring dumbbell loops and between the loops and the DNA origami tile would influence the structural features of the underlying tiles. A systematic, atomic force microscopy (AFM) study of how the number and position of the DNA loops influenced the global twist of the structure was performed, and several structural models to explain the results were proposed. The observations unambiguously revealed that the first generation of rectangular shaped origami tiles adopt a conformation in which the upper right (corner 2) and bottom left (corner 4) corners bend upward out of the plane, causing linear superstructures attached by these corners to form twisted ribbons. Our experimental observations are consistent with the twist model predicted by the DNA mechanical property simulation software CanDo. Through the systematic design and organization of various numbers of dumbbell loops on both surfaces of the tile, a nearly planar rectangular origami tile was achieved. © 2011 American Chemical Society

  11. On hairpin vortices in a transitional boundary layer

    Directory of Open Access Journals (Sweden)

    Uruba Václav

    2012-04-01

    Full Text Available In the presented paper the results of experiments on transitional boundary layer are presented. The boundary layer was generated on smooth flat wall with zero pressure gradient forming one side of the channel of rectangular cross section. The hairpin vortices, packets of hairpin vortices, turbulent spots and calmed regions were experimentally investigated using time-resolved PIV technique.

  12. Bacillus subtilis BY-kinase PtkA controls enzyme activity and localization of its protein substrates

    DEFF Research Database (Denmark)

    Jers, Carsten; Pedersen, Malene Mejer; Paspaliari, Dafni Katerina

    2010-01-01

    P>Bacillus subtilis BY-kinase PtkA was previously shown to phosphorylate, and thereby regulate the activity of two classes of protein substrates: UDP-glucose dehydrogenases and single-stranded DNA-binding proteins. Our recent phosphoproteome study identified nine new tyrosine-phosphorylated prote......P>Bacillus subtilis BY-kinase PtkA was previously shown to phosphorylate, and thereby regulate the activity of two classes of protein substrates: UDP-glucose dehydrogenases and single-stranded DNA-binding proteins. Our recent phosphoproteome study identified nine new tyrosine......-phosphorylated proteins in B. subtilis. We found that the majority of these proteins could be phosphorylated by PtkA in vitro. Among these new substrates, single-stranded DNA exonuclease YorK, and aspartate semialdehyde dehydrogenase Asd were activated by PtkA-dependent phosphorylation. Because enzyme activity...

  13. Synthesis of a wild-type and three mutant Cucurbita maxima trypsin inhibitor-encoding genes by a single-strand approach.

    Science.gov (United States)

    Botes, D P; Qobose, M D; Corfield, V A

    1991-09-15

    A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.

  14. The casein genes in goat breeds from different Continents: analysis by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP

    Directory of Open Access Journals (Sweden)

    A. Caroli

    2010-04-01

    Full Text Available A screening of casein gene variability was carried out by Polymerase Chain Reaction – Single Strand Conformation Polymorphism in 8 goat breeds from Sudan (Nubian goat, Turkey (Angora Goat Lalahan Tiftic, Angora Goat Yerkoy, Hair goat and India (Jammu, Maharashtra, Rajasthan, South Goat. A total of 16 different alleles or groups of alleles were found, showing conspicuous differences among breeds. The allele frequencies were submitted to cluster analysis in order to highlight differences between breeds, also including data from Red Sokoto, West African Dwarf Nigeria, West African Dwarf Cameroon, and Borno Goat. The tree obtained from the cluster analysis showed two main lineages. The West African goat clustered together, the Indian and Turkish breeds were in the other group. Nubian goat was found in an intermediate position.

  15. Investigation of single-strand conformational polymorphism of the TP53 gene in women with a family history of breast cancer

    Directory of Open Access Journals (Sweden)

    R.R. Burbano

    2000-11-01

    Full Text Available Breast cancer in families with germ line mutations in the TP53 gene has been described in the medical literature. Mutation screening for susceptibility genes should allow effective prophylactic and preventive measures. Using single-strand conformational polymorphism, we screened for mutations in exons 5, 6, 7 and 8 of gene TP53 in the peripheral blood of 8 young non-affected members (17 to 36 years old of families with a history of breast cancer. Studies of this type on young patients (mean age, 25 years are very rare in the literature. The identification of these mutations would contribute to genetic counseling of members of families with predisposition to breast cancer. The results obtained did not show any polymorphism indicating mutation. In our sample, the familial tumorigenesis is probably related to other gene etiologies.

  16. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.

    1994-01-01

    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  17. Influence of the single-strand linker composition on the structural/dynamical properties of a truncated octahedral DNA nano-cage family.

    Science.gov (United States)

    Iacovelli, Federico; Alves, Cassio; Falconi, Mattia; Oteri, Francesco; de Oliveira, Cristiano L P; Desideri, Alessandro

    2014-10-01

    The structural/dynamical properties of three truncated octahedral DNA nano-cages composed by identical double helices but single strand linkers with different composition, namely 7 thymidines, 7 adenines, and 7 alternated thymidines and adenines, have been investigated through classical molecular dynamics simulations. Trajectories have been analyzed to investigate the role of the linkers in defining nano-cages stability and flexibility, including possible influence on the internal cages motions. The data indicate that the cages behavior is almost identical and that the structural/dynamical parameters measured along the trajectories are not particularly affected by the presence of different bases. These results demonstrate that the constraints imposed by the nano-structure geometry are the main factor in modulating these properties

  18. Localization of specific sequences and DNA single-strand breaks in individual UV-A-irradiated human lymphocytes by COMET FISH

    Science.gov (United States)

    Bock, Claudia; Rapp, Alexander; Dittmar, Heike; Monajembashi, Shamci; Greulich, Karl-Otto

    1999-01-01

    The COMET assay, a single cell electrophoresis technique which allows to separate electrophoretically fractionated DNA according to size has been combined with fluorescence in situ hybridization (FISH) which allows to localize specific genes or gene regions. This combination (COMET FISH) allows the detection of DNA single strand breaks in specific regions of the genome of human lymphocytes at the single cell level. Various types of DNA probes, e.g. centromere-, (alpha) - satellite-, telomere-, whole chromosome-, single copy- and region specific DNA probes have been used to investigate whether the UV-A induced DNA single strand breaks are distributed randomly all over the human genome or induced at specific sites ('hot spots'). In the investigated human peripheral blood lymphocytes all but one centromere reveal low sensitivity for UV-A irradiation (500 kJ/m2), while telomeres are randomly distributed over COMET heads and tails. The human chromosome 1 is fractionated by irradiation, but remains in the COMET head, indicating an only moderate degree of fractionation. Among three tested single copy probes, c- myc, p53 and p58, the p53 gene located on chromosome 17p13.1 and the p58 gene (1p36) appear to be located in UV-A stable regions of the human genome in 95% of 65 investigated lymphocytes. In contrast, the c-myc proto-oncogene (8q24) is found in the COMET tail in 90% of the 27 investigated lymphocytes and thus appears to be more sensitive to UV-A irradiation.

  19. Evidence that single-stranded DNA breaks are a normal feature of koala sperm chromatin, while double-stranded DNA breaks are indicative of DNA damage.

    Science.gov (United States)

    Zee, Yeng Peng; López-Fernández, Carmen; Arroyo, F; Johnston, Stephen D; Holt, William V; Gosalvez, Jaime

    2009-08-01

    In this study, we have used single and double comet assays to differentiate between single- and double-stranded DNA damage in an effort to refine the interpretation of DNA damage in mature koala spermatozoa. We have also investigated the likelihood that single-stranded DNA breakage is part of the natural spermiogenic process in koalas, where its function would be the generation of structural bends in the DNA molecule so that appropriate packaging and compaction can occur. Koala spermatozoa were examined using the sperm chromatin dispersion test (SCDt) and comet assays to investigate non-orthodox double-stranded DNA. Comet assays were conducted under 1) neutral conditions; and 2) neutral followed by alkaline conditions (double comet assay); the latter technique enabled simultaneous visualisation of both single-stranded and double-stranded DNA breaks. Following the SCDt, there was a continuum of nuclear morphotypes, ranging from no apparent DNA fragmentation to those with highly dispersed and degraded chromatin. Dispersion morphotypes were mirrored by a similar diversity of comet morphologies that could be further differentiated using the double comet assay. The majority of koala spermatozoa had nuclei with DNA abasic-like residues that produced single-tailed comets following the double comet assay. The ubiquity of these residues suggests that constitutive alkali-labile sites are part of the structural configuration of the koala sperm nucleus. Spermatozoa with 'true' DNA fragmentation exhibited a continuum of comet morphologies, ranging from a more severe form of alkaline-susceptible DNA with a diffuse single tail to nuclei that exhibited both single- and double-stranded breaks with two comet tails.

  20. Functional roles of the N- and C-terminal regions of the human mitochondrial single-stranded DNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Marcos T Oliveira

    2010-10-01

    Full Text Available Biochemical studies of the mitochondrial DNA (mtDNA replisome demonstrate that the mtDNA polymerase and the mtDNA helicase are stimulated by the mitochondrial single-stranded DNA-binding protein (mtSSB. Unlike Escherichia coli SSB, bacteriophage T7 gp2.5 and bacteriophage T4 gp32, mtSSBs lack a long, negatively charged C-terminal tail. Furthermore, additional residues at the N-terminus (notwithstanding the mitochondrial presequence are present in the sequence of species across the animal kingdom. We sought to analyze the functional importance of the N- and C-terminal regions of the human mtSSB in the context of mtDNA replication. We produced the mature wild-type human mtSSB and three terminal deletion variants, and examined their physical and biochemical properties. We demonstrate that the recombinant proteins adopt a tetrameric form, and bind single-stranded DNA with similar affinities. They also stimulate similarly the DNA unwinding activity of the human mtDNA helicase (up to 8-fold. Notably, we find that unlike the high level of stimulation that we observed previously in the Drosophila system, stimulation of DNA synthesis catalyzed by human mtDNA polymerase is only moderate, and occurs over a narrow range of salt concentrations. Interestingly, each of the deletion variants of human mtSSB stimulates DNA synthesis at a higher level than the wild-type protein, indicating that the termini modulate negatively functional interactions with the mitochondrial replicase. We discuss our findings in the context of species-specific components of the mtDNA replisome, and in comparison with various prokaryotic DNA replication machineries.

  1. Lentiviral delivery of short hairpin RNAs

    Science.gov (United States)

    Manjunath, N; Haoquan, Wu; Sandesh, Subramanya; Premlata, Shankar

    2009-01-01

    In less than a decade after discovery, RNA interference-mediated gene silencing is already being tested as potential therapy in clinical trials for a number of diseases. Lentiviral vectors provide a means to express short hairpin RNA (shRNA) to induce stable and long-term gene silencing in both dividing and non-dividing cells and thus, are being intensively investigated for this purpose. However, induction of long-term shRNA expression can also cause toxicities by inducing off target effects and interference with the endogenous micro RNA (miRNA) pathway that regulates cellular gene expression. Recently, several advances have been made in the shRNA vector design to mimic cellular miRNA processing and to express multiplex siRNAs in a tightly regulated and reversible manner to overcome toxicities. In this review we describe some of these advances, focusing on the progress made in the development of lentiviral shRNA delivery strategies to combat viral infections. PMID:19341774

  2. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  3. Short hairpin RNA expression for enhancing the resistance of ...

    African Journals Online (AJOL)

    Short hairpin RNA expression for enhancing the resistance of Bombyx mori (Bm) to nucleopolyhedrovirus in vitro and in vivo. Roy Bhaskar, Fang Zhou, Shuang Liang, Wan-Fu Yue, Yan-shan Niu, Yun- gen Miao ...

  4. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide

    2015-10-01

    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  5. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2016-05-28

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  6. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy

    2008-01-01

    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  7. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray.

    Science.gov (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino

    2008-08-25

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  8. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Science.gov (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino

    2008-01-01

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  9. A biomarker model of sublethal genotoxicity (DNA single-strand breaks and adducts) using the sentinel organism Aporrectodea longa in spiked soil

    International Nuclear Information System (INIS)

    Martin, Francis L.; Piearce, Trevor G.; Hewer, Alan; Phillips, David H.; Semple, Kirk T.

    2005-01-01

    There is a need to develop risk biomarkers during the remediation of contaminated land. We employed the earthworm, Aporrectodea longa (Ude), to determine whether genotoxicity measures could be applied to this organism's intestinal tissues. Earthworms were added, for 24 h or 7 days, to soil samples spiked with benzo[a]pyrene (B[a]P) and/or lindane. After exposure, intestinal tissues (crop/gizzard or intestine) were removed prior to the measurement in disaggregated cells of DNA single-strand breaks (SSBs) by the alkaline comet assay. Damage was quantified by comet tail length (CTL, μm). B[a]P 24-h exposure induced dose-related increases (P 32 P-postlabelling, showed a two-adduct-spot pattern. This preliminary investigation suggests that earthworm tissues may be incorporated into genotoxicity assays to facilitate hazard identification within terrestrial ecosystems. - Sublethal genotoxicity in the sentinel organism A. longa can be used to monitor the effects of contaminants in soil

  10. Conformation effects of CpG methylation on single-stranded DNA oligonucleotides: analysis of the opioid peptide dynorphin-coding sequences.

    Directory of Open Access Journals (Sweden)

    Malik Mumtaz Taqi

    Full Text Available Single-stranded DNA (ssDNA is characterized by high conformational flexibility that allows these molecules to adopt a variety of conformations. Here we used native polyacrylamide gel electrophoresis (PAGE, circular dichroism (CD spectroscopy and nuclear magnetic resonance (NMR spectroscopy to show that cytosine methylation at CpG sites affects the conformational flexibility of short ssDNA molecules. The CpG containing 37-nucleotide PDYN (prodynorphin fragments were used as model molecules. The presence of secondary DNA structures was evident from differences in oligonucleotide mobilities on PAGE, from CD spectra, and from formation of A-T, G-C, and non-canonical G-T base pairs observed by NMR spectroscopy. The oligonucleotides displayed secondary structures at 4°C, and some also at 37°C. Methylation at CpG sites prompted sequence-dependent formation of novel conformations, or shifted the equilibrium between different existing ssDNA conformations. The effects of methylation on gel mobility and base pairing were comparable in strength to the effects induced by point mutations in the DNA sequences. The conformational effects of methylation may be relevant for epigenetic regulatory events in a chromatin context, including DNA-protein or DNA-DNA recognition in the course of gene transcription, and DNA replication and recombination when double-stranded DNA is unwinded to ssDNA.

  11. Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Krzysztof Lepek

    2015-01-01

    Full Text Available Monitoring and control of infections are key parts of surveillance systems and epidemiological risk prevention. In the case of influenza A viruses (IAVs, which show high variability, a wide range of hosts, and a potential of reassortment between different strains, it is essential to study not only people, but also animals living in the immediate surroundings. If understated, the animals might become a source of newly formed infectious strains with a pandemic potential. Special attention should be focused on pigs, because of the receptors specific for virus strains originating from different species, localized in their respiratory tract. Pigs are prone to mixed infections and may constitute a reservoir of potentially dangerous IAV strains resulting from genetic reassortment. It has been reported that a quadruple reassortant, A(H1N1pdm09, can be easily transmitted from humans to pigs and serve as a donor of genetic segments for new strains capable of infecting humans. Therefore, it is highly desirable to develop a simple, cost-effective, and rapid method for evaluation of IAV genetic variability. We describe a method based on multitemperature single-strand conformational polymorphism (MSSCP, using a fragment of the hemagglutinin (HA gene, for detection of coinfections and differentiation of genetic variants of the virus, difficult to identify by conventional diagnostic.

  12. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS.

    Science.gov (United States)

    Pachkowski, Brian F; Tano, Keizo; Afonin, Valeriy; Elder, Rhoderick H; Takeda, Shunichi; Watanabe, Masami; Swenberg, James A; Nakamura, Jun

    2009-12-01

    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase beta.

  13. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against the Pesticide Fipronil and Sensitive Detection in River Water

    Directory of Open Access Journals (Sweden)

    Ka L. Hong

    2017-12-01

    Full Text Available Fipronil is a commonly used insecticide that has been shown to have environmental and human health risks. The current standard methods of detection for fipronil and its metabolites, such as GC-MS, are time consuming and labor intensive. In this study, a variant of systematic evolution of ligands by exponential enrichment (SELEX, was utilized to identify the first single-stranded DNA (ssDNA molecular recognition element (MRE that binds to fipronil with high affinity (Kd = 48 ± 8 nM. The selected MRE displayed low cross binding activity on various environmentally relevant, structurally unrelated herbicides and pesticides, in addition to broad-spectrum binding activity on major metabolites of fipronil and a structurally similar pesticide in prepared river samples. Additionally, a proof-of-principle fluorescent detection assay was developed by using the selected ssDNA MRE as a signal-reporting element, with a limit of detection of 105 nM in a prepared river water sample.

  14. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Boye, E.; Johansen, I.; Brustad, T.

    1976-01-01

    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 2 0 C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 2 0 C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  15. Clonal origin of multiple lung cancers: K-ras and p53 mutations determined by nonradioisotopic single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Lau, D H; Yang, B; Hu, R; Benfield, J R

    1997-08-01

    Disease stage is the most important factor in determining prognosis and treatment of lung cancer. Staging of lung cancer is complicated by presentation of multiple pulmonary malignant lesions with a similar histology. It is a dilemma to decide if these lesions are synchronous primaries arising from different malignant clones or metastases from a single clone. Lung cancer is associated with multiple genetic abnormalities including mutations of K-ras and p53, which are believed to occur prior to onset of metastasis. To determine the clonal origin of multiple pulmonary malginant nodules, we analyzed point-mutations of K-ras and p53 by microdissection, polymerase chain reactions (PCR), nonradioisotopic single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. Each pulmonary lesion was microdissected from paraffin slides. Genomic DNA was amplified by two sequential PCRs followed by electrophoresis in a minigel and silver staining. Deoxyribonucleic acid sequencing was performed if necessary to confirm a mutation found upon SSCP analysis. Applying this molecular approach, we were able to differentiate the clonal origins of multiple malignant nodules of the lung as exemplified by the two cases presented.

  16. Simultaneous identification of seven foodborne pathogens and Escherichia coli (pathogenic and nonpathogenic) using capillary electrophoresis-based single-strand conformation polymorphism coupled with multiplex PCR.

    Science.gov (United States)

    Oh, Mi-Hwa; Paek, Se-Hee; Shin, Gi Won; Kim, Hae-Yeong; Jung, Gyoo Yeol; Oh, Sangsuk

    2009-06-01

    The objective of this study was to develop a novel technique for parallel analysis of eight important foodborne microbes using capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) coupled with multiplex PCR. Specific primers for multiplex PCR amplification of the 16S rRNA gene were designed, corresponding to eight species of bacteria, including Escherichia coli, Clostridium perfringens, Campylobacter jejuni, Salmonella enterica, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Bacillus cereus, for the species-specific identification and optimal separation of their PCR products in subsequent analysis by CE-SSCP. Multiplex PCR conditions including annealing temperature, extension time, the number of PCR cycles, and primer concentrations were then optimized for simultaneous detection of all target foodborne bacteria. The diagnostic system using CE-SSCP combined with multiplex PCR developed here can be used for rapid investigation of causative agents of foodborne illness. The simplicity and high sensitivity of the method may lead to improved management of safety and illness related to food.

  17. Selection and Characterization of Single-Stranded DNA Aptamers Binding Human B-Cell Surface Protein CD20 by Cell-SELEX

    Directory of Open Access Journals (Sweden)

    Mansoureh Haghighi

    2018-03-01

    Full Text Available The B-lymphocyte antigen (CD20 is a suitable target for single-stranded (ss nucleic acid oligomer (aptamers. The aim of study was selection and characterization of a ssDNA aptamer against CD20 using Cell-Systematic Evolution of Ligands by Exponential Enrichment (Cell-SELEX. The cDNA clone of CD20 (pcDNA-CD20 was transfected to human embryonic kidney (HEK293T cells. Ten rounds of Cell-SELEX was performed on recombinant HEK-CD20 cells. The final eluted ssDNA pool was amplified and ligated in T/A vector for cloning. The plasmids of positive clones were extracted, sequenced and the secondary structures of the aptamers predicted using DNAMAN® software. The sequencing results revealed 10 different types; three of them had the highest thermodynamic stability, named AP-1, AP-2 and AP-3. The AP-1 aptamer was the most thermodynamically stable one (ΔGAP-1 = −10.87 kcal/mol with the highest binding affinity to CD20 (96.91 ± 4.5 nM. Since, the CD20 is a suitable target for recognition of B-Cell. The selected aptamers could be comparable to antibodies with many advantages. The AP-1, AP-2 and AP-3 could be candidate instead of antibodies for diagnostic and therapeutic applications in immune deficiency, autoimmune diseases, leukemia and lymphoma.

  18. Integrative modelling coupled with ion mobility mass spectrometry reveals structural features of the clamp loader in complex with single-stranded DNA binding protein.

    Science.gov (United States)

    Politis, Argyris; Park, Ah Young; Hall, Zoe; Ruotolo, Brandon T; Robinson, Carol V

    2013-11-29

    DNA polymerase III, a decameric 420-kDa assembly, simultaneously replicates both strands of the chromosome in Escherichia coli. A subassembly of this holoenzyme, the seven-subunit clamp loader complex, is responsible for loading the sliding clamp (β2) onto DNA. Here, we use structural information derived from ion mobility mass spectrometry (IM-MS) to build three-dimensional models of one form of the full clamp loader complex, γ3δδ'ψχ (254 kDa). By probing the interaction between the clamp loader and a single-stranded DNA (ssDNA) binding protein (SSB4) and by identifying two distinct conformational states, with and without ssDNA, we assemble models of ψχ-SSB4 (108 kDa) and the clamp loader-SSB4 (340 kDa) consistent with IM data. A significant increase in measured collision cross-section (~10%) of the clamp loader-SSB4 complex upon DNA binding suggests large conformational rearrangements. This DNA bound conformation represents the active state and, along with the presence of ψχ, stabilises the clamp loader-SSB4 complex. Overall, this study of a large heteromeric complex analysed by IM-MS, coupled with integrative modelling, highlights the potential of such an approach to reveal structural features of previously unknown complexes of high biological importance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. porphyrin with single strand DNAs

    Indian Academy of Sciences (India)

    for organization of porphyrin molecules into extended assemblies, providing opportunities for construction of supramolecular structures.6–8 Among the porphyrin .... and consequently the mono- and bi-exponential nature of the decays were judged by the reduced chi-square. (χ2) values and distribution of the weighted ...

  20. Hybridization-based biosensor containing hairpin probes and use thereof

    Science.gov (United States)

    Miller, Benjamin L.; Strohsahl, Christopher M.

    2010-10-12

    A sensor chip that includes: a fluorescence quenching surface; a nucleic acid probe that contains first and second ends with the first end bound to the fluorescence quenching surface, and is characterized by being able to self-anneal into a hairpin conformation; and a first fluorophore bound to the second end of the first nucleic acid molecule. When the first nucleic acid molecule is in the hairpin conformation, the fluorescence quenching surface substantially quenches fluorescent emissions by the first fluorophore; and when the first nucleic acid molecule is in a non-hairpin conformation, fluorescent emissions by the fluorophore are substantially free of quenching by the fluorescence quenching surface. Various nucleic acid probes, methods of making the sensor chip, biological sensor devices that contain the sensor chip, and their methods of use are also disclosed.

  1. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA.

    Science.gov (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S

    2000-09-20

    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  2. Flow cytometry analysis of single-strand DNA damage in neuroblastoma cell lines using the F7-26 monoclonal antibody.

    Science.gov (United States)

    Grigoryan, Rita S; Yang, Bo; Keshelava, Nino; Barnhart, Jerry R; Reynolds, C Patrick

    2007-11-01

    The F7-26 monoclonal antibody (Mab) has been reported to be specific for single-strand DNA damage (ssDNA) and to also identify cells in apoptosis. We carriedout studies to determine if F7-26 binding measured by flow cytometry was able to specifically identify exogenous ssDNA as opposed to DNA damage from apoptosis. Neuroblastoma cells were treated with melphalan (L-PAM), fenretinide, 4-hydroperoxycyclophosphamide (4-HC)+/-pan-caspase inhibitor BOC-d-fmk, topotecan or with 10Gy gamma radiation+/-hydrogen peroxide (H2O2) and fixed immediately postradiation. Cytotoxicity was measured by DIMSCAN digital imaging fluorescence assay. The degree of ssDNA damage was analyzed by flow cytometry using Mab F7-26, with DNA visualized by propidium iodide counterstaining. Flow cytometry was used to measure apoptosis detected by terminal deoxynucleotidyltransferase (TUNEL) assay and reactive oxygen species (ROS) by carboxy-dichlorofluorescein diacetate. Irradiated and immediately fixed neuroblastoma cells showed increased ssDNA, but not apoptosis by TUNEL (TUNEL-negative). 4-HC or L-PAM+/-BOC-d-fmk increased ssDNA (F7-26-positive), but BOC-d-fmk prevented TUNEL staining. Fenretinide increased apoptosis by TUNEL but not ssDNA damage detected with F7-26. Enhanced ssDNA in neuroblastoma cells treated with radiation+H2O2 was associated with increased ROS. Topotecan increased both ssDNA and cytotoxicity in 4-HC-treated cells. These data demonstrate that Mab F7-26 recognized ssDNA due to exogenous DNA damage, rather than apoptosis. This assay should be useful to characterize the mechanism of action of antineoplastic drugs. Copyright (c) 2007 International Society for Analytical Cytology.

  3. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani

    2006-09-01

    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  4. Detection of p53 mutations by single-strand conformation polymorphisms (SSCP) gel electrophoresis. A comparative study of radioactive and nonradioactive silver-stained SSCP analysis.

    Science.gov (United States)

    Bosari, S; Marchetti, A; Buttitta, F; Graziani, D; Borsani, G; Loda, M; Bevilacqua, G; Coggi, G

    1995-12-01

    p53 mutations are the most common genetic abnormality in humans tumors, but their clinical significance remains to be precisely elucidated. Conventional single-strand conformation polymorphism (SSCP) analysis, a well-established technique for detecting p53 mutations, uses radioactively labeled polymerase chain reaction (PCR) products, which migrate abnormally in the presence of mutations. We performed radioactive PCR-SSCP analysis in a series of 30 formalin-fixed, paraffin-embedded ovarian carcinomas and two cell lines (SW480 and Caov4) harboring known homozygous p53 mutations and compared the results with nonradioactive silver-stained SSCP. The purpose was to assess whether nonradioactive SSCP is suitable for detecting p53 mutations in a rapid, sensitive, cost-effective fashion, without the need of radioactive isotopes. We accomplished PCR amplification of p53 exons 5 through 8 in 26 carcinomas, and radioactive SSCP detected p53 mutations in 13 tumors; three mutations were localized in exon 5, six in exon 6, two in exon 7, and two in exon 8. All mutations were correctly identified with nonradioactive SSCP, except for one exon 8 mutation. To establish the sensitivity of nonradioactive SSCP, DNA samples of SW480 and Caov4 were mixed with increasing amounts (0-90%) of normal DNA and subjected to PCR-SSCP analysis. Mutations were detected until the concentration of SW480 and Caov4 was 15% and 10%, respectively, of the total sample. The results of our investigation demonstrate that nonradioactive silver-stained SSCP is a sensitive, rapid, and simple technique to detect p53 mutations, even in formalin-fixed tissues, and could be easily used to investigate large series of patients to assess the clinical significance of p53 mutations in human tumors.

  5. Ampelomyces mycoparasites from apple powdery mildew identified as a distinct group based on single-stranded conformation polymorphism analysis of the rDNA ITS region.

    Science.gov (United States)

    Szentiványi, Orsolya; Kiss, Levente; Russell, John C; Kovács, Gábor M; Varga, Krisztina; Jankovics, Tünde; Lesemann, Silke; Xu, Xiang-Ming; Jeffries, Peter

    2005-04-01

    Pycnidial fungi belonging to the genus Ampelomyces are the most common natural antagonists of powdery mildews worldwide. During a study of the interactions between apple powdery mildew (Podosphaera leucotricha) and Ampelomyces mycoparasites, 52 new Ampelomyces isolates were obtained from P. leucotricha and, in addition, 13 new isolates from other species of the Erysiphaceae in four European countries. Their genetic diversity was screened using single-stranded conformation polymorphism (SSCP) analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). For comparison, 24 isolates obtained from genetic resource collections or other sources were included in this study. Based on the ITS-SSCP patterns, the isolates were placed in eight groups. The isolates belonged to two types based on their growth in culture. The faster-growing and the slower-growing isolates were included in different SSCP groups. A phylogenetic analysis of the ITS sequences of representatives of these groups confirmed the results obtained with the SSCP method, and showed that the faster-growing isolates do not belong to Ampelomyces as suggested by earlier studies. All the isolates from P. leucotricha fell into a distinct SSCP group of genetically homogeneous isolates. This suggests that Ampelomyces mycoparasites which occur in apple powdery mildew are slightly different from the other Ampelomyces groups which contain mycoparasites from various powdery mildew species. This may be because the main growth period of Ampelomyces mycoparasites in apple powdery mildew is isolated in time from that of Ampelomyces isolates that occur in other species of the Erysiphaceae. P. leucotricha starts its life-cycle early in the season, usually in March-April, while most powdery mildews are active in the same environments only late in the year.

  6. Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody: a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody.

    Science.gov (United States)

    Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua

    2018-02-01

    Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.

  7. Variabilidad genética de Aedes aegypti en algunas áreas del Perú usando Single Stranded Conformational Polymorphism (SSCP

    Directory of Open Access Journals (Sweden)

    Nélida Leiva G

    2004-07-01

    Full Text Available Aedes aegypti es el vector responsable de la transmisión del virus del dengue, su distribución geográfica se ha ampliado rápidamente debido principalmente a la intervención de los seres humanos. Objetivo: Analizar la variabilidad genética de este mosquito mediante la comparación del Segundo Espaciador Transcrito Interno (ITS 2 perteneciente al ADN ribosomal (rADN. Materiales y Métodos: Se analizaron muestras de ocho localidades (Jaén, Tingo María, Iquitos, Lambayeque, el distrito de El Rimac, Sullana y Zarumilla y uno de la provincia de Huaquillas (Ecuador. El análisis de la variabilidad se determinó usando la técnica conocida como SSCP (Single Stranded Conformation Polymorphism. Resultados: El estudio muestra que existe variabilidad genética entre las poblaciones analizadas, principalmente entre las muestras localizadas en la costa del Perú (Zarumilla, El Rímac, Sullana y Huaquillas y las muestras del nororiente (Tingo María, Iquitos, Jaén y Lambayeque Conclusión: Se determinaron dos variantes genéticas entre las poblaciones de Aedes aegypti: Costeña y Nororiental, que probablemente provienen de dos ancestros diferentes y cuyo ancestro común sufrió de aislamiento por distancia. Se observó que no existe relación entre las distancias genéticas y las distancias geográficas indicando que la migración de estas poblaciones es el resultado de la intervención de los seres humanos que diseminan al vector y no por la migración activa del mosquito. Se plantea el papel de la Cordillera de los Andes en la migración y separación de las poblaciones de Aedes.

  8. Detection of hybridization of single-strand DNA PCR products in temperature change process by a novel metal-clamping piezoelectric sensor.

    Science.gov (United States)

    Chen, Qinghai; Bian, Zhiheng; Hua, Xing; Yao, Chunyan; Wu, Wei; Zhang, Xue; Zhang, Bo; Huang, Junfu; Tang, Wanli; Fu, Weiling

    2010-05-15

    Oligonucleotide probes on the sensor surface can be hybridized with single-strand DNA (ssDNA) that is formed from PCR products in ice bath after degeneration. Thus, detection of PCR products by piezoelectric sensors requires the participation of ssDNA PCR products in ice bath. When PCR products in ice bath are added into the buffer of the sensor well at room temperature, there will be a temperature change process during mixing. However, it still remains unclear whether the temperature change affects the frequency baseline stability of the sensor and the result judgment, which is the basic condition for detecting hybridization of nucleic acid. In this study, we detected the hybridization of HPV PCR products during temperature change process by a self-designed adjustable metal-clamping piezoelectric sensor. The study mainly involves sensor adjustment, probe immobilization and ice bath sample addition (at different concentrations and different volumes). The response curve of basic frequency in temperature change process showed three stages, i.e., increase, decrease to baseline, and continuous decrease to stability. The early increase of frequency and duration of the time can reach 55+/-7.4 Hz and 39 min when 40 microL sample (0-1 degrees C) was added into 110 microL buffer (25 degrees C). The frequency increase effect caused by temperature difference at early stage depends on the volume ratio of two liquids and on the temperature difference. The results indicate that we should pay more attention to possibly small volume of PCR products in ice bath and minor temperature difference of two liquids in operation. 2010 Elsevier B.V. All rights reserved.

  9. Gauging the Nanotoxicity of h2D-C2N toward Single-Stranded DNA: An in Silico Molecular Simulation Approach.

    Science.gov (United States)

    Mukhopadhyay, Titas Kumar; Bhattacharyya, Kalishankar; Datta, Ayan

    2018-04-12

    Recent toxicological assessments of graphene, graphene oxides, and some other two-dimensional (2D) materials have shown them to be substantially toxic at the nanoscale, where they inhibit and eventually disrupt biological processes. These shortfalls of graphene and analogs have resulted in a quest for novel biocompatible 2D materials with minimum cytotoxicity. In this article, we demonstrate C 2 N (h2D-C 2 N), a newly synthesized 2D porous graphene analog, to be non-nanotoxic toward genetic materials from an "in-silico" point of view through sequence-dependent binding of different polynucleotide single-stranded DNA (ssDNA) onto it. The calculated binding energy of nucleobases and the free energy of binding of polynucleotides follow the common trait, cytosine > guanine > adenine > thymine, and are well within the limits of physisorption. Ab-initio simulations completely exclude the possibility of any chemical reaction, demonstrating purely noncovalent binding of nucleobases with C 2 N through a crucial interplay between hydrogen bonding and π-stacking interactions with the surface. Further, we show that the extent of distortion inflicted upon ssDNA by C 2 N is negligible. Analysis of the density of states of the nucleobase-C 2 N hybrids confirms minimum electronic perturbation of the bases after adsorption. Most importantly, we demonstrate the potency of C 2 N in nucleic acid transportation via reversible binding of ssDNA. The plausible use of C 2 N as a template for DNA repair is illustrated through an example of C 2 N-assisted complementary ssDNA winding.

  10. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms.

    Science.gov (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A

    2012-05-01

    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    Science.gov (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Whirlwinds and hairpins in the atmospheric surface layer

    NARCIS (Netherlands)

    Oncley, Steven P.; Hartogensis, O.K.; Tong, Chenning

    2016-01-01

    Vortices in the atmospheric surface layer are characterized using observations at unprecedented resolution from a fixed array of 31 turbulence sensors. During the day, these vortices likely are dust devils, though no visual observations are available for confirmation. At night, hairpin vortices

  14. Modeling the mechanism of CLN025 beta-hairpin formation

    Science.gov (United States)

    McKiernan, Keri A.; Husic, Brooke E.; Pande, Vijay S.

    2017-09-01

    Beta-hairpins are substructures found in proteins that can lend insight into more complex systems. Furthermore, the folding of beta-hairpins is a valuable test case for benchmarking experimental and theoretical methods. Here, we simulate the folding of CLN025, a miniprotein with a beta-hairpin structure, at its experimental melting temperature using a range of state-of-the-art protein force fields. We construct Markov state models in order to examine the thermodynamics, kinetics, mechanism, and rate-determining step of folding. Mechanistically, we find the folding process is rate-limited by the formation of the turn region hydrogen bonds, which occurs following the downhill hydrophobic collapse of the extended denatured protein. These results are presented in the context of established and contradictory theories of the beta-hairpin folding process. Furthermore, our analysis suggests that the AMBER-FB15 force field, at this temperature, best describes the characteristics of the full experimental CLN025 conformational ensemble, while the AMBER ff99SB-ILDN and CHARMM22* force fields display a tendency to overstabilize the native state.

  15. Method of identifying hairpin DNA probes by partial fold analysis

    Science.gov (United States)

    Miller, Benjamin L [Penfield, NY; Strohsahl, Christopher M [Saugerties, NY

    2009-10-06

    Method of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

  16. Design of extended short hairpin RNAs for HIV-1 inhibition

    NARCIS (Netherlands)

    Liu, Ying Poi; Haasnoot, Joost; Berkhout, Ben

    2007-01-01

    RNA interference (RNAi) targeted towards viral mRNAs is widely used to block virus replication in mammalian cells. The specific antiviral RNAi response can be induced via transfection of synthetic small interfering RNAs (siRNAs) or via intracellular expression of short hairpin RNAs (shRNAs). For

  17. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W

    2009-12-23

    Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation

  18. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  19. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  20. Structural basis for the substrate selectivity of Helicobacter pylori NucT nuclease activity.

    Directory of Open Access Journals (Sweden)

    Louisa Celma

    Full Text Available The Phospholipase D (PLD superfamily of proteins includes a group of enzymes with nuclease activity on various nucleic acid substrates. Here, with the aim of better understanding the substrate specificity determinants in this subfamily, we have characterised the enzymatic activity and the crystal structure of NucT, a nuclease implicated in Helicobacter pylori purine salvage and natural transformation and compared them to those of its bacterial and mammalian homologues. NucT exhibits an endonuclease activity with a strong preference for single stranded nucleic acids substrates. We identified histidine124 as essential for the catalytic activity of the protein. Comparison of the NucT crystal structure at 1.58 Å resolution reported here with those of other members of the sub-family suggests that the specificity of NucT for single-stranded nucleic acids is provided by the width of a positively charged groove giving access to the catalytic site.

  1. Contribution of single-strand breaks and alkali-labile bonds to the loss of infectivity of γ-irradiated phiX174 RF-DNA in E. coli cells mutant in various repair functions

    International Nuclear Information System (INIS)

    McKee, R.H.

    1975-01-01

    Twenty-one radiation sensitive mutants have been examined for their capacity to support gamma-irradiated phiX174 RF-DNA. The survival of phiX174 RF-DNA was reduced in essentially all of the sensitive mutants. The irradiated phiX174 RF-DNA was then separated into populations containing either single-strand breaks or alkali-labile bonds to examine the capacity of the mutants to repair each of the classes of lesions. It was found that all E. coli strains are unable to repair 22 percent of the single-strand breaks and all sensitive mutants are unable to repair an additional 10 percent of the breaks. All the repair functions examined are involved in single-strand break repair and none are more or less necessary than any of the others. PhiX174 RF-DNA is also inactivated by alkali-labile bonds. In the normal strains the inactivation efficiency is 0.16 lethal events per lesion with a threshold dose of 15 to 20 krads. The mutants are divided into two classes by their sensitivity to alkali-labile bonds. Both classes of mutants are also inactivated by alkali-labile bonds with efficiencies of about 0.17 and 0.29 lethal events per lesion, respectively. It is proposed that the differences seen in survival curves of phiX174 measured in the sensitive mutants is due to this difference. Although in normal cells the efficiency of inactivation of phiX174 by single-strand breaks is 50 percent greater than by alkali-labile bonds, alkali-labile bonds are produced at approximately twice the rate of single-strand breaks so alkali-labile bonds account for about 61 percent of the overall inactivation. In the mutants of least sensitivity alkali-labile bonds account for about 54 percent of the inactivating events and in the most sensitive about 67 percent

  2. Compact Hairpin Bandpass Filter with Wide Stopband and High Attenuation Using Multilayer Broadside-coupled Stripline

    Directory of Open Access Journals (Sweden)

    Xiaowei GU

    2014-11-01

    Full Text Available This paper presents a compact bandpass filter with stopband and high attenuation by using multilayer folded broadside-coupled quarter-wavelength stripline resonators in a low- temperature co-fired ceramic (LTCC substrate. The proposed bandpass filter centered at 1.1 GHz with a fractional bandwith of 4.5 % shows the first spurious frequency at 3.8 times the center frequency. In comparison to the conventional half-wavelength hairpin bandpass filter with the same passband performance, the proposed bandpass filter shows not only a 50 % size reduction but also a wider stopband from 1.3 GHz -3.8 GHz with a high rejection level up to 60 dB.

  3. Mutational analysis of an archaeal minichromosome maintenance protein exterior hairpin reveals critical residues for helicase activity and DNA binding

    Directory of Open Access Journals (Sweden)

    Brewster Aaron S

    2010-08-01

    Full Text Available Abstract Background The mini-chromosome maintenance protein (MCM complex is an essential replicative helicase for DNA replication in Archaea and Eukaryotes. While the eukaryotic complex consists of six homologous proteins (MCM2-7, the archaeon Sulfolobus solfataricus has only one MCM protein (ssoMCM, six subunits of which form a homohexamer. We have recently reported a 4.35Å crystal structure of the near full-length ssoMCM. The structure reveals a total of four β-hairpins per subunit, three of which are located within the main channel or side channels of the ssoMCM hexamer model generated based on the symmetry of the N-terminal Methanothermobacter thermautotrophicus (mtMCM structure. The fourth β-hairpin, however, is located on the exterior of the hexamer, near the exit of the putative side channels and next to the ATP binding pocket. Results In order to better understand this hairpin's role in DNA binding and helicase activity, we performed a detailed mutational and biochemical analysis of nine residues on this exterior β-hairpin (EXT-hp. We examined the activities of the mutants related to their helicase function, including hexamerization, ATPase, DNA binding and helicase activities. The assays showed that some of the residues on this EXT-hp play a role for DNA binding as well as for helicase activity. Conclusions These results implicate several current theories regarding helicase activity by this critical hexameric enzyme. As the data suggest that EXT-hp is involved in DNA binding, the results reported here imply that the EXT-hp located near the exterior exit of the side channels may play a role in contacting DNA substrate in a manner that affects DNA unwinding.

  4. Substrate recognition by ribonucleoprotein ribonuclease MRP.

    Science.gov (United States)

    Esakova, Olga; Perederina, Anna; Quan, Chao; Berezin, Igor; Krasilnikov, Andrey S

    2011-02-01

    The ribonucleoprotein complex ribonuclease (RNase) MRP is a site-specific endoribonuclease essential for the survival of the eukaryotic cell. RNase MRP closely resembles RNase P (a universal endoribonuclease responsible for the maturation of the 5' ends of tRNA) but recognizes distinct substrates including pre-rRNA and mRNA. Here we report the results of an in vitro selection of Saccharomyces cerevisiae RNase MRP substrates starting from a pool of random sequences. The results indicate that RNase MRP cleaves single-stranded RNA and is sensitive to sequences in the immediate vicinity of the cleavage site requiring a cytosine at the position +4 relative to the cleavage site. Structural implications of the differences in substrate recognition by RNases P and MRP are discussed.

  5. Characterization of a Novel Megabirnavirus from Sclerotinia sclerotiorum Reveals Horizontal Gene Transfer from Single-Stranded RNA Virus to Double-Stranded RNA Virus.

    Science.gov (United States)

    Wang, Minghong; Wang, Yong; Sun, Xiangzhong; Cheng, Jiasen; Fu, Yanping; Liu, Huiquan; Jiang, Daohong; Ghabrial, Said A; Xie, Jiatao

    2015-08-01

    Mycoviruses have been detected in all major groups of filamentous fungi, and their study represents an important branch of virology. Here, we characterized a novel double-stranded RNA (dsRNA) mycovirus, Sclerotinia sclerotiorum megabirnavirus 1 (SsMBV1), in an apparently hypovirulent strain (SX466) of Sclerotinia sclerotiorum. Two similarly sized dsRNA segments (L1- and L2-dsRNA), the genome of SsMBV1, are packaged in rigid spherical particles purified from strain SX466. The full-length cDNA sequence of L1-dsRNA/SsMBV1 comprises two large open reading frames (ORF1 and ORF2), which encode a putative coat protein and an RNA-dependent RNA polymerase (RdRp), respectively. Phylogenetic analysis of the RdRp domain clearly indicates that SsMBV1 is related to Rosellinia necatrix megabirnavirus 1 (RnMBV1). L2-dsRNA/SsMBV1 comprises two nonoverlapping ORFs (ORFA and ORFB) encoding two hypothetical proteins with unknown functions. The 5'-terminal regions of L1- and L2-dsRNA/SsMBV1 share strictly conserved sequences and form stable stem-loop structures. Although L2-dsRNA/SsMBV1 is dispensable for replication, genome packaging, and pathogenicity of SsMBV1, it enhances transcript accumulation of L1-dsRNA/SsMBV1 and stability of virus-like particles (VLPs). Interestingly, a conserved papain-like protease domain similar to a multifunctional protein (p29) of Cryphonectria hypovirus 1 was detected in the ORFA-encoded protein of L2-dsRNA/SsMBV1. Phylogenetic analysis based on the protease domain suggests that horizontal gene transfer may have occurred from a single-stranded RNA (ssRNA) virus (hypovirus) to a dsRNA virus, SsMBV1. Our results reveal that SsMBV1 has a slight impact on the fundamental biological characteristics of its host regardless of the presence or absence of L2-dsRNA/SsMBV1. Mycoviruses are widespread in all major fungal groups, and they possess diverse genomes of mostly ssRNA and dsRNA and, recently, circular ssDNA. Here, we have characterized a novel dsRNA virus

  6. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family.

    Science.gov (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław

    2017-05-01

    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  7. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D

    2010-01-01

    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  8. Increased type I collagen content and DNA binding activity of a single-stranded, cytosine-rich sequence in the high-salt buffer protein extract of the copper-deficient rat heart.

    Science.gov (United States)

    Zeng, Huawei; Saari, Jack T

    2004-11-01

    Dietary copper (Cu) deficiency not only causes a hypertrophic cardiomyopathy but also increases cancer risk in rodent models. However, a possible alteration in gene expression has not been fully examined. The present study was undertaken to determine the effect of Cu deficiency on protein profiles in rat heart tissue. Male Sprague-Dawley rats were fed diets that were either a Cu-adequate diet (6.0 microg Cu/g diet, n = 6) or a Cu-deficient diet (0.3 microg Cu/g diet, n = 6) for 5 weeks. The high-salt buffer (HSB) protein extract from heart tissue of Cu-deficient, but not Cu-adequate rats showed a 132 kDa protein band by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. This protein band stained pink with Coomassie Blue, suggesting the presence of collagens or other proline-rich proteins. Dot immunoblotting demonstrated that total type I collagen was increased by 110% in HSB protein extract from Cu-deficient, relative to Cu-adequate, rats. Liquid chromatography with mass spectrometry analysis indicated that the 132 kDa protein band contained a collagen alpha (I) chain precursor as well as a leucine-rich protein 130 (LRP130) in HSB protein extract from Cu-deficient but not Cu-adequate rats. A gel shift assay showed that HSB protein extract from Cu-deficient rats bound to a single-stranded cytosine-rich DNA with higher affinity than the extract of Cu-adequate rats, similar to reports of an increase in LRP130 single-stranded DNA binding activity in several types of tumor cells. Collectively, these results not only suggest an additional feature of altered collagen metabolism with Cu deficiency but also demonstrate for the first time an increase in single-stranded cytosine-rich DNA binding in Cu-deficient rat heart.

  9. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: tcheng@ntu.edu.tw [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)

    2013-02-01

    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ► To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ► ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ► PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ► The findings

  10. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: skim1@lsuhsc.edu [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  11. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  12. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee

    2012-01-01

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  13. Structural modeling of DNA mini-hairpin molecules with various loop sequences

    Science.gov (United States)

    Nakamura, Shugo; Hirose, Hitoshi; Ikeguchi, Mitsunori; Shimizu, Kentaro

    1999-07-01

    We modeled the structures of DNA fragments dGC(GNA)GC (N = A, G, T, and C), which are known to form mini-hairpins, and dGC(GAC)GC and dGC(GAG)GC, which are known not to form mini-hairpins, by using global optimization of conformational energy. For all of the fragments, we obtained mini-hairpins which had similar backbone structures and positions of bases. The conformational energy differences between the energy-optimized structures were small. Our results suggest that the optimized energy values are not sufficient to discriminate which fragments form thermo-stable mini-hairpins and which do not.

  14. HTS dual-band bandpass filters using stub-loaded hair-pin resonators for mobile communication systems

    Energy Technology Data Exchange (ETDEWEB)

    Sekiya, N., E-mail: nsekiya@yamanashi.ac.jp; Sugiyama, S.

    2014-09-15

    Highlights: • We have developed a HTS five-pole dual-band bandpass filter using stub-loaded hair-pin resonators. • The proposed dual-band BPF can independently control of the center frequency. • Flexibly adjustment of the bandwidth can be achieved by the H-shaped waveguide. • The proposed BPF is evaluated by simulation and measurement with good agreement. - Abstract: A HTS dual-band bandpass filter is developed to obtain sharp-cut off characteristics for mobile communication systems. The filter is composed of five stub-loaded hair-pin resonators with H-shaped waveguides between them. The main advantage of the proposed filter is to allow independent control of the center frequency of the first and second bands. The bandwidths can be flexibly adjusted using the H-shaped waveguide. An electromagnetic simulator was used to design and analyze the filter, which have a 3.5-GHz center frequency and a 70-MHz (2%) bandwidth for the first band and a 5.0-GHz center frequency and a 100-MHz (2%) bandwidth for the second band. The filter was fabricated using YBa{sub 2}Cu{sub 3}O{sub y} thin film on an Al{sub 2}O{sub 3} substrate. Ground plane was fabricated using Au thin film. The measured frequency responses of the filter tally well with the simulated ones.

  15. Correlations between structure, material properties and bioproperties in self-assembled beta-hairpin peptide hydrogels.

    Science.gov (United States)

    Hule, Rohan A; Nagarkar, Radhika P; Altunbas, Aysegul; Ramay, Hassna R; Branco, Monica C; Schneider, Joel P; Pochan, Darrin J

    2008-01-01

    A de novo designed beta-hairpin peptide (MAX8), capable of undergoing intramolecular folding and consequent intermolecular self-assembly into a cytocompatible hydrogel, has been studied. A combination of small angle neutron scattering (SANS) and cryogenic-transmission electron microscopy (cryo-TEM) have been used to quantitatively investigate the MAX8 nanofibrillar hydrogel network morphology. A change in the peptide concentration from 0.5 to 2 wt% resulted in a denser fibrillar network as revealed via SANS by a change in the high q (q = (4 pi/lambda) x sin (theta/2), where lambda = wavelength of incident neutrons and theta = scattering angle) mass fractal exponent from 2.5 to 3 and by a decrease in the measured correlation length from 23 to 16 A. A slope of -4 in the USANS regime indicates well-defined gel microporosity, an important characteristic for cellular substrate applications. These changes, both at the network as well as the individual fibril lengthscales, can be directly visualized in situ by cryo-TEM. Fibrillar nanostructures and network properties are directly related to bulk hydrogel stiffness via oscillatory rheology. Preliminary cell viability and anchorage studies at varying hydrogel stiffness confirm cell adhesion at early stages of cell culture within the window of stiffness investigated. Knowledge of the precise structure spanning length scales from the nanoscale up to the microscale can help in the formation of future, specific structure-bioproperty relationships when studying in vitro and in vivo behavior of these new peptide scaffolds.

  16. The tripartite motif coiled-coil is an elongated antiparallel hairpin dimer

    Science.gov (United States)

    Sanchez, Jacint G.; Okreglicka, Katarzyna; Chandrasekaran, Viswanathan; Welker, Jordan M.; Sundquist, Wesley I.; Pornillos, Owen

    2014-01-01

    Tripartite motif (TRIM) proteins make up a large family of coiled-coil-containing RING E3 ligases that function in many cellular processes, particularly innate antiviral response pathways. Both dimerization and higher-order assembly are important elements of TRIM protein function, but the atomic details of TRIM tertiary and quaternary structure have not been fully understood. Here, we present crystallographic and biochemical analyses of the TRIM coiled-coil and show that TRIM proteins dimerize by forming interdigitating antiparallel helical hairpins that position the N-terminal catalytic RING domains at opposite ends of the dimer and the C-terminal substrate-binding domains at the center. The dimer core comprises an antiparallel coiled-coil with a distinctive, symmetric pattern of flanking heptad and central hendecad repeats that appear to be conserved across the entire TRIM family. Our studies reveal how the coiled-coil organizes TRIM25 to polyubiquitylate the RIG-I/viral RNA recognition complex and how dimers of the TRIM5α protein are arranged within hexagonal arrays that recognize the HIV-1 capsid lattice and restrict retroviral replication. PMID:24550273

  17. Hairpin packet structure of a turbulent boundary layer in inclined wall-normal/spanwise planes

    Science.gov (United States)

    Lee, Jae Hwa; Sung, Hyung Jin

    2009-11-01

    Turbulent coherent structures associated with hairpin packet motions have been scrutinized using the instantaneous flow fields obtained from the direct numerical simulation (DNS) of a turbulent boundary layer (TBL). The Reynolds number based on the momentum thickness was varied in the range Reθ=890˜2560. This study focused on the hairpin packet motions in inclined wall-normal/spanwise planes. The hairpin vortex signature associated with the hairpin leg components in the vertical inclined plane consists of a counter-rotating vortex pair, upward and downward motions and a stagnation point induced by the Q2 and Q4 events. These hairpin signatures were observed in the instantaneous flow field, in the two-point correlations and in the conditionally averaged flow fields, respectively. We considered three inclined planes (45^o, 90^o, and 135^o) to investigate the spatial characteristics of the hairpin packet motions in the log and wake regions. The statistical flow fields showed that significantly different flow patterns are induced by the intersections of the three inclined planes with the hairpin packet motions.

  18. HBS-Tools for Hairpin Bisulfite Sequencing Data Processing and Analysis

    Directory of Open Access Journals (Sweden)

    Ming-an Sun

    2015-01-01

    Full Text Available The emerging genome-wide hairpin bisulfite sequencing (hairpin-BS-Seq technique enables the determination of the methylation pattern for DNA double strands simultaneously. Compared with traditional bisulfite sequencing (BS-Seq techniques, hairpin-BS-Seq can determine methylation fidelity and increase mapping efficiency. However, no computational tool has been designed for the analysis of hairpin-BS-Seq data yet. Here we present HBS-tools, a set of command line based tools for the preprocessing, mapping, methylation calling, and summarizing of genome-wide hairpin-BS-Seq data. It accepts paired-end hairpin-BS-Seq reads to recover the original (pre-bisulfite-converted sequences using global alignment and then calls the methylation statuses for cytosines on both DNA strands after mapping the original sequences to the reference genome. After applying to hairpin-BS-Seq datasets, we found that HBS-tools have a reduced mapping time and improved mapping efficiency compared with state-of-the-art mapping tools. The HBS-tools source scripts, along with user guide and testing data, are freely available for download.

  19. Detailed study of DNA hairpin dynamics using single-molecule fluorescence assisted by DNA origami.

    Science.gov (United States)

    Tsukanov, Roman; Tomov, Toma E; Masoud, Rula; Drory, Hagai; Plavner, Noa; Liber, Miran; Nir, Eyal

    2013-10-10

    The dynamics of two DNA hairpins (5'-TCGCCT-A31-AGGCGA-3' and 5'-TCGCCG-A31-CGGCGA-3') were studied using immobilization-based and diffusion-based single-molecule fluorescence techniques. The techniques enabled separated and detailed investigation of the states and of the transition reactions. Only two states, open and closed, were identified from analysis of the FRET histograms; metastable states with lifetimes longer than the technique resolution (0.3 ms) were not observed. The opening and closing reaction rates were determined directly from the FRET time trajectories, and the Gibbs free energies of these states and of the transition state were calculated using the Kramer theory. The rates, which are undoubtedly of transitions between the fully closed and the fully open states and ranged from 2 to 90 s(-1), were lower (∼10-fold) than the rates previously determined from fluorescence correlation spectroscopy. The heights of the barriers for closing were almost identical for the two hairpins. The barrier for opening the hairpin with the stronger stem was higher (4.3 kJ/mol) than that for the hairpin with the weaker stem, in very good agreement with the difference in stability calculated by the nearest-neighbor method. The barrier for closing the hairpin decreased (∼8 kJ/mol) and the barrier for opening increased (∼4 kJ/mol) with increasing NaCl concentration (10-100 mM), indicating that higher ionic strength stabilizes the folded state with respect to the transition state and stabilizes the transition state relative to the unfolded state. The very good agreements in the dynamics measured for free hairpins, for hairpins anchored to origami, and for hairpins anchored to the coverslip and the very good agreement between the two single-molecule techniques demonstrate that neither the origami nor the coverslip influence the hairpin dynamics, supporting a previous demonstration that origami can serve as a platform for biophysical investigations.

  20. Spatial confinement induces hairpins in nicked circular DNA

    Science.gov (United States)

    Japaridze, Aleksandre; Orlandini, Enzo; Smith, Kathleen Beth; Gmür, Lucas; Valle, Francesco; Micheletti, Cristian

    2017-01-01

    Abstract In living cells, DNA is highly confined in space with the help of condensing agents, DNA binding proteins and high levels of supercoiling. Due to challenges associated with experimentally studying DNA under confinement, little is known about the impact of spatial confinement on the local structure of the DNA. Here, we have used well characterized slits of different sizes to collect high resolution atomic force microscopy images of confined circular DNA with the aim of assessing the impact of the spatial confinement on global and local conformational properties of DNA. Our findings, supported by numerical simulations, indicate that confinement imposes a large mechanical stress on the DNA as evidenced by a pronounced anisotropy and tangent–tangent correlation function with respect to non-constrained DNA. For the strongest confinement we observed nanometer sized hairpins and interwound structures associated with the nicked sites in the DNA sequence. Based on these findings, we propose that spatial DNA confinement in vivo can promote the formation of localized defects at mechanically weak sites that could be co-opted for biological regulatory functions. PMID:28201616

  1. Complexity Results and the Growths of Hairpin Completions of Regular Languages (Extended Abstract)

    Science.gov (United States)

    Diekert, Volker; Kopecki, Steffen

    The hairpin completion is a natural operation on formal languages which has been inspired by molecular phenomena in biology and by DNA-computing. In 2009 we presented in [6] a (polynomial time) decision algorithm to decide regularity of the hairpin completion. In this paper we provide four new results: 1.) We show that the decision problem is NL-complete. 2.) There is a polynomial time decision algorithm which runs in time O(n8), this improves [6], which provided O(n^{20}). 3.) For the one-sided case (which is closer to DNA computing) the time is O(n2), only. 4.) The hairpin completion is unambiguous linear context-free. This result allows to compute the growth (generating function) of the hairpin completion and to compare it with the growth of the underlying regular language.

  2. The Rev1 interacting region (RIR) motif in the scaffold protein XRCC1 mediates a low-affinity interaction with polynucleotide kinase/phosphatase (PNKP) during DNA single-strand break repair.

    Science.gov (United States)

    Breslin, Claire; Mani, Rajam S; Fanta, Mesfin; Hoch, Nicolas; Weinfeld, Michael; Caldecott, Keith W

    2017-09-29

    The scaffold protein X-ray repair cross-complementing 1 (XRCC1) interacts with multiple enzymes involved in DNA base excision repair and single-strand break repair (SSBR) and is important for genetic integrity and normal neurological function. One of the most important interactions of XRCC1 is that with polynucleotide kinase/phosphatase (PNKP), a dual-function DNA kinase/phosphatase that processes damaged DNA termini and that, if mutated, results in ataxia with oculomotor apraxia 4 (AOA4) and microcephaly with early-onset seizures and developmental delay (MCSZ). XRCC1 and PNKP interact via a high-affinity phosphorylation-dependent interaction site in XRCC1 and a forkhead-associated domain in PNKP. Here, we identified using biochemical and biophysical approaches a second PNKP interaction site in XRCC1 that binds PNKP with lower affinity and independently of XRCC1 phosphorylation. However, this interaction nevertheless stimulated PNKP activity and promoted SSBR and cell survival. The low-affinity interaction site required the highly conserved Rev1-interacting region (RIR) motif in XRCC1 and included three critical and evolutionarily invariant phenylalanine residues. We propose a bipartite interaction model in which the previously identified high-affinity interaction acts as a molecular tether, holding XRCC1 and PNKP together and thereby promoting the low-affinity interaction identified here, which then stimulates PNKP directly. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  4. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  5. OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

    Directory of Open Access Journals (Sweden)

    Kevin M. Bradley

    2014-08-01

    Full Text Available Synthetic biologists wishing to self-assemble large DNA (L-DNA constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson–Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS, and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting" software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

  6. The interaction of hyperthermophilic TATA-box binding protein with single-stranded DNA is entropically favorable and exhibits a large negative heat capacity change at high salt concentration.

    Science.gov (United States)

    Nagatoishi, Satoru; Tanaka, Yoshikazu; Kudou, Motonori; Tsumoto, Kouhei

    2009-09-01

    We have investigated the thermodynamics of the interaction between the TATA-box-binding protein from Pyrococcus horikoshii (PhoTBP) and its target DNA (TATA-1). The interaction between PhoTBP and double-stranded DNA (dsDNA) is entropically favorable and enthalpically unfavorable. The thermodynamic parameters for TATA-1 duplex formation in the presence of PhoTBP, that is, ternary PhoTBP-dsDNA complexation, are similar to those for TATA-1 duplex formation, which is enthalpically favorable. Surface plasmon resonance analysis indicates that the interaction between PhoTBP and single-stranded DNA (ssDNA) of TATA-1 is entropy driven and has a large negative heat capacity change (-1.19 kcal mol(-1) K(-1)) at high salt concentration (800 mM NaCl). These results suggest that the favorable entropic effect corresponding to the interaction between PhoTBP and dsDNA is due not to ternary complexation but to the interaction between PhoTBP and ssDNA. This report is the first to describe the thermodynamics of the interaction between TBP and ssDNA.

  7. Different Fluorophore Labeling Strategies and Designs Affect Millisecond Kinetics of DNA Hairpins

    Directory of Open Access Journals (Sweden)

    Andreas Hartmann

    2014-09-01

    Full Text Available Changes in molecular conformations are one of the major driving forces of complex biological processes. Many studies based on single-molecule techniques have shed light on conformational dynamics and contributed to a better understanding of living matter. In particular, single-molecule FRET experiments have revealed unprecedented information at various time scales varying from milliseconds to seconds. The choice and the attachment of fluorophores is a pivotal requirement for single-molecule FRET experiments. One particularly well-studied millisecond conformational change is the opening and closing of DNA hairpin structures. In this study, we addressed the influence of base- and terminal-labeled fluorophores as well as the fluorophore DNA interactions on the extracted kinetic information of the DNA hairpin. Gibbs free energies varied from ∆G0 = −3.6 kJ/mol to ∆G0 = −0.2 kJ/mol for the identical DNA hairpin modifying only the labeling scheme and design of the DNA sample. In general, the base-labeled DNA hairpin is significantly destabilized compared to the terminal-labeled DNA hairpin and fluorophore DNA interactions additionally stabilize the closed state of the DNA hairpin. Careful controls and variations of fluorophore attachment chemistry are essential for a mostly undisturbed measurement of the underlying energy landscape of biomolecules.

  8. Correlations between structure, material properties and bioproperties in self-assembled β-hairpin peptide hydrogels

    Science.gov (United States)

    Hule, Rohan A.; Nagarkar, Radhika P.; Altunbas, Aysegul; Ramay, Hassna R.; Branco, Monica C.; Schneider, Joel P.; Pochan, Darrin J.

    2009-01-01

    A de novo designed β-hairpin peptide (MAX8), capable of undergoing intramolecular folding and consequent intermolecular self-assembly into a cytocompatible hydrogel, has been studied. A combination of small angle neutron scattering (SANS) and cryogenic-transmission electron microscopy (cryo-TEM) have been used to quantitatively investigate the MAX8 nanofibrillar hydrogel network morphology. A change in the peptide concentration from 0.5 to 2 wt% resulted in a denser fibrillar network as revealed via SANS by a change in the high q (q = (4π/λ) × sin (θ/2), where λ = wavelength of incident neutrons and θ = scattering angle) mass fractal exponent from 2.5 to 3 and by a decrease in the measured correlation length from 23 to 16 A. Å slope of −4 in the USANS regime indicates well-defined gel microporosity, an important characteristic for cellular substrate applications. These changes, both at the network as well as the individual fibril lengthscales, can be directly visualized in situ by cryo-TEM. Fibrillar nanostructures and network properties are directly related to bulk hydrogel stiffness via oscillatory rheology. Preliminary cell viability and anchorage studies at varying hydrogel stiffness confirm cell adhesion at early stages of cell culture within the window of stiffness investigated. Knowledge of the precise structure spanning length scales from the nanoscale up to the microscale can help in the formation of future, specific structure-bioproperty relationships when studying in vitro and in vivo behavior of these new peptide scaffolds. PMID:19048999

  9. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

    2003-01-01

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  10. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  11. A G-C-rich palindromic structural motif and a stretch of single-stranded purines are required for optimal packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA.

    Science.gov (United States)

    Jaballah, Soumeya Ali; Aktar, Suriya J; Ali, Jahabar; Phillip, Pretty Susan; Al Dhaheri, Noura Salem; Jabeen, Aayesha; Rizvi, Tahir A

    2010-09-03

    During retroviral RNA packaging, two copies of genomic RNA are preferentially packaged into the budding virus particles whereas the spliced viral RNAs and the cellular RNAs are excluded during this process. Specificity towards retroviral RNA packaging is dependent upon sequences at the 5' end of the viral genome, which at times extend into Gag sequences. It has earlier been suggested that the Mason-Pfizer monkey virus (MPMV) contains packaging sequences within the 5' untranslated region (UTR) and Gag. These studies have also suggested that the packaging determinants of MPMV that lie in the UTR are bipartite and are divided into two regions both upstream and downstream of the major splice donor. However, the precise boundaries of these discontinuous regions within the UTR and the role of the intervening sequences between these dipartite sequences towards MPMV packaging have not been investigated. Employing a combination of genetic and structural prediction analyses, we have shown that region "A", immediately downstream of the primer binding site, is composed of 50 nt, whereas region "B" is composed of the last 23 nt of UTR, and the intervening 55 nt between these two discontinuous regions do not contribute towards MPMV RNA packaging. In addition, we have identified a 14-nt G-C-rich palindromic sequence (with 100% autocomplementarity) within region A that has been predicted to fold into a structural motif and is essential for optimal MPMV RNA packaging. Furthermore, we have also identified a stretch of single-stranded purines (ssPurines) within the UTR and 8 nt of these ssPurines are duplicated in region B. The native ssPurines or its repeat in region B when predicted to refold as ssPurines has been shown to be essential for RNA packaging, possibly functioning as a potential nucleocapsid binding site. Findings from this study should enhance our understanding of the steps involved in MPMV replication including RNA encapsidation process. Copyright (c) 2010 Elsevier Ltd

  12. A single-stranded conformational polymorphism (SSCP)-derived quantitative variable to monitor the virulence of a Barley yellow dwarf virus-PAV (BYDV-PAV) isolate during adaptation to the TC14 resistant wheat line.

    Science.gov (United States)

    Delaunay, Agnes; Lacroix, Christelle; Morliere, Stephanie; Riault, Gerard; Chain, Florian; Trottet, Maxime; Jacquot, Emmanuel

    2010-09-01

    A standardized single-stranded conformational polymorphism (SSCP) procedure is proposed as an alternative to the time-consuming biological characterization of Barley yellow dwarf virus-PAV (BYDV-PAV) isolates. Using this procedure, six of 21 overlapping regions used to scan the viral genome gave patterns specific to '4E' (avirulent) or '4T' ('4E'-derived virulent) isolates. The calibration of samples and integration of SSCP patterns corresponding to the nucleotide region 1482-2023 allowed the estimation of P(T) values that reflect the proportions of a '4T'-specific band. Analysis of the biological (area under the pathogen progress curve) and molecular (P(T)) data suggested a positive linear relation between these variables. Moreover, sequence analysis of the nucleotide region 1482-2023 highlighted the presence of a nucleotide polymorphism (C/A(1835)) which can be considered as a candidate for virus-host interactions linked to the monitored virulence. According to these parameters, P(T) values associated with '4E'- and '4T'-derived populations show that: (i) long-term infection of a BYDV-PAV isolate on the 'TC14' resistant host leads to the fixation of virulent individuals in viral populations; and (ii) the introduction of susceptible hosts in successive 'TC14' infections results in the maintenance of low virulence of the populations. Thus, the presented study demonstrates that SSCP is a useful tool for monitoring viral populations during the host adaptation process. The described impact of host alternation provides new opportunities for the use of the 'TC14' resistance source in BYDV-resistant breeding programmes. This study is part of the global effort made by the scientific community to propose sustainable alternatives to the chemical control of this viral disease.

  13. Ex vivo gene editing of the dystrophin gene in muscle stem cells mediated by peptide nucleic acid single stranded oligodeoxynucleotides induces stable expression of dystrophin in a mouse model for Duchenne muscular dystrophy.

    Science.gov (United States)

    Nik-Ahd, Farnoosh; Bertoni, Carmen

    2014-07-01

    Duchenne muscular dystrophy (DMD) is a fatal disease caused by mutations in the dystrophin gene, which result in the complete absence of dystrophin protein throughout the body. Gene correction strategies hold promise to treating DMD. Our laboratory has previously demonstrated the ability of peptide nucleic acid single-stranded oligodeoxynucleotides (PNA-ssODNs) to permanently correct single-point mutations at the genomic level. In this study, we show that PNA-ssODNs can target and correct muscle satellite cells (SCs), a population of stem cells capable of self-renewing and differentiating into muscle fibers. When transplanted into skeletal muscles, SCs transfected with correcting PNA-ssODNs were able to engraft and to restore dystrophin expression. The number of dystrophin-positive fibers was shown to significantly increase over time. Expression was confirmed to be the result of the activation of a subpopulation of SCs that had undergone repair as demonstrated by immunofluorescence analyses of engrafted muscles using antibodies specific to full-length dystrophin transcripts and by genomic DNA analysis of dystrophin-positive fibers. Furthermore, the increase in dystrophin expression detected over time resulted in a significant improvement in muscle morphology. The ability of transplanted cells to return into quiescence and to activate upon demand was confirmed in all engrafted muscles following injury. These results demonstrate the feasibility of using gene editing strategies to target and correct SCs and further establish the therapeutic potential of this approach to permanently restore dystrophin expression into muscle of DMD patients. © 2014 AlphaMed Press.

  14. Hairpin formation within the enhancer region of the human enkephalin gene

    Energy Technology Data Exchange (ETDEWEB)

    McMurray, C.T.; Douglass, J.O. (Oregon Health Sciences Univ., Portland (United States)); Wilson, W.D. (Georgia State Univ., Atlanta (United States))

    1991-01-15

    The 3{prime},5{prime}-cyclic adenosine monophosphate (cAMP)-inducible enhancer of the human enkephaline gene is located within an imperfect palindrom of 23 base pairs. The authors have found that a 23-base-pair oligonucleotide duplex containing the enhancer undergoes a reversible conformational transition from the duplex to two individual hairpin structures each formed from one strand of the duplex. Each individual hairpin forms with mismatched base pairs, one containing two GT pairs and the other containing two AC pairs. The conformational transition is stabilized by proton transfer to the hairpin containing AC mismatched pairs. The unique physical and thermodynamic properties of the enkephalin enhancer DNA suggest a model in which DNA secondary structure within the enhancer region plays and active role incAMP-inducible activation of the human enkephalin gene via formation of cruciform structures.

  15. Dynamic force spectroscopy of DNA hairpins: I. Force kinetics and free energy landscapes

    International Nuclear Information System (INIS)

    Mossa, A; Manosas, M; Forns, N; Huguet, J M; Ritort, F

    2009-01-01

    We investigate the thermodynamics and kinetics of DNA hairpins that fold/unfold under the action of applied mechanical force. We introduce the concept of the molecular free energy landscape and derive simplified expressions for the force dependent Kramers–Bell rates. To test the theory we have designed a specific DNA hairpin sequence that shows two-state cooperative folding under mechanical tension and carried out pulling experiments using optical tweezers. We show how we can determine the parameters that characterize the molecular free energy landscape of such sequences from rupture force kinetic studies. Finally we combine such kinetic studies with experimental investigations of the Crooks fluctuation relation to derive the free energy of formation of the hairpin at zero force

  16. Linear Chromosome-generating System of Agrobacterium tumefaciens C58: Protelomerase Generates and Protects Hairpin Ends

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Wai Mun; DaGloria, Jeanne; Fox, Heather; Ruan, Qiurong; Tillou, John; Shi, Ke; Aihara, Hideki; Aron, John; Casjens, Sherwood (Utah); (UMM)

    2012-09-05

    Agrobacterium tumefaciens C58, the pathogenic bacteria that causes crown gall disease in plants, harbors one circular and one linear chromosome and two circular plasmids. The telomeres of its unusual linear chromosome are covalently closed hairpins. The circular and linear chromosomes co-segregate and are stably maintained in the organism. We have determined the sequence of the two ends of the linear chromosome thus completing the previously published genome sequence of A. tumefaciens C58. We found that the telomeres carry nearly identical 25-bp sequences at the hairpin ends that are related by dyad symmetry. We further showed that its Atu2523 gene encodes a protelomerase (resolvase) and that the purified enzyme can generate the linear chromosomal closed hairpin ends in a sequence-specific manner. Agrobacterium protelomerase, whose presence is apparently limited to biovar 1 strains, acts via a cleavage-and-religation mechanism by making a pair of transient staggered nicks invariably at 6-bp spacing as the reaction intermediate. The enzyme can be significantly shortened at both the N and C termini and still maintain its enzymatic activity. Although the full-length enzyme can uniquely bind to its product telomeres, the N-terminal truncations cannot. The target site can also be shortened from the native 50-bp inverted repeat to 26 bp; thus, the Agrobacterium hairpin-generating system represents the most compact activity of all hairpin linear chromosome- and plasmid-generating systems to date. The biochemical analyses of the protelomerase reactions further revealed that the tip of the hairpin telomere may be unusually polymorphically capable of accommodating any nucleotide.

  17. Probing for DNA damage with β-hairpins: Similarities in incision efficiencies of bulky DNA adducts by prokaryotic and human nucleotide excision repair systems in vitro

    Science.gov (United States)

    Liu, Yang; Reeves, Dara; Kropachev, Konstantin; Cai, Yuqin; Ding, Shuang; Kolbanovskiy, Marina; Kolbanovskiy, Alexander; Bolton, Judith L.; Broyde, Suse; Van Houten, Bennett; Geacintov, Nicholas E.

    2011-01-01

    Nucleotide excision repair (NER) is an important prokaryotic and eukaryotic defense mechanism that removes a large variety of structurally distinct lesions in cellular DNA. While the proteins involved are completely different, the mode of action of these two repair systems is similar, involving a cut-and-patch mechanism in which an oligonucleotide sequence containing the lesion is excised. The prokaryotic and eukaryotic NER damage-recognition factors have common structural features of β-hairpin intrusion between the two DNA strands at the site of the lesion. In the present study, we explored the hypothesis that this common β-hairpin intrusion motif is mirrored in parallel NER incision efficiencies in the two systems. We have utilized human HeLa cell extracts and the prokaryotic UvrABC proteins to determine their relative NER incision efficiencies. We report here comparisons of relative NER efficiencies with a set of stereoisomeric DNA lesions derived from metabolites of benzo[a]pyrene and equine estrogens in different sequence contexts, utilizing 21 samples. We found a general qualitative trend towards similar relative NER incision efficiencies for ~ 65% of these substrates; the other cases deviate mostly by ~ 30% or less from a perfect correlation, although several more distant outliers are also evident. This resemblance is consistent with the hypothesis that lesion recognition through β-hairpin insertion, a common feature of the two systems, is facilitated by local thermodynamic destabilization induced by the lesions in both cases. In the case of the UvrABC system, varying the nature of the UvrC endonuclease, while maintaining the same UvrA/B proteins, can markedly affect the relative incision efficiencies. These observations suggest that, in addition to recognition involving the initial modified duplexes, downstream events involving UvrC can also play a role in distinguishing and processing different lesions in prokaryotic NER. PMID:21741328

  18. DNA hairpins promote temperature controlled cargo encapsulation in a truncated octahedral nanocage structure family

    DEFF Research Database (Denmark)

    Franch, Oskar; Iacovelli, Federico; Falconi, Mattia

    2016-01-01

    In the present study we investigate the mechanism behind temperature controlled cargo uptake using a truncated octahedral DNA cage scaffold functionalized with one, two, three or four hairpin forming DNA strands inserted in one corner of the structure. This investigation was inspired by our...... previous demonstration of temperature controlled reversible encapsulation of the cargo enzyme, horseradish peroxidase, in the cage with four hairpin forming strands. However, in this previous study the mechanism of cargo uptake was not directly addressed (Juul, et al., Temperature-Controlled Encapsulation...

  19. Mutagenesis of the Agrobacterium VirE2 single-stranded DNA-binding protein identifies regions required for self-association and interaction with VirE1 and a permissive site for hybrid protein construction.

    Science.gov (United States)

    Zhou, X R; Christie, P J

    1999-07-01

    The VirE2 single-stranded DNA-binding protein (SSB) of Agrobacterium tumefaciens is required for delivery of T-DNA to the nuclei of susceptible plant cells. By yeast two-hybrid and immunoprecipitation analyses, VirE2 was shown to self-associate and to interact with VirE1. VirE2 mutants with small deletions or insertions of a 31-residue oligopeptide (i31) at the N or C terminus or with an i31 peptide insertion at Leu236 retained the capacity to form homomultimers. By contrast, VirE2 mutants with modifications outside a central region located between residues 320 and 390 retained the capacity to interact with VirE1. These findings suggest the tertiary structure of VirE2 is important for homomultimer formation whereas a central domain mediates formation of a complex with VirE1. The capacity of VirE2 mutants to interact with full-length VirE2 in the yeast Saccharomyces cerevisiae correlated with the abundance of the mutant proteins in A. tumefaciens, suggesting that VirE2 is stabilized by homomultimerization in the bacterium. We further characterized the promoter and N- and C-terminal sequence requirements for synthesis of functional VirE2. A PvirB::virE2 construct yielded functional VirE2 protein as defined by complementation of a virE2 null mutation. By contrast, PvirE or Plac promoter constructs yielded functional VirE2 only if virE1 was coexpressed with virE2. Deletion of 10 or 9 residues from the N or C terminus of VirE2, respectively, or addition of heterologous peptides or proteins to either terminus resulted in a loss of protein function. However, an i31 peptide insertion at Tyr39 had no effect on protein function as defined by the capacity of the mutant protein to (i) interact with native VirE2, (ii) interact with VirE1, (iii) accumulate at abundant levels in A. tumefaciens, and (iv) restore wild-type virulence to a virE2 null mutant. We propose that Tyr39 of VirE2 corresponds to a permissive site for insertion of heterologous peptides or proteins of interest

  20. Vibrational spectral simulation for peptides of mixed secondary structure: Method comparisons with the Trpzip model hairpin

    Czech Academy of Sciences Publication Activity Database

    Bouř, Petr; Keiderling, T. A.

    2005-01-01

    Roč. 109, - (2005), 23687-23697 ISSN 1089-5647 R&D Projects: GA AV ČR(CZ) IAA4055104 Grant - others:NSF(US) CHE03-16014 Institutional research plan: CEZ:AV0Z40550506 Keywords : VCD * trpzin model hairpin * peptides Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.679, year: 2003

  1. Inhibition of HIV Replication by Cyclic and Hairpin PNAs Targeting the HIV-1 TAR RNA Loop

    Directory of Open Access Journals (Sweden)

    Gregory Upert

    2012-01-01

    Full Text Available Human immunodeficiency virus-1 (HIV-1 replication and gene expression entails specific interaction of the viral protein Tat with its transactivation responsive element (TAR, to form a highly stable stem-bulge-loop structure. Previously, we described triphenylphosphonium (TPP cation-based vectors that efficiently deliver nucleotide analogs (PNAs into the cytoplasm of cells. In particular, we showed that the TPP conjugate of a linear 16-mer PNA targeting the apical stem-loop region of TAR impedes Tat-mediated transactivation of the HIV-1 LTR in vitro and also in cell culture systems. In this communication, we conjugated TPP to cyclic and hairpin PNAs targeting the loop region of HIV-1 TAR and evaluated their antiviral efficacy in a cell culture system. We found that TPP-cyclic PNAs containing only 8 residues, showed higher antiviral potency compared to hairpin PNAs of 12 or 16 residues. We further noted that the TPP-conjugates of the 8-mer cyclic PNA as well as the 16-mer linear PNA displayed similar antiviral efficacy. However, cyclic PNAs were shown to be highly specific to their target sequences. This communication emphasizes on the importance of small constrained cyclic PNAs over both linear and hairpin structures for targeting biologically relevant RNA hairpins.

  2. Hairpin-like fluorescent probe for imaging of NF-κB transcription factor activity.

    Science.gov (United States)

    Metelev, Valeri; Zhang, Surong; Tabatadze, David; Bogdanov, Alexei

    2011-04-20

    Three oligodeoxyribonucleotides (ODN) covalently labeled with near-infrared (NIR) fluorochromes were synthesized and characterized with a goal of comparing in vitro a hairpin-based and a duplex-based FRET probe designed for the detection of human recombinant NF-κB p50/p65 heterodimer binding to DNA. Using deoxyguanosine phosphoramidite with a phosphorus-linked aminoethylene (diethylene glycol) hydrophilic linker, we synthesized ODNs with internucleoside reactive sites. The hairpin loop amino linker was modified with IRDye 800CW (FRET acceptor), and the 3'-end was modified with Cy5.5 (FRET donor) using a dithio-linker. To obtain a duplex probe, we conjugated Cy5.5 and 800CW to complementary strands at the distance of ten base pairs in the resultant duplex. No quenching of dyes was observed in either probe. The FRET efficiency was higher in the duplex (71%) than in the hairpin (56%) due to a more favorable distance between the donor and the acceptor. However, the hairpin design allowed more precise ratiometric measurement of fluorescence intensity changes as a result of NF-κB p50/p65 binding to the probe. We determined that as a result of binding there was a statistically significant increase of fluorescence intensity of Cy5.5 (donor) due to a decrease of FRET if normalized by 800CW intensity measured independently of FRET. We conclude that the hairpin based probe design allows for the synthesis of a dual fluorescence imaging probe that renders signal changes that are simple to interpret and stoichiometrically correct for detecting transcription factor-DNA interactions.

  3. The influence of junction conformation on RNA cleavage by the hairpin ribozyme in its natural junction form.

    Science.gov (United States)

    Thomson, J B; Lilley, D M

    1999-01-01

    In the natural form of the hairpin ribozyme the two loop-carrying duplexes that comprise the majority of essential bases for activity form two adjacent helical arms of a four-way RNA junction. In the present work we have manipulated the sequence around the junction in a way known to perturb the global folding properties. We find that replacement of the junction by a different sequence that has the same conformational properties as the natural sequence gives closely similar reaction rate and Arrhenius activation energy for the substrate cleavage reaction. By comparison, rotation of the natural sequence in order to alter the three-dimensional folding of the ribozyme leads to a tenfold reduction in the kinetics of cleavage. Replacement with the U1 four-way junction that is resistant to rotation into the antiparallel structure required to allow interaction between the loops also gives a tenfold reduction in cleavage rate. The results indicate that the conformation of the junction has a major influence on the catalytic activity of the ribozyme. The results are all consistent with a role for the junction in the provision of a framework by which the loops are presented for interaction in order to create the active form of the ribozyme. PMID:10024170

  4. Design and Simulation of Microstrip Hairpin Bandpass Filter with Open Stub and Defected Ground Structure (DGS) at X-Band Frequency

    Science.gov (United States)

    Hariyadi, T.; Mulyasari, S.; Mukhidin

    2018-02-01

    In this paper we have designed and simulated a Band Pass Filter (BPF) at X-band frequency. This filter is designed for X-band weather radar application with 9500 MHz center frequency and bandwidth -3 dB is 120 MHz. The filter design was performed using a hairpin microstrip combined with an open stub and defected ground structure (DGS). The substrate used is Rogers RT5880 with a dielectric constant of 2.2 and a thickness of 1.575 mm. Based on the simulation results, it is found that the filter works on frequency 9,44 - 9,56 GHz with insertion loss value at pass band is -1,57 dB.

  5. β-hairpin-mediated formation of structurally distinct multimers of neurotoxic prion peptides.

    Directory of Open Access Journals (Sweden)

    Andrew C Gill

    Full Text Available Protein misfolding disorders are associated with conformational changes in specific proteins, leading to the formation of potentially neurotoxic amyloid fibrils. During pathogenesis of prion disease, the prion protein misfolds into β-sheet rich, protease-resistant isoforms. A key, hydrophobic domain within the prion protein, comprising residues 109-122, recapitulates many properties of the full protein, such as helix-to-sheet structural transition, formation of fibrils and cytotoxicity of the misfolded isoform. Using all-atom, molecular simulations, it is demonstrated that the monomeric 109-122 peptide has a preference for α-helical conformations, but that this peptide can also form β-hairpin structures resulting from turns around specific glycine residues of the peptide. Altering a single amino acid within the 109-122 peptide (A117V, associated with familial prion disease increases the prevalence of β-hairpin formation and these observations are replicated in a longer peptide, comprising residues 106-126. Multi-molecule simulations of aggregation yield different assemblies of peptide molecules composed of conformationally-distinct monomer units. Small molecular assemblies, consistent with oligomers, comprise peptide monomers in a β-hairpin-like conformation and in many simulations appear to exist only transiently. Conversely, larger assemblies are comprised of extended peptides in predominately antiparallel β-sheets and are stable relative to the length of the simulations. These larger assemblies are consistent with amyloid fibrils, show cross-β structure and can form through elongation of monomer units within pre-existing oligomers. In some simulations, assemblies containing both β-hairpin and linear peptides are evident. Thus, in this work oligomers are on pathway to fibril formation and a preference for β-hairpin structure should enhance oligomer formation whilst inhibiting maturation into fibrils. These simulations provide an

  6. β-Hairpin-Mediated Formation of Structurally Distinct Multimers of Neurotoxic Prion Peptides

    Science.gov (United States)

    Gill, Andrew C.

    2014-01-01

    Protein misfolding disorders are associated with conformational changes in specific proteins, leading to the formation of potentially neurotoxic amyloid fibrils. During pathogenesis of prion disease, the prion protein misfolds into β-sheet rich, protease-resistant isoforms. A key, hydrophobic domain within the prion protein, comprising residues 109–122, recapitulates many properties of the full protein, such as helix-to-sheet structural transition, formation of fibrils and cytotoxicity of the misfolded isoform. Using all-atom, molecular simulations, it is demonstrated that the monomeric 109–122 peptide has a preference for α-helical conformations, but that this peptide can also form β-hairpin structures resulting from turns around specific glycine residues of the peptide. Altering a single amino acid within the 109–122 peptide (A117V, associated with familial prion disease) increases the prevalence of β-hairpin formation and these observations are replicated in a longer peptide, comprising residues 106–126. Multi-molecule simulations of aggregation yield different assemblies of peptide molecules composed of conformationally-distinct monomer units. Small molecular assemblies, consistent with oligomers, comprise peptide monomers in a β-hairpin-like conformation and in many simulations appear to exist only transiently. Conversely, larger assemblies are comprised of extended peptides in predominately antiparallel β-sheets and are stable relative to the length of the simulations. These larger assemblies are consistent with amyloid fibrils, show cross-β structure and can form through elongation of monomer units within pre-existing oligomers. In some simulations, assemblies containing both β-hairpin and linear peptides are evident. Thus, in this work oligomers are on pathway to fibril formation and a preference for β-hairpin structure should enhance oligomer formation whilst inhibiting maturation into fibrils. These simulations provide an important new

  7. Stabilization of a β-hairpin in monomeric Alzheimer's amyloid-β peptide inhibits amyloid formation

    Science.gov (United States)

    Hoyer, Wolfgang; Grönwall, Caroline; Jonsson, Andreas; Ståhl, Stefan; Härd, Torleif

    2008-01-01

    According to the amyloid hypothesis, the pathogenesis of Alzheimer's disease is triggered by the oligomerization and aggregation of the amyloid-β (Aβ) peptide into protein plaques. Formation of the potentially toxic oligomeric and fibrillar Aβ assemblies is accompanied by a conformational change toward a high content of β-structure. Here, we report the solution structure of Aβ(1–40) in complex with the phage-display selected affibody protein ZAβ3, a binding protein of nanomolar affinity. Bound Aβ(1–40) features a β-hairpin comprising residues 17–36, providing the first high-resolution structure of Aβ in β conformation. The positions of the secondary structure elements strongly resemble those observed for fibrillar Aβ. ZAβ3 stabilizes the β-sheet by extending it intermolecularly and by burying both of the mostly nonpolar faces of the Aβ hairpin within a large hydrophobic tunnel-like cavity. Consequently, ZAβ3 acts as a stoichiometric inhibitor of Aβ fibrillation. The selected Aβ conformation allows us to suggest a structural mechanism for amyloid formation based on soluble oligomeric hairpin intermediates. PMID:18375754

  8. Combined High-Speed 3D Scalar and Velocity Reconstruction of Hairpin Vortex

    Science.gov (United States)

    Sabatino, Daniel; Rossmann, Tobias; Zhu, Xuanyu; Thorsen, Mary

    2017-11-01

    The combination of 3D scanning stereoscopic particle image velocimetry (PIV) and 3D Planar Laser Induced Fluorescence (PLIF) is used to create high-speed three-dimensional reconstructions of the scalar and velocity fields of a developing hairpin vortex. The complete description of the regenerating hairpin vortex is needed as transitional boundary layers and turbulent spots are both comprised of and influenced by these vortices. A new high-speed, high power, laser-based imaging system is used which enables both high-speed 3D scanning stereo PIV and PLIF measurements. The experimental system uses a 250 Hz scanning mirror, two high-speed cameras with a 10 kHz frame rate, and a 40 kHz pulsed laser. Individual stereoscopic PIV images and scalar PLIF images are then reconstructed into time-resolved volumetric velocity and scalar data. The results from the volumetric velocity and scalar fields are compared to previous low-speed tomographic PIV data and scalar visualizations to determine the accuracy and fidelity of the high-speed diagnostics. Comparisons between the velocity and scalar field during hairpin development and regeneration are also discussed. Supported by the National Science Foundation under Grant CBET-1531475, Lafayette College,and the McCutcheon Foundation.

  9. "Off-on" electrochemical hairpin-DNA-based genosensor for cancer diagnostics.

    Science.gov (United States)

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt; Ferapontova, Elena E

    2011-03-01

    A simple and robust "off-on" signaling genosensor platform with improved selectivity for single-nucleotide polymorphism (SNP) detection based on the electronic DNA hairpin molecular beacons has been developed. The DNA beacons were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 3'-end, while the 5'-end was labeled with a methylene blue (MB) redox probe. A typical "on-off" change of the electrochemical signal was observed upon hybridization of the 27-33 nucleotide (nt) long hairpin DNA to the target DNA, in agreement with all the hitherto published data. Truncation of the DNA hairpin beacons down to 20 nts provided improved genosensor selectivity for SNP and allowed switching of the electrochemical genosensor response from the on-off to the off-on mode. Switching was consistent with the variation in the mechanism of the electron transfer reaction between the electrode and the MB redox label, for the folded beacon being characteristic of the electrochemistry of adsorbed species, while for the "open" duplex structure being formally controlled by the diffusion of the redox label within the adsorbate layer. The relative current intensities of both processes were governed by the length of the formed DNA duplex, potential scan rate, and apparent diffusion coefficient of the redox species. The off-on genosensor design used for detection of a cancer biomarker TP53 gene sequence favored discrimination between the healthy and SNP-containing DNA sequences, which was particularly pronounced at short hybridization times.

  10. ncRNAclassifier: a tool for detection and classification of transposable element sequences in RNA hairpins

    Directory of Open Access Journals (Sweden)

    Tempel Sébastien

    2012-09-01

    Full Text Available Abstract Background Inverted repeat genes encode precursor RNAs characterized by hairpin structures. These RNA hairpins are then metabolized by biosynthetic pathways to produce functional small RNAs. In eukaryotic genomes, short non-autonomous transposable elements can have similar size and hairpin structures as non-coding precursor RNAs. This resemblance leads to problems annotating small RNAs. Results We mapped all microRNA precursors from miRBASE to several genomes and studied the repetition and dispersion of the corresponding loci. We then searched for repetitive elements overlapping these loci. We developed an automatic method called ncRNAclassifier to classify pre-ncRNAs according to their relationship with transposable elements (TEs. We showed that there is a correlation between the number of scattered occurrences of ncRNA precursor candidates and the presence of TEs. We applied ncRNAclassifier on six chordate genomes and report our findings. Among the 1,426 human and 721 mouse pre-miRNAs of miRBase, we identified 235 and 68 mis-annotated pre-miRNAs respectively corresponding completely to TEs. Conclusions We provide a tool enabling the identification of repetitive elements in precursor ncRNA sequences. ncRNAclassifier is available at http://EvryRNA.ibisc.univ-evry.fr.

  11. Opening of the TAR hairpin in the HIV-1 genome causes aberrant RNA dimerization and packaging

    Directory of Open Access Journals (Sweden)

    Das Atze T

    2012-07-01

    Full Text Available Abstract Background The TAR hairpin is present at both the 5′ and 3′ end of the HIV-1 RNA genome. The 5′ element binds the viral Tat protein and is essential for Tat-mediated activation of transcription. We recently observed that complete TAR deletion is allowed in the context of an HIV-1 variant that does not depend on this Tat-TAR axis for transcription. Mutations that open the 5′ stem-loop structure did however affect the leader RNA conformation and resulted in a severe replication defect. In this study, we set out to analyze which step of the HIV-1 replication cycle is affected by this conformational change of the leader RNA. Results We demonstrate that opening the 5′ TAR structure through a deletion in either side of the stem region caused aberrant dimerization and reduced packaging of the unspliced viral RNA genome. In contrast, truncation of the TAR hairpin through deletions in both sides of the stem did not affect RNA dimer formation and packaging. Conclusions These results demonstrate that, although the TAR hairpin is not essential for RNA dimerization and packaging, mutations in TAR can significantly affect these processes through misfolding of the relevant RNA signals.

  12. 2-Aminopurine hairpin probes for the detection of ultraviolet-induced DNA damage

    International Nuclear Information System (INIS)

    El-Yazbi, Amira F.; Loppnow, Glen R.

    2012-01-01

    Highlights: ► Molecular beacon with 2AP bases detects DNA damage in a simple mix-and-read assay. ► Molecular beacons with 2AP bases detect damage at a 17.2 nM limit of detection. ► The 2AP molecular beacon is linear over a 0–3.5 μM concentration range for damage. - Abstract: Nucleic acid exposure to radiation and chemical insults leads to damage and disease. Thus, detection and understanding DNA damage is important for elucidating molecular mechanisms of disease. However, current methods of DNA damage detection are either time-consuming, destroy the sample, or are too specific to be used for generic detection of damage. In this paper, we develop a fluorescence sensor of 2-aminopurine (2AP), a fluorescent analogue of adenine, incorporated in the loop of a hairpin probe for the quantification of ultraviolet (UV) C-induced nucleic acid damage. Our results show that the selectivity of the 2AP hairpin probe to UV-induced nucleic acid damage is comparable to molecular beacon (MB) probes of DNA damage. The calibration curve for the 2AP hairpin probe shows good linearity (R 2 = 0.98) with a limit of detection of 17.2 nM. This probe is a simple, fast and economic fluorescence sensor for the quantification of UV-induced damage in DNA.

  13. A four-way junction accelerates hairpin ribozyme folding via a discrete intermediate

    Science.gov (United States)

    Tan, Elliot; Wilson, Timothy J.; Nahas, Michelle K.; Clegg, Robert M.; Lilley, David M. J.; Ha, Taekjip

    2003-01-01

    The natural form of the hairpin ribozyme comprises two major structural elements: a four-way RNA junction and two internal loops carried by adjacent arms of the junction. The ribozyme folds into its active conformation by an intimate association between the loops, and the efficiency of this process is greatly enhanced by the presence of the junction. We have used single-molecule spectroscopy to show that the natural form fluctuates among three distinct states: the folded state and two additional, rapidly interconverting states (proximal and distal) that are inherited from the junction. The proximal state juxtaposes the two loop elements, thereby increasing the probability of their interaction and thus accelerating folding by nearly three orders of magnitude and allowing the ribozyme to fold rapidly in physiological conditions. Therefore, the hairpin ribozyme exploits the dynamics of the junction to facilitate the formation of the active site from its other elements. Dynamic interplay between structural elements, as we demonstrate for the hairpin ribozyme, may be a general theme for other functional RNA molecules. PMID:12883002

  14. An approach to the construction of tailor-made amphiphilic peptides that strongly and selectively bind to hairpin RNA targets.

    Science.gov (United States)

    Lee, Su Jin; Hyun, Soonsil; Kieft, Jeffrey S; Yu, Jaehoon

    2009-02-18

    The hairpin RNA motif is one of the most frequently observed secondary structures and is often targeted by therapeutic agents. An amphiphilic peptide with seven lysine and eight leucine residues and its derivatives were designed for use as ligands against RNA hairpin motifs. We hypothesized that variations in both the hydrophobic leucine-rich and hydrophilic lysine-rich spheres of these amphiphilic peptides would create extra attractive interactions with hairpin RNA targets. A series of alanine-scanned peptides were probed to identify the most influential lysine residues in the hydrophilic sphere. The binding affinities of these modified peptides with several hairpins, such as RRE, TAR from HIV, a short hairpin from IRES of HCV, and a hairpin from the 16S A-site stem from rRNA, were determined. Since the hairpin from IRES of HCV was the most susceptible to the initial series of alanine-scanned peptides, studies investigating how further variations in the peptides effect binding employed the IRES hairpin. Next, the important Lys residues were substituted by shorter chain amines, such as ornithine, to place the peptide deeper into the hairpin groove. In a few cases, a 70-fold improved binding was observed for peptides that contained the specifically located shorter amine side chains. To further explore changes in binding affinities brought about by alterations in the hydrophobic sphere, tryptophan residues were introduced in place of leucine. A few peptides with tryptophan in specific positions also displayed 70-fold improved binding affinities. Finally, double mutant peptides incorporating both specifically located shorter amine side chains in the hydrophilic region and tryptophan residues in the hydrophobic region were synthesized. The binding affinities of peptides containing the simple double modification were observed to be 80 times lower, and their binding specificities were increased 40-fold. The results of this effort provide important information about

  15. Offshore Substrate

    Data.gov (United States)

    California Department of Resources — This shapefile displays the distribution of substrate types from Pt. Arena to Pt. Sal in central/northern California. Originally this data consisted of seven paper...

  16. Conformational dynamics of DNA hairpins at millisecond resolution obtained from analysis of single-molecule FRET histograms.

    Science.gov (United States)

    Tsukanov, Roman; Tomov, Toma E; Berger, Yaron; Liber, Miran; Nir, Eyal

    2013-12-19

    Here we provide high resolution study of DNA hairpin dynamics achieved by probability distribution analysis (PDA) of diffusion-based single-molecule Förster resonance energy transfer (sm-FRET) histograms. The opening and closing rates of three hairpins both free and attached to DNA origami were determined. The agreement with rates previously obtained using the total internal reflection (TIRF) technique and between free hairpins and hairpins attached to origami validated the PDA and demonstrated that the origami had no influence on the hairpin dynamics. From comparison of rates of four DNA hairpins, differing only in stem sequence, and from comparison with rates calculated using nearest-neighbor method and standard transition state theory, we conclude that the unfolding reaction resembles that of melting of DNA duplex with a corresponding sequence and that the folding reaction depends on counterion concentration and not on stem sequence. Our validation and demonstration of the PDA method will encourage its implementation in future high-resolution dynamic studies of freely diffusing biomolecules.

  17. Recognition and processing of a new repertoire of DNA substrates by human 3-methyladenine DNA glycosylase (AAG).

    Science.gov (United States)

    Lee, Chun-Yue I; Delaney, James C; Kartalou, Maria; Lingaraju, Gondichatnahalli M; Maor-Shoshani, Ayelet; Essigmann, John M; Samson, Leona D

    2009-03-10

    The human 3-methyladenine DNA glycosylase (AAG) recognizes and excises a broad range of purines damaged by alkylation and oxidative damage, including 3-methyladenine, 7-methylguanine, hypoxanthine (Hx), and 1,N(6)-ethenoadenine (epsilonA). The crystal structures of AAG bound to epsilonA have provided insights into the structural basis for substrate recognition, base excision, and exclusion of normal purines and pyrimidines from its substrate recognition pocket. In this study, we explore the substrate specificity of full-length and truncated Delta80AAG on a library of oligonucleotides containing structurally diverse base modifications. Substrate binding and base excision kinetics of AAG with 13 damaged oligonucleotides were examined. We found that AAG bound to a wide variety of purine and pyrimidine lesions but excised only a few of them. Single-turnover excision kinetics showed that in addition to the well-known epsilonA and Hx substrates, 1-methylguanine (m1G) was also excised efficiently by AAG. Thus, along with epsilonA and ethanoadenine (EA), m1G is another substrate that is shared between AAG and the direct repair protein AlkB. In addition, we found that both the full-length and truncated AAG excised 1,N(2)-ethenoguanine (1,N(2)-epsilonG), albeit weakly, from duplex DNA. Uracil was excised from both single- and double-stranded DNA, but only by full-length AAG, indicating that the N-terminus of AAG may influence glycosylase activity for some substrates. Although AAG has been primarily shown to act on double-stranded DNA, AAG excised both epsilonA and Hx from single-stranded DNA, suggesting the possible significance of repair of these frequent lesions in single-stranded DNA transiently generated during replication and transcription.

  18. DNA/RNA hybrid substrates modulate the catalytic activity of purified AID.

    Science.gov (United States)

    Abdouni, Hala S; King, Justin J; Ghorbani, Atefeh; Fifield, Heather; Berghuis, Lesley; Larijani, Mani

    2018-01-01

    Activation-induced cytidine deaminase (AID) converts cytidine to uridine at Immunoglobulin (Ig) loci, initiating somatic hypermutation and class switching of antibodies. In vitro, AID acts on single stranded DNA (ssDNA), but neither double-stranded DNA (dsDNA) oligonucleotides nor RNA, and it is believed that transcription is the in vivo generator of ssDNA targeted by AID. It is also known that the Ig loci, particularly the switch (S) regions targeted by AID are rich in transcription-generated DNA/RNA hybrids. Here, we examined the binding and catalytic behavior of purified AID on DNA/RNA hybrid substrates bearing either random sequences or GC-rich sequences simulating Ig S regions. If substrates were made up of a random sequence, AID preferred substrates composed entirely of DNA over DNA/RNA hybrids. In contrast, if substrates were composed of S region sequences, AID preferred to mutate DNA/RNA hybrids over substrates composed entirely of DNA. Accordingly, AID exhibited a significantly higher affinity for binding DNA/RNA hybrid substrates composed specifically of S region sequences, than any other substrates composed of DNA. Thus, in the absence of any other cellular processes or factors, AID itself favors binding and mutating DNA/RNA hybrids composed of S region sequences. AID:DNA/RNA complex formation and supporting mutational analyses suggest that recognition of DNA/RNA hybrids is an inherent structural property of AID. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Human Ku70 protein binds hairpin RNA and double stranded DNA through two different sites.

    Science.gov (United States)

    Anisenko, Andrey N; Knyazhanskaya, Ekaterina S; Zatsepin, Timofey S; Gottikh, Marina B

    2017-01-01

    Human protein Ku usually functions in the cell as a complex of two subunits, Ku70 and Ku80. The Ku heterodimer plays a key role in the non-homologous end joining DNA repair pathway by specifically recognizing the DNA ends at the site of the lesion. The binding of the Ku heterodimer to DNA has been well-studied, and its interactions with RNA have been also described. However, Ku70 subunit is known to have independent DNA binding capability, which is less characterized. RNA binding properties of Ku70 have not been yet specially studied. We have prepared recombinant full-length Ku70 and a set of its truncated mutants in E. coli, and studied their interactions with nucleic acids of various structures: linear single- and double-stranded DNA and RNA, as well as closed circular DNA and hairpin RNA. Ku70 has demonstrated a high affinity binding to double stranded DNA and hairpin RNA with a certain structure only. Interestingly, in contrast to the Ku heterodimer, Ku70 is found to interact with closed circular DNA. We also show for the first time that Ku70 employs two different sites for DNA and RNA binding. The double-stranded DNA is recognized by the C-terminal part of Ku70 including SAP domain as it has been earlier demonstrated, whereas hairpin RNA binding is provided by amino acids 251-438. Copyright © 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  20. Efficacy Analysis of Combinatorial siRNAs against HIV Derived from One Double Hairpin RNA Precursor.

    Science.gov (United States)

    Liu, Chang; Liang, Zhipin; Kong, Xiaohong

    2017-01-01

    Combinatorial small interfering RNA duplexes (siRNAs) have the potential to be a gene therapy against HIV-1, and some studies have reported that transient combinatorial siRNA expression represses HIV replication, but the effects of long-term siRNA expression on HIV replication have not been studied in detail. In this study, HIV-1 replication under the influence of stable combinatorial siRNA expression from a single RNA transcript was analyzed. First, a series of cassettes encoding short hairpin RNA (shRNA)/long hairpin RNA (lhRNA)/double long hairpins (dlhRNA) was constructed and subjected to an analysis of inhibitory efficacy. Next, an optimized dlhRNA encoding cassette was selected and inserted into lentiviral delivery vector FG12. Transient dlhRNA expression reduced replication of HIV-1 in TZM-bl cells and CD4+ T cells successfully. HIV-1 susceptible TZM-bl cells were transducted with the dlhRNA expressing lentiviral vector and sorted by fluorescence-activated cell sorting to obtain stable dlhRNA expressing cells. The generation of four anti-HIV siRNAs in these dlhRNA expressing cells was verified by stem-loop RT-PCR assay. dlhRNA expression did not activate a non-specific interferon response. The dlhRNA expressing cells were also challenged with HIV-1 NL4-3, which revealed that stable expression of combinatorial siRNAs repressed HIV-1 replication for 8 days, after which HIV-1 overcame the inhibitory effect of siRNA expression by expressing mutant versions of RNAi targets. The results of this evaluation of the long-term inhibitory effects of combinatorial siRNAs against HIV-1 provide a reference for researchers who utilize combinatorial RNA interference against HIV-1 or other error-prone viruses.

  1. Effect of secondary structure on the thermodynamics and kinetics of PNA hybridization to DNA hairpins

    DEFF Research Database (Denmark)

    Kushon, S A; Jordan, J P; Seifert, J L

    2001-01-01

    The binding of a series of PNA and DNA probes to a group of unusually stable DNA hairpins of the tetraloop motif has been observed using absorbance hypochromicity (ABS), circular dichroism (CD), and a colorimetric assay for PNA/DNA duplex detection. These results indicate that both stable PNA...... structures in both target and probe molecules are shown to depress the melting temperatures and free energies of the probe-target duplexes. Kinetic analysis of hybridization yields reaction rates that are up to 160-fold slower than hybridization between two unstructured strands. The thermodynamic and kinetic...

  2. β-Hairpin of Islet Amyloid Polypeptide Bound to an Aggregation Inhibitor

    Science.gov (United States)

    Mirecka, Ewa A.; Feuerstein, Sophie; Gremer, Lothar; Schröder, Gunnar F.; Stoldt, Matthias; Willbold, Dieter; Hoyer, Wolfgang

    2016-01-01

    In type 2 diabetes, the formation of islet amyloid consisting of islet amyloid polypeptide (IAPP) is associated with reduction in β-cell mass and contributes to the failure of islet cell transplantation. Rational design of inhibitors of IAPP amyloid formation has therapeutic potential, but is hampered by the lack of structural information on inhibitor complexes of the conformationally flexible, aggregation-prone IAPP. Here we characterize a β-hairpin conformation of IAPP in complex with the engineered binding protein β-wrapin HI18. The β-strands correspond to two amyloidogenic motifs, 12-LANFLVH-18 and 22-NFGAILS-28, which are connected by a turn established around Ser-20. Besides backbone hydrogen bonding, the IAPP:HI18 interaction surface is dominated by non-polar contacts involving hydrophobic side chains of the IAPP β-strands. Apart from monomers, HI18 binds oligomers and fibrils and inhibits IAPP aggregation and toxicity at low substoichiometric concentrations. The IAPP β-hairpin can serve as a molecular recognition motif enabling control of IAPP aggregation. PMID:27641459

  3. Statistical scale of hairpin packets in the later stage of bypass transition induced by cylinder wake

    Science.gov (United States)

    Tang, Z. Q.; Jiang, N.

    2012-08-01

    The hairpin packet's structure and its statistical scale in the later stage of bypass transition induced by a cylinder wake are investigated by time-resolved particle image velocimetry from the side and top view, respectively. Linear stochastic estimation is used to achieve the conditionally averaged velocity fields. For the side view case, the conditionally averaged structure consists of a series of swirling motions located along a line inclining at a large angle (18°) from the wall and a low-speed region occupied by the cylinder wake appearing right above them. In the ( x, z)-plane at the wall-normal height y/δ = 0.2, the dominant structures are shown to be the large-scale regions of low momentum elongated almost over 3δ along the streamwise. The low-speed regions are consistently bordered by small-scale counter-rotating vortice pairs organized in the streamwise with a statistical spanwise width of 0.55δ. The results suggest that in the later part of the transitional zone, the upward induction of the cylinder wake enhances both the wall-normal and spanwise extent of the hairpin packets.

  4. Transient β-hairpin formation in α-synuclein monomer revealed by coarse-grained molecular dynamics simulation

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Hang; Ma, Wen [Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Center for Biophysics and Computational Biology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Han, Wei [Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Department of Physics, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Schulten, Klaus, E-mail: kschulte@ks.uiuc.edu [Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Center for Biophysics and Computational Biology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Department of Physics, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States)

    2015-12-28

    Parkinson’s disease, originating from the intrinsically disordered peptide α-synuclein, is a common neurodegenerative disorder that affects more than 5% of the population above age 85. It remains unclear how α-synuclein monomers undergo conformational changes leading to aggregation and formation of fibrils characteristic for the disease. In the present study, we perform molecular dynamics simulations (over 180 μs in aggregated time) using a hybrid-resolution model, Proteins with Atomic details in Coarse-grained Environment (PACE), to characterize in atomic detail structural ensembles of wild type and mutant monomeric α-synuclein in aqueous solution. The simulations reproduce structural properties of α-synuclein characterized in experiments, such as secondary structure content, long-range contacts, chemical shifts, and {sup 3}J(H{sub N}H{sub C{sub α}})-coupling constants. Most notably, the simulations reveal that a short fragment encompassing region 38-53, adjacent to the non-amyloid-β component region, exhibits a high probability of forming a β-hairpin; this fragment, when isolated from the remainder of α-synuclein, fluctuates frequently into its β-hairpin conformation. Two disease-prone mutations, namely, A30P and A53T, significantly accelerate the formation of a β-hairpin in the stated fragment. We conclude that the formation of a β-hairpin in region 38-53 is a key event during α-synuclein aggregation. We predict further that the G47V mutation impedes the formation of a turn in the β-hairpin and slows down β-hairpin formation, thereby retarding α-synuclein aggregation.

  5. Structural and dynamic characterization of the upper part of the HIV-1 cTAR DNA hairpin

    OpenAIRE

    Zargarian, Loussin?; Kanevsky, Igor; Bazzi, Ali; Boynard, Jonathan; Chaminade, Fran?oise; Foss?, Philippe; Mauffret, Olivier

    2009-01-01

    First strand transfer is essential for HIV-1 reverse transcription. During this step, the TAR RNA hairpin anneals to the cTAR DNA hairpin; this annealing reaction is promoted by the nucleocapsid protein and involves an initial loop?loop interaction between the apical loops of TAR and cTAR. Using NMR and probing methods, we investigated the structural and dynamic properties of the top half of the cTAR DNA (mini-cTAR). We show that the upper stem located between the apical and the internal loop...

  6. On the a priori possibility of the formation of hexameric mini-hairpin d(GCGAGC) in solution

    Science.gov (United States)

    Rubin, Yu. V.; Belous, L. F.; Evstigneev, M. P.

    2012-11-01

    Combined high-level (M05-2x, M06-2x functionals of DFT method) and semi-empirical structural and energetic analyses have confirmed the a priori possibility for the formation of the shortest ever known hexameric hairpin d(GCGAGC) with GA loop in aqueous solution. The origin of stabilisation comes from intramolecular H-bonding and hydrophobic interactions and, to lesser extent, from intramolecular van der Waals and electrostatic forces. This result provides a basis for seeking of such mini-hairpins in experiment.

  7. RNA polymerase II mediated transcription from the polymerase III promoters in short hairpin RNA expression vector

    International Nuclear Information System (INIS)

    Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu

    2006-01-01

    RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use

  8. A versatile approach to multiple gene RNA interference using microRNA-based short hairpin RNAs

    Directory of Open Access Journals (Sweden)

    Kivork Christine

    2007-10-01

    Full Text Available Abstract Background Effective and stable knockdown of multiple gene targets by RNA interference is often necessary to overcome isoform redundancy, but it remains a technical challenge when working with intractable cell systems. Results We have developed a flexible platform using RNA polymerase II promoter-driven expression of microRNA-like short hairpin RNAs which permits robust depletion of multiple target genes from a single transcript. Recombination-based subcloning permits expression of multi-shRNA transcripts from a comprehensive range of plasmid or viral vectors. Retroviral delivery of transcripts targeting isoforms of cAMP-dependent protein kinase in the RAW264.7 murine macrophage cell line emphasizes the utility of this approach and provides insight to cAMP-dependent transcription. Conclusion We demonstrate functional consequences of depleting multiple endogenous target genes using miR-shRNAs, and highlight the versatility of the described vector platform for multiple target gene knockdown in mammalian cells.

  9. Decay of the electron number density in the nitrogen afterglow using a hairpin resonator probe

    International Nuclear Information System (INIS)

    Siefert, Nicholas S.; Ganguly, Biswa N.; Sands, Brian L.; Hebner, Greg A.

    2006-01-01

    A hairpin resonator was used to measure the electron number density in the afterglow of a nitrogen glow discharge (p=0.25-0.75 Torr). Electron number densities were measured using a time-dependent approach similar to the approach used by Spencer et al. [J. Phys. D 20, 923 (1987)]. The decay time of the electron number density was used to determine the electron temperature in the afterglow, assuming a loss of electrons via ambipolar diffusion to the walls. The electron temperature in the near afterglow remained between 0.4 and 0.6 eV, depending on pressure. This confirms the work by Guerra et al. [IEEE Trans. Plasma. Sci. 31, 542 (2003)], who demonstrated experimentally and numerically that the electron temperature stays significantly above room temperature via superelastic collisions with highly vibrationally excited ground state molecules and metastables, such as A 3 Σ u +

  10. One-step isothermal detection of multiple KRAS mutations by forming SNP specific hairpins on a gold nanoshell.

    Science.gov (United States)

    Chung, Chan Ho; Kim, Joong Hyun

    2018-04-24

    We developed a one-step isothermal method for typing multiple KRAS mutations using a designed set of primers to form a hairpin on a gold nanoshell upon being ligated by a SNP specific DNA ligase after binding of targets. As a result, we could detect as low as 20 attomoles of KRAS mutations within 1 h.

  11. Melting of a beta-hairpin peptide using isotope-edited 2D IR spectroscopy and simulations.

    NARCIS (Netherlands)

    Smith, A.W.; Lessing, J.; Ganim, Z.; Peng, C.S.; Tokmakoff, A.; Roy, S.; Jansen, T.L.Th.A.; Knoester, J.

    2010-01-01

    Isotope-edited two-dimensional infrared spectroscopy has been used to characterize the conformational heterogeneity of the beta-hairpin peptide TrpZip2 (TZ2) across its thermal unfolding transition. Four isotopologues were synthesized to probe hydrogen bonding and solvent exposure of the beta-turn

  12. Melting of a beta-Hairpin Peptide Using Isotope-Edited 2D IR Spectroscopy and Simulations

    NARCIS (Netherlands)

    Smith, Adam W.; Lessing, Joshua; Ganim, Ziad; Peng, Chunte Sam; Tokmakoff, Andrei; Roy, Santanu; Jansen, Thomas L. C.; Knoester, Jasper

    2010-01-01

    Isotope-edited two-dimensional infrared spectroscopy has been used! to characterize the conformational heterogeneity of the beta-hairpin peptide TrpZip2 (17.2) across its thermal unfolding transition Four isotopologues were synthesized to probe hydrogen bonding and solvent exposure of the beta-turn

  13. Origins of biological function in DNA and RNA hairpin loop motifs from replica exchange molecular dynamics simulation.

    Science.gov (United States)

    Swadling, Jacob B; Ishii, Kunihiko; Tahara, Tahei; Kitao, Akio

    2018-01-31

    Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) have remarkably similar chemical structures, but despite this, they play significantly different roles in modern biology. In this article, we explore the possible conformations of DNA and RNA hairpins to better understand the fundamental differences in structure formation and stability. We use large parallel temperature replica exchange molecular dynamics ensembles to sample the full conformational landscape of these hairpin molecules so that we can identify the stable structures formed by the hairpin sequence. Our simulations show RNA adopts a narrower distribution of folded structures compared to DNA at room temperature, which forms both hairpins and many unfolded conformations. RNA is capable of forming twice as many hydrogen bonds than DNA which results in a higher melting temperature. We see that local chemical differences lead to emergent molecular properties such as increased persistence length in RNA that is weakly temperature dependant. These discoveries provide fundamental insight into how RNA forms complex folded tertiary structures which confer enzymatic-like function in ribozymes, whereas DNA retains structural motifs in order to facilitate function such as translation of sequence.

  14. A New Computational Approach for Mechanical Folding Kinetics of RNA Hairpins

    Science.gov (United States)

    Cao, Song; Chen, Shi-Jie

    2009-01-01

    Based on an ensemble of kinetically accessible conformations, we propose a new analytical model for RNA folding kinetics. The model gives populational kinetics, kinetic rates, transition states, and pathways from the rate matrix. Applications of the new kinetic model to mechanical folding of RNA hairpins such as trans-activation-responsive RNA reveal distinct kinetic behaviors in different force regimes, from zero force to forces much stronger than the critical force for the folding-unfolding transition. In the absence of force or a low force, folding can be initiated (nucleated) at any position by forming the first base stack and there exist many pathways for the folding process. In contrast, for a higher force, the folding/unfolding would predominantly proceed along a single zipping/unzipping pathway. Studies for different hairpin-forming sequences indicate that depending on the nucleotide sequence, a kinetic intermediate can emerge in the low force regime but disappear in high force regime, and a new kinetic intermediate, which is absent in the low and high force regimes, can emerge in the medium force range. Variations of the force lead to changes in folding cooperativity and rate-limiting steps. The predicted network of pathways for trans-activation-responsive RNA suggests two parallel dominant pathways. The rate-limiting folding steps (at f = 8 pN) are the formation of specific basepairs that are 2–4 basepairs away from the loop. At a higher force (f = 11 pN), the folding rate is controlled by the formation of the bulge loop. The predicted rates and transition states are in good agreement with the experimental data for a broad force regime. PMID:19450474

  15. Water isotope effect on the thermostability of a polio viral RNA hairpin: A metadynamics study

    Science.gov (United States)

    Pathak, Arup K.; Bandyopadhyay, Tusar

    2017-04-01

    Oral polio vaccine is considered to be the most thermolabile of all the common childhood vaccines. Despite heavy water (D2O) having been known for a long time to stabilise attenuated viral RNA against thermodegradation, the molecular underpinnings of its mechanism of action are still lacking. Whereas, understanding the basis of D2O action is an important step that might reform the way other thermolabile drugs are stored and could possibly minimize the cold chain problem. Here using a combination of parallel tempering and well-tempered metadynamics simulation in light water (H2O) and in D2O, we have fully described the free energy surface associated with the folding/unfolding of a RNA hairpin containing a non-canonical basepair motif, which is conserved within the 3'-untranslated region of poliovirus-like enteroviruses. Simulations reveal that in heavy water (D2O) there is a considerable increase of the stability of the folded basin as monitored through an intramolecular hydrogen bond (HB), size, shape, and flexibility of RNA structures. This translates into a higher melting temperature in D2O by 41 K when compared with light water (H2O). We have explored the hydration dynamics of the RNA, hydration shell around the RNA surface, and spatial dependence of RNA-solvent collective HB dynamics in the two water systems. Simulation in heavy water clearly showed that D2O strengthens the HB network in the solvent, lengthens inter-residue water-bridge lifetime, and weakens dynamical coupling of the hairpin to its solvation environment, which enhances the rigidity of solvent exposed sites of the native configurations. The results might suggest that like other added osmoprotectants, D2O can act as a thermostabilizer when used as a solvent.

  16. Mechanism of membrane permeation induced by synthetic β-hairpin peptides.

    Science.gov (United States)

    Gupta, Kshitij; Jang, Hyunbum; Harlen, Kevin; Puri, Anu; Nussinov, Ruth; Schneider, Joel P; Blumenthal, Robert

    2013-11-05

    We have investigated the membrane destabilizing properties of synthetic amphiphilic cationic peptides, MAX1 and MAX35, which have the propensity to form β-hairpin structures under certain conditions, and a control non-β-hairpin-forming peptide MAX8V16E. All three peptides bind to liposomes containing a mixture of zwitterionic POPC and negatively charged POPS lipids as determined by Zeta potential measurements. Circular dichroism measurements indicated folding of MAX1 and MAX35 in the presence of the POPC/POPS liposomes, whereas no such folding was observed with MAX8V16E. There was no binding or folding of these peptides to liposomes containing only POPC. MAX1 and MAX35 induced release of contents from negatively charged liposomes, whereas MAX8V16E failed to promote solute release under identical conditions. Thus, MAX1 and MAX35 bind to, and fold at the surface of negatively charged liposomes adopting a lytic conformation. We ruled out leaky fusion as a mechanism of release by including 2 mol % PEG-PE in the liposomes, which inhibits aggregation/fusion but not folding of MAX or MAX-induced leakage. Using a concentration-dependent quenching probe (calcein), we determined that MAX-induced leakage of liposome contents was an all-or-none process. At MAX1 concentrations, which cause release of ~50% of the liposomes that contain small (R(h) peptides are relatively more stable than MAX8V16E barrels in the bilayer, suggesting that barrels of this size are responsible for the peptides lytic action. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  17. Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown

    Science.gov (United States)

    Moore, Chris B.; Guthrie, Elizabeth H.; Huang, Max Tze-Han; Taxman, Debra J.

    2013-01-01

    Shortly after the cellular mechanism of RNA interference (RNAi) was first described, scientists began using this powerful technique to study gene function. This included designing better methods for the successful delivery of small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) into mammalian cells. While the simplest method for RNAi is the cytosolic delivery of siRNA oligonucleotides, this technique is limited to cells capable of transfection and is primarily utilized during transient in vitro studies. The introduction of shRNA into mammalian cells through infection with viral vectors allows for stable integration of shRNA and long-term knockdown of the targeted gene; however, several challenges exist with the implementation of this technology. Here we describe some well-tested protocols which should increase the chances of successful design, delivery, and assessment of gene knockdown by shRNA. We provide suggestions for designing shRNA targets and controls, a protocol for sequencing through the secondary structure of the shRNA hairpin structure, and protocols for packaging and delivery of shRNA lentiviral particles. Using real-time PCR and functional assays we demonstrate the successful knockdown of ASC, an inflammatory adaptor molecule. These studies demonstrate the practicality of including two shRNAs with different efficacies of knockdown to provide an additional level of control and to verify dose dependency of functional effects. Along with the methods described here, as new techniques and algorithms are designed in the future, shRNA is likely to include further promising application and continue to be a critical component of gene discovery. PMID:20387148

  18. Combinatorial Pattern Discovery Approach for the Folding Trajectory Analysis of a beta-Hairpin.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available The study of protein folding mechanisms continues to be one of the most challenging problems in computational biology. Currently, the protein folding mechanism is often characterized by calculating the free energy landscape versus various reaction coordinates, such as the fraction of native contacts, the radius of gyration, RMSD from the native structure, and so on. In this paper, we present a combinatorial pattern discovery approach toward understanding the global state changes during the folding process. This is a first step toward an unsupervised (and perhaps eventually automated approach toward identification of global states. The approach is based on computing biclusters (or patterned clusters-each cluster is a combination of various reaction coordinates, and its signature pattern facilitates the computation of the Z-score for the cluster. For this discovery process, we present an algorithm of time complexity cinRO((N + nm log n, where N is the size of the output patterns and (n x m is the size of the input with n time frames and m reaction coordinates. To date, this is the best time complexity for this problem. We next apply this to a beta-hairpin folding trajectory and demonstrate that this approach extracts crucial information about protein folding intermediate states and mechanism. We make three observations about the approach: (1 The method recovers states previously obtained by visually analyzing free energy surfaces. (2 It also succeeds in extracting meaningful patterns and structures that had been overlooked in previous works, which provides a better understanding of the folding mechanism of the beta-hairpin. These new patterns also interconnect various states in existing free energy surfaces versus different reaction coordinates. (3 The approach does not require calculating the free energy values, yet it offers an analysis comparable to, and sometimes better than, the methods that use free energy landscapes, thus validating the

  19. Short, multiple-stranded β-hairpin peptides have antimicrobial potency with high selectivity and salt resistance.

    Science.gov (United States)

    Chou, Shuli; Shao, Changxuan; Wang, Jiajun; Shan, Anshan; Xu, Lin; Dong, Na; Li, Zhongyu

    2016-01-01

    The β-hairpin structure has been proposed to exhibit potent antimicrobial properties with low cytotoxicity, thus, multiple β-hairpin structures have been proved to be highly stable in structures containing tightly packed hydrophobic cores. The aim of this study was to develop peptide-based synthetic strategies for generating short, but effective AMPs as inexpensive antimicrobial agents. Multiple-stranded β-hairpin peptides with the same β-hairpin unit, (WRXxRW)n where n=1, 2, 3, or 4 and Xx represent the turn sequence, were synthesized, and their potential as antimicrobial agents was evaluated. Owning to the tightly packed hydrophobic core and paired Trp of this multiple-stranded β-hairpin structure, all the 12-residues peptides exhibited high cell selectivity towards bacterial cells over human red blood cells (hRBCs), and the peptide W2 exhibited stronger antimicrobial activities with the MIC values of 2-8μM against various tested bacteria. Not only that, but W2 also showed obvious synergy with streptomycin and chloramphenicol against Escherichia coli, and displayed synergy with ciprofloxacin against Staphylococcus aureus with the FICI values ⩽0.5. Fluorescence spectroscopy and electron microscopy analyses indicated that W2 kills microbial cells by permeabilizing the cell membrane and damaging membrane integrity. Collectively, based on the multiple β-hairpin peptides, the ability to develop libraries of short and effective peptides will be a powerful approach to the discovery of novel antimicrobial agents. We successfully screened a peptide W2 ((WRPGRW)2) from a series of multiple-stranded β-hairpin antimicrobial peptides based on the "S-shaped" motif that induced the formation of a globular structure, and Trp zipper was used to replace the disulfide bonds to reduce the cost of production. This novel structure applied to AMPs improved cell selectivity and salt stability. The findings of this study will promote the development of peptide

  20. Structural characterization of a six-nucleotide RNA hairpin loop found in Escherichia coli, r(UUAAGU).

    Science.gov (United States)

    Zhang, H; Fountain, M A; Krugh, T R

    2001-08-21

    The binding region of the Escherichia coli S2 ribosomal protein contains a conserved UUAAGU hairpin loop. The structure of the hairpin formed by the oligomer r(GCGU4U5A6A7G8U9CGCA), which has an r(UUAAGU) hairpin loop, was determined by NMR and molecular modeling techniques as part of a study aimed at characterizing the structure and thermodynamics of RNA hairpin loops. Thermodynamic data obtained from melting curves for this RNA oligomer show that it forms a hairpin in solution with the following parameters: DeltaH degrees = -42.8 +/- 2.2 kcal/mol, DeltaS degrees = -127.6 +/- 6.5 eu, and DeltaG degrees (37) = -3.3 +/- 0.2 kcal/mol. Two-dimensional NOESY WATERGATE spectra show an NOE between U imino protons, which suggests that U4 and U9 form a hydrogen bonded U.U pair. The U5(H2') proton shows NOEs to both the A6(H8) proton and the A7(H8) proton, which is consistent with formation of a "U" turn between nucleotides U5 and A6. An NOE between the A7(H2) proton and the U9(H4') proton shows the proximity of the A7 base to the U9 sugar, which is consistent with the structure determined for the six-nucleotide loop. In addition to having a hydrogen-bonded U.U pair as the first mismatch and a U turn, the r(UUAAGU) loop has the G8 base protruding into the solvent. The solution structure of the r(UUAAGU) loop is essentially identical to the structure of an identical loop found in the crystal structure of the 30S ribosomal subunit where the guanine in the loop is involved in tertiary interactions with RNA bases from adjacent regions [Wimberly, B. T., Brodersen, D. E., Clemons, W. M., Morgan-Warren, R. J., Carter, A. P., Vonrhein, C., Hartsch, T., and Ramakrishnan, V. (2000) Nature 407, 327-339]. The similarity of the solution and solid-state structures of this hairpin loop suggests that formation of this hairpin may facilitate folding of 16S RNA.

  1. A hairpin within YAP mRNA 3′UTR functions in regulation at post-transcription level

    International Nuclear Information System (INIS)

    Gao, Yuen; Wang, Yuan; Feng, Jinyan; Feng, Guoxing; Zheng, Minying; Yang, Zhe; Xiao, Zelin; Lu, Zhanping; Ye, Lihong; Zhang, Xiaodong

    2015-01-01

    The central dogma of gene expression is that DNA is transcribed into messenger RNAs, which in turn serve as the template for protein synthesis. Recently, it has been reported that mRNAs display regulatory roles that rely on their ability to compete for microRNA binding, independent of their protein-coding function. However, the regulatory mechanism of mRNAs remains poorly understood. Here, we report that a hairpin within YAP mRNA 3′untranslated region (3′UTR) functions in regulation at post-transcription level through generating endogenous siRNAs (esiRNAs). Bioinformatics analysis for secondary structure showed that YAP mRNA displayed a hairpin structure (termed standard hairpin, S-hairpin) within its 3′UTR. Surprisingly, we observed that the overexpression of S-hairpin derived from YAP 3′UTR (YAP-sh) increased the luciferase reporter activities of transcriptional factor NF-κB and AP-1 in 293T cells. Moreover, we identified that a fragment from YAP-sh, an esiRNA, was able to target mRNA 3′UTR of NF2 (a member of Hippo-signaling pathway) and YAP mRNA 3′UTR itself in hepatoma cells. Thus, we conclude that the YAP-sh within YAP mRNA 3′UTR may serve as a novel regulatory element, which functions in regulation at post-transcription level. Our finding provides new insights into the mechanism of mRNAs in regulatory function. - Highlights: • An S-hairpin within YAP mRNA 3′UTR possesses regulatory function. • YAP-sh acts as a regulatory element for YAP at post-transcription level. • YAP-sh-3p20, an esiRNA derived from YAP-sh, targets mRNAs of YAP and NF2. • YAP-sh-3p20 depresses the proliferation of HepG2 cells in vitro

  2. A hairpin within YAP mRNA 3′UTR functions in regulation at post-transcription level

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Yuen; Wang, Yuan; Feng, Jinyan; Feng, Guoxing; Zheng, Minying; Yang, Zhe; Xiao, Zelin; Lu, Zhanping [State Key Laboratory of Medicinal Chemical Biology, Department of Cancer Research, College of Life Sciences, Nankai University, Tianjin 300071 (China); Ye, Lihong [State Key Laboratory of Medicinal Chemical Biology, Department of Biochemistry, College of Life Sciences, Nankai University, Tianjin 300071 (China); Zhang, Xiaodong, E-mail: zhangxd@nankai.edu.cn [State Key Laboratory of Medicinal Chemical Biology, Department of Cancer Research, College of Life Sciences, Nankai University, Tianjin 300071 (China)

    2015-04-03

    The central dogma of gene expression is that DNA is transcribed into messenger RNAs, which in turn serve as the template for protein synthesis. Recently, it has been reported that mRNAs display regulatory roles that rely on their ability to compete for microRNA binding, independent of their protein-coding function. However, the regulatory mechanism of mRNAs remains poorly understood. Here, we report that a hairpin within YAP mRNA 3′untranslated region (3′UTR) functions in regulation at post-transcription level through generating endogenous siRNAs (esiRNAs). Bioinformatics analysis for secondary structure showed that YAP mRNA displayed a hairpin structure (termed standard hairpin, S-hairpin) within its 3′UTR. Surprisingly, we observed that the overexpression of S-hairpin derived from YAP 3′UTR (YAP-sh) increased the luciferase reporter activities of transcriptional factor NF-κB and AP-1 in 293T cells. Moreover, we identified that a fragment from YAP-sh, an esiRNA, was able to target mRNA 3′UTR of NF2 (a member of Hippo-signaling pathway) and YAP mRNA 3′UTR itself in hepatoma cells. Thus, we conclude that the YAP-sh within YAP mRNA 3′UTR may serve as a novel regulatory element, which functions in regulation at post-transcription level. Our finding provides new insights into the mechanism of mRNAs in regulatory function. - Highlights: • An S-hairpin within YAP mRNA 3′UTR possesses regulatory function. • YAP-sh acts as a regulatory element for YAP at post-transcription level. • YAP-sh-3p20, an esiRNA derived from YAP-sh, targets mRNAs of YAP and NF2. • YAP-sh-3p20 depresses the proliferation of HepG2 cells in vitro.

  3. Towards the modeling of nanoindentation of virus shells: Do substrate adhesion and geometry matter?

    Science.gov (United States)

    Bousquet, Arthur; Dragnea, Bogdan; Tayachi, Manel; Temam, Roger

    2016-12-01

    Soft nanoparticles adsorbing at surfaces undergo deformation and buildup of elastic strain as a consequence of interfacial adhesion of similar magnitude with constitutive interactions. An example is the adsorption of virus particles at surfaces, a phenomenon of central importance for experiments in virus nanoindentation and for understanding of virus entry. The influence of adhesion forces and substrate corrugation on the mechanical response to indentation has not been studied. This is somewhat surprising considering that many single-stranded RNA icosahedral viruses are organized by soft intermolecular interactions while relatively strong adhesion forces are required for virus immobilization for nanoindentation. This article presents numerical simulations via finite elements discretization investigating the deformation of a thick shell in the context of slow evolution linear elasticity and in presence of adhesion interactions with the substrate. We study the influence of the adhesion forces in the deformation of the virus model under axial compression on a flat substrate by comparing the force-displacement curves for a shell having elastic constants relevant to virus capsids with and without adhesion forces derived from the Lennard-Jones potential. Finally, we study the influence of the geometry of the substrate in two-dimensions by comparing deformation of the virus model adsorbed at the cusp between two cylinders with that on a flat surface.

  4. Novel guanidinylated bioresponsive poly(amidoamines designed for short hairpin RNA delivery

    Directory of Open Access Journals (Sweden)

    Yu J

    2016-12-01

    Full Text Available Jiankun Yu,1 Jinmin Zhang,1 Haonan Xing,1 Yanping Sun,1 Zhen Yang,1 Tianzhi Yang,2 Cuifang Cai,1 Xiaoyun Zhao,3 Li Yang,1 Pingtian Ding1 1School of Pharmacy, Shenyang Pharmaceutical University, Shenyang, China; 2Department of Basic Pharmaceutical Sciences, School of Pharmacy, Husson University, Bangor, ME, USA; 3Department of Microbiology and Cell Biology, School of Life Science and Biopharmaceutics, Shenyang Pharmaceutical University, Shenyang, China Abstract: Two different disulfide (SS-containing poly(amidoamine (PAA polymers were constructed using guanidino (Gua-containing monomers (ie, arginine [Arg] and agmatine [Agm] and N,N'-cystamine bisacrylamide (CBA by Michael-addition polymerization. In order to characterize these two Gua-SS-PAA polymers and investigate their potentials as short hairpin RNA (shRNA-delivery carriers, pSilencer 4.1-CMV FANCF shRNA was chosen as a model plasmid DNA to form complexes with these two polymers. The Gua-SS-PAAs and plasmid DNA complexes were determined with particle sizes less than 90 nm and positive ζ-potentials under 20 mV at nucleic acid:polymer weight ratios lower than 1:24. Bioresponsive release of plasmid DNA was observed from both newly constructed complexes. Significantly lower cytotoxicity was observed for both polymer complexes compared with polyethylenimine and Lipofectamine 2000, two widely used transfection reagents as reference carriers. Arg-CBA showed higher transfection efficiency and gene-silencing efficiency in MCF7 cells than Agm-CBA and the reference carriers. In addition, the cellular uptake of Arg-CBA in MCF7 cells was found to be higher and faster than Agm-CBA and the reference carriers. Similarly, plasmid DNA transport into the nucleus mediated by Arg-CBA was more than that by Agm-CBA and the reference carriers. The study suggested that guanidine and carboxyl introduced into Gua-SS-PAAs polymers resulted in a better nuclear localization effect, which played a key role in the

  5. Structure of the antimicrobial beta-hairpin peptide protegrin-1 in a DLPC lipid bilayer investigated by molecular dynamics simulation

    DEFF Research Database (Denmark)

    Khandelia, Himanshu; Kaznessis, Yiannis N

    2007-01-01

    -18 to extend perpendicular to the beta-hairpin plane. This bend was driven by a highly persistent hydrogen-bond between the polar peptide side-chain of TYR7 and the unshielded backbone carbonyl oxygen atom of GLY17. The H-bond formation relieves the unfavorable free energy of insertion of polar groups......All atom molecular dynamics simulations of the 18-residue beta-hairpin antimicrobial peptide protegrin-1 (PG-1, RGGRLCYCRRRFCVCVGR-NH(2)) in a fully hydrated dilauroylphosphatidylcholine (DLPC) lipid bilayer have been implemented. The goal of the reported work is to investigate the structure......-550]), and to delineate specific peptide-membrane interactions which are responsible for the peptide's membrane binding properties. A novel, previously unknown, "kick" shaped conformation of the peptide was detected, where a bend at the C-terminal beta-strand of the peptide caused the peptide backbone at residues 16...

  6. Power electronics substrate for direct substrate cooling

    Science.gov (United States)

    Le, Khiet [Mission Viejo, CA; Ward, Terence G [Redondo Beach, CA; Mann, Brooks S [Redondo Beach, CA; Yankoski, Edward P [Corona, CA; Smith, Gregory S [Woodland Hills, CA

    2012-05-01

    Systems and apparatus are provided for power electronics substrates adapted for direct substrate cooling. A power electronics substrate comprises a first surface configured to have electrical circuitry disposed thereon, a second surface, and a plurality of physical features on the second surface. The physical features are configured to promote a turbulent boundary layer in a coolant impinged upon the second surface.

  7. Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus

    Directory of Open Access Journals (Sweden)

    Fangquan Wang

    2016-05-01

    Full Text Available Rice black-streaked dwarf virus (RBSDV belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21–24 nt small interfering RNA (siRNA. By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

  8. Comparison of Cytotoxic Activity in Leukemic Lineages Reveals Important Features of β-Hairpin Antimicrobial Peptides.

    Science.gov (United States)

    Buri, Marcus V; Torquato, Heron F Vieira; Barros, Carlos Castilho; Ide, Jaime S; Miranda, Antonio; Paredes-Gamero, Edgar J

    2017-07-01

    Several reports described different modes of cell death triggered by antimicrobial peptides (AMPs) due to direct effects on membrane disruption, and more recently by apoptosis and necrosis-like patterns. Cytotoxic curves of four β-hairpin AMPs (gomesin, protegrin, tachyplesin, and polyphemusin) were obtained from several human leukemic lineages and normal monocytes and Two cell lines were then selected based on their cytotoxic sensitivity. One was sensitive to AMPs (K562) and the other resistant (KG-1) and their effect compared between these lineages. Thus, these lineages were chosen to further investigate biological features related with their cytotoxicities to AMPs. Stimulation with AMPs produced cell death, with activation of caspase-3, in K562 lineage. Increase on the fluidity of plasmatic membrane by reducing cholesterol potentiated cytotoxicity of AMPs in both lineages. Quantification of internal and external gomesin binding to the cellular membrane of both K562 and KG-1 cells showed that more peptide is accumulated inside of K562 cells. Additionally, evaluation of multi-drug resistant pumps activity showed that KG-1 has more activity than K562 lineage. A comparison of intrinsic gene patterns showed great differences between K562 and KG-1, but stimulation with gomesin promoted few changes in gene expression patterns. Differences in internalization process through the plasma membrane, multidrug resistance pumps activity, and gene expression pattern are important features to AMPs regulated cell death. J. Cell. Biochem. 118: 1764-1773, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  9. Biological Applications of Designed Hairpin Peptides: As Antimicrobials and as Inhibitors of Amyloidogenesis

    Science.gov (United States)

    Sivanesam, Kalkena

    More than 40 diseases have been associated with the misfolding of peptides (or proteins) that form fibrils with a very specific morphology. These peptides classified as amyloidogenic peptides have been implicated in the development of Alzheimer's Disease, Parkinson's Disease, Type II Diabetes, Hungtinton's Disease etc. To date, these diseases have no cure, only therapies that can ameliorate the symptoms to a degree. Inhibition of the amyloidogenesis of these peptides has been proposed as a possible treatment option. While small molecules have been heavily tested as inhibitors of amyloidogenesis, peptides have emerged as potential inhibitors. In this work, the ability of a set of designed hairpin peptides to inhibit the amyloidogenesis of two different systems, alpha-synuclein (implicated in Parkinson's Disease) and human amylin (implicated in Type II Diabetes) is tested. Using circular dichroism and thioflavin T fluorescence, the ability of these peptides to inhibit amyloidogenesis is tested. The binding loci of these inhibitors to alpha-synuclein are also explored. The use of peptides as antimicrobials on the other hand is not a novel concept. However, most antimicrobial peptides, both natural and designed, rely heavily on covalent stabilizations in order to maintain secondary structure. In this study, non-covalent stabilizations are applied to a couple of natural as well as designed antimicrobials in order to study the effects of secondary structure stabilization on biological activity.

  10. Construction of equalized short hairpin RNA library from human brain cDNA.

    Science.gov (United States)

    Xu, Lei; Li, Jingqi; Liu, Li; Lu, Lixia; Gao, Jingxia; Li, Xueli

    2007-02-20

    Short hairpin RNA (shRNA) library is a powerful new tool for high-throughput loss-of-function genetic screens in mammalian cells. An shRNA library can be constructed from synthetic oligonucleotides or enzymatically cleaved natural cDNA. Here, we describe a new method for constructing equalized shRNA libraries from cDNA. First, enzymatically digested cDNA fragments are equalized by a suppression PCR-based method modified from suppression subtractive hybridization. The efficiency of equalization was confirmed by quantitative real-time PCR. The fragments are then converted into an shRNA library by a series of enzymatic treatments. With this new technology, we constructed a library from human brain cDNA. Sequence analysis showed that most of the randomly selected clones had inverted repeat sequences converted from different cDNA. After transfecting HEK 293T cells and detecting gene expression, three out of eight clones were demonstrated to significantly inhibit their target genes.

  11. Optimum Design of Novel UWB Multilayer Microstrip Hairpin Filters with Harmonic Suppression and Impedance Matching

    Directory of Open Access Journals (Sweden)

    Homayoon Oraizi

    2012-01-01

    Full Text Available Optimum design of a novel ultra-wideband multilayer microstrip hairpin filter is presented, providing for harmonic suppression and impedance matching between source and load impedances. The theory of N-coupled transmission lines is employed to obtain an equivalent circuit for development of a design procedure based on the method of least squares. A prototype model of proposed two-layer filter of order 5 is fabricated for 3.1–10.6 GHz. The dimensions of designed filter are 23 mm × 7 mm. The insertion loss in the passband varies from 0.3 dB to 3 dB (in the worst case at the edge of passband and in the stopband is about 30 dB up to 20 GHz. Its group delay in the UWB region is about 0.5 ns. Close agreement among the filter frequency responses as obtained by the proposed method, full-wave computer simulation softwares, and measurement data verify the effectiveness of the proposed filter structure and design methods.

  12. Thermodynamics and kinetics of RNA tertiary structure formation in the junctionless hairpin ribozyme.

    Science.gov (United States)

    White, Neil A; Hoogstraten, Charles G

    2017-09-01

    The hairpin ribozyme consists of two RNA internal loops that interact to form the catalytically active structure. This docking transition is a rare example of intermolecular formation of RNA tertiary structure without coupling to helix annealing. We have used temperature-dependent surface plasmon resonance (SPR) to characterize the thermodynamics and kinetics of RNA tertiary structure formation for the junctionless form of the ribozyme, in which loops A and B reside on separate molecules. We find docking to be strongly enthalpy-driven and to be accompanied by substantial activation barriers for association and dissociation, consistent with the structural reorganization of both internal loops upon complex formation. Comparisons with the parallel analysis of a ribozyme variant carrying a 2'-O-methyl modification at the self-cleavage site and with published data in other systems reveal a surprising diversity of thermodynamic signatures, emphasizing the delicate balance of contributions to the free energy of formation of RNA tertiary structure. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. The Inverse Autotransporter Intimin Exports Its Passenger Domain via a Hairpin Intermediate*

    Science.gov (United States)

    Oberhettinger, Philipp; Leo, Jack C.; Linke, Dirk; Autenrieth, Ingo B.; Schütz, Monika S.

    2015-01-01

    Autotransporter proteins comprise a large family of virulence factors that consist of a β-barrel translocation unit and an extracellular effector or passenger domain. The β-barrel anchors the protein to the outer membrane of Gram-negative bacteria and facilitates the transport of the passenger domain onto the cell surface. By inserting an epitope tag into the N terminus of the passenger domain of the inverse autotransporter intimin, we generated a mutant defective in autotransport. Using this stalled mutant, we could show that (i) at the time point of stalling, the β-barrel appears folded; (ii) the stalled autotransporter is associated with BamA and SurA; (iii) the stalled intimin is decorated with large amounts of SurA; (iv) the stalled autotransporter is not degraded by periplasmic proteases; and (v) inverse autotransporter passenger domains are translocated by a hairpin mechanism. Our results suggest a function for the BAM complex not only in insertion and folding of the β-barrel but also for passenger translocation. PMID:25488660

  14. Efficient production of superior dumbbell-shaped DNA minimal vectors for small hairpin RNA expression.

    Science.gov (United States)

    Yu, Han; Jiang, Xiaoou; Tan, Kar Tong; Hang, Liting; Patzel, Volker

    2015-10-15

    Genetic therapy holds great promise for the treatment of inherited or acquired genetic diseases; however, its breakthrough is hampered by the lack of suitable gene delivery systems. Dumbbell-shaped DNA minimal vectors represent an attractive, safe alternative to the commonly used viral vectors which are fraught with risk, but dumbbell generation appears to be costly and time-consuming. We developed a new PCR-based method for dumbbell production which comprises only two steps. First, PCR amplification of the therapeutic expression cassette using chemically modified primers to form a ready-to-ligate DNA structure; and second, a highly efficient intramolecular ligation reaction. Compared with conventional strategies, the new method produces dumbbell vector/span>s more rapidly, with higher yields and purity, and at lower costs. In addition, such produced small hairpin RNA expressing dumbbells triggered superior target gene knockdown compared with conventionally produced dumbbells or plasmids. Our novel method is suitable for large-scale dumbbell production and can facilitate clinical applications of this vector system. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Efficient production of superior dumbbell-shaped DNA minimal vectors for small hairpin RNA expression

    Science.gov (United States)

    Yu, Han; Jiang, Xiaoou; Tan, Kar Tong; Hang, Liting; Patzel, Volker

    2015-01-01

    Genetic therapy holds great promise for the treatment of inherited or acquired genetic diseases; however, its breakthrough is hampered by the lack of suitable gene delivery systems. Dumbbell-shaped DNA minimal vectors represent an attractive, safe alternative to the commonly used viral vectors which are fraught with risk, but dumbbell generation appears to be costly and time-consuming. We developed a new PCR-based method for dumbbell production which comprises only two steps. First, PCR amplification of the therapeutic expression cassette using chemically modified primers to form a ready-to-ligate DNA structure; and second, a highly efficient intramolecular ligation reaction. Compared with conventional strategies, the new method produces dumbbell vectors more rapidly, with higher yields and purity, and at lower costs. In addition, such produced small hairpin RNA expressing dumbbells triggered superior target gene knockdown compared with conventionally produced dumbbells or plasmids. Our novel method is suitable for large-scale dumbbell production and can facilitate clinical applications of this vector system. PMID:26068470

  16. Buckwheat trypsin inhibitor with helical hairpin structure belongs to a new family of plant defence peptides.

    Science.gov (United States)

    Oparin, Peter B; Mineev, Konstantin S; Dunaevsky, Yakov E; Arseniev, Alexander S; Belozersky, Mikhail A; Grishin, Eugene V; Egorov, Tsezi A; Vassilevski, Alexander A

    2012-08-15

    A new peptide trypsin inhibitor named BWI-2c was obtained from buckwheat (Fagopyrum esculentum) seeds by sequential affinity, ion exchange and reversed-phase chromatography. The peptide was sequenced and found to contain 41 amino acid residues, with four cysteine residues involved in two intramolecular disulfide bonds. Recombinant BWI-2c identical to the natural peptide was produced in Escherichia coli in a form of a cleavable fusion with thioredoxin. The 3D (three-dimensional) structure of the peptide in solution was determined by NMR spectroscopy, revealing two antiparallel α-helices stapled by disulfide bonds. Together with VhTI, a trypsin inhibitor from veronica (Veronica hederifolia), BWI-2c represents a new family of protease inhibitors with an unusual α-helical hairpin fold. The linker sequence between the helices represents the so-called trypsin inhibitory loop responsible for direct binding to the active site of the enzyme that cleaves BWI-2c at the functionally important residue Arg(19). The inhibition constant was determined for BWI-2c against trypsin (1.7×10(-1)0 M), and the peptide was tested on other enzymes, including those from various insect digestive systems, revealing high selectivity to trypsin-like proteases. Structural similarity shared by BWI-2c, VhTI and several other plant defence peptides leads to the acknowledgement of a new widespread family of plant peptides termed α-hairpinins.

  17. The inverse autotransporter intimin exports its passenger domain via a hairpin intermediate.

    Science.gov (United States)

    Oberhettinger, Philipp; Leo, Jack C; Linke, Dirk; Autenrieth, Ingo B; Schütz, Monika S

    2015-01-16

    Autotransporter proteins comprise a large family of virulence factors that consist of a β-barrel translocation unit and an extracellular effector or passenger domain. The β-barrel anchors the protein to the outer membrane of Gram-negative bacteria and facilitates the transport of the passenger domain onto the cell surface. By inserting an epitope tag into the N terminus of the passenger domain of the inverse autotransporter intimin, we generated a mutant defective in autotransport. Using this stalled mutant, we could show that (i) at the time point of stalling, the β-barrel appears folded; (ii) the stalled autotransporter is associated with BamA and SurA; (iii) the stalled intimin is decorated with large amounts of SurA; (iv) the stalled autotransporter is not degraded by periplasmic proteases; and (v) inverse autotransporter passenger domains are translocated by a hairpin mechanism. Our results suggest a function for the BAM complex not only in insertion and folding of the β-barrel but also for passenger translocation. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Leptin gene polymorphism in Indian Sahiwal cattle by single strand ...

    African Journals Online (AJOL)

    These leptin gene variants can be sequenced and screened in the entire population to develop single nucleotide polymorphisms (SNPs) for association studies with different productive and reproductive performances and marker assisted selection. Keywords: Leptin gene, PCR-SSCP, genetic variability, dairy cattle

  19. Crystal structure of raptor adenovirus 1 fibre head and role of the beta-hairpin in siadenovirus fibre head domains.

    Science.gov (United States)

    Nguyen, Thanh H; Ballmann, Mónika Z; Do, Huyen T; Truong, Hai N; Benkő, Mária; Harrach, Balázs; van Raaij, Mark J

    2016-06-22

    Most adenoviruses recognize their host cells via an interaction of their fibre head domains with a primary receptor. The structural framework of adenovirus fibre heads is conserved between the different adenovirus genera for which crystal structures have been determined (Mastadenovirus, Aviadenovirus, Atadenovirus and Siadenovirus), but genus-specific differences have also been observed. The only known siadenovirus fibre head structure, that of turkey adenovirus 3 (TAdV-3), revealed a twisted beta-sandwich resembling the reovirus fibre head architecture more than that of other adenovirus fibre heads, plus a unique beta-hairpin embracing a neighbouring monomer. The TAdV-3 fibre head was shown to bind sialyllactose. Raptor adenovirus 1 (RAdV-1) fibre head was expressed, crystallized and its structure was solved and refined at 1.5 Å resolution. The structure could be solved by molecular replacement using the TAdV-3 fibre head structure as a search model, despite them sharing a sequence identity of only 19 %. Versions of both the RAdV-1 and TAdV-3 fibre heads with their beta-hairpin arm deleted were prepared and their stabilities were compared with the non-mutated proteins by a thermal unfolding assay. The structure of the RAdV-1 fibre head contains the same twisted ABCJ-GHID beta-sandwich and beta-hairpin arm as the TAdV-3 fibre head. However, while the predicted electro-potential surface charge of the TAdV-3 fibre head is mainly positive, the RAdV-1 fibre head shows positively and negatively charged patches and does not appear to bind sialyllactose. Deletion of the beta-hairpin arm does not affect the structure of the raptor adenovirus 1 fibre head and only affects the stability of the RAdV-1 and TAdV-3 fibre heads slightly. The high-resolution structure of RAdV-1 fibre head is the second known structure of a siadenovirus fibre head domain. The structure shows that the siadenovirus fibre head structure is conserved, but differences in the predicted surface charge

  20. Constructing multi-resolution Markov State Models (MSMs) to elucidate RNA hairpin folding mechanisms.

    Science.gov (United States)

    Huang, Xuhui; Yao, Yuan; Bowman, Gregory R; Sun, Jian; Guibas, Leonidas J; Carlsson, Gunnar; Pande, Vijay S

    2010-01-01

    Simulating biologically relevant timescales at atomic resolution is a challenging task since typical atomistic simulations are at least two orders of magnitude shorter. Markov State Models (MSMs) provide one means of overcoming this gap without sacrificing atomic resolution by extracting long time dynamics from short simulations. MSMs coarse grain space by dividing conformational space into long-lived, or metastable, states. This is equivalent to coarse graining time by integrating out fast motions within metastable states. By varying the degree of coarse graining one can vary the resolution of an MSM; therefore, MSMs are inherently multi-resolution. Here we introduce a new algorithm Super-level-set Hierarchical Clustering (SHC), to our knowledge, the first algorithm focused on constructing MSMs at multiple resolutions. The key insight of this algorithm is to generate a set of super levels covering different density regions of phase space, then cluster each super level separately, and finally recombine this information into a single MSM. SHC is able to produce MSMs at different resolutions using different super density level sets. To demonstrate the power of this algorithm we apply it to a small RNA hairpin, generating MSMs at four different resolutions. We validate these MSMs by showing that they are able to reproduce the original simulation data. Furthermore, long time folding dynamics are extracted from these models. The results show that there are no metastable on-pathway intermediate states. Instead, the folded state serves as a hub directly connected to multiple unfolded/misfolded states which are separated from each other by large free energy barriers.

  1. Induction of RNAi Responses by Short Left-Handed Hairpin RNAi Triggers.

    Science.gov (United States)

    Hagopian, Jonathan C; Hamil, Alexander S; van den Berg, Arjen; Meade, Bryan R; Eguchi, Akiko; Palm-Apergi, Caroline; Dowdy, Steven F

    2017-10-01

    Small double-stranded, left-handed hairpin (LHP) RNAs containing a 5'-guide-loop-passenger-3' structure induce RNAi responses by a poorly understood mechanism. To explore LHPs, we synthesized fully 2'-modified LHP RNAs targeting multiple genes and found all to induce robust RNAi responses. Deletion of the loop and nucleotides at the 5'-end of the equivalent passenger strand resulted in a smaller LHP that still induced strong RNAi responses. Surprisingly, progressive deletion of up to 10 nucleotides from the 3'-end of the guide strand resulted in a 32mer LHP capable of inducing robust RNAi responses. However, further guide strand deletion inhibited LHP activity, thereby defining the minimal length guide targeting length to 13 nucleotides. To dissect LHP processing, we examined LHP species that coimmunoprecipitated with Argonaute 2 (Ago2), the catalytic core of RNA-induced silencing complex, and found that the Ago2-associated processed LHP species was of a length that correlated with Ago2 cleavage of the passenger strand. Placement of a blocking 2'-OMe blocking modification at the LHP predicted Ago2 cleavage site resulted in an intact LHP loaded into Ago2 and no RNAi response. Taken together, these data argue that in the absence of a substantial loop, this novel class of small LHP RNAs enters the RNAi pathway by a Dicer-independent mechanism that involves Ago2 cleavage and results in an extended guide strand. This work establishes LHPs as an alternative RNAi trigger that can be produced from a single synthesis for potential use as an RNAi therapeutic.

  2. Function and anatomy of plant siRNA pools derived from hairpin transgenes

    Directory of Open Access Journals (Sweden)

    Lee Kevin AW

    2007-11-01

    Full Text Available Abstract Background RNA interference results in specific gene silencing by small-interfering RNAs (siRNAs. Synthetic siRNAs provide a powerful tool for manipulating gene expression but high cost suggests that novel siRNA production methods are desirable. Strong evolutionary conservation of siRNA structure suggested that siRNAs will retain cross-species function and that transgenic plants expressing heterologous siRNAs might serve as useful siRNA bioreactors. Here we report a detailed evaluation of the above proposition and present evidence regarding structural features of siRNAs extracted from plants. Results Testing the gene silencing capacity of plant-derived siRNAs in mammalian cells proved to be very challenging and required partial siRNA purification and design of a highly sensitive assay. Using the above assay we found that plant-derived siRNAs are ineffective for gene silencing in mammalian cells. Plant-derived siRNAs are almost exclusively double-stranded and most likely comprise a mixture of bona fide siRNAs and aberrant partially complementary duplexes. We also provide indirect evidence that plant-derived siRNAs may contain a hitherto undetected physiological modification, distinct from 3' terminal 2-O-methylation. Conclusion siRNAs produced from plant hairpin transgenes and extracted from plants are ineffective for gene silencing in mammalian cells. Thus our findings establish that a previous claim that transgenic plants offer a cost-effective, scalable and sustainable source of siRNAs is unwarranted. Our results also indicate that the presence of aberrant siRNA duplexes and possibly a plant-specific siRNA modification, compromises the gene silencing capacity of plant-derived siRNAs in mammalian cells.

  3. An efficient method to enhance gene silencing by using precursor microRNA designed small hairpin RNAs.

    Science.gov (United States)

    Shan, Zhixin; Lin, Qiuxiong; Deng, Chunyu; Li, Xiaohong; Huang, Wei; Tan, Honghong; Fu, Yongheng; Yang, Min; Yu, Xi-Yong

    2009-07-01

    Gene silencing can be mediated by small interfering RNA (siRNA) and microRNA (miRNA). To investigate the potential application of using a precursor microRNA (pre-miRNA) backbone for gene silencing, we studied the inhibition efficiency of exogenous GFP and endogenous GAPDH by conventional shRNA- and pre-miRNA-designed hairpins, respectively. In this study, the conventional shRNA-, pre-miRNA-30-, and pre-miRNA-155-designed hairpins targeting either GFP or GAPDH were transfected into the HEK293 cells that were mediated by the pSilencer-4.1-neo vector, which carries a modified RNA polymerase II-type CMV promoter. Comparisons with conventional GFP shRNA showed that GFP levels were reduced markedly by pre-miRNA-30- and pre-miRNA-155-designed GFP shRNAs by fluorescence microscopy. The consistent results from semi-quantitative RT-PCR and Western blot analysis revealed that pre-miRNA-30- and pre-miRNA-155-designed GFP shRNAs could suppress GFP expression significantly. As for endogenous GAPDH, the results from semi-quantitative RT-PCR and Western blot analysis showed that pre-miRNA-30- and pre-miRNA-155-designed GAPDH shRNAs could suppress GAPDH expression even more efficiently than conventional GAPDH shRNA. Together, this study confirmed the efficiency of gene silencing mediated by pre-miRNA-30- and pre-miRNA-155-designed shRNAs, demonstrating that pre-miRNA-designed hairpins are a good strategy for gene silencing.

  4. The mitochondrial genomes of sponges provide evidence for multiple invasions by Repetitive Hairpin-forming Elements (RHE

    Directory of Open Access Journals (Sweden)

    Lavrov Dennis V

    2009-12-01

    Full Text Available Abstract Background The mitochondrial (mt genomes of sponges possess a variety of features, which appear to be intermediate between those of Eumetazoa and non-metazoan opisthokonts. Among these features is the presence of long intergenic regions, which are common in other eukaryotes, but generally absent in Eumetazoa. Here we analyse poriferan mitochondrial intergenic regions, paying particular attention to repetitive sequences within them. In this context we introduce the mitochondrial genome of Ircinia strobilina (Lamarck, 1816; Demospongiae: Dictyoceratida and compare it with mtDNA of other sponges. Results Mt genomes of dictyoceratid sponges are identical in gene order and content but display major differences in size and organization of intergenic regions. An even higher degree of diversity in the structure of intergenic regions was found among different orders of demosponges. One interesting observation made from such comparisons was of what appears to be recurrent invasions of sponge mitochondrial genomes by repetitive hairpin-forming elements, which cause large genome size differences even among closely related taxa. These repetitive hairpin-forming elements are structurally and compositionally divergent and display a scattered distribution throughout various groups of demosponges. Conclusion Large intergenic regions of poriferan mt genomes are targets for insertions of repetitive hairpin- forming elements, similar to the ones found in non-metazoan opisthokonts. Such elements were likely present in some lineages early in animal mitochondrial genome evolution but were subsequently lost during the reduction of intergenic regions, which occurred in the Eumetazoa lineage after the split of Porifera. Porifera acquired their elements in several independent events. Patterns of their intra-genomic dispersal can be seen in the mt genome of Vaceletia sp.

  5. Short Hairpin RNA Suppression of Thymidylate Synthase Produces DNA Mismatches and Results in Excellent Radiosensitization

    International Nuclear Information System (INIS)

    Flanagan, Sheryl A.; Cooper, Kristin S.; Mannava, Sudha; Nikiforov, Mikhail A.; Shewach, Donna S.

    2012-01-01

    Purpose: To determine the effect of short hairpin ribonucleic acid (shRNA)-mediated suppression of thymidylate synthase (TS) on cytotoxicity and radiosensitization and the mechanism by which these events occur. Methods and Materials: shRNA suppression of TS was compared with 5-fluoro-2′-deoxyuridine (FdUrd) inactivation of TS with or without ionizing radiation in HCT116 and HT29 colon cancer cells. Cytotoxicity and radiosensitization were measured by clonogenic assay. Cell cycle effects were measured by flow cytometry. The effects of FdUrd or shRNA suppression of TS on dNTP deoxynucleotide triphosphate imbalances and consequent nucleotide misincorporations into deoxyribonucleic acid (DNA) were analyzed by high-pressure liquid chromatography and as pSP189 plasmid mutations, respectively. Results: TS shRNA produced profound (≥90%) and prolonged (≥8 days) suppression of TS in HCT116 and HT29 cells, whereas FdUrd increased TS expression. TS shRNA also produced more specific and prolonged effects on dNTPs deoxynucleotide triphosphates compared with FdUrd. TS shRNA suppression allowed accumulation of cells in S-phase, although its effects were not as long-lasting as those of FdUrd. Both treatments resulted in phosphorylation of Chk1. TS shRNA alone was less cytotoxic than FdUrd but was equally effective as FdUrd in eliciting radiosensitization (radiation enhancement ratio: TS shRNA, 1.5-1.7; FdUrd, 1.4-1.6). TS shRNA and FdUrd produced a similar increase in the number and type of pSP189 mutations. Conclusions: TS shRNA produced less cytotoxicity than FdUrd but was equally effective at radiosensitizing tumor cells. Thus, the inhibitory effect of FdUrd on TS alone is sufficient to elicit radiosensitization with FdUrd, but it only partially explains FdUrd-mediated cytotoxicity and cell cycle inhibition. The increase in DNA mismatches after TS shRNA or FdUrd supports a causal and sufficient role for the depletion of dTTP thymidine triphosphate and consequent DNA

  6. Short Hairpin RNA Suppression of Thymidylate Synthase Produces DNA Mismatches and Results in Excellent Radiosensitization

    Energy Technology Data Exchange (ETDEWEB)

    Flanagan, Sheryl A., E-mail: sflan@umich.edu [Department of Pharmacology, University of Michigan Medical Center, Ann Arbor, Michigan (United States); Cooper, Kristin S. [Department of Pharmacology, University of Michigan Medical Center, Ann Arbor, Michigan (United States); Mannava, Sudha; Nikiforov, Mikhail A. [Department of Cell Stress Biology, Roswell Park Cancer Institute, Buffalo, New York (United States); Shewach, Donna S. [Department of Pharmacology, University of Michigan Medical Center, Ann Arbor, Michigan (United States)

    2012-12-01

    Purpose: To determine the effect of short hairpin ribonucleic acid (shRNA)-mediated suppression of thymidylate synthase (TS) on cytotoxicity and radiosensitization and the mechanism by which these events occur. Methods and Materials: shRNA suppression of TS was compared with 5-fluoro-2 Prime -deoxyuridine (FdUrd) inactivation of TS with or without ionizing radiation in HCT116 and HT29 colon cancer cells. Cytotoxicity and radiosensitization were measured by clonogenic assay. Cell cycle effects were measured by flow cytometry. The effects of FdUrd or shRNA suppression of TS on dNTP deoxynucleotide triphosphate imbalances and consequent nucleotide misincorporations into deoxyribonucleic acid (DNA) were analyzed by high-pressure liquid chromatography and as pSP189 plasmid mutations, respectively. Results: TS shRNA produced profound ({>=}90%) and prolonged ({>=}8 days) suppression of TS in HCT116 and HT29 cells, whereas FdUrd increased TS expression. TS shRNA also produced more specific and prolonged effects on dNTPs deoxynucleotide triphosphates compared with FdUrd. TS shRNA suppression allowed accumulation of cells in S-phase, although its effects were not as long-lasting as those of FdUrd. Both treatments resulted in phosphorylation of Chk1. TS shRNA alone was less cytotoxic than FdUrd but was equally effective as FdUrd in eliciting radiosensitization (radiation enhancement ratio: TS shRNA, 1.5-1.7; FdUrd, 1.4-1.6). TS shRNA and FdUrd produced a similar increase in the number and type of pSP189 mutations. Conclusions: TS shRNA produced less cytotoxicity than FdUrd but was equally effective at radiosensitizing tumor cells. Thus, the inhibitory effect of FdUrd on TS alone is sufficient to elicit radiosensitization with FdUrd, but it only partially explains FdUrd-mediated cytotoxicity and cell cycle inhibition. The increase in DNA mismatches after TS shRNA or FdUrd supports a causal and sufficient role for the depletion of dTTP thymidine triphosphate and consequent DNA

  7. Targeting of human interleukin-12B by small hairpin RNAs in xenografted psoriatic skin

    Directory of Open Access Journals (Sweden)

    Jakobsen Maria

    2011-02-01

    Full Text Available Abstract Background Psoriasis is a chronic inflammatory skin disorder that shows as erythematous and scaly lesions. The pathogenesis of psoriasis is driven by a dysregulation of the immune system which leads to an altered cytokine production. Proinflammatory cytokines that are up-regulated in psoriasis include tumor necrosis factor alpha (TNFα, interleukin-12 (IL-12, and IL-23 for which monoclonal antibodies have already been approved for clinical use. We have previously documented the therapeutic applicability of targeting TNFα mRNA for RNA interference-mediated down-regulation by anti-TNFα small hairpin RNAs (shRNAs delivered by lentiviral vectors to xenografted psoriatic skin. The present report aims at targeting mRNA encoding the shared p40 subunit (IL-12B of IL-12 and IL-23 by cellular transduction with lentiviral vectors encoding anti-IL12B shRNAs. Methods Effective anti-IL12B shRNAs are identified among a panel of shRNAs by potency measurements in cultured cells. The efficiency and persistency of lentiviral gene delivery to xenografted human skin are investigated by bioluminescence analysis of skin treated with lentiviral vectors encoding the luciferase gene. shRNA-expressing lentiviral vectors are intradermally injected in xenografted psoriatic skin and the effects of the treatment evaluated by clinical psoriasis scoring, by measurements of epidermal thickness, and IL-12B mRNA levels. Results Potent and persistent transgene expression following a single intradermal injection of lentiviral vectors in xenografted human skin is reported. Stable IL-12B mRNA knockdown and reduced epidermal thickness are achieved three weeks after treatment of xenografted psoriatic skin with lentivirus-encoded anti-IL12B shRNAs. These findings mimick the results obtained with anti-TNFα shRNAs but, in contrast to anti-TNFα treatment, anti-IL12B shRNAs do not ameliorate the psoriatic phenotype as evaluated by semi-quantitative clinical scoring and by

  8. Stabilization of the beta-hairpin in Mason-Pfizer monkey virus capsid protein- a critical step for infectivity

    Czech Academy of Sciences Publication Activity Database

    Obr, M.; Hadravová, Romana; Doležal, Michal; Křížová, Ivana; Papoušková, V.; Žídek, L.; Hrabal, R.; Ruml, T.; Rumlová, Michaela

    2014-01-01

    Roč. 11, Oct 30 (2014), 94/1-94/14 ISSN 1742-4690 R&D Projects: GA ČR(CZ) GA14-15326S; GA MŠk LO1302 Grant - others:GA MŠk(CZ) ED1.1.00/02.0068; Seventh Framework Programme of the European Union(XE) FP7-261863 Program:ED Institutional support: RVO:61388963 Keywords : retrovirus * assembly * M-PMV * capsid protein * maturation * beta-hairpin Subject RIV: EE - Microbiology, Virology Impact factor: 4.185, year: 2014 http://www.retrovirology.com/content/11/1/94

  9. Structure of 23S rRNA hairpin 35 and its interaction with the tylosin-resistance methyltransferase RlmAII

    Science.gov (United States)

    Lebars, Isabelle; Yoshizawa, Satoko; Stenholm, Anne R.; Guittet, Eric; Douthwaite, Stephen; Fourmy, Dominique

    2003-01-01

    The bacterial rRNA methyltransferase RlmAII (formerly TlrB) contributes to resistance against tylosin-like 16-membered ring macrolide antibiotics. RlmAII was originally discovered in the tylosin-producer Streptomyces fradiae, and members of this subclass of methyltransferases have subsequently been found in other Gram-positive bacteria, including Streptococcus pneumoniae. In all cases, RlmAII methylates 23S rRNA at nucleotide G748, which is situated in a stem–loop (hairpin 35) at the macrolide binding site of the ribosome. The conformation of hairpin 35 recognized by RlmAII is shown here by NMR spectroscopy to resemble the anticodon loop of tRNA. The loop folds independently of the rest of the 23S rRNA, and is stabilized by a non-canonical G–A pair and a U-turn motif, rendering G748 accessible. Binding of S.pneumoniae RlmAII induces changes in NMR signals at specific nucleotides that are involved in the methyltransferase–RNA interaction. The conformation of hairpin 35 that interacts with RlmAII is radically different from the structure this hairpin adopts within the 50S subunit. This indicates that the hairpin undergoes major structural rearrangement upon interaction with ribosomal proteins during 50S assembly. PMID:12514124

  10. Design of a new hairpin DNAzyme: The activity controlled by TMPyP4

    African Journals Online (AJOL)

    Jane

    2011-08-01

    . The formation and stability of the G-quadruplex structure as the DNAzyme stem in the absence or the presence of TMPyP4 ..... presence of 100 nM 32P-labeled RNA substrate as indicated, the reaction product was visualized ...

  11. DNA and Protein Requirements for Substrate Conformational Changes Necessary for Human Flap Endonuclease-1-catalyzed Reaction*

    Science.gov (United States)

    Algasaier, Sana I.; Exell, Jack C.; Bennet, Ian A.; Thompson, Mark J.; Gotham, Victoria J. B.; Shaw, Steven J.; Craggs, Timothy D.; Finger, L. David; Grasby, Jane A.

    2016-01-01

    Human flap endonuclease-1 (hFEN1) catalyzes the essential removal of single-stranded flaps arising at DNA junctions during replication and repair processes. hFEN1 biological function must be precisely controlled, and consequently, the protein relies on a combination of protein and substrate conformational changes as a prerequisite for reaction. These include substrate bending at the duplex-duplex junction and transfer of unpaired reacting duplex end into the active site. When present, 5′-flaps are thought to thread under the helical cap, limiting reaction to flaps with free 5′-termini in vivo. Here we monitored DNA bending by FRET and DNA unpairing using 2-aminopurine exciton pair CD to determine the DNA and protein requirements for these substrate conformational changes. Binding of DNA to hFEN1 in a bent conformation occurred independently of 5′-flap accommodation and did not require active site metal ions or the presence of conserved active site residues. More stringent requirements exist for transfer of the substrate to the active site. Placement of the scissile phosphate diester in the active site required the presence of divalent metal ions, a free 5′-flap (if present), a Watson-Crick base pair at the terminus of the reacting duplex, and the intact secondary structure of the enzyme helical cap. Optimal positioning of the scissile phosphate additionally required active site conserved residues Tyr40, Asp181, and Arg100 and a reacting duplex 5′-phosphate. These studies suggest a FEN1 reaction mechanism where junctions are bound and 5′-flaps are threaded (when present), and finally the substrate is transferred onto active site metals initiating cleavage. PMID:26884332

  12. Virus-derived transgenes expressing hairpin RNA give immunity to Tobacco mosaic virus and Cucumber mosaic virus

    Directory of Open Access Journals (Sweden)

    Liu Yong

    2011-01-01

    Full Text Available Abstract Background An effective method for obtaining resistant transgenic plants is to induce RNA silencing by expressing virus-derived dsRNA in plants and this method has been successfully implemented for the generation of different plant lines resistant to many plant viruses. Results Inverted repeats of the partial Tobacco mosaic virus (TMV movement protein (MP gene and the partial Cucumber mosaic virus (CMV replication protein (Rep gene were introduced into the plant expression vector and the recombinant plasmids were transformed into Agrobacterium tumefaciens. Agrobacterium-mediated transformation was carried out and three transgenic tobacco lines (MP16-17-3, MP16-17-29 and MP16-17-58 immune to TMV infection and three transgenic tobacco lines (Rep15-1-1, Rep15-1-7 and Rep15-1-32 immune to CMV infection were obtained. Virus inoculation assays showed that the resistance of these transgenic plants could inherit and keep stable in T4 progeny. The low temperature (15℃ did not influence the resistance of transgenic plants. There was no significant correlation between the resistance and the copy number of the transgene. CMV infection could not break the resistance to TMV in the transgenic tobacco plants expressing TMV hairpin MP RNA. Conclusions We have demonstrated that transgenic tobacco plants expressed partial TMV movement gene and partial CMV replicase gene in the form of an intermolecular intron-hairpin RNA exhibited complete resistance to TMV or CMV infection.

  13. Structural and dynamic characterization of the upper part of the HIV-1 cTAR DNA hairpin

    Science.gov (United States)

    Zargarian, Loussiné; Kanevsky, Igor; Bazzi, Ali; Boynard, Jonathan; Chaminade, Françoise; Fossé, Philippe; Mauffret, Olivier

    2009-01-01

    First strand transfer is essential for HIV-1 reverse transcription. During this step, the TAR RNA hairpin anneals to the cTAR DNA hairpin; this annealing reaction is promoted by the nucleocapsid protein and involves an initial loop–loop interaction between the apical loops of TAR and cTAR. Using NMR and probing methods, we investigated the structural and dynamic properties of the top half of the cTAR DNA (mini-cTAR). We show that the upper stem located between the apical and the internal loops is stable, but that the lower stem of mini-cTAR is unstable. The residues of the internal loop undergo slow motions at the NMR time-scale that are consistent with conformational exchange phenomena. In contrast, residues of the apical loop undergo fast motions. The lower stem is destabilized by the slow interconversion processes in the internal loop, and thus the internal loop is responsible for asymmetric destabilization of mini-cTAR. These findings are consistent with the functions of cTAR in first strand transfer: its apical loop is suitably exposed to interact with the apical loop of TAR RNA and its lower stem is significantly destabilized to facilitate the subsequent action of the nucleocapsid protein which promotes the annealing reaction. PMID:19417069

  14. Folding topology of a bimolecular DNA quadruplex containing a stable mini-hairpin motif within the diagonal loop.

    Science.gov (United States)

    Balkwill, Graham D; Garner, Thomas P; Williams, Huw E L; Searle, Mark S

    2009-02-06

    We describe the NMR structural characterisation of a bimolecular anti-parallel DNA quadruplex d(G(3)ACGTAGTG(3))(2) containing an autonomously stable mini-hairpin motif inserted within the diagonal loop. A folding topology is identified that is different from that observed for the analogous d(G(3)T(4)G(3))(2) dimer with the two structures differing in the relative orientation of the diagonal loops. This appears to reflect specific base stacking interactions at the quadruplex-duplex interface that are not present in the structure with the T(4)-loop sequence. A truncated version of the bimolecular quadruplex d(G(2)ACGTAGTG(2))(2), with only two core G-tetrads, is less stable and forms a heterogeneous mixture of three 2-fold symmetric quadruplexes with different loop arrangements. We demonstrate that the nature of the loop sequence, its ability to form autonomously stable structure, the relative stabilities of the hairpin loop and core quadruplex, and the ability to form favourable stacking interactions between these two motifs are important factors in controlling DNA G-quadruplex topology.

  15. Structure of HIV-1 reverse transcriptase bound to a novel 38-mer hairpin template-primer DNA aptamer.

    Science.gov (United States)

    Miller, Matthew T; Tuske, Steve; Das, Kalyan; DeStefano, Jeffrey J; Arnold, Eddy

    2016-01-01

    The development of a modified DNA aptamer that binds HIV-1 reverse transcriptase (RT) with ultra-high affinity has enabled the X-ray structure determination of an HIV-1 RT-DNA complex to 2.3 Å resolution without the need for an antibody Fab fragment or RT-DNA cross-linking. The 38-mer hairpin-DNA aptamer has a 15 base-pair duplex, a three-deoxythymidine hairpin loop, and a five-nucleotide 5'-overhang. The aptamer binds RT in a template-primer configuration with the 3'-end positioned at the polymerase active site and has 2'-O-methyl modifications at the second and fourth duplex template nucleotides that interact with the p66 fingers and palm subdomains. This structure represents the highest resolution RT-nucleic acid structure to date. The RT-aptamer complex is catalytically active and can serve as a platform for studying fundamental RT mechanisms and for development of anti-HIV inhibitors through fragment screening and other approaches. Additionally, the structure allows for a detailed look at a unique aptamer design and provides the molecular basis for its remarkably high affinity for RT. © 2015 The Protein Society.

  16. Selective inhibition of HIV-1 reverse transcriptase (HIV-1 RT) RNase H by small RNA hairpins and dumbbells.

    Science.gov (United States)

    Hannoush, Rami N; Carriero, Sandra; Min, Kyung-Lyum; Damha, Masad J

    2004-04-02

    We present here the design of a novel class of RNA inhibitors of the RNase H domain of HIV-1 RT, a ribonuclease activity that is essential for viral replication in vivo. Specifically, we show that small RNA hairpins and dumbbells can selectively inhibit the RNase H activity of HIV-1 RT without affecting other cellular RNases H (e.g., E. coli and human RNase H). These results suggest that the inhibitors do not interact with the nucleic acid binding site of RT RNase H, as this region should be well conserved among the various enzymes. The most potent inhibitors displayed IC50 values in the 3-8 microM range. Remarkably, the DNA polymerase activity, an intrinsic property of HIV RT, was not inhibited by the hairpin and dumbbell aptamers, a property not previously observed for any nucleic acid aptamer directed against RT RNase H. The results described here suggest a noncompetitive binding mechanism, as outlined in the differential inhibitory characteristics of each of the nucleic acid aptamers against the bacterial, human, and viral RNase H homologues.

  17. Importance of specific nucleotides in the folding of the natural form of the hairpin ribozyme.

    Science.gov (United States)

    Wilson, T J; Zhao, Z Y; Maxwell, K; Kontogiannis, L; Lilley, D M

    2001-02-20

    The hairpin ribozyme in its natural context consists of two loops in RNA duplexes that are connected as arms of a four-way helical junction. Magnesium ions induce folding into the active conformation in which the two loops are in proximity. In this study, we have investigated nucleotides that are important to this folding process. We have analyzed the folding in terms of the cooperativity and apparent affinity for magnesium ions as a function of changes in base sequence and functional groups, using fluorescence resonance energy transfer. Our results suggest that the interaction between the loops is the sum of a number of component interactions. Some sequence variants such as A10U, G+1A, and C25U exhibit loss of cooperativity and reduced affinity of apparent magnesium ion binding. These variants are also very impaired in ribozyme cleavage activity. Nucleotides A10, G+1, and C25 thus appear to be essential in creating the conformational environment necessary for ion binding. The double variant G+1A/C25U exhibits a marked recovery of both folding and catalytic activity compared to either individual variant, consistent with the proposal of a triple-base interaction among A9, G+1, and C25 [Pinard, R., Lambert, D., Walter, N. G., Heckman, J. E., Major, F., and Burke, J. M. (1999) Biochemistry 38, 16035-16039]. However, substitution of A9 leads to relatively small changes in folding properties and cleavage activity, and the double variant G+1DAP/C25U (DAP is 2,6-diaminopurine), which could form an isosteric triple-base interaction, exhibits folding and cleavage activities that are both very impaired compared to those of the natural sequence. Our results indicate an important role for a Watson--Crick base pair between G+1 and C25; this may be buttressed by an interaction with A9, but the loss of this has less significant consequences for folding. 2'-Deoxyribose substitution leads to folding with reduced magnesium ion affinity in the following order: unmodified RNA > dA9

  18. The haloarchaeal MCM proteins: bioinformatic analysis and targeted mutagenesis of the β7-β8 and β9-β10 hairpin loops and conserved zinc binding domain cysteines

    Directory of Open Access Journals (Sweden)

    Tatjana P Kristensen

    2014-03-01

    Full Text Available The hexameric MCM complex is the catalytic core of the replicative helicase in eukaryotic and archaeal cells. Here we describe the first in vivo analysis of archaeal MCM protein structure and function relationships using the genetically tractable haloarchaeon Haloferax volcanii as a model system. Hfx. volcanii encodes a single MCM protein that is part of the previously identified core group of haloarchaeal MCM proteins. Three structural features of the N-terminal domain of the Hfx. volcanii MCM protein were targeted for mutagenesis: the β7-β8 and β9-β10 β-hairpin loops and putative zinc binding domain. Five strains carrying single point mutations in the β7-β8 β-hairpin loop were constructed, none of which displayed impaired cell growth under normal conditions or when treated with the DNA damaging agent mitomycin C. However, short sequence deletions within the β7-β8 β-hairpin were not tolerated and neither was replacement of the highly conserved residue glutamate 187 with alanine. Six strains carrying paired alanine substitutions within the β9-β10 β-hairpin loop were constructed, leading to the conclusion that no individual amino acid within that hairpin loop is absolutely required for MCM function, although one of the mutant strains displays greatly enhanced sensitivity to mitomycin C. Deletions of two or four amino acids from the β9-β10 β-hairpin were tolerated but mutants carrying larger deletions were inviable. Similarly, it was not possible to construct mutants in which any of the conserved zinc binding cysteines was replaced with alanine, underlining the likely importance of zinc binding for MCM function. The results of these studies demonstrate the feasibility of using Hfx. volcanii as a model system for reverse genetic analysis of archaeal MCM protein function and provide important confirmation of the in vivo importance of conserved structural features identified by previous bioinformatic, biochemical and structural

  19. Extraordinarily stable mini-hairpins: electrophoretical and thermal properties of the various sequence variants of d(GCGAAAGC) and their effect on DNA sequencing.

    OpenAIRE

    Hirao, I; Nishimura, Y; Tagawa, Y; Watanabe, K; Miura, K

    1992-01-01

    A small DNA fragment having a characteristic sequence d(GCGAAAGC) has been shown to form an extraordinarily stable mini-hairpin structure and to have an unusually rapid mobility in polyacrylamide gel electrophoresis, even when containing 7M urea. Here, we have studied the stability of the various sequence variants of d(GCGAAAGC) and the corresponding RNA fragments. Many such sequence variants form stable mini-hairpins in a similar manner to the d(GCGAAAGC) sequence. The RNA fragment, r(GCGAAA...

  20. A Cell-Permeable Hairpin Peptide Inhibits Hepatitis C Viral Nonstructural Protein 5A Mediated Translation and Virus Production

    Science.gov (United States)

    Khachatoorian, Ronik; Arumugaswami, Vaithilingaraja; Ruchala, Piotr; Raychaudhuri, Santanu; Maloney, Eden M.; Miao, Edna; Dasgupta, Asim; French, Samuel W.

    2012-01-01

    NS5A is a key regulator of hepatitis C virus (HCV) life cycle including RNA replication, assembly, and translation. We and others have shown NS5A to augment HCV IRES-mediated translation. Further, Quercetin treatment and heat shock protein (HSP) 70 knockdown inhibit NS5A-driven augmentation of IRES-mediated translation and infectious virus production. We have also co-immunoprecipitated HSP70 with NS5A and demonstrated cellular colocalization leading to the hypothesis that the NS5A/HSP70 complex formation is important for IRES-mediated translation. Here, we have identified the NS5A region responsible for complex formation through in vitro deletion analyses. Deletion of NS5A domains II and III failed to reduce HSP70 binding, whereas domain I deletion eliminated complex formation. NS5A domain I alone also bound HSP70. Deletion mapping of domain I identified the C-terminal 34 amino acids (C34) to be the interaction site. Further, addition of C34 to domains II and III restored complex formation. C34 expression significantly reduced intracellular viral protein levels, in contrast to same size control peptides from other NS5A domains. C34 also competitively inhibited NS5A-augmented IRES-mediated translation, while controls did not. Triple-alanine scan mutagenesis identified an exposed beta-sheet hairpin in C34 to be primarily responsible for NS5A-augmented IRES-mediated translation. Moreover, treatment with a 10 amino acid peptide derivative of C34 suppressed NS5A-augmented IRES-mediated translation and significantly inhibited intracellular viral protein synthesis, with no associated cytotoxicity. Conclusion: These results support the hypothesis that the NS5A/HSP70 complex augments viral IRES-mediated translation, identify a sequence-specific hairpin element in NS5A responsible for complex formation, and demonstrate the functional significance of C34 hairpin-mediated NS5A/HSP70 interaction. Identification of this element may allow for further interrogation of NS5A

  1. Mutation in the β-hairpin of the Bordetella pertussis adenylate cyclase toxin modulates N-lobe conformation in calmodulin

    International Nuclear Information System (INIS)

    Springer, Tzvia I.; Goebel, Erich; Hariraju, Dinesh; Finley, Natosha L.

    2014-01-01

    Highlights: • Bordetella pertussis adenylate cyclase toxin modulates bi-lobal structure of CaM. • The structure and stability of the complex rely on intermolecular associations. • A novel mode of CaM-dependent activation of the adenylate cyclase toxin is proposed. - Abstract: Bordetella pertussis, causative agent of whooping cough, produces an adenylate cyclase toxin (CyaA) that is an important virulence factor. In the host cell, the adenylate cyclase domain of CyaA (CyaA-ACD) is activated upon association with calmodulin (CaM), an EF-hand protein comprised of N- and C-lobes (N-CaM and C-CaM, respectively) connected by a flexible tether. Maximal CyaA-ACD activation is achieved through its binding to both lobes of intact CaM, but the structural mechanisms remain unclear. No high-resolution structure of the intact CaM/CyaA-ACD complex is available, but crystal structures of isolated C-CaM bound to CyaA-ACD shed light on the molecular mechanism by which this lobe activates the toxin. Previous studies using molecular modeling, biochemical, and biophysical experiments demonstrate that CyaA-ACD’s β-hairpin participates in site-specific interactions with N-CaM. In this study, we utilize nuclear magnetic resonance (NMR) spectroscopy to probe the molecular association between intact CaM and CyaA-ACD. Our results indicate binding of CyaA-ACD to CaM induces large conformational perturbations mapping to C-CaM, while substantially smaller structural changes are localized primarily to helices I, II, and IV, and the metal-binding sites in N-CaM. Site-specific mutations in CyaA-ACD’s β-hairpin structurally modulate N-CaM, resulting in conformational perturbations in metal binding sites I and II, while no significant structural modifications are observed in C-CaM. Moreover, dynamic light scattering (DLS) analysis reveals that mutation of the β-hairpin results in a decreased hydrodynamic radius (R h ) and reduced thermal stability in the mutant complex. Taken together

  2. Mutation in the β-hairpin of the Bordetella pertussis adenylate cyclase toxin modulates N-lobe conformation in calmodulin

    Energy Technology Data Exchange (ETDEWEB)

    Springer, Tzvia I.; Goebel, Erich; Hariraju, Dinesh [Department of Microbiology, Miami University, Oxford, OH 45056 (United States); Finley, Natosha L., E-mail: finleynl@miamioh.edu [Department of Microbiology, Miami University, Oxford, OH 45056 (United States); Cell, Molecular, and Structural Biology Program, Miami University, Oxford, OH 45056 (United States)

    2014-10-10

    Highlights: • Bordetella pertussis adenylate cyclase toxin modulates bi-lobal structure of CaM. • The structure and stability of the complex rely on intermolecular associations. • A novel mode of CaM-dependent activation of the adenylate cyclase toxin is proposed. - Abstract: Bordetella pertussis, causative agent of whooping cough, produces an adenylate cyclase toxin (CyaA) that is an important virulence factor. In the host cell, the adenylate cyclase domain of CyaA (CyaA-ACD) is activated upon association with calmodulin (CaM), an EF-hand protein comprised of N- and C-lobes (N-CaM and C-CaM, respectively) connected by a flexible tether. Maximal CyaA-ACD activation is achieved through its binding to both lobes of intact CaM, but the structural mechanisms remain unclear. No high-resolution structure of the intact CaM/CyaA-ACD complex is available, but crystal structures of isolated C-CaM bound to CyaA-ACD shed light on the molecular mechanism by which this lobe activates the toxin. Previous studies using molecular modeling, biochemical, and biophysical experiments demonstrate that CyaA-ACD’s β-hairpin participates in site-specific interactions with N-CaM. In this study, we utilize nuclear magnetic resonance (NMR) spectroscopy to probe the molecular association between intact CaM and CyaA-ACD. Our results indicate binding of CyaA-ACD to CaM induces large conformational perturbations mapping to C-CaM, while substantially smaller structural changes are localized primarily to helices I, II, and IV, and the metal-binding sites in N-CaM. Site-specific mutations in CyaA-ACD’s β-hairpin structurally modulate N-CaM, resulting in conformational perturbations in metal binding sites I and II, while no significant structural modifications are observed in C-CaM. Moreover, dynamic light scattering (DLS) analysis reveals that mutation of the β-hairpin results in a decreased hydrodynamic radius (R{sub h}) and reduced thermal stability in the mutant complex. Taken

  3. High quality epoxysilane substrate for clinical multiplex serodiagnostic proteomic microarrays

    Science.gov (United States)

    Ewart, Tom; Carmichael, Stuart; Lea, Peter

    2005-09-01

    Polylysine and aminopropylsilane treated glass comprised the majority of substrates employed in first generation genetic microarray substrates. Second generation single stranded long oligo libraries with amino termini provided for controlled terminal specific attachment, and rationally designed unique sequence libraries with normalized melting temperatures. These libraries benefit from active covalent coupling surfaces such as Epoxysilane. The latter's oxime ring shows versatile reactivity with amino-, thiol- and hydroxyl- groups thus encompassing small molecule, oligo and proteomic microarray applications. Batch-to-batch production uniformity supports entry of the Epoxysilane process into clinical diagnostics. We carried out multiple print runs of 21 clinically relevant bacterial and viral antigens at optimized concentrations, plus human IgG and IgM standards in triplicate on multiple batches of Epoxysilane substrates. A set of 45 patient sera were assayed in a 35 minute protocol using 10 microliters per array in a capillary-fill format (15 minute serum incubation, wash, 15 minute incubation with Cy3-labeled anti-hIgG plus Dy647-labeled anti-hIgM, final wash). The LOD (3 SD above background) was better than 1 microgram/ml for IgG, and standard curves were regular and monotonically increasing over the range 0 to 1000 micrograms/ml. Ninety-five percent of the CVs for the standards were under 10%, and 90% percent of CVs for antigen responses were under 10% across all batches of Epoxysilane and print runs. In addition, where SDs are larger than expected, microarray images may be readily reviewed for quality control purposes and pin misprints quickly identified. In order to determine the influence of stirring on sensitivity and speed of the microarray assay, we printed 10 common ToRCH antigens (H. pylori, T. gondii, Rubella, Rubeola, C. trachomatis, Herpes 1 and 2, CMV, C. jejuni, and EBV) in Epoxysilane-activated slide-wells. Anti-IgG-Cy3 direct binding to printed Ig

  4. Short-hairpin RNA-mediated stable silencing of Grb2 impairs cell growth and DNA synthesis

    International Nuclear Information System (INIS)

    Di Fulvio, Mauricio; Henkels, Karen M.; Gomez-Cambronero, Julian

    2007-01-01

    Grb2 is an SH2-SH3 protein adaptor responsible for linking growth factor receptors with intracellular signaling cascades. To study the role of Grb2 in cell growth, we have generated a new COS7 cell line (COS7 shGrb2 ), based on RNAi technology, as null mutations in mammalian Grb2 genes are lethal in early development. This novel cell line continuously expresses a short hairpin RNA that targets endogenous Grb2. Stable COS7 shGrb2 cells had the shGrb2 integrated into the genomic DNA and carried on SiL construct (made refractory to the shRNA-mediated interference), but not with an SH2-deficient mutant (R86K). Thus, a viable knock-down and rescue protocol has demonstrated that Grb2 is crucial for cell proliferation

  5. Hairpin DNA probe with 5'-TCC/CCC-3' overhangs for the creation of silver nanoclusters and miRNA assay.

    Science.gov (United States)

    Xia, Xiaodong; Hao, Yuanqiang; Hu, Shengqiang; Wang, Jianxiu

    2014-01-15

    A facile strategy for the assay of target miRNA using fluorescent silver nanoclusters (AgNCs) has been described. Due to the preferable interaction between cytosine residues and Ag(+), a short cytosine-rich oligonucleotide (ODN) with only six bases 5'-TCCCCC-3' served as an efficient scaffold for the creation of the AgNCs. The AgNCs displayed a bright red emission when excited at 545nm. Such ODN base-stabilized AgNCs have been exploited for miRNA sensing. Overhangs of TCC at the 5' end (5'-TCC) and CCC at the 3' end (CCC-3') (denoted as 5'-TCC/CCC-3') appended to the hairpin ODN probe which also contains recognition sequences for target miRNA were included. Interestingly, the AgNCs/hairpin ODN probe showed similar spectral properties as that templated by 5'-TCCCCC-3'. The formation of the hairpin ODN probe/miRNA duplex separated the 5'-TCC/CCC-3' overhangs, thus disturbing the optical property or structure of the AgNCs. As a result, fluorescence quenching of the AgNCs/hairpin ODN probe was obtained, which allows for facile determination of target miRNA. The proposed method is simple and cost-effective, holding great promise for clinical applications. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Differential RNAi responses of Nicotiana benthamiana individuals transformed with a hairpin-inducing construct during Plum pox virus challenge.

    Science.gov (United States)

    Montes, Christian; Castro, Álvaro; Barba, Paola; Rubio, Julia; Sánchez, Evelyn; Carvajal, Denisse; Aguirre, Carlos; Tapia, Eduardo; DelÍ Orto, Paola; Decroocq, Veronique; Prieto, Humberto

    2014-10-01

    Gene silencing and large-scale small RNA analysis can be used to develop RNA interference (RNAi)-based resistance strategies for Plum pox virus (PPV), a high impact disease of Prunus spp. In this study, a pPPViRNA hairpin-inducing vector harboring two silencing motif-rich regions of the PPV coat protein (CP) gene was evaluated in transgenic Nicotiana benthamiana (NB) plants. Wild-type NB plants infected with a chimeric PPV virus (PPV::GFP) exhibited affected leaves with mosaic chlorosis congruent to GFP fluorescence at 21 day post-inoculation; transgenic lines depicted a range of phenotypes from fully resistant to susceptible. ELISA values and GFP fluorescence intensities were used to select transgenic-resistant (TG-R) and transgenic-susceptible (TG-S) lines for further characterization of small interfering RNAs (siRNAs) by large-scale small RNA sequencing. In infected TG-S and untransformed (WT) plants, the observed siRNAs were nearly exclusively 21- and 22-nt siRNAs that targeted the whole PPV::GFP genome; 24-nt siRNAs were absent in these individuals. Challenged TG-R plants accumulated a full set of 21- to 24-nt siRNAs that were primarily associated with the selected motif-rich regions, indicating that a trans-acting siRNAs process prevented viral multiplication. BLAST analysis identified 13 common siRNA clusters targeting the CP gene. 21-nt siRNA sequences were associated with the 22-nt siRNAs and the scarce 23- and 24-nt molecules in TG-S plants and with most of the observed 22-, 23-, and 24-nt siRNAs in TG-R individuals. These results validate the use of a multi-hot spot silencing vector against PPV and elucidate the molecules by which hairpin-inducing vectors initiate RNAi in vivo.

  7. Sensor Substrate Development

    Data.gov (United States)

    National Aeronautics and Space Administration — Novel substrates, such as aerogels and porous, low density ceramics may increase the sensitivities of chemical reaction-based sensors for toxic vapors. These sensors...

  8. Evidence that the C-terminal domain of a type B PutA protein contributes to aldehyde dehydrogenase activity and substrate channeling.

    Science.gov (United States)

    Luo, Min; Christgen, Shelbi; Sanyal, Nikhilesh; Arentson, Benjamin W; Becker, Donald F; Tanner, John J

    2014-09-09

    Proline utilization A (PutA) is a bifunctional enzyme that catalyzes the oxidation of proline to glutamate. Structures of type A PutAs have revealed the catalytic core consisting of proline dehydrogenase (PRODH) and Δ(1)-pyrroline-5-carboxylate dehydrogenase (P5CDH) modules connected by a substrate-channeling tunnel. Type B PutAs also have a C-terminal domain of unknown function (CTDUF) that is absent in type A PutAs. Small-angle X-ray scattering (SAXS), mutagenesis, and kinetics are used to determine the contributions of this domain to PutA structure and function. The 1127-residue Rhodobacter capsulatus PutA (RcPutA) is used as a representative CTDUF-containing type B PutA. The reaction progress curve for the coupled PRODH-P5CDH activity of RcPutA does not exhibit a time lag, implying a substrate channeling mechanism. RcPutA is monomeric in solution, which is unprecedented for PutAs. SAXS rigid body modeling with target-decoy validation is used to build a model of RcPutA. On the basis of homology to aldehyde dehydrogenases (ALDHs), the CTDUF is predicted to consist of a β-hairpin fused to a noncatalytic Rossmann fold domain. The predicted tertiary structural interactions of the CTDUF resemble the quaternary structural interactions in the type A PutA dimer interface. The model is tested by mutagenesis of the dimerization hairpin of a type A PutA and the CTDUF hairpin of RcPutA. Similar functional phenotypes are observed in the two sets of variants, supporting the hypothesis that the CTDUF mimics the type A PutA dimer interface. These results suggest annotation of the CTDUF as an ALDH superfamily domain that facilitates P5CDH activity and substrate channeling by stabilizing the aldehyde-binding site and sealing the substrate-channeling tunnel from the bulk medium.

  9. Recognition of a 10 base pair sequence of DNA and stereochemical control of the binding affinity of chiral hairpin polyamide-Hoechst 33258 conjugates.

    Science.gov (United States)

    Reddy, Putta Mallikarjuna; Toporowski, Joseph W; Kahane, Alexandra L; Bruice, Thomas C

    2005-12-15

    Chiral hairpin polyamides linked to a Hoechst 33258 analogue at the alpha-position of the hairpin turn amino acid (1,2) were synthesized on solid phase by adopting Fmoc and ivDde techniques. The DNA-binding properties of enantiomeric conjugates 1 and 2, and N-terminal linked conjugate 3 for 8-14bp sequences were determined by spectrofluorometric and thermal melting studies. Conjugates 1 and 2 recognize a 10bp sequence, while conjugate 3 recognizes a 9bp sequence. Interestingly, R-enantiomer 1 exhibited 10- to 30-fold higher binding affinities than S-enantiomer 2 for the DNA sequences studied. These binding differences were accounted for by molecular modeling studies, which revealed that the amide proton nearest to the chiral center in R-conjugate 1 is better positioned to form hydrogen bonds to the DNA bases, while S-conjugate 2 does not.

  10. Design of hybrid β-hairpin peptides with enhanced cell specificity and potent anti-inflammatory activity.

    Science.gov (United States)

    Liu, YiFan; Xia, Xi; Xu, Liang; Wang, YiZhen

    2013-01-01

    Antimicrobial peptides (AMPs) have attracted considerable attention for their broad-spectrum antimicrobial activity and reduced tendency to cause bacterial resistance. Emerging concerns over the host cytotoxicity of AMPs, however, may ultimately compromise their development as pharmaceuticals. In order to optimize AMPs with potent cell specificity and anti-inflammatory activity, we designed β-hairpin hybrid peptides based upon progetrin-1, bovine lactoferricin and cecropin A. The synthetic hybrid peptides LB-PG and CA-PG demonstrated high selectivity over a wide range of microbes from Gram-positive and Gram-negative bacteria in porcine red blood cells. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) show that these peptides kill microbial cells by penetrating the cell membrane and damaging the membrane envelope. Gel retardation demonstrates that the peptides have a high affinity for DNA, indicating an additional possible intracellular bactericidal mechanism. Moreover, the hybrid peptides inhibit the expression of LPS-induced proinflammatory cytokines and chemokines, such as tumor necrosis factor-α (TNF-α), inducible nitric oxide synthase (iNOS), macrophage inflammatory protein-1α (MIP-1α) and monocyte chemoattractant protein 1(MCP-1), following LPS stimulation in RAW264.7 cells. Our results indicate that these hybrid peptides have considerable potential for future development as antimicrobial and anti-inflammatory agents. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Inhibition of porcine transmissible gastroenteritis virus infection in porcine kidney cells using short hairpin RNAs targeting the membrane gene.

    Science.gov (United States)

    Wang, Li; Dai, Xianjin; Song, Han; Yuan, Peng; Yang, Zhou; Dong, Wei; Song, Zhenhui

    2017-04-01

    The membrane (M) protein is the most abundant component of the porcine transmissible gastroenteritis virus (TGEV) particle. To exploit the possibility of using RNA interference (RNAi) as a strategy against TGEV infection, three plasmids (pRNAT-1, pRNAT-2, and pRNAT-3) expressing short hairpin RNAs were designed to target three different coding regions of the M gene of TGEV. The plasmids were constructed and transiently transfected into a porcine kidney cells, PK-15, to determine whether these constructs inhibited TGEV production. The analysis of cytopathic effects demonstrated that pRNAT-2 and pRNAT-3 could protect PK-15 cells against pathological changes specifically and efficiently. Additionally, indirect immunofluorescence and 50% tissue culture infectious dose (TCID 50 ) assays showed that pRNAT-2 and pRNAT-3 inhibited the multiplication of the virus at the protein level effectively. Quantitative real-time PCR further confirmed that the amounts of viral RNAs in cell cultures pre-transfected with the three plasmids were reduced by 13, 68, and 70%, respectively. This is the first report showing that RNAi targeting of the M gene. Our results could promote studies of the specific function of viral genes associated with TGEV infection and might provide a theoretical basis for potential therapeutic applications.

  12. Comparison of approaches for efficient gene silencing induced by microRNA-based short hairpin RNA and indicator gene expression.

    Science.gov (United States)

    Shan, Z X; Lin, Q X; Deng, C Y; Zhou, Z L; Tan, H H; Fu, Y H; Li, X H; Zhu, J N; Mai, L P; Kuang, S J; Lin, S G; Yu, X Y

    2010-04-01

    MicroRNA-based short hairpin RNAs (shRNAs) are natural inducers of RNA interference and have been increasingly used in shRNA expression strategies. In the present study, we compared the efficiencies of exogenous green fluorescence protein (GFP) and endogenous glyceraldehyde-3-phosphate dehydrogenase (GAPDH) knockdown and red fluorescent protein (RFP) indicator expression mediated by three differently designed plasmids. RFP was introduced either at the 5' end, at the 3' end of the human mir155-based target gene (TG) (e.g., GFP or GAPDH) shRNA expression cassette (EC), or at the 3' end of the chimeric intron-containing TG shRNA EC. Comparisons with the control vector showed an obvious reduction of GFP or GAPDH expression with the various shRNA expression plasmids (P < 0.05). When RFP was located at the 5' end or at the 3' end of the TG shRNA EC, RFP expression was low; whereas when RFP was connected with the chimeric intron-containing TG shRNA EC, RFP expression was high. Taken together, this study demonstrated an efficient plasmid design for both TG silencing induced by microRNA-based shRNA and indicator gene expression in vitro.

  13. An optimized lentiviral vector system for conditional RNAi and efficient cloning of microRNA embedded short hairpin RNA libraries.

    Science.gov (United States)

    Adams, Felix F; Heckl, Dirk; Hoffmann, Thomas; Talbot, Steven R; Kloos, Arnold; Thol, Felicitas; Heuser, Michael; Zuber, Johannes; Schambach, Axel; Schwarzer, Adrian

    2017-09-01

    RNA interference (RNAi) and CRISPR-Cas9-based screening systems have emerged as powerful and complementary tools to unravel genetic dependencies through systematic gain- and loss-of-function studies. In recent years, a series of technical advances helped to enhance the performance of virally delivered RNAi. For instance, the incorporation of short hairpin RNAs (shRNAs) into endogenous microRNA contexts (shRNAmiRs) allows the use of Tet-regulated promoters for synchronous onset of gene knockdown and precise interrogation of gene dosage effects. However, remaining challenges include lack of efficient cloning strategies, inconsistent knockdown potencies and leaky expression. Here, we present a simple, one-step cloning approach for rapid and efficient cloning of miR-30 shRNAmiR libraries. We combined a human miR-30 backbone retaining native flanking sequences with an optimized all-in-one lentiviral vector system for conditional RNAi to generate a versatile toolbox characterized by higher doxycycline sensitivity, reduced leakiness and enhanced titer. Furthermore, refinement of existing shRNA design rules resulted in substantially improved prediction of powerful shRNAs. Our approach was validated by accurate quantification of the knockdown potency of over 250 single shRNAmiRs. To facilitate access and use by the scientific community, an online tool was developed for the automated design of refined shRNA-coding oligonucleotides ready for cloning into our system. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Enzyme-free amplification for sensitive electrochemical detection of DNA via target-catalyzed hairpin assembly assisted current change.

    Science.gov (United States)

    Qian, Yong; Wang, Chunyan; Gao, Fenglei

    2014-12-01

    An isothermal, enzyme-free and sensitive method for electrochemical detection of DNA is proposed based on target catalyzed hairpin assembly and for signal amplification. Molecular beacon 1 (MB1) contains a ferrocene (Fc) tag, which was immobilized on the gold electrode as recognition probe to hybridize with target DNA. Then, molecular beacon 2 hybridized with the opened MB1, allowing the target to be displaced. The displaced target again triggered the next round of strand exchange reaction resulting in many Fc far away from the GE to achieve signal amplification for sensitive DNA detection. The current signal amplification strategy is relatively simple and inexpensive owing to avoid the use of any kind of enzyme or sophisticated equipment. It can achieve a sensitivity of 42 fM with a wide linear dynamic range from 10(-13) to 10(-9)M and discriminate mismatched DNA from perfect matched target DNA with a high selectivity. The proposed method showed excellent specificity, high sensitivity and low detection limit, and could be applied in analysis of real samples. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. SHARP-2 gene silencing by lentiviral-based short hairpin RNA interference prolonged rat kidney transplant recipients' survival time.

    Science.gov (United States)

    Shou, Z; Xiao, H; Xu, Y; Wang, Y; Yang, Y; Jiang, H; Chen, J; Yamada, K; Miyamoto, K

    2009-01-01

    Split- and hairy-related protein-2 (SHARP-2) controls the expression of interleukin-2 (IL-2) and interferon-gamma (IFN-gamma), which both play a key role in transplant rejection. This study was designed to investigate whether SHARP-2 short hairpin RNA interference (shRNAi) could prolong the survival of rat kidney transplant recipients. A lentiviral-based shRNAi construct, LV-SHARP-2iC, showed a SHARP-2 gene silencing efficiency of 84% in normal rat kidney cells. In activated T-cells, SHARP-2 gene silencing with the LV-SHARP-2iC construct resulted in 61% and 69% down-regulation of IL-2 and IFN-gamma, respectively, compared with a scramble control construct. When donor kidney was perfused with 5 x 10(7) transforming units of the LV-SHARP-2iC construct, the median survival time of the transplant recipients was prolonged by 4 - 5 days compared with control groups. In conclusion, recombinant lentiviral LV-SHARP-2iC construct effectively silenced SHARP-2 gene expression, which reduced IL-2 and IFN-gamma mRNA expression and prolonged rat kidney transplant recipients' survival.

  16. Fast and quantitative differentiation of single-base mismatched DNA by initial reaction rate of catalytic hairpin assembly.

    Science.gov (United States)

    Li, Chenxi; Li, Yixin; Xu, Xiao; Wang, Xinyi; Chen, Yang; Yang, Xiaoda; Liu, Feng; Li, Na

    2014-10-15

    The widely used catalytic hairpin assembly (CHA) amplification strategy generally needs several hours to accomplish one measurement based on the prevailingly used maximum intensity detection mode, making it less practical for assays where high throughput or speed is desired. To make the best use of the kinetic specificity of toehold domain for circuit reaction initiation, we developed a mathematical model and proposed an initial reaction rate detection mode to quantitatively differentiate the single-base mismatch. Using the kinetic mode, assay time can be reduced substantially to 10 min for one measurement with the comparable sensitivity and single-base mismatch differentiating ability as were obtained by the maximum intensity detection mode. This initial reaction rate based approach not only provided a fast and quantitative differentiation of single-base mismatch, but also helped in-depth understanding of the CHA system, which will be beneficial to the design of highly sensitive and specific toehold-mediated hybridization reactions. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. The hairpin structure of the 6F11F22F2 fragment from human fibronectin enhances gelatin binding

    Science.gov (United States)

    Pickford, Andrew R.; Smith, Steven P.; Staunton, David; Boyd, Jonathan; Campbell, Iain D.

    2001-01-01

    The solution structure of the 6F11F22F2 fragment from the gelatin-binding region of fibronectin has been determined (Protein Data Bank entry codes 1e88 and 1e8b). The structure reveals an extensive hydrophobic interface between the non-contiguous 6F1 and 2F2 modules. The buried surface area between 6F1 and 2F2 (∼870 Å2) is the largest intermodule interface seen in fibronectin to date. The dissection of 6F11F22F2 into the 6F11F2 pair and 2F2 results in near-complete loss of gelatin-binding activity. The hairpin topology of 6F11F22F2 may facilitate intramolecular contact between the matrix assembly regions flanking the gelatin-binding domain. This is the first high-resolution study to reveal a compact, globular arrangement of modules in fibronectin. This arrangement is not consistent with the view that fibronectin is simply a linear ‘string of beads’. PMID:11285216

  18. Significant inhibition of Tembusu virus envelope and NS5 gene using an adenovirus-mediated short hairpin RNA delivery system.

    Science.gov (United States)

    Wang, Hongzhi; Feng, Qiang; Wei, Lei; Zhuo, Liling; Chen, Hao; Diao, Youxiang; Tang, Yi

    2017-10-01

    Tembusu virus (TMUV) is a mosquito-borne flavivirus, which was first isolated in the tropics during the 1970s. Recently, a disease characterized by ovarian haemorrhage and neurological symptoms was observed in ducks in China, which threatens poultry production. However, there is no suitable vaccination strategy or effective antiviral drugs to combat TMUV infections. Consequently, there is an urgent need to develop a new anti-TMUV therapy. In this study, we report an efficient short hairpin RNA (shRNA) delivery strategy for the inhibition of TMUV production using an adenovirus vector system. Using specifically designed shRNAs based on the E and NS5 protein genes of TMUV, the vector-expressed viral genes, TMUV RNA replication and infectious virus production were downregulated at different levels in Vero cells, where the shRNA (NS52) was highly effective in inhibiting TMUV. Using the human adenovirus type 5 shRNA delivery system, the recombinant adenovirus (rAd-NS52) inhibited TMUV multiplication with high efficiency. Furthermore, the significant dose-dependent inhibition of viral RNA copies induced by rAd-NS52 was found in TMUV-infected cells, which could last for at least 96h post infection. Our results indicated that the adenovirus-mediated delivery of shRNAs could play an active role in future TMUV antiviral therapeutics. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Is TNF-a-targeted short hairpin RNA (shRNA) a novel potential therapeutic tool in psoriasis treatment?

    DEFF Research Database (Denmark)

    Stenderup, Karin; Jakobsen, Maria; Rosada, Cecilia

    2008-01-01

      TNF-α is a well known target in psoriasis treatment and biological treatments targeting TNF-a are already clinically used against psoriasis and psoriasis arthritis. Attention is however given to a novel therapeutic tool: RNA interference that controls gene silencing. This study investigates...... the efficiency of targeting TNF-a with specific short hairpin RNA (shRNA) and explores its potential in treating psoriasis. ShRNAs targeting human TNF-α mRNA were generated. Their efficiency in down-regulating TNF-a protein expression was evaluated using a Renilla luciferase screening-assay and a transient co...... TNF-a shRNA was used to transduce HEK293 cells and verify vector-derived TNF-a knockdown in vitro. In vivo, psoriasis skin was exposed to lentiviral TNF-a shRNAs by a single intra-dermal injection. Psoriasis skin for the in vivo study was obtained from psoriatic plaque skin biopsies that were...

  20. Coating of substrates

    International Nuclear Information System (INIS)

    Cairns, J.A.; Nelson, R.L.; Woodhead, J.L.

    1979-01-01

    The process is concerned with providing substrates with coatings obtainable from sols, for example to protect the substrate (such as in nuclear reactors or hydrocarbon cracking plant) or to provide a carrier for catalytically active material. Hitherto, coatings obtained from sols have had a high porosity and high surface area so that they have not been entirely satisfactory for the above applications. In the process described, dense, low-porosity coatings are provided by contacting the substrate with a sol of refractory material (e.g. CeO 2 or SiO 2 ) convertible to a gel of density at least 40% of the theoretical density of the refractory material, and converting the sol to the gel. Optionally, the gel may be converted to a ceramic coating by firing. (author)

  1. Target-induced structure switching of hairpin aptamers for label-free and sensitive fluorescent detection of ATP via exonuclease-catalyzed target recycling amplification.

    Science.gov (United States)

    Xu, Yunying; Xu, Jin; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2014-01-15

    In this work, we described the development of a new label-free, simple and sensitive fluorescent ATP sensing platform based on exonuclease III (Exo III)-catalyzed target recycling (ECTR) amplification and SYBR Green I indicator. The hairpin aptamer probes underwent conformational structure switching and re-configuration in the presence of ATP, which led to catalytic cleavage of the re-configured aptamers by Exo III to release ATP and to initiate the ECTR process. Such ECTR process resulted in the digestion of a significant number of the hairpin aptamer probes, leading to much less intercalation of SYBR Green I to the hairpin stems and drastic suppression of the fluorescence emission for sensitive ATP detection down to the low nanomolar level. Due to the highly specific affinity bindings between aptamers and ATP, the developed method exhibited excellent selectivity toward ATP against other analogous molecules. Besides, our ATP sensing approach used un-modified aptamer probes and could be performed in a "mix-and-detect" fashion in homogenous solutions. All these distinct advantages of the developed method thus made it hold great potential for the development of simple and robust sensing strategies for the detection of other small molecules. © 2013 Elsevier B.V. All rights reserved.

  2. Natural abundance heteronuclear NMR studies of the T3 mini-loop hairpin in the terminal repeat of the adenoassociated virus 2.

    Science.gov (United States)

    Chou, S H; Tseng, Y Y; Chu, B Y

    2000-05-01

    A DNA hairpin containing a T3 loop, as occurs in the terminal repeat of a popular gene therapy vector (Adenoassociated Virus 2, AAV2), has been extensively studied using homo- and heteronuclear NMR experiments. Almost complete assignment of the proton and carbon resonances, including H5'(Pro-S) and H5'(Pro-R) protons, has been accomplished at natural abundance. NOESY spectra in H2O and D2O have revealed many unusual NOEs, which, when combined with the epsilon, beta, gamma, and chi torsion angles determined from heteronuclear 1H-13C, 1H-31P, and 13C-31P coupling constants, have allowed for a more detailed picture of the T3 mini-loop hairpin. The three loop thymidines are all unpaired, yet are highly structured when bracketed by a 5'-GC...GC-3' stem sequence. The structure determined in this manuscript is considerably different from several other structures reported so far. Contrary to an RNA oligomer with a central U3 sequence that has the tendency to form a duplex with three U*U mismatches, the d(GAAGC-TTT-GCTTC) sequence exists mostly as a hairpin under millimolar NMR conditions. Since T3 triloop was found to be an essential element for the site-specific non-homologous integration of the AAV2 virus, and modification of the T3 loop residue abolishes such capability, the structure we report here may be of biological significance.

  3. Robust plasmonic substrates

    DEFF Research Database (Denmark)

    Kostiučenko, Oksana; Fiutowski, Jacek; Tamulevicius, Tomas

    2014-01-01

    Robustness is a key issue for the applications of plasmonic substrates such as tip-enhanced Raman spectroscopy, surface-enhanced spectroscopies, enhanced optical biosensing, optical and optoelectronic plasmonic nanosensors and others. A novel approach for the fabrication of robust plasmonic...... substrates is presented, which relies on the coverage of gold nanostructures with diamond-like carbon (DLC) thin films of thicknesses 25, 55 and 105 nm. DLC thin films were grown by direct hydrocarbon ion beam deposition. In order to find the optimum balance between optical and mechanical properties...

  4. Catalysis of protein disulfide bond isomerization in a homogeneous substrate.

    Science.gov (United States)

    Kersteen, Elizabeth A; Barrows, Seth R; Raines, Ronald T

    2005-09-13

    Protein disulfide isomerase (PDI) catalyzes the rearrangement of nonnative disulfide bonds in the endoplasmic reticulum of eukaryotic cells, a process that often limits the rate at which polypeptide chains fold into a native protein conformation. The mechanism of the reaction catalyzed by PDI is unclear. In assays involving protein substrates, the reaction appears to involve the complete reduction of some or all of its nonnative disulfide bonds followed by oxidation of the resulting dithiols. The substrates in these assays are, however, heterogeneous, which complicates mechanistic analyses. Here, we report the first analysis of disulfide bond isomerization in a homogeneous substrate. Our substrate is based on tachyplesin I, a 17-mer peptide that folds into a beta hairpin stabilized by two disulfide bonds. We describe the chemical synthesis of a variant of tachyplesin I in which its two disulfide bonds are in a nonnative state and side chains near its N and C terminus contain a fluorescence donor (tryptophan) and acceptor (N(epsilon)-dansyllysine). Fluorescence resonance energy transfer from 280 to 465 nm increases by 28-fold upon isomerization of the disulfide bonds into their native state (which has a lower E(o') = -0.313 V than does PDI). We use this continuous assay to analyze catalysis by wild-type human PDI and a variant in which the C-terminal cysteine residue within each Cys-Gly-His-Cys active site is replaced with alanine. We find that wild-type PDI catalyzes the isomerization of the substrate with kcat/K(M) = 1.7 x 10(5) M(-1) s(-1), which is the largest value yet reported for catalysis of disulfide bond isomerization. The variant, which is a poor catalyst of disulfide bond reduction and dithiol oxidation, retains virtually all of the activity of wild-type PDI in catalysis of disulfide bond isomerization. Thus, the C-terminal cysteine residues play an insignificant role in the isomerization of the disulfide bonds in nonnative tachyplesin I. We conclude

  5. Multiple alternative substrate kinetics.

    Science.gov (United States)

    Anderson, Vernon E

    2015-11-01

    The specificity of enzymes for their respective substrates has been a focal point of enzyme kinetics since the initial characterization of metabolic chemistry. Various processes to quantify an enzyme's specificity using kinetics have been utilized over the decades. Fersht's definition of the ratio kcat/Km for two different substrates as the "specificity constant" (ref [7]), based on the premise that the important specificity existed when the substrates were competing in the same reaction, has become a consensus standard for enzymes obeying Michaelis-Menten kinetics. The expansion of the theory for the determination of the relative specificity constants for a very large number of competing substrates, e.g. those present in a combinatorial library, in a single reaction mixture has been developed in this contribution. The ratio of kcat/Km for isotopologs has also become a standard in mechanistic enzymology where kinetic isotope effects have been measured by the development of internal competition experiments with extreme precision. This contribution extends the theory of kinetic isotope effects to internal competition between three isotopologs present at non-tracer concentrations in the same reaction mix. This article is part of a special issue titled: Enzyme Transition States from Theory and Experiment. Published by Elsevier B.V.

  6. Short Hairpin RNA Silencing of PHD-2 Improves Neovascularization and Functional Outcomes in Diabetic Wounds and Ischemic Limbs.

    Directory of Open Access Journals (Sweden)

    Kevin J Paik

    Full Text Available The transcription factor hypoxia-inducible factor 1-alpha (HIF-1α is responsible for the downstream expression of over 60 genes that regulate cell survival and metabolism in hypoxic conditions as well as those that enhance angiogenesis to alleviate hypoxia. However, under normoxic conditions, HIF-1α is hydroxylated by prolyl hydroxylase 2, and subsequently degraded, with a biological half-life of less than five minutes. Here we investigated the therapeutic potential of inhibiting HIF-1α degradation through short hairpin RNA silencing of PHD-2 in the setting of diabetic wounds and limb ischemia. Treatment of diabetic mouse fibroblasts with shPHD-2 in vitro resulted in decreased levels of PHD-2 transcript demonstrated by qRT-PCR, higher levels of HIF-1α as measured by western blot, and higher expression of the downstream angiogenic genes SDF-1 and VEGFα, as measured by qRT-PCR. In vivo, shPHD-2 accelerated healing of full thickness excisional wounds in diabetic mice compared to shScr control, (14.33 ± 0.45 days vs. 19 ± 0.33 days and was associated with an increased vascular density. Delivery of shPHD-2 also resulted in improved perfusion of ischemic hind limbs compared to shScr, prevention of distal digit tip necrosis, and increased survival of muscle tissue. Knockdown of PHD-2 through shRNA treatment has the potential to stimulate angiogenesis through overexpression of HIF-1α and upregulation of pro-angiogenic genes downstream of HIF-1α, and may represent a viable, non-viral approach to gene therapy for ischemia related applications.

  7. Robust RNAi-mediated resistance to infection of seven potyvirids in soybean expressing an intron hairpin NIb RNA.

    Science.gov (United States)

    Yang, Xiangdong; Niu, Lu; Zhang, Wei; He, Hongli; Yang, Jing; Xing, Guojie; Guo, Dongquan; Du, Qian; Qian, Xueyan; Yao, Yao; Li, Qiyun; Dong, Yingshan

    2017-10-01

    Viral pathogens, such as soybean mosaic virus (SMV), are a major constraint in soybean production and often cause significant yield loss and quality deterioration. Engineering resistance by RNAi-mediated gene silencing is a powerful strategy for controlling viral diseases. In this study, a 248-bp inverted repeat of the replicase (nuclear inclusion b, NIb) gene was isolated from the SMV SC3 strain, driven by the leaf-specific rbcS2 promoter from Phaseolus vulgaris, and introduced into soybean. The transgenic lines had significantly lower average disease indices (ranging from 2.14 to 12.35) than did the non-transformed (NT) control plants in three consecutive generations, exhibiting a stable and significantly enhanced resistance to the SMV SC3 strain under field conditions. Furthermore, seed mottling did not occur in transgenic seeds, whereas the NT plants produced ~90% mottled seeds. Virus resistance spectrum screening showed that the greenhouse-grown transgenic lines exhibited robust resistance to five SMV strains (SC3, SC7, SC15, SC18, and a recombinant SMV), bean common mosaic virus, and watermelon mosaic virus. Nevertheless, no significantly enhanced resistance to bean pod mottle virus (BPMV, Comovirus) was observed in the transgenic lines relative to their NT counterparts. Consistent with the results of resistance evaluation, the accumulation of each potyvirid (but not of BPMV) was significantly inhibited in the transgenic plants relative to the NT controls as confirmed by quantitative real-time (qRT-PCR) and double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). These results demonstrate that robust RNAi-mediated resistance to multiple potyvirids in soybean was conferred by expressing an intron hairpin SMV NIb RNA.

  8. Conformation-Specific Infrared and Ultraviolet Spectroscopy of Cold [YAPAA+H]^{+} and [YGPAA+H]^{+} Ions: a Stereochemical "twist" on the β-HAIRPIN Turn

    Science.gov (United States)

    DeBlase, Andrew F.; Harrilal, Christopher P.; Lawler, John T.; Burke, Nicole L.; McLuckey, Scott A.; Zwier, Timothy S.

    2017-06-01

    Incorporation of the unnatural D-proline (^{D}P) stereoisomer into a polypeptide sequence is a typical strategy to encourage formation of β-hairpin loops because natural sequences are often unstructured in solution. Using conformation-specific IR and UV spectroscopy of cold (10 K) gas-phase ions, we probe the inherent conformational preferences of the ^{D}P and ^{L}P diastereomers in the protonated peptide [YAPAA+H]^{+}, where only intramolecular interactions are possible. Consistent with the solution phase studies, one of the conformers of [YADPAA+H]^{+} is folded into a charge-stabilized β-hairpin turn. However, a second predominant conformer family containing two sequential γ-turns is also identified, with similar energetic stability. A single conformational isomer of the ^{L}P diastereomer, [YALPAA+H]^{+}, is found and assigned to a structure that is not the anticipated "mirror image" β-turn. Instead, the ^{L}P stereo center promotes a cis alanine-proline amide bond. The assigned structures contain clues that the preference of the ^{D}P diastereomer to support a trans-amide bond and the proclivity of ^{L}P for a cis-amide bond is sterically driven and can be reversed by substituting glycine for alanine in position 2, forming [YGLPAA+H]^{+}. These results provide a basis for understanding the residue-specific and stereo-specific alterations in the potential energy surface that underlie these changing preferences, providing insights to the origin of β-hairpin formation.

  9. Metschnikowia Species Share a Pool of Diverse rRNA Genes Differing in Regions That Determine Hairpin-Loop Structures and Evolve by Reticulation.

    Directory of Open Access Journals (Sweden)

    Matthias Sipiczki

    Full Text Available Modern taxonomy of yeasts is mainly based on phylogenetic analysis of conserved DNA and protein sequences. By far the most frequently used sequences are those of the repeats of the chromosomal rDNA array. It is generally accepted that the rDNA repeats of a genome have identical sequences due to the phenomenon of sequence homogenisation and can thus be used for identification and barcoding of species. Here we show that the rDNA arrays of the type strains of Metschnikowia andauensis and M. fructicola are not homogenised. Both have arrays consisting of diverse repeats that differ from each other in the D1/D2 domains by up to 18 and 25 substitutions. The variable sites are concentrated in two regions that correspond to back-folding stretches of hairpin loops in the predicted secondary structure of the RNA molecules. The substitutions do not alter significantly the overall hairpin-loop structure due to wobble base pairing at sites of C-T transitions and compensatory mutations in the complementary strand of the hairpin stem. The phylogenetic and network analyses of the cloned sequences revealed that the repeats had not evolved in a vertical tree-like way but reticulation might have shaped the rDNA arrays of both strains. The neighbour-net analysis of all cloned sequences of the type strains and the database sequences of different strains further showed that these species share a continuous pool of diverse repeats that appear to evolve by reticulate evolution.

  10. Co-expression of Argonaute2 enhances short hairpin RNA-induced RNA interference in Xenopus CNS neurons in vivo

    Directory of Open Access Journals (Sweden)

    Chih-ming Chen

    2009-07-01

    Full Text Available RNA interference (RNAi is an evolutionarily conserved mechanism for sequence-specific gene silencing. Recent advances in our understanding of RNAi machinery make it possible to reduce protein expression by introducing short hairpin RNA (shRNA into cells of many systems, however, the efficacy of RNAi-mediated protein knockdown can be quite variable, especially in intact animals, and this limits its application. We built adaptable molecular tools, pSilencer (pSi and pReporter (pRe constructs, to evaluate the impact of different promoters, shRNA structures and overexpression of Ago2, the key enzyme in the RNA-induced silencing complex (RISC, on the efficiency of RNAi. The magnitude of RNAi knockdown was evaluated in cultured cells and intact animals by comparing fluorescence intensity levels of GFP, the RNAi target, relative to mCherry, which was not targeted. Co-expression of human Ago2 with shRNA significantly enhanced efficiency of GFP knockdown in cell lines and in neurons of intact Xenopus tadpoles. Human H1- and U6-promotors alone or the U6-promotor with an enhancer element were equally effective at driving GFP knockdown. shRNA derived from the microRNA-30 design (shRNAmir30 enhanced the efficiency of GFP knockdown. Expressing pSi containing Ago2 with shRNA increased knockdown efficiency of an endogenous neuronal protein, the GluR2 subunit of the AMPA receptor, functionally accessed by recording AMPA receptor-mediated spontaneous synaptic currents in Xenopus CNS neurons. Our data suggest that co-expression of Ago2 and shRNA is a simple method to enhance RNAi in intact animals. While morpholino antisense knockdown is effective in Xenopus and Zebrafish, a principle advantage of the RNAi method is the possibility of spatial and temporal control of protein knockdown by use of cell type specific and regulatable pol II promoters to drive shRNA and Ago2. This should extend the application of RNAi to study gene function of intact brain circuits.

  11. The oxidative DNA glycosylases of Mycobacterium tuberculosis exhibit different substrate preferences from their Escherichia coli counterparts.

    Science.gov (United States)

    Guo, Yin; Bandaru, Viswanath; Jaruga, Pawel; Zhao, Xiaobei; Burrows, Cynthia J; Iwai, Shigenori; Dizdaroglu, Miral; Bond, Jeffrey P; Wallace, Susan S

    2010-02-04

    The DNA glycosylases that remove oxidized DNA bases fall into two general families: the Fpg/Nei family and the Nth superfamily. Based on protein sequence alignments, we identified four putative Fpg/Nei family members, as well as a putative Nth protein in Mycobacterium tuberculosis H37Rv. All four Fpg/Nei proteins were successfully overexpressed using a bicistronic vector created in our laboratory. The MtuNth protein was also overexpressed in soluble form. The substrate specificities of the purified enzymes were characterized in vitro with oligodeoxynucleotide substrates containing single lesions. Some were further characterized by gas chromatography/mass spectrometry (GC/MS) analysis of products released from gamma-irradiated DNA. MtuFpg1 has substrate specificity similar to that of EcoFpg. Both EcoFpg and MtuFpg1 are more efficient at removing spiroiminodihydantoin (Sp) than 7,8-dihydro-8-oxoguanine (8-oxoG). However, MtuFpg1 shows a substantially increased opposite base discrimination compared to EcoFpg. MtuFpg2 contains only the C-terminal domain of an Fpg protein and has no detectable DNA binding activity or DNA glycosylase/lyase activity and thus appears to be a pseudogene. MtuNei1 recognizes oxidized pyrimidines on both double-stranded and single-stranded DNA and exhibits uracil DNA glycosylase activity. MtuNth recognizes a variety of oxidized bases, including urea, 5,6-dihydrouracil (DHU), 5-hydroxyuracil (5-OHU), 5-hydroxycytosine (5-OHC) and methylhydantoin (MeHyd). Both MtuNei1 and MtuNth excise thymine glycol (Tg); however, MtuNei1 strongly prefers the (5R) isomers, whereas MtuNth recognizes only the (5S) isomers. MtuNei2 did not demonstrate activity in vitro as a recombinant protein, but like MtuNei1 when expressed in Escherichia coli, it decreased the spontaneous mutation frequency of both the fpg mutY nei triple and nei nth double mutants, suggesting that MtuNei2 is functionally active in vivo recognizing both guanine and cytosine oxidation products

  12. Molecular dynamics and binding selectivity of nucleotides and polynucleotide substrates with EIF2C2/Ago2 PAZ domain.

    Science.gov (United States)

    Kandeel, Mahmoud; Kitade, Yukio

    2018-02-01

    RNA interference (RNAi) constitutes a major target in drug discovery. Recently, we reported that the Argonaute protein 2 (Ago2) PAZ domain selectively binds with all ribonucleotides except adenine and poorly recognizes deoxyribonucleotides. The binding properties of the PAZ domain with polynucleotides and the molecular mechanisms of substrates' selectivity remains unclear. In this study, the binding potencies of polynucleotides and the associated conformational and dynamic changes in PAZ domain are investigated. Coinciding with nucleotides' binding profile with the PAZ domain, polyuridylate (PolyU) and polycytidylate (PolyC) were potent binders. However, K dPolyU and K dPolyC were 15.8 and 9.3μM, respectively. In contrast, polyadenylate (PolyA) binding was not detectable. Molecular dynamics (MD) simulation revealed the highest change in root mean square deviation (RMSD) with ApoPAZ or PAZ domain bound with experimentally approved, low affinity substrates, whereas stronger binding substrates such as UMP or PolyU showed minimal RMSD changes. The loop between α3 and β5 in the β-hairpin subdomain showed the most responsive change in RMSD, being highly movable in the ApoPAZ and PAZ-AMP complex. Favorable substrate recognition was associate with moderate change in secondary structure content. In conclusion, the PAZ domain retains differential substrate selectivity associated with corresponding dynamic and structural changes upon binding. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Effect of a Dual Charge on the DNA-Conjugated Redox Probe on DNA Sensing by Short Hairpin Beacons Tethered to Gold Electrodes.

    Science.gov (United States)

    Kékedy-Nagy, László; Shipovskov, Stepan; Ferapontova, Elena E

    2016-08-16

    Charges of redox species can critically affect both the interfacial state of DNA and electrochemistry of DNA-conjugated redox labels and, as a result, the electroanalytical performance of those systems. Here, we show that the kinetics of electron transfer (ET) between the gold electrode and methylene blue (MB) label conjugated to a double-stranded (ds) DNA tethered to gold strongly depend on the charge of the MB molecule, and that affects the performance of genosensors exploiting MB-labeled hairpin DNA beacons. Positively charged MB binds to dsDNA via electrostatic and intercalative/groove binding, and this binding allows the DNA-mediated electrochemistry of MB intercalated into the duplex and, as a result, a complex mode of the electrochemical signal change upon hairpin hybridization to the target DNA, dominated by the "on-off" signal change mode at nanomolar levels of the analyzed DNA. When MB bears an additional carboxylic group, the negative charge provided by this group prevents intimate interactions between MB and DNA, and then the ET in duplexes is limited by the diffusion of the MB-conjugated dsDNA (the phenomenon first shown in Farjami , E. ; Clima , L. ; Gothelf , K. ; Ferapontova , E. E. Anal. Chem. 2011 , 83 , 1594 ) providing the robust "off-on" nanomolar DNA sensing. Those results can be extended to other intercalating redox probes and are of strategic importance for design and development of electrochemical hybridization sensors exploiting DNA nanoswitchable architectures.

  14. A Conserved Target Site in HIV-1 Gag RNA is Accessible to Inhibition by Both an HDV Ribozyme and a Short Hairpin RNA

    Directory of Open Access Journals (Sweden)

    Robert J Scarborough

    2014-01-01

    Full Text Available Antisense-based molecules targeting HIV-1 RNA have the potential to be used as part of gene or drug therapy to treat HIV-1 infection. In this study, HIV-1 RNA was screened to identify more conserved and accessible target sites for ribozymes based on the hepatitis delta virus motif. Using a quantitative screen for effects on HIV-1 production, we identified a ribozyme targeting a highly conserved site in the Gag coding sequence with improved inhibitory potential compared to our previously described candidates targeting the overlapping Tat/Rev coding sequence. We also demonstrate that this target site is highly accessible to short hairpin directed RNA interference, suggesting that it may be available for the binding of antisense RNAs with different modes of action. We provide evidence that this target site is structurally conserved in diverse viral strains and that it is sufficiently different from the human transcriptome to limit off-target effects from antisense therapies. We also show that the modified hepatitis delta virus ribozyme is more sensitive to a mismatch in its target site compared to the short hairpin RNA. Overall, our results validate the potential of a new target site in HIV-1 RNA to be used for the development of antisense therapies.

  15. Short hairpin RNA targeting insulin-like growth factor binding protein-3 restores the bioavailability of insulin-like growth factor-1 in diabetic rats

    Directory of Open Access Journals (Sweden)

    Zhang-Yan Zhou

    2016-02-01

    Full Text Available ABSTRACT Purpose To investigate whether intracavernosal injection of short hairpin RNA for IGFBP-3 could improve erectile function in streptozotocin-induced diabetic rats. Materials and methods After 12 weeks of IGFBP-3 short hairpin RNA injection treatment, intracavernous pressure responses to electrical stimulation of cavernous nerves were evaluated. The expression of IGFBP-3 and IGF-1 at mRNA and protein levels were detected by quantitative real-time PCR analysis and Western blot, respectively. The concentration of cavernous cyclic guanosine monophosphate was detected by enzyme-linked immunosorbent assay. Results At 12 weeks after intracavernous administration of IGFBP-3 shRNA, the cavernosal pressure was significantly increased in response to the cavernous nerves stimulation compared to the diabetic group (P<0.05. Cavernous IGFBP-3 expression at both mRNA and protein levels was significantly inhibited. At the same time, cavernous IGF-1 expression was significantly increased in the IGFBP-3 shRNA treatment group compared to the diabetic group (P<0.01. Cavernous cyclic guanosine monophosphate concentration was significantly increased in the IGFBP-3 shRNA treatment group compared to the diabetic group (P<0.01. Conclusions Gene transfer of IGFBP-3 shRNA could improve erectile function via the restoration of cavernous IGF-1 bioavailability and an increase of cavernous cGMP concentration in the pathogenesis of erectile dysfunction in streptozotocin-induced diabetic rats.

  16. Effect of hairpin loop structure on reactivity, sequence preference and adduct orientation of a DNA-interactive pyrrolo[2,1-c][1,4]benzodiazepine (PBD) antitumour agent.

    Science.gov (United States)

    Thurston, David E; Vassoler, Higia; Jackson, Paul J M; James, Colin H; Rahman, Khondaker M

    2015-04-07

    The pyrrolobenzodiazepines (PBDs) are a family of covalent-binding DNA-interactive minor-groove binding agents with a thermodynamic preference for binding to 5'-Pu-G-Pu-3' sequences (Pu = Purine) but a kinetic preference for 5'-Py-G-Py-3' (Py = Pyrimidine). Using HPLC/MS methodology and a range of designed hairpin-forming oligonucleotides, the kinetics of reaction of a C8-bis-pyrrole pyrrolobenzodiazepine (PBD) conjugate (GWL-78, 2) with sixteen isomeric oligonucleotides has been evaluated, each containing a single PBD binding site in one of two locations. The PBD-binding base-pair triplets were designed to include every possible combination of A and T bases adjacent to the covalently-reacting guanine, with the set of hairpins consisting of isomeric pairs containing the same sequence in the hairpin stem but with either hexaethylene glycol (HEG) or TTT loops. The PBD 2 reacted most rapidly with TGT and TGA sequences, with the possibility that adducts might form in both the 3'- and 5'-directions with some sequences according to modelling studies. A faster reaction rate was observed for all hairpins containing the HEG loop except one (Seq 10) when the PBD binding triplets were located either near the loop or adjacent to the 5'-end. Modelling studies have suggested that this difference in reactivity could be due to the structural flexibility of the HEG loop allowing both A-ring-3' and A-ring-5' adducts to form, while a TTT loop should favour only A-ring-5' adducts due to steric considerations. These findings contrast with the results reported by Nguyen and Wilson for the interaction of non-covalent DNA-binding molecules with DNA hairpins, where the loop structure was found to have little effect on interaction in the main stem of the hairpin.

  17. PLZT capacitor on glass substrate

    Science.gov (United States)

    Fairchild, M. Ray; Taylor, Ralph S.; Berlin, Carl W.; Wong, Celine W. K.; Ma, Beihai; Balachandran, Uthamalingam

    2016-01-05

    A lead-lanthanum-zirconium-titanate (PLZT) capacitor on a substrate formed of glass. The first metallization layer is deposited on a top side of the substrate to form a first electrode. The dielectric layer of PLZT is deposited over the first metallization layer. The second metallization layer deposited over the dielectric layer to form a second electrode. The glass substrate is advantageous as glass is compatible with an annealing process used to form the capacitor.

  18. ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by Mismatch and Double-strand Break Repair DNA substrates

    Science.gov (United States)

    Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M.; Bianco, Piero R.; Surtees, Jennifer A.

    2014-01-01

    In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3′ non-homologous tail removal (3′NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3′ NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3′ NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3′ NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype. PMID:24746922

  19. Influence of intra-molecular flexibility on the elastic property of double-stranded DNA film on a substrate

    Science.gov (United States)

    Wu, Jun-Zheng; Meng, Wei-Lie; Tang, Heng-Song; Zhang, Neng-Hui

    2017-05-01

    DNA film self-assembled or nanografted on a substrate, as a kind of soft matter, consists of fixed DNA chains endowed with negative charges and an aqueous solution full of cations, anions and water molecules. Their thermal/electrical/mechanical properties are closely related to the complex biodetection signals in nano-/micro-scale biosensors and other new genome technologies. This makes it important to properly characterize these properties. In this paper, the effect of flexible micro-scale configurations on the elastic moduli of DNA films is investigated. First, illuminated by Qiu’s sphere model, an alternative bead-chain model in terms of the Yukawa potential is presented for flexible intra-DNA configurations to describe interactions between DNA fragments. The effective charges of coarse-grained DNA beads could be derived, in which the empirical parameters are identified by curve fitting with Qiu’s experimental data. Second, the updated mesoscopic bead-chain model and the thought experiment of a continuum compression bar are used to compare the elastic moduli of double-stranded DNA (dsDNA) films prepared by self-assembling and nanografting techniques. Configurational sampling is achieved via Monte Carlo simulation. Our predictions quantitatively or qualitatively agree well with the relevant experiments on the effective charge of dsDNA from low to moderate monovalent counterion concentration, immobilization deflection of single-stranded DNA (ssDNA) or dsDNA microcantilever with the variation of salt concentration, and elastic modulus of ssDNA film in the air. The results reveal that different solution environment stimulates the diverse mechanical properties of dsDNA film on a substrate, and the end effect (i.e. terminal group effect) makes self-assembling dsDNA film stiffer in the sense of the same average packing density.

  20. SERS substrate and a method of providing a SERS substrate

    DEFF Research Database (Denmark)

    2011-01-01

    Source: US2011116089A A substrate primarily for SERS determination, the substrate has a number of elongate elements with a density of at least 1x108 elongate elements per cm2 and having metal coated tips. When the elements may be made to lean toward each other, such as by providing a drop...

  1. Evidence for Substrate Influence on Artificial Substrate Invertebrate Communities.

    Science.gov (United States)

    Phillips, Iain D; Prestie, Kate S

    2017-08-01

    Cobble baskets are frequently used as a tool to measure differences in benthic macroinvertebrate communities between waterbodies; however, underlying differences in substrate type may influence the resultant colonization of baskets, misrepresenting communities. This study tests the hypothesis that cobble basket placement influences the resulting benthic macroinvertebrate community. Cobble basket arrays (n = 4) were deployed in Dog Lake, Saskatchewan, in 2011 (97 d) and 2012 (95 d) on cobble habitats and soft or sandy substrates ∼100 m apart. Baskets placed on cobble substrate had significantly higher Shannon-Weaver diversity relative to those placed on soft substrate in both years, and higher % EPT (Ephemeroptera Plecoptera Trichoptera) in 2011, but total density was not significantly different. Nonmetric multidimensional scaling revealed that the community was different between both treatments, characterized by higher densities of Gammarus lacustris Sars in baskets placed on soft sediment in both years, higher densities of Aeshna sp. and Mystacides sp. on cobble substrate in 2011, and higher densities of Helobdella stagnalis (L.) and Glossophinia complanata (L.) on cobble substrate in 2012. The results were consistent with the hypothesis that baskets placed on cobble substrate versus soft substrate will result in differing community colonization. The resulting recommendation for monitoring and assessment using cobble baskets in lakes is that baskets be placed on comparable substrate type when comparing between lakes, and that cobble beds be chosen as a more appropriate substrate for deployment, as the added habitat complexity of baskets on soft sediment may act as an attractant and not reflect the true community composition of that habitat. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  2. Proximity hybridization-regulated catalytic DNA hairpin assembly for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Fuyi [School of Chemistry and Chemical Engineering, Jiangsu Normal University, Xuzhou 221116 (China); Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Yao, Yao; Luo, Jianjun; Zhang, Xing; Zhang, Yu; Yin, Dengyang [Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Gao, Fenglei, E-mail: jsxzgfl@sina.com [Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Wang, Po, E-mail: wangpo@jsnu.edu.cn [School of Chemistry and Chemical Engineering, Jiangsu Normal University, Xuzhou 221116 (China)

    2017-05-29

    Novel hybridization proximity-regulated catalytic DNA hairpin assembly strategy has been proposed for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles as signal label. The DNA template-synthesized Pd nanoparticles were characterized with atomic force microscopic and X-ray photoelectron spectroscopy. The highly efficient electrocatalysis by DNA template synthesized Pd nanoparticles for NaBH{sub 4} oxidation produced an intense detection signal. The label-free electrochemical method achieved the detection of carcinoembryonic antigen (CEA) with a linear range from 10{sup −15} to 10{sup −11} g mL{sup −1} and a detection limit of 0.43 × 10{sup −15} g mL{sup −1}. Through introducing a supersandwich reaction to increase the DNA length, the electrochemical signal was further amplified, leading to a detection limit of 0.52 × 10{sup −16} g mL{sup −1}. And it rendered satisfactory analytical performance for the determination of CEA in serum samples. Furthermore, it exhibited good reproducibility and stability; meanwhile, it also showed excellent specificity due to the specific recognition of antigen by antibody. Therefore, the DNA template synthesized Pd nanoparticles based signal amplification approach has great potential in clinical applications and is also suitable for quantification of biomarkers at ultralow level. - Graphical abstract: A novel label-free and enzyme-free electrochemical immunoassay based on proximity hybridization-regulated catalytic DNA hairpin assemblies for recycling of the CEA. - Highlights: • A novel enzyme-free electrochemical immunosensor was developed for detection of CEA. • The signal amplification was based on catalytic DNA hairpin assembly and DNA-template-synthesized Pd nanoparticles. • The biosensor could detect CEA down to 0.52 × 10{sup −16} g mL{sup −1} level with a dynamic range spanning 5 orders of magnitude.

  3. Eroding dipoles and vorticity growth for Euler flows in {{{R}}}^{3}: the hairpin geometry as a model for finite-time blowup

    Science.gov (United States)

    Childress, Stephen; Gilbert, Andrew D.

    2018-02-01

    A theory of an eroding ‘hairpin’ vortex dipole structure in three-dimensions is developed, extending our previous study of an axisymmetric eroding dipole without swirl. The axisymmetric toroidal dipole was found to lead to maximal growth of vorticity, as {t}4/3. The hairpin is here similarly proposed as a model to produce large ‘self-stretching’ of vorticity, with the possibility of finite-time blow-up. We derive a system of partial differential equations of ‘generalized’ form, involving contour averaging of a locally two-dimensional Euler flow. We do not attempt here to solve the system exactly, but point out that non-existence of physically acceptable solutions would most probably be a result of the axial flow. Because of the axial flow the vorticity distribution within the dipole eddies is no longer of the simple Sadovskii type (vorticity constant over a cross-section) obtained in the axisymmetric problem. Thus the solution of the system depends upon the existence of a larger class of propagating two-dimensional dipoles. The hairpin model is obtained by formal asymptotic analysis. As in the axisymmetric problem a local transformation to ‘shrinking’ coordinates is introduced, but now in a self-similar form appropriate to the study of a possible finite-time singularity. We discuss some properties of the model, including a study of the helicity and a first step in iterating toward a solution from the Sadovskii structure. We also present examples of two-dimensional propagating dipoles not previously studied, which have a vorticity profile consistent with our model. Although no rigorous results can be given, and analysis of the system is only partial, the formal calculations are consistent with the possibility of a finite time blowup of vorticity at a point of vanishing circulation of the dipole eddies, but depending upon the existence of the necessary two-dimensional propagating dipole. Our results also suggest that conservation of kinetic energy as

  4. Droplet dynamics on patterned substrates

    Indian Academy of Sciences (India)

    ... on a substrate comprising hydrophobic and hydrophilic stripes can depend sensitively on the dynamical pathway by which the state is reached. We also consider a substrate covered with micron-scale posts and investigate how this can lead to superhydrophobic behaviour. Finally we model how a Namibian desert beetle ...

  5. Composite substrate for bipolar electrodes

    Science.gov (United States)

    Tekkanat, Bora; Bolstad, James J.

    1992-12-22

    Substrates for electrode systems, particularly those to be used for bipolar electrodes in zinc-bromine batteries, are disclosed. The substrates preferably include carbon-black as a conductive filler in a polymeric matrix, with reinforcing materials such as glass fibers. Warpage of the zinc-bromine electrodes which was experienced in the prior art and which was believed to be caused by physical expansion of the electrodes due to bromine absorption by the carbon-black, is substantially eliminated when new substrate fabrication techniques are employed. In the pesent invention, substrates are prepared using a lamination process known as glass mat reinforced thermoplastics technology or, in an alternate embodiment, the substrate is made using a slurry process.

  6. A Dual-Band Band-Pass Filter with Overlap Step-Impedance and Capacitively Loaded Hairpin Resonators for Wireless LAN Systems

    Directory of Open Access Journals (Sweden)

    P. Chomtong

    2011-01-01

    Full Text Available This paper presents a dual-band band-pass filter using modified cross-coupled step-impedance and capacitively loaded hairpin resonators for WLAN systems. The proposed filter has been designed to operate at a fundamental frequency of 2.4 GHz and the first harmonics frequency of 5.2 GHz. The techniques of step impedance and load capacitor are combined in the design of the proposed filter. In particular, the techniques of modified cross-coupling and overlap resonators are applied to improve the response of insertion losses 21 at the first harmonic frequency of 5.2 GHz. The simulated and experimental results of insertion losses and return losses are better than 3 dB and 20 dB, respectively, at the operating frequencies.

  7. Recombination analysis and structure prediction show correlation between breakpoint clusters and RNA hairpins in the pol gene of human immunodeficiency virus type 1 unique recombinant forms

    DEFF Research Database (Denmark)

    Galli, Andrea; Lai, Alessia; Corvasce, Stefano

    2008-01-01

    throughout the genome, leading to viral recombination. Some recombination hotspots have been identified and found to correlate with RNA structure or sequence features. The aim of this study was to evaluate the presence of recombination hotspots in the pol gene of HIV-1 and to assess their correlation......Recombination is recognized as a primary force in human immunodeficiency virus type 1 (HIV-1) evolution, increasing viral diversity through reshuffling of genomic portions. The strand-switching activity of reverse transcriptase is required to complete HIV-1 replication and can occur randomly...... with the underlying RNA structure. Analysis of the recombination pattern and breakpoint distribution in a group of unique recombinant forms (URFs) detected two recombination hotspots in the pol region. Two stable and conserved hairpins were consistently predicted corresponding to the identified hotspots using six...

  8. Disulfide-stabilized Helical Hairpin Structure and Activity of a Novel Antifungal Peptide EcAMP1 from Seeds of Barnyard Grass (Echinochloa crus-galli)*

    Science.gov (United States)

    Nolde, Svetlana B.; Vassilevski, Alexander A.; Rogozhin, Eugene A.; Barinov, Nikolay A.; Balashova, Tamara A.; Samsonova, Olga V.; Baranov, Yuri V.; Feofanov, Alexey V.; Egorov, Tsezi A.; Arseniev, Alexander S.; Grishin, Eugene V.

    2011-01-01

    This study presents purification, activity characterization, and 1H NMR study of the novel antifungal peptide EcAMP1 from kernels of barnyard grass Echinochloa crus-galli. The peptide adopts a disulfide-stabilized α-helical hairpin structure in aqueous solution and thus represents a novel fold among naturally occurring antimicrobial peptides. Micromolar concentrations of EcAMP1 were shown to inhibit growth of several fungal phytopathogens. Confocal microscopy revealed intensive EcAMP1 binding to the surface of fungal conidia followed by internalization and accumulation in the cytoplasm without disturbance of membrane integrity. Close spatial structure similarity between EcAMP1, the trypsin inhibitor VhTI from seeds of Veronica hederifolia, and some scorpion and cone snail toxins suggests natural elaboration of different functions on a common fold. PMID:21561864

  9. Disulfide-stabilized helical hairpin structure and activity of a novel antifungal peptide EcAMP1 from seeds of barnyard grass (Echinochloa crus-galli).

    Science.gov (United States)

    Nolde, Svetlana B; Vassilevski, Alexander A; Rogozhin, Eugene A; Barinov, Nikolay A; Balashova, Tamara A; Samsonova, Olga V; Baranov, Yuri V; Feofanov, Alexey V; Egorov, Tsezi A; Arseniev, Alexander S; Grishin, Eugene V

    2011-07-15

    This study presents purification, activity characterization, and (1)H NMR study of the novel antifungal peptide EcAMP1 from kernels of barnyard grass Echinochloa crus-galli. The peptide adopts a disulfide-stabilized α-helical hairpin structure in aqueous solution and thus represents a novel fold among naturally occurring antimicrobial peptides. Micromolar concentrations of EcAMP1 were shown to inhibit growth of several fungal phytopathogens. Confocal microscopy revealed intensive EcAMP1 binding to the surface of fungal conidia followed by internalization and accumulation in the cytoplasm without disturbance of membrane integrity. Close spatial structure similarity between EcAMP1, the trypsin inhibitor VhTI from seeds of Veronica hederifolia, and some scorpion and cone snail toxins suggests natural elaboration of different functions on a common fold.

  10. Adeno-Associated Viral Vector-Mediated mTOR Inhibition by Short Hairpin RNA Suppresses Laser-Induced Choroidal Neovascularization

    Directory of Open Access Journals (Sweden)

    Tae Kwann Park

    2017-09-01

    Full Text Available Choroidal neovascularization (CNV is the defining characteristic feature of the wet subtype of age-related macular degeneration (AMD and may result in irreversible blindness. Based on anti-vascular endothelial growth factor (anti-VEGF, the current therapeutic approaches to CNV are fraught with difficulties, and mammalian target of rapamycin (mTOR has recently been proposed as a possible therapeutic target, although few studies have been conducted. Here, we show that a recombinant adeno-associated virus-delivered mTOR-inhibiting short hairpin RNA (rAAV-mTOR shRNA, which blocks the activity of both mTOR complex 1 and 2, represents a promising therapeutic approach for the treatment of CNV. Eight-week-old male C57/B6 mice were treated with the short hairpin RNA (shRNA after generating CNV lesions in the eyes via laser photocoagulation. The recombinant adeno-associated virus (rAAV delivery vehicle was able to effectively transduce cells in the inner retina, and significantly fewer inflammatory cells and less extensive CNV were observed in the animals treated with rAAV-mTOR shRNA when compared with control- and rAAV-scrambled shRNA-treated groups. Presumably related to the reduction of CNV, increased autophagy was detected in CNV lesions treated with rAAV-mTOR shRNA, whereas significantly fewer apoptotic cells detected in the outer nuclear layer around the CNV indicate that mTOR inhibition may also have neuroprotective effects. Taken together, these results demonstrate the therapeutic potential of mTOR inhibition, resulting from rAAV-mTOR shRNA activity, in the treatment of AMD-related CNV. Keywords: retinal neovascularization, choroidal neovascularization, adeno-associated virus, mTOR, RNA interference, mTOR shRNA, autophagy

  11. Direct cooled power electronics substrate

    Science.gov (United States)

    Wiles, Randy H [Powell, TN; Wereszczak, Andrew A [Oak Ridge, TN; Ayers, Curtis W [Kingston, TN; Lowe, Kirk T [Knoxville, TN

    2010-09-14

    The disclosure describes directly cooling a three-dimensional, direct metallization (DM) layer in a power electronics device. To enable sufficient cooling, coolant flow channels are formed within the ceramic substrate. The direct metallization layer (typically copper) may be bonded to the ceramic substrate, and semiconductor chips (such as IGBT and diodes) may be soldered or sintered onto the direct metallization layer to form a power electronics module. Multiple modules may be attached to cooling headers that provide in-flow and out-flow of coolant through the channels in the ceramic substrate. The modules and cooling header assembly are preferably sized to fit inside the core of a toroidal shaped capacitor.

  12. Substrate noise coupling in RFICs

    CERN Document Server

    Helmy, Ahmed

    2008-01-01

    Substrate Noise Coupling in RFICs addresses substrate noise coupling in RF and mixed signal ICs when used in a system on chip (SoC) containing digital ICs as well. This trend of integrating RF, mixed signal ICs with large digital ICs is found in many of today's commercial ICs such as single chip Wi-Fi or Bluetooth solutions and is expected to grow rapidly in the future. The book reports modeling and simulation techniques for substrate noise coupling effects in RFICs and introduces isolation structures and design guides to mitigate such effects with the ultimate goal of enhancing the yield of R

  13. Coated substrate apparatus and method

    Energy Technology Data Exchange (ETDEWEB)

    Bao, Zhenan; Diao, Ying; Mannsfeld, Stefan Christian Bernhardt; Tee, Chee-Keong; Becerril-Garcia, Hector A.; Zhou, Yan

    2018-01-09

    A coated substrate is formed with aligned objects such as small molecules, macromolecules and nanoscale particulates, such as inorganic, organic or inorganic/organic hybrid materials. In accordance with one or more embodiments, an apparatus or method involves an applicator having at least one surface patterned with protruded or indented features, and a coated substrate including a solution-based layer of objects having features and morphology attributes arranged as a function of the protruded or indented features.

  14. Substrate channeling in proline metabolism

    Science.gov (United States)

    Arentson, Benjamin W.; Sanyal, Nikhilesh; Becker, Donald F.

    2012-01-01

    Proline metabolism is an important pathway that has relevance in several cellular functions such as redox balance, apoptosis, and cell survival. Results from different groups have indicated that substrate channeling of proline metabolic intermediates may be a critical mechanism. One intermediate is pyrroline-5-carboxylate (P5C), which upon hydrolysis opens to glutamic semialdehyde (GSA). Recent structural and kinetic evidence indicate substrate channeling of P5C/GSA occurs in the proline catabolic pathway between the proline dehydrogenase and P5C dehydrogenase active sites of bifunctional proline utilization A (PutA). Substrate channeling in PutA is proposed to facilitate the hydrolysis of P5C to GSA which is unfavorable at physiological pH. The second intermediate, gamma-glutamyl phosphate, is part of the proline biosynthetic pathway and is extremely labile. Substrate channeling of gamma-glutamyl phosphate is thought to be necessary to protect it from bulk solvent. Because of the unfavorable equilibrium of P5C/GSA and the reactivity of gamma-glutamyl phosphate, substrate channeling likely improves the efficiency of proline metabolism. Here, we outline general strategies for testing substrate channeling and review the evidence for channeling in proline metabolism. PMID:22201749

  15. Mapping protease substrates using a biotinylated phage substrate library.

    Energy Technology Data Exchange (ETDEWEB)

    Scholle, M. D.; Kriplani, U.; Pabon, A.; Sishtla, K.; Glucksman, M. J.; Kay, B. K.; Biosciences Division; Chicago Medical School

    2005-05-05

    We describe a bacteriophage M13 substrate library encoding the AviTag (BirA substrate) and combinatorial heptamer peptides displayed at the N terminus of the mature form of capsid protein III. Phages are biotinylated efficiently (> or = 50%) when grown in E. coli cells coexpressing BirA, and such viral particles can be immobilized on a streptavidin-coated support and released by protease cleavage within the combinatorial peptide. We have used this library to map the specificity of human Factor Xa and a neuropeptidase, neurolysin (EC3.4.24.16). Validation by analysis of isolated peptide substrates has revealed that neurolysin recognizes the motif hydrophobic-X-Pro-Arg-hydrophobic, where Arg-hydrophobic is the scissile bond.

  16. Metallization of Single-Stranded Polyl by Zn2+ Ions in Neutral Solutions

    Czech Academy of Sciences Publication Activity Database

    Sorokin, V. A.; Valeev, V. A.; Usenko, E. L.; Andrushchenko, Valery

    2014-01-01

    Roč. 118, č. 43 (2014), s. 12360-12365 ISSN 1520-6106 Institutional support: RVO:61388963 Keywords : nucleic acid metallization * zinc ion * differential UV spectroscopy Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.302, year: 2014

  17. Oligo(dT) is not a correct native PAGE marker for single-stranded DNA

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Kypr, Jaroslav; Vorlíčková, Michaela

    2007-01-01

    Roč. 353, č. 3 (2007), s. 776-779 ISSN 0006-291X R&D Projects: GA AV ČR(CZ) IAA4004201; GA AV ČR(CZ) IAA1004201 Institutional research plan: CEZ:AV0Z50040702 Keywords : polyacrylamide gel electrophoresis * DNA length markers * oligo(dT) Subject RIV: BO - Biophysics Impact factor: 2.749, year: 2007

  18. Determination of nanogram quantities of osmium-labeled single stranded DNA by differential pulse stripping voltammetry

    Czech Academy of Sciences Publication Activity Database

    Kizek, René; Havran, Luděk; Fojta, Miroslav; Paleček, Emil

    2002-01-01

    Roč. 55, 1/2 (2002), s. 199-121 ISSN 1567-5394 R&D Projects: GA ČR GV204/97/K084; GA ČR GA204/00/D049; GA AV ČR IAA4004108 Institutional research plan: CEZ:AV0Z5004920 Keywords : differential pulse stripping voltammetry * microdetermination of DNA * chemical modification of DNA Subject RIV: BO - Biophysics Impact factor: 1.463, year: 2002

  19. Single stranded loops of quadruplex DNA as key benchmark for testing nucleic acids force fields

    Czech Academy of Sciences Publication Activity Database

    Fadrná, E.; Špačková, Naďa; Sarzynska, J.; Koča, J.; Orozco, M.; Cheatham III, T.E.; Kulinski, T.; Šponer, Jiří

    2009-01-01

    Roč. 5, č. 9 (2009), s. 2514-2530 ISSN 1549-9618 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802 Grant - others:GA ČR(CZ) GA203/09/1476 Program:GA Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA quadruplex * MD simulation * force fields Subject RIV: BO - Biophysics Impact factor: 4.804, year: 2009

  20. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-01

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  1. Absorption by DNA single strands of adenine isolated in vacuo: The role of multiple chromophores

    DEFF Research Database (Denmark)

    Nielsen, L.M.; Pedersen, S.O.; Kirketerp, M.-B.S.

    2012-01-01

    to that for the adenine molecule and the dAMP mononucleotide. Desolvation has little effect on the bandwidth, which implies that inhomogenous broadening of the absorption bands in aqueous solution is of minor importance compared to, e.g., conformational disorder. Finally, at high photon energies, internal conversion...

  2. RADX interacts with single-stranded DNA to promote replication fork stability

    DEFF Research Database (Denmark)

    Schubert, Lisa; Ho, Teresa; Hoffmann, Saskia

    2017-01-01

    has an essential genome maintenance role, protecting ssDNA regions from nucleolytic degradation and providing a recruitment platform for proteins involved in responses to replication stress and DNA damage. Here, we identify the uncharacterized protein RADX (CXorf57) as an ssDNA-binding factor in human...... cells. RADX binds ssDNA via an N-terminal OB fold cluster, which mediates its recruitment to sites of replication stress. Deregulation of RADX expression and ssDNA binding leads to enhanced replication fork stalling and degradation, and we provide evidence that a balanced interplay between RADX and RPA...

  3. Heterochromatin Reorganization during Early Mouse Development Requires a Single-Stranded Noncoding Transcript

    Directory of Open Access Journals (Sweden)

    Miguel Casanova

    2013-09-01

    Full Text Available The equalization of pericentric heterochromatin from distinct parental origins following fertilization is essential for genome function and development. The recent implication of noncoding transcripts in this process raises questions regarding the connection between RNA and the nuclear organization of distinct chromatin environments. Our study addresses the interrelationship between replication and transcription of the two parental pericentric heterochromatin (PHC domains and their reorganization during early embryonic development. We demonstrate that the replication of PHC is dispensable for its clustering at the late two-cell stage. In contrast, using parthenogenetic embryos, we show that pericentric transcripts are essential for this reorganization independent of the chromatin marks associated with the PHC domains. Finally, our discovery that only reverse pericentric transcripts are required for both the nuclear reorganization of PHC and development beyond the two-cell stage challenges current views on heterochromatin organization.

  4. Role of Electrostatics in the assembly pathway of a single-stranded RNA virus

    NARCIS (Netherlands)

    Garmann, R.F.; Comas-Garcia, M.; Koay, M.S.T.; Cornelissen, Jeroen Johannes Lambertus Maria; Knobler, C.M.; Gelbart, W.M.

    2014-01-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318–3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of

  5. Comment on "Monomer Dynamics in Double- and Single-Stranded DNA Polymers"

    OpenAIRE

    Tothova, J.; Brutovsky, B.; Lisy, V.

    2005-01-01

    It is discussed that the kinetics observed by Shusterman et al. [Phys. Rev. Lett. 92, 048303] for long dsDNA is not the Rouse one and, in fact, the macromolecule behaves (approximately) as the Zimm polymer.

  6. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-04-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  7. Toxin MqsR Cleaves Single-Stranded mRNA with Various 5 Ends

    Science.gov (United States)

    2016-08-24

    decreases persisence about 2400- fold (Harrison et al. 2009). Another type II TA toxin, MazF, induces growth arrest that results in up to a 700- fold...Life Technologies, Waltham, MA). In brief, 25 pmol of RNA was first treated with 0.1 U of calf intestine alkaline phosphatase (CIP, 0.1 U/μL) for 1...MqsR/MqsA regulate toxin CspD. Environ. Microbiol. 12:1105–1121. Kwan, B. W., J. A. Valenta, M. J. Benedik, and T. K. Wood. 2013. Arrested protein

  8. Detection of short single-strand DNA homopolymers with ultrathin Si3N4 nanopores.

    Science.gov (United States)

    Ma, Jian; Qiu, Yinghua; Yuan, Zhishan; Zhang, Yin; Sha, Jingjie; Liu, Lei; Sun, Litao; Ni, Zhonghua; Yi, Hong; Li, Deyu; Chen, Yunfei

    2015-08-01

    A series of nanopores with diameters ranging from 2.5 to 63 nm are fabricated on a reduced Si3N4 membrane by focused ion beam and high energy electron beam. Through measuring the blocked ionic currents for DNA strands threading linearly through those solid-state nanopores, it is found that the blockade ionic current is proportional to the square of the hydrodynamic diameter of the DNA strand. With the nanopore diameter reduced to be comparable with that of DNA strands, the hydrodynamic diameter of the DNA becomes smaller, which is attributed to the size confinement effects. The duration time for the linear DNA translocation events increases monotonically with the nanopore length. By comparing the spatial configurations of DNA strands through nanopores with different diameters, it is found that the nanopore with large diameter has enough space to allow the DNA strand to translocate through with complex conformation. With the decrease of the nanopore diameter, the folded part of the DNA is prone to be straightened by the nanopore, which leads to the increase in the occurrence frequency of the linear DNA translocation events. Reducing the diameter of the nanopore to 2.5 nm allows the detection and discrimination of three nucleotide "G" and three nucleotide "T" homopolymer DNA strands based on differences in their physical dimensions.

  9. Differentiation of Short Single-Stranded DNA Homopolymers in Solid-State Nanopores

    Science.gov (United States)

    Venta, Kimberly; Shemer, Gabriel; Puster, Matthew; Rodríguez-Manzo, Julio A.; Balan, Adrian; Rosenstein, Jacob K.; Shepard, Ken; Drndić, Marija

    2013-01-01

    In the last two decades, new techniques that monitor ionic current modulations as single molecules pass through a nanoscale pore have enabled numerous single-molecule studies. While biological nanopores have recently shown the ability to resolve single nucleotides within individual DNA molecules, similar developments with solid-state nanopores have lagged, due to challenges both in fabricating stable nanopores of similar dimensions as biological nanopores and in achieving sufficiently low-noise and high-bandwidth recordings. Here we show that small silicon nitride nanopores (0.8 to 2-nm-diameter in 5 to 8-nm-thick membranes) can resolve differences between ionic current signals produced by short (30 base) ssDNA homopolymers (poly(dA), poly(dC), poly(dT)), when combined with measurement electronics that allow a signal-to-noise ratio of better than 10 to be achieved at 1 MHz bandwidth. While identifying intramolecular DNA sequences with silicon nitride nanopores will require further improvements in nanopore sensitivity and noise levels, homopolymer differentiation represents an important milestone in the development of solid-state nanopores. PMID:23621759

  10. Source-based nomenclature for single-strand homopolymers and copolymers (IUPAC Recommendations 2016)

    Czech Academy of Sciences Publication Activity Database

    Jones, R. G.; Kitayama, T.; Hellwich, K. H.; Hess, M.; Jenkins, A. D.; Kahovec, Jaroslav; Kratochvíl, Pavel; Mita, I.; Mormann, W.; Ober, C. K.; Penczek, S.; Stepto, R. F. T.; Thurlow, K.; Vohlídal, J.; Wilks, E. S.

    2016-01-01

    Roč. 88, 10-11 (2016), s. 1073-1100 ISSN 0033-4545 Institutional support: RVO:61389013 Keywords : apparent monomer * copolymer * end-groups Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.626, year: 2016

  11. Theoretical Study of the Transpore Velocity Control of Single-Stranded DNA

    Directory of Open Access Journals (Sweden)

    Weixin Qian

    2014-08-01

    Full Text Available The electrokinetic transport dynamics of deoxyribonucleic acid (DNA molecules have recently attracted significant attention in various fields of research. Our group is interested in the detailed examination of the behavior of DNA when confined in micro/nanofluidic channels. In the present study, the translocation mechanism of a DNA-like polymer chain in a nanofluidic channel was investigated using Langevin dynamics simulations. A coarse-grained bead-spring model was developed to simulate the dynamics of a long polymer chain passing through a rectangular cross-section nanopore embedded in a nanochannel, under the influence of a nonuniform electric field. Varying the cross-sectional area of the nanopore was found to allow optimization of the translocation process through modification of the electric field in the flow channel, since a drastic drop in the electric potential at the nanopore was induced by changing the cross-section. Furthermore, the configuration of the polymer chain in the nanopore was observed to determine its translocation velocity. The competition between the strength of the electric field and confinement in the small pore produces various transport mechanisms and the results of this study thus represent a means of optimizing the design of nanofluidic devices for single molecule detection.

  12. Mismatched single stranded antisense oligonucleotides can induce efficient dystrophin splice switching

    Directory of Open Access Journals (Sweden)

    Kole Ryszard

    2011-10-01

    Full Text Available Abstract Background Antisense oligomer induced exon skipping aims to reduce the severity of Duchenne muscular dystrophy by redirecting splicing during pre-RNA processing such that the causative mutation is by-passed and a shorter but partially functional Becker muscular dystrophy-like dystrophin isoform is produced. Normal exons are generally targeted to restore the dystrophin reading frame however, an appreciable subset of dystrophin mutations are intra-exonic and therefore have the potential to compromise oligomer efficiency, necessitating personalised oligomer design for some patients. Although antisense oligomers are easily personalised, it remains unclear whether all patient polymorphisms within antisense oligomer target sequences will require the costly process of producing and validating patient specific compounds. Methods Here we report preclinical testing of a panel of splice switching antisense oligomers, designed to excise exon 25 from the dystrophin transcript, in normal and dystrophic patient cells. These patient cells harbour a single base insertion in exon 25 that lies within the target sequence of an oligomer shown to be effective at removing exon 25. Results It was anticipated that such a mutation would compromise oligomer binding and efficiency. However, we show that, despite the mismatch an oligomer, designed and optimised to excise exon 25 from the normal dystrophin mRNA, removes the mutated exon 25 more efficiently than the mutation-specific oligomer. Conclusion This raises the possibility that mismatched AOs could still be therapeutically applicable in some cases, negating the necessity to produce patient-specific compounds.

  13. Telomerase suppresses formation of ALT-associated single-stranded telomeric C-circles.

    Science.gov (United States)

    Plantinga, Matthew J; Pascarelli, Kara M; Merkel, Anna S; Lazar, Alexander J; von Mehren, Margaret; Lev, Dina; Broccoli, Dominique

    2013-06-01

    Telomere maintenance is an essential characteristic of cancer cells, most commonly achieved by activation of telomerase. Telomeres can also be maintained by a recombination-based mechanism, alternative lengthening of telomeres (ALT). Cells using ALT are characterized by the presence of ALT-associated promyelocytic leukemia (PML) bodies (APB), long, heterogeneously sized telomeres, extrachromosomal telomeric circular DNA, and elevated telomeric recombination. Consistent with other reports, we found that liposarcomas containing APBs, but lacking telomerase expression, always contained C-rich circles (C-circles), and these C-circles were never present in the absence of APBs, indicating a tight link between these features in ALT cells. However, a rare subgroup of tumors showing evidence of telomere maintenance by both telomerase and ALT did not contain C-circles. To test the hypothesis that telomerase expression disrupts the tight link between APBs and C-circles, we used ALT cell lines that were engineered to express telomerase. Introduction of telomerase activity in these ALT cells resulted in, on average, shorter telomeres with retention of APBs. However, at high passage, the level of C-circles was significantly reduced, which was paralleled by a switch from C-strand overhangs to G-strand overhangs. We propose that by extending critically short telomeres in these cells, telomerase is disrupting a key step in the ALT pathway necessary for production and/or maintenance of C-circles. ©2013 AACR.

  14. Electric light scattering from single-stranded DNA in linear polyacrylamide solutions.

    Science.gov (United States)

    Todorov, R; Starchev, K; Stoylov, S P

    2001-01-01

    The electric light scattering (ELS) of ssDNA (calf thymus, 10 kbp, 55 micrograms/mL) in denaturing polyacrylamide (PAA) solutions was studied as a function of applied sinusoidal electric field and polymer concentration. Electric fields of strengths up to 300 V/cm and of frequencies between 100 and 5000 Hz were applied. It was found that the ELS effect increases with the field strength and decreases at high frequencies. The dependence of the ELS effect of ssDNA on polymer concentration passes through a maximum at 1% PAA. The relaxation times of decay of the ELS effect increase with increasing polymer concentrations. It was demonstrated that ELS is a useful method for investigation of ssDNA behavior in the course of pulse-field electrophoresis in polymer solutions.

  15. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin.

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-13

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecule, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G • U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G • U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  16. Therapeutic Effect of Novel Single-Stranded RNAi Agent Targeting Periostin in Eyes with Retinal Neovascularization

    Directory of Open Access Journals (Sweden)

    Takahito Nakama

    2017-03-01

    Full Text Available Retinal neovascularization (NV due to retinal ischemia remains one of the principal causes of vision impairment in patients with ischemic retinal diseases. We recently reported that periostin (POSTN may play a role in the development of preretinal fibrovascular membranes, but its role in retinal NV has not been determined. The purpose of this study was to examine the expression of POSTN in the ischemic retinas of a mouse model of oxygen-induced retinal NV. We also studied the function of POSTN on retinal NV using Postn KO mice and human retinal endothelial cells (HRECs in culture. In addition, we used a novel RNAi agent, NK0144, which targets POSTN to determine its effect on the development of retinal NV. Our results showed that the expression of POSTN was increased in the vascular endothelial cells, pericytes, and M2 macrophages in ischemic retinas. POSTN promoted the ischemia-induced retinal NV by Akt phosphorylation through integrin αvβ3. NK0144 had a greater inhibitory effect than canonical double-stranded siRNA on preretinal pathological NV in vivo and in vitro. These findings suggest a causal relationship between POSTN and retinal NV, and indicate a potential therapeutic role of intravitreal injection of NK0144 for retinal neovascular diseases.

  17. Expansion during PCR of short single-stranded DNA fragments carrying nonselfcomplementary dinucleotide or trinucleotide repeats

    Czech Academy of Sciences Publication Activity Database

    Reichová, Naďa; Kypr, Jaroslav

    2003-01-01

    Roč. 30, č. 3 (2003), s. 155-163 ISSN 0301-4851 R&D Projects: GA ČR GA301/01/0590 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA * PCR * expansion Subject RIV: BO - Biophysics Impact factor: 0.565, year: 2003

  18. Double-stranded DNA dissociates into single strands when dragged into a poor solvent.

    Science.gov (United States)

    Cui, Shuxun; Yu, Jin; Kühner, Ferdinand; Schulten, Klaus; Gaub, Hermann E

    2007-11-28

    DNA displays a richness of biologically relevant supramolecular structures, which depend on both sequence and ambient conditions. The effect of dragging double-stranded DNA (dsDNA) from water into poor solvent on the double-stranded structure is still unclear because of condensation. Here, we employed single molecule techniques based on atomic force microscopy and molecular dynamics (MD) simulations to investigate the change in structure and mechanics of DNA during the ambient change. We found that the two strands are split apart when the dsDNA is pulled at one strand from water into a poor solvent. The findings were corroborated by MD simulations where dsDNA was dragged from water into poor solvent, revealing details of the strand separation at the water/poor solvent interface. Because the structure of DNA is of high polarity, all poor solvents show a relatively low polarity. We speculate that the principle of spontaneous unwinding/splitting of dsDNA by providing a low-polarity (in other word, hydrophobic) micro-environment is exploited as one of the catalysis mechanisms of helicases.

  19. Genomic analysis of Pseudomonas putida phage tf with localized single-strand DNA interruptions.

    Directory of Open Access Journals (Sweden)

    Anatoly S Glukhov

    Full Text Available The complete sequence of the 46,267 bp genome of the lytic bacteriophage tf specific to Pseudomonas putida PpG1 has been determined. The phage genome has two sets of convergently transcribed genes and 186 bp long direct terminal repeats. The overall genomic architecture of the tf phage is similar to that of the previously described Pseudomonas aeruginosa phages PaP3, LUZ24 and phiMR299-2, and 39 out of the 72 products of predicted tf open reading frames have orthologs in these phages. Accordingly, tf was classified as belonging to the LUZ24-like bacteriophage group. However, taking into account very low homology levels between tf DNA and that of the other phages, tf should be considered as an evolutionary divergent member of the group. Two distinguishing features not reported for other members of the group were found in the tf genome. Firstly, a unique end structure--a blunt right end and a 4-nucleotide 3'-protruding left end--was observed. Secondly, 14 single-chain interruptions (nicks were found in the top strand of the tf DNA. All nicks were mapped within a consensus sequence 5'-TACT/RTGMC-3'. Two nicks were analyzed in detail and were shown to be present in more than 90% of the phage population. Although localized nicks were previously found only in the DNA of T5-like and phiKMV-like phages, it seems increasingly likely that this enigmatic structural feature is common to various other bacteriophages.

  20. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-02-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  1. Ion Density Analysis of Single-Stranded DNA in Liquid Crystal

    Science.gov (United States)

    Iwabata, Kazuki; Seki, Yasutaka; Toizumi, Ryota; Shimada, Yuki; Furue, Hirokazu; Sakaguchi, Kengo

    2013-09-01

    With the widespread use of liquid crystals (LCs) in liquid crystal displays, we have looked into the application of liquid crystals in biotechnology. The purpose of the study described here is to investigate the physical properties of DNA using LCs. Synthetic oligonucleotide molecules were dispersed in MLC6884, the sample injected into antiparallel cells, and the amount of mobile ions was measured. The LC cell doped with oligonucleotide molecules showed a sequence-dependent, specific correlation between oligonucleotide concentration and the amount of mobile ions in the LC cells. In the framework of the Stokes model and polyacrylamide gel electrophoresis (PAGE) analysis, we speculate that this result arises from the difference in ion mobility, which is caused by the shape of the oligonucleotide molecule in the LC.

  2. A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B.

    Directory of Open Access Journals (Sweden)

    Jeffrey A DeGrasse

    Full Text Available The bacterium Staphylococcus aureus is a common foodborne pathogen capable of secreting a cocktail of small, stable, and strain-specific, staphylococcal enterotoxins (SEs. Staphylococcal food poisoning (SFP results when improperly handled food contaminated with SEs is consumed. Gastrointestinal symptoms of SFP include emesis, diarrhea and severe abdominal pain, which manifest within hours of ingesting contaminated food. Immuno-affinity based methods directly detect, identify, and quantify several SEs within a food or clinical sample. However, the success of these assays depends upon the availability of a monoclonal antibody, the development of which is non-trivial and costly. The current scope of the available immuno-affinity based methods is limited to the classical SEs and does not encompass all of the known or emergent SEs. In contrast to antibodies, aptamers are short nucleic acids that exhibit high affinity and specificity for their targets without the high-costs and ethical concerns of animal husbandry. Further, researchers may choose to freely distribute aptamers and develop assays without the proprietary issues that increase the per-sample cost of immuno-affinity assays. This study describes a novel aptamer, selected in vitro, with affinity to staphylococcal enterotoxin B (SEB that may be used in lieu of antibodies in SE detection assays. The aptamer, designated APT(SEB1, successfully isolates SEB from a complex mixture of SEs with extremely high discrimination. This work sets the foundation for future aptamer and assay development towards the entire family of SEs. The rapid, robust, and low-cost identification and quantification of all of the SEs in S. aureus contaminated food is essential for food safety and epidemiological efforts. An in vitro generated library of SE aptamers could potentially allow for the comprehensive and cost-effective analysis of food samples that immuno-affinity assays currently cannot provide.

  3. Substrate curvature regulates cell migration.

    Science.gov (United States)

    He, Xiuxiu; Jiang, Yi

    2017-05-23

    Cell migration is essential in many aspects of biology. Many basic migration processes, including adhesion, membrane protrusion and tension, cytoskeletal polymerization, and contraction, have to act in concert to regulate cell migration. At the same time, substrate topography modulates these processes. In this work, we study how substrate curvature at micrometer scale regulates cell motility. We have developed a 3D mechanical model of single cell migration and simulated migration on curved substrates with different curvatures. The simulation results show that cell migration is more persistent on concave surfaces than on convex surfaces. We have further calculated analytically the cell shape and protrusion force for cells on curved substrates. We have shown that while cells spread out more on convex surfaces than on concave ones, the protrusion force magnitude in the direction of migration is larger on concave surfaces than on convex ones. These results offer a novel biomechanical explanation to substrate curvature regulation of cell migration: geometric constrains bias the direction of the protrusion force and facilitates persistent migration on concave surfaces.

  4. Expression of self-complementary hairpin RNA under the control of the rolC promoter confers systemic disease resistance to plum pox virus without preventing local infection.

    Science.gov (United States)

    Pandolfini, Tiziana; Molesini, Barbara; Avesani, Linda; Spena, Angelo; Polverari, Annalisa

    2003-06-25

    Homology-dependent selective degradation of RNA, or post-transcriptional gene silencing (PTGS), is involved in several biological phenomena, including adaptative defense mechanisms against plant viruses. Small interfering RNAs mediate the selective degradation of target RNA by guiding a multicomponent RNAse. Expression of self-complementary hairpin RNAs within two complementary regions separated by an intron elicits PTGS with high efficiency. Plum pox virus (PPV) is the etiological agent of sharka disease in Drupaceae, although it can also be transmitted to herbaceous species (e.g. Nicotiana benthamiana). Once inside the plant, PPV is transmitted via plasmodesmata from cell to cell, and at longer distances, via phloem. The rolC promoter drives expression in phloem cells. RolC expression is absent in both epidermal and mesophyll cells. The aim of the present study was to confer systemic disease resistance without preventing local viral infection. In the ihprolC-PP197 gene (intron hair pin rolC PPV 197), a 197 bp sequence homologous to the PPV RNA genome (from base 134 to 330) was placed as two inverted repeats separated by the DNA sequence of the rolA intron. This hairpin construct is under the control of the rolC promoter.N. benthamiana plants transgenic for the ihprolC-PP197 gene contain siRNAs homologous to the 197 bp sequence. The transgenic progeny of ihprolC-PP197 plants are resistant to PPV systemic infection. Local infection is unaffected. Most (80%) transgenic plants are virus free and symptomless. Some plants (20%) contain virus in uninoculated apical leaves; however they show only mild symptoms of leaf mottling. PPV systemic resistance cosegregates with the ihprolC-PP197 transgene and was observed in progeny plants of all independent transgenic lines analyzed. SiRNAs of 23-25 nt homologous to the PPV sequence used in the ihprolC-PP197 construct were detected in transgenic plants before and after inoculation. Transitivity of siRNAs was observed in

  5. Expression of self-complementary hairpin RNA under the control of the rolC promoter confers systemic disease resistance to plum pox virus without preventing local infection

    Directory of Open Access Journals (Sweden)

    Spena Angelo

    2003-06-01

    Full Text Available Abstract Background Homology-dependent selective degradation of RNA, or post-transcriptional gene silencing (PTGS, is involved in several biological phenomena, including adaptative defense mechanisms against plant viruses. Small interfering RNAs mediate the selective degradation of target RNA by guiding a multicomponent RNAse. Expression of self-complementary hairpin RNAs within two complementary regions separated by an intron elicits PTGS with high efficiency. Plum pox virus (PPV is the etiological agent of sharka disease in Drupaceae, although it can also be transmitted to herbaceous species (e.g. Nicotiana benthamiana. Once inside the plant, PPV is transmitted via plasmodesmata from cell to cell, and at longer distances, via phloem. The rolC promoter drives expression in phloem cells. RolC expression is absent in both epidermal and mesophyll cells. The aim of the present study was to confer systemic disease resistance without preventing local viral infection. Results In the ihprolC-PP197 gene (intron hair pin rolC PPV 197, a 197 bp sequence homologous to the PPV RNA genome (from base 134 to 330 was placed as two inverted repeats separated by the DNA sequence of the rolA intron. This hairpin construct is under the control of the rolC promoter.N. benthamiana plants transgenic for the ihprolC-PP197 gene contain siRNAs homologous to the 197 bp sequence. The transgenic progeny of ihprolC-PP197 plants are resistant to PPV systemic infection. Local infection is unaffected. Most (80% transgenic plants are virus free and symptomless. Some plants (20% contain virus in uninoculated apical leaves; however they show only mild symptoms of leaf mottling. PPV systemic resistance cosegregates with the ihprolC-PP197 transgene and was observed in progeny plants of all independent transgenic lines analyzed. SiRNAs of 23–25 nt homologous to the PPV sequence used in the ihprolC-PP197 construct were detected in transgenic plants before and after inoculation

  6. Porous substrates filled with nanomaterials

    Science.gov (United States)

    Worsley, Marcus A.; Baumann, Theodore F.; Satcher, Jr., Joe H.; Stadermann, Michael

    2014-08-19

    A composition comprising: at least one porous carbon monolith, such as a carbon aerogel, comprising internal pores, and at least one nanomaterial, such as carbon nanotubes, disposed uniformly throughout the internal pores. The nanomaterial can be disposed in the middle of the monolith. In addition, a method for making a monolithic solid with both high surface area and good bulk electrical conductivity is provided. A porous substrate having a thickness of 100 microns or more and comprising macropores throughout its thickness is prepared. At least one catalyst is deposited inside the porous substrate. Subsequently, chemical vapor deposition is used to uniformly deposit a nanomaterial in the macropores throughout the thickness of the porous substrate. Applications include electrical energy storage, such as batteries and capacitors, and hydrogen storage.

  7. Methods of etching a substrate

    International Nuclear Information System (INIS)

    Cosmo, J.J.; Gambino, R.J.; Harper, J.M.E.

    1979-01-01

    The invention relates to a method of etching a substrate. The substrate is located opposite a target electrode in a vacuum chamber, and the surface of the target electrode is bombarded with energetic particles of atomic dimensions. The target electrode is an intermetallic composition (compound, alloy or finely divided homogeneous mixture) of two metals A and B such that upon bombardment the electrode emits negative ions of metal B which have sufficient energy to produce etching of the substrate. Many target materials are exemplified. Typically the metal A has an electronegativity XA and metal B has an electronegativity XB such that Xb - Xa is greater than about 2.55 electron volts, with the exception of combinations of metals having a fractional ionicity Q less than about 0.314. The source of the energetic particles may be an ionised gas in the vacuum chamber. The apparatus and its mode of operation are described in detail. (U.K.)

  8. Porous substrates filled with nanomaterials

    Energy Technology Data Exchange (ETDEWEB)

    Worsley, Marcus A.; Baumann, Theodore F.; Satcher, Jr., Joe H.; Stadermann, Michael

    2018-04-03

    A composition comprising: at least one porous carbon monolith, such as a carbon aerogel, comprising internal pores, and at least one nanomaterial, such as carbon nanotubes, disposed uniformly throughout the internal pores. The nanomaterial can be disposed in the middle of the monolith. In addition, a method for making a monolithic solid with both high surface area and good bulk electrical conductivity is provided. A porous substrate having a thickness of 100 microns or more and comprising macropores throughout its thickness is prepared. At least one catalyst is deposited inside the porous substrate. Subsequently, chemical vapor deposition is used to uniformly deposit a nanomaterial in the macropores throughout the thickness of the porous substrate. Applications include electrical energy storage, such as batteries and capacitors, and hydrogen storage.

  9. Substrate mediated enzyme prodrug therapy

    DEFF Research Database (Denmark)

    Fejerskov, Betina; Jarlstad Olesen, Morten T; Zelikin, Alexander N

    2017-01-01

    Substrate mediated enzyme prodrug therapy (SMEPT) is a biomedical platform developed to perform a localized synthesis of drugs mediated by implantable biomaterials. This approach combines the benefits and at the same time offers to overcome the drawbacks for traditional pill-based drug administra......Substrate mediated enzyme prodrug therapy (SMEPT) is a biomedical platform developed to perform a localized synthesis of drugs mediated by implantable biomaterials. This approach combines the benefits and at the same time offers to overcome the drawbacks for traditional pill-based drug...

  10. Crystal Structure of the Full-Length Feline Immunodeficiency Virus Capsid Protein Shows an N-Terminal β-Hairpin in the Absence of N-Terminal Proline

    Directory of Open Access Journals (Sweden)

    Christelle Folio

    2017-11-01

    Full Text Available Feline immunodeficiency virus (FIV is a member of the Retroviridae family. It is the causative agent of an acquired immunodeficiency syndrome (AIDS in cats and wild felines. Its capsid protein (CA drives the assembly of the viral particle, which is a critical step in the viral replication cycle. Here, the first atomic structure of full-length FIV CA to 1.67 Å resolution is determined. The crystallized protein exhibits an original tetrameric assembly, composed of dimers which are stabilized by an intermolecular disulfide bridge induced by the crystallogenesis conditions. The FIV CA displays a standard α-helical CA topology with two domains, separated by a linker shorter than other retroviral CAs. The β-hairpin motif at its amino terminal end, which interacts with nucleotides in HIV-1, is unusually long in FIV CA. Interestingly, this functional β-motif is formed in this construct in the absence of the conserved N-terminal proline. The FIV CA exhibits a cis Arg–Pro bond in the CypA-binding loop, which is absent in known structures of lentiviral CAs. This structure represents the first tri-dimensional structure of a functional, full-length FIV CA.

  11. In vitro inhibition of transmissible gastroenteritis coronavirus replication in swine testicular cells by short hairpin RNAs targeting the ORF 7 gene.

    Science.gov (United States)

    He, Lei; Zhang, Yan-ming; Dong, Ling-juan; Cheng, Min; Wang, Jing; Tang, Qing-hai; Wang, Gang

    2012-08-28

    Transmissible gastroenteritis (TGE) is a highly contagious viral disease of swine, characterized by severe vomiting, diarrhea, and high mortality. Currently, the vaccines for it are only partially effective and no specific drug is available for treatment of TGE virus (TGEV) infection. RNA interference has been confirmed as a new approach for controlling viral infections. In this study, the inhibitory effect of short hairpin RNAs (shRNAs) targeting the ORF 7 gene of TGEV on virus replication was examined. Four theoretically effective sequences of TGEV ORF 7 gene were designed and selected for construction of shRNA expression plasmids. In the reporter assays, three of four shRNA expression plasmids were able to inhibit significantly the expression of ORF 7 gene and replication of TGEV, as shown by real-time quantitative RT-PCR analysis of viral ORF 7 and N genes and detection of virus titers (TCID50/ml). Stable swine testicular (ST) cells expressing the shRNAs were established. Observation of the cytopathic effect and apoptosis, as well as a cell proliferation assay demonstrated that the three shRNAs were capable of protecting ST cells against TGEV destruction, with high specificity and efficiency. Our results indicated that plasmid-transcribed shRNAs targeting the ORF 7 gene in the TGEV genome effectively inhibited expression of the viral target gene and viral replication in vitro. These findings provide evidence that the shRNAs have potential therapeutic application for treatment of TGE.

  12. In vitro inhibition of transmissible gastroenteritis coronavirus replication in swine testicular cells by short hairpin RNAs targeting the ORF 7 gene

    Directory of Open Access Journals (Sweden)

    He Lei

    2012-08-01

    Full Text Available Abstract Background Transmissible gastroenteritis (TGE is a highly contagious viral disease of swine, characterized by severe vomiting, diarrhea, and high mortality. Currently, the vaccines for it are only partially effective and no specific drug is available for treatment of TGE virus (TGEV infection. RNA interference has been confirmed as a new approach for controlling viral infections. In this study, the inhibitory effect of short hairpin RNAs (shRNAs targeting the ORF 7 gene of TGEV on virus replication was examined. Results Four theoretically effective sequences of TGEV ORF 7 gene were designed and selected for construction of shRNA expression plasmids. In the reporter assays, three of four shRNA expression plasmids were able to inhibit significantly the expression of ORF 7 gene and replication of TGEV, as shown by real-time quantitative RT-PCR analysis of viral ORF 7 and N genes and detection of virus titers (TCID50/ml. Stable swine testicular (ST cells expressing the shRNAs were established. Observation of the cytopathic effect and apoptosis, as well as a cell proliferation assay demonstrated that the three shRNAs were capable of protecting ST cells against TGEV destruction, with high specificity and efficiency. Conclusions Our results indicated that plasmid-transcribed shRNAs targeting the ORF 7 gene in the TGEV genome effectively inhibited expression of the viral target gene and viral replication in vitro. These findings provide evidence that the shRNAs have potential therapeutic application for treatment of TGE.

  13. High-throughput sequencing as an effective approach in profiling small RNAs derived from a hairpin RNA expression vector in woody plants.

    Science.gov (United States)

    Zhao, Dongyan; Song, Guo-Qing

    2014-11-01

    Hairpin RNA (hpRNA)-mediated gene silencing has proved to be an efficient approach to develop virus-resistant transgenic plants. To characterize small RNA molecules (sRNAs) derived from an hpRNA expression vector in transgenic cherry rootstock plants, we conducted small RNA sequencing of (1) a transgenic rootstock containing an inverted repeat of the partial coat protein of Prunus necrotic ring spot virus (PNRSV-hpRNA); (2) a nontransgenic rootstock; and (3) a PNRSV-infected sweet cherry plant. Analysis of the PNRSV sRNA pools indicated that 24-nt (nucleotide) small interfering RNAs (siRNAs) were the most prevalent sRNAs in the transgenic rootstock whereas the most abundant sRNAs in the PNRSV-infected nontransgenic rootstock were 21-nt siRNAs. In addition, the 24-nt siRNAs of the PNRSV-hpRNA were more abundant on the sense strand than those on the antisense strand in the transgenic rootstock. In contrast, preference in generating PNRSV sRNAs, ranging from 19-nt to 30-nt for sense and antisense strands, was not distinct in the PNRSV-infected nontransgenic sweet cherry. Taken together, this is the first report on profiling hpRNA-derived sRNAs in woody plants using high-throughput sequencing technology, which is an efficient way to verify the presence/absence, the abundance, and the sequence features of certain sRNAs. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  14. Preclinical safety and efficacy of an anti–HIV-1 lentiviral vector containing a short hairpin RNA to CCR5 and the C46 fusion inhibitor

    Directory of Open Access Journals (Sweden)

    Orit Wolstein

    2014-01-01

    Full Text Available Gene transfer has therapeutic potential for treating HIV-1 infection by generating cells that are resistant to the virus. We have engineered a novel self-inactivating lentiviral vector, LVsh5/C46, using two viral-entry inhibitors to block early steps of HIV-1 cycle. The LVsh5/C46 vector encodes a short hairpin RNA (shRNA for downregulation of CCR5, in combination with the HIV-1 fusion inhibitor, C46. We demonstrate here the effective delivery of LVsh5/C46 to human T cell lines, peripheral blood mononuclear cells, primary CD4+ T lymphocytes, and CD34+ hematopoietic stem/progenitor cells (HSPC. CCR5-targeted shRNA (sh5 and C46 peptide were stably expressed in the target cells and were able to effectively protect gene-modified cells against infection with CCR5- and CXCR4-tropic strains of HIV-1. LVsh5/C46 treatment was nontoxic as assessed by cell growth and viability, was noninflammatory, and had no adverse effect on HSPC differentiation. LVsh5/C46 could be produced at a scale sufficient for clinical development and resulted in active viral particles with very low mutagenic potential and the absence of replication-competent lentivirus. Based on these in vitro results, plus additional in vivo safety and efficacy data, LVsh5/C46 is now being tested in a phase 1/2 clinical trial for the treatment of HIV-1 disease.

  15. Crystal Structure of the Full-Length Feline Immunodeficiency Virus Capsid Protein Shows an N-Terminal β-Hairpin in the Absence of N-Terminal Proline.

    Science.gov (United States)

    Folio, Christelle; Sierra, Natalia; Dujardin, Marie; Alvarez, Guzman; Guillon, Christophe

    2017-11-09

    Feline immunodeficiency virus (FIV) is a member of the Retroviridae family. It is the causative agent of an acquired immunodeficiency syndrome (AIDS) in cats and wild felines. Its capsid protein (CA) drives the assembly of the viral particle, which is a critical step in the viral replication cycle. Here, the first atomic structure of full-length FIV CA to 1.67 Å resolution is determined. The crystallized protein exhibits an original tetrameric assembly, composed of dimers which are stabilized by an intermolecular disulfide bridge induced by the crystallogenesis conditions. The FIV CA displays a standard α-helical CA topology with two domains, separated by a linker shorter than other retroviral CAs. The β-hairpin motif at its amino terminal end, which interacts with nucleotides in HIV-1, is unusually long in FIV CA. Interestingly, this functional β-motif is formed in this construct in the absence of the conserved N-terminal proline. The FIV CA exhibits a cis Arg-Pro bond in the CypA-binding loop, which is absent in known structures of lentiviral CAs. This structure represents the first tri-dimensional structure of a functional, full-length FIV CA.

  16. Blocking the Wnt/β-Catenin Pathway by Lentivirus-Mediated Short Hairpin RNA Targeting β-Catenin Gene Suppresses Silica-Induced Lung Fibrosis in Mice

    Science.gov (United States)

    Wang, Xin; Dai, Wujing; Wang, Yanrang; Gu, Qing; Yang, Deyi; Zhang, Ming

    2015-01-01

    Silicosis is a form of occupational lung disease caused by inhalation of crystalline silica dust. While the pathogenesis of silicosis is not clearly understood, the Wnt/β-catenin signaling pathway is thought to play a major role in lung fibrosis. To explore the role of Wnt/β-catenin pathway in silicosis, we blocked Wnt/β-catenin pathway both in silica-treated MLE-12 cells (a mouse pulmonary epithelial cell line) and in a mouse silicosis model by using a lentiviral vector expressing a short hairpin RNA silencing β-catenin (Lv-shβ-catenin). In vitro, Lv-shβ-catenin significantly decreased the expression of β-catenin, MMP2 and MMP9, and secretion of TGF-β1. In vivo, intratracheal treatment with Lv-shβ-catenin significantly reduced expression of β-catenin in the lung and levels of TGF-β1 in bronchoalveolar lavage fluid, and notably attenuated pulmonary fibrosis as evidenced by hydroxyproline content and collagen I\\III synthesis in silica-administered mice. These results indicate that blockade of the Wnt/β-catenin pathway can prevent the development of silica-induced lung fibrosis. Thus Wnt/β-catenin pathway may be a target in prevention and treatment of silicosis. PMID:26340635

  17. Short hairpin RNA targeting 2B gene of coxsackievirus B3 exhibits potential antiviral effects both in vitro and in vivo

    Directory of Open Access Journals (Sweden)

    Yao Hailan

    2012-08-01

    Full Text Available Abstract Background Coxsackievirus B3 is an important infectious agent of viral myocarditis, pancreatitis and aseptic meningitis, but there are no specific antiviral therapeutic reagents in clinical use. RNA interference-based technology has been developed to prevent the viral infection. Methods To evaluate the impact of RNA interference on viral replication, cytopathogenicity and animal survival, short hairpin RNAs targeting the viral 2B region (shRNA-2B expressed by a recombinant vector (pGCL-2B or a recombinant lentivirus (Lenti-2B were tansfected in HeLa cells or transduced in mice infected with CVB3. Results ShRNA-2B exhibited a significant effect on inhibition of viral production in HeLa cells. Furthermore, shRNA-2B improved mouse survival rate, reduced the viral tissues titers and attenuated tissue damage compared with those of the shRNA-NC treated control group. Lenti-2B displayed more effective role in inhibition of viral replication than pGCL-2B in vivo. Conclusions Coxsackievirus B3 2B is an effective target of gene silencing against coxsackievirus B3 infection, suggesting that shRNA-2B is a potential agent for further development into a treatment for enterviral diseases.

  18. Phonon scattering in graphene over substrate steps

    DEFF Research Database (Denmark)

    Sevincli, Haldun; Brandbyge, Mads

    2014-01-01

    We calculate the effect on phonon transport of substrate-induced bends in graphene. We consider bending induced by an abrupt kink in the substrate, and provide results for different step-heights and substrate interaction strengths. We find that individual substrate steps reduce thermal conductance...

  19. Droplet dynamics on patterned substrates

    Indian Academy of Sciences (India)

    tens of microns and it is important to understand how their spreading depends on the properties of the substrate onto which they are printed. Experimental work on such mesoscopic drops is difficult and expensive because of the length and time scales involved. Therefore there is a need for numerical modelling both to ...

  20. Neuronal substrate of eating disorders

    OpenAIRE

    Timofeeva, Elena; Calvez, Juliane

    2014-01-01

    Eating disorders are devastating and life-threatening psychiatric diseases. Although clinical and experimental investigations have significantly progressed in discovering the neuronal causes of eating disorders, the exact neuronal and molecular mechanisms of the development and maintenance of these pathologies are not fully understood. The complexity of the neuronal substrate of eating disorders hampers progress in revealing the precise mechanisms. The present re...

  1. Neurobiological Substrates of Tourette's Disorder

    NARCIS (Netherlands)

    Leckman, James F.; Bloch, Michael H.; Smith, Megan E.; Larabi, Daouia; Hampson, Michelle

    Objective: This article reviews the available scientific literature concerning the neurobiological substrates of Tourette's disorder (TD). Methods: The electronic databases of PubMed, ScienceDirect, and PsycINFO were searched for relevant studies using relevant search terms. Results:

  2. Imparting Icephobicity with Substrate Flexibility

    Science.gov (United States)

    Schutzius, Thomas; Vasileiou, Thomas; Poulikakos, Dimos

    2017-11-01

    Ice accumulation poses serious safety and performance issues for modern infrastructure. Rationally designed superhydrophobic surfaces have demonstrated potential as a passive means to mitigate ice accretion; however, further studies on solutions that reduce impalement and contact time for impacting supercooled droplets are urgently needed. Here we demonstrate the collaborative effect of substrate flexibility and surface texture on enhancing icephobicity and repelling viscous droplets. We first investigate the influence of increased viscosity on impalement resistance and droplet-substrate contact time. Then we examine the effect of droplet partial solidification on recoil by impacting supercooled water droplets onto surfaces containing ice nucleation promoters. We demonstrate a passive method for shedding partially solidified droplets that does not rely on the classic recoil mechanism. Using an energy-based model, we identify a previously unexplored mechanism whereby the substrate oscillation governs the rebound process by efficiently absorbing the droplet kinetic energy and rectifying it back, allowing for droplet recoil. This mechanism applies for a range of droplet viscosities and ice slurries, which do not rebound from rigid superhydrophobic substrates. Partial support of the Swiss National Science Foundation under Grant No. 162565 and the European Research Council under Advanced Grant No. 669908 (INTICE) is acknowledged.

  3. Sensor Technologies on Flexible Substrates

    Science.gov (United States)

    Koehne, Jessica

    2016-01-01

    NASA Ames has developed sensor technologies on flexible substrates integrated into textiles for personalized environment monitoring and human performance evaluation. Current technologies include chemical sensing for gas leak and event monitoring and biological sensors for human health and performance monitoring. Targeted integration include next generation EVA suits and flexible habitats.

  4. PREFACE: Cell-substrate interactions Cell-substrate interactions

    Science.gov (United States)

    Gardel, Margaret; Schwarz, Ulrich

    2010-05-01

    One of the most striking achievements of evolution is the ability to build cellular systems that are both robust and dynamic. Taken by themselves, both properties are obvious requirements: robustness reflects the fact that cells are there to survive, and dynamics is required to adapt to changing environments. However, it is by no means trivial to understand how these two requirements can be implemented simultaneously in a physical system. The long and difficult quest to build adaptive materials is testimony to the inherent difficulty of this goal. Here materials science can learn a lot from nature, because cellular systems show that robustness and dynamics can be achieved in a synergetic fashion. For example, the capabilities of tissues to repair and regenerate are still unsurpassed in the world of synthetic materials. One of the most important aspects of the way biological cells adapt to their environment is their adhesive interaction with the substrate. Numerous aspects of the physiology of metazoan cells, including survival, proliferation, differentiation and migration, require the formation of adhesions to the cell substrate, typically an extracellular matrix protein. Adhesions guide these diverse processes both by mediating force transmission from the cell to the substrate and by controlling biochemical signaling pathways. While the study of cell-substrate adhesions is a mature field in cell biology, a quantitative biophysical understanding of how the interactions of the individual molecular components give rise to the rich dynamics and mechanical behaviors observed for cell-substrate adhesions has started to emerge only over the last decade or so. The recent growth of research activities on cell-substrate interactions was strongly driven by the introduction of new physical techniques for surface engineering into traditional cell biological work with cell culture. For example, microcontact printing of adhesive patterns was used to show that cell fate depends

  5. Ketone Bodies as Brain Substrates

    OpenAIRE

    Silva, Paula Sofia Valente da

    2015-01-01

    SILVA, Paula Sofia Valente da - Ketone Bodies as Brain Substrates. Coimbra : [s.n.], 2015. Dissertação de Mestrado em Bioquimica. Since their discovery as a marker for diabetic ketoacidosis, ketone bodies have become known for their therapeutic role as effective agents in refractory epilepsy and a diet specifically designed to increase ketone bodies’ levels in circulation has been often prescribed as treatment. In the classical ketogenic diet, intake of even small additional amounts of car...

  6. Substrate analogues for isoprenoid enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Stremler, K.E.

    1987-01-01

    Diphosphonate analogues of geranyl diphosphate, resistant to degradation by phosphatases, were found to be alternate substrates for the reaction with farnesyl diphosphate synthetase isolated from avian liver. The difluoromethane analogue was shown to be the better alternate substrate, in agreement with solvolysis results which indicate that the electronegativity of the difluoromethylene unit more closely approximates that of the normal bridging oxygen. The usefulness of the C/sub 10/ difluoro analogue, for detecting low levels of isoprenoid enzymes in the presence of high levels of phosphatase activity, was demonstrated with a cell-free preparation from lemon peel. A series of C/sub 5/ through C/sub 15/ homoallylic and allylic diphosphonates, as well as two 5'-nucleotide diphosphonates, was prepared in high overall yield using the activation-displacement sequence. Radiolabeled samples of several of the allylic diphosphonates were prepared with tritium located at C1. A series of geraniols, stereospecifically deuterated at C1, was prepared. The enantiomeric purities and absolute configurations were determined by derivatization as the mandelate esters for analysis by /sup 1/H NMR. The stereochemistry of the activation-displacement sequence was examined using C1-deuterated substrates.

  7. Expression Analysis of Hairpin RNA Carrying Sugarcane mosaic virus (SCMV Derived Sequences and Transgenic Resistance Development in a Model Rice Plant

    Directory of Open Access Journals (Sweden)

    Sehrish Akbar

    2017-01-01

    Full Text Available Developing transgenic resistance in monocotyledonous crops against pathogens remains a challenging area of research. Sugarcane mosaic virus (SCMV is a serious pathogen of many monocotyledonous crops including sugarcane. The objective of present study was to analyze transgenic expression of hairpin RNA (hpRNA, targeting simultaneously CP (Coat Protein and Hc-Pro (helper component-proteinase genes of SCMV, in a model rice plant. Conserved nucleotide sequences, exclusive for DAG (Aspartic acid-Alanine-Glycine and KITC (Lycine-Isoleucine-Threonine-Cysteine motifs, derived from SCMV CP and Hc-Pro genes, respectively, were fused together and assembled into the hpRNA cassette under maize ubiquitin promoter to form Ubi-hpCP:Hc-Pro construct. The same CP:Hc-Pro sequence was fused with the β-glucuronidase gene (GUS at the 3′ end under CaMV 35S promoter to develop 35S-GUS:CP:Hc-Pro served as a target reporter gene construct. When delivered into rice callus tissues by particle bombardment, the Ubi-hpCP:Hc-Pro construct induced strong silencing of 35S-GUS:CP:Hc-Pro. Transgenic rice plants, containing Ubi-hpCP:Hc-Pro construct, expressed high level of 21–24 nt small interfering RNAs, which induced specific suppression against GUS:CP:Hc-Pro delivered by particle bombardment and conferred strong resistance to mechanically inoculated SCMV. It is concluded that fusion hpRNA approach is an affordable method for developing resistance against SCMV in model rice plant and it could confer SCMV resistance when transformed into sugarcane.

  8. Increased electrocatalyzed performance through hairpin oligonucleotide aptamer-functionalized gold nanorods labels and graphene-streptavidin nanomatrix: Highly selective and sensitive electrochemical biosensor of carcinoembryonic antigen.

    Science.gov (United States)

    Wen, Wei; Huang, Jing-Yi; Bao, Ting; Zhou, Jun; Xia, Hong-Xing; Zhang, Xiu-Hua; Wang, Sheng-Fu; Zhao, Yuan-Di

    2016-09-15

    We report a triplex signal amplification strategy for sensitive biosensing of cancer biomarker by taking advantage of hairpin-shaped oligonucleotide-functionalized gold nanorods (HO-GNRs), graphene and the avidin-biotin reation. The strategy expands electrochemical detection of carcinoembryonic antigen (CEA) by using an aptamer as biosensor's recognition element and HO-GNRs as signal enhancer. To construct this biosensor, the GNR was used as a carrier of horseradish peroxidase (HRP) and HO aptamer with a biotin at the 3'-end and a thiol at the 5'-end, which amplified the electrochemical response because of a large molar ratio of HRP to HO. In the presence of target CEA, the binding reactions of CEA with the loop portions of the HOs caused HOs' loop-stem structure opened and exposed the biotins, and then HRP-GNRs-HO conjugates were captured on graphene and streptavidin modified electrodes via the reaction between the exposed biotins and preimmobilized streptavidins. The accumulation of HRP effectively catalyzed the hydrogen peroxide-mediated oxidation of o-phenylenediamine to generate an electrochemical reduction current for CEA detection. Under optimal conditions, the electrochemical biosensor exhibited a wide dynamic range of 5pgmL(-1) and 50ngmL(-1) toward CEA standards with a low detection limit of 1.5pgmL(-1) (signal-to-noise ratio of 3). The proposed biosensor accurately detected CEA concentration in 8 human serum samples from patients with lung diseases, showing excellent correlations with standard chemiluminescence immunoassay. Furthermore, these results of target DNA detection made it abundantly clear that the proposed strategy can also be extended for detection of other relative biomarkers using different functional DNA structures, which shows great prospects in single-nucleotide polymorphisms analysis, biomedical sensing and application for accurate clinical diseases diagnostic. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Effective relief of neuropathic pain by adeno-associated virus-mediated expression of a small hairpin RNA against GTP cyclohydrolase 1

    Directory of Open Access Journals (Sweden)

    Chang Jin

    2009-11-01

    Full Text Available Abstract Background Recent studies show that transcriptional activation of GTP cyclohydrolase I (GCH1 in dorsal root ganglia (DRG is significantly involved in the development and persistency of pain symptoms. We thus hypothesize that neuropathic pain may be attenuated by down-regulation of GCH1 expression, and propose a gene silencing system for this purpose. Results To interrupt GCH1 synthesis, we designed a bidirectional recombinant adeno-associated virus encoding both a small hairpin RNA against GCH1 and a GFP reporter gene (rAAV-shGCH1. After rAAV-shGCH1 was introduced into the sciatic nerve prior to or following pain-inducing surgery, therapeutic efficacy and the underlying mechanisms were subsequently validated in animal models. The GFP expression data indicates that rAAV effectively delivered transgenes to DRG. Subsequently reduced GCH1 expression was evident from immunohistochemistry and western-blotting analysis. Along with the down-regulation of GCH1, the von Frey test correspondingly indicated a sharp decline in pain symptoms upon both pre- and post-treatment with rAAV-shGCH1. Interestingly, GCH1 down-regulation additionally led to decreased microglial activation in the dorsal horn, implying an association between pain attenuation and reduced inflammation. Conclusion Therefore, the data suggests that GCH1 levels can be reduced by introducing rAAV-shGCH1, leading to pain relief. Based on the results, we propose that GCH1 modulation may be developed as a clinically applicable gene therapy strategy to treat neuropathic pain.

  10. A novel bidirectional expression system for simultaneous expression of both the protein-coding genes and short hairpin RNAs in mammalian cells

    International Nuclear Information System (INIS)

    Hung, C.-F.; Cheng, T.-L.; Wu, R.-H.; Teng, C.-F.; Chang, W.-T.

    2006-01-01

    RNA interference (RNAi) is an extremely powerful and widely used gene silencing approach for reverse functional genomics and molecular therapeutics. In mammals, the conserved poly(ADP-ribose) polymerase 2 (PARP-2)/RNase P bidirectional control promoter simultaneously expresses both the PARP-2 protein and RNase P RNA by RNA polymerase II- and III-dependent mechanisms, respectively. To explore this unique bidirectional control system in RNAi-mediated gene silencing strategy, we have constructed two novel bidirectional expression vectors, pbiHsH1 and pbiMmH1, which contained the PARP-2/RNase P bidirectional control promoters from human and mouse, for simultaneous expression of both the protein-coding genes and short hairpin RNAs. Analyses of the dual transcriptional activities indicated that these two bidirectional expression vectors could not only express enhanced green fluorescent protein as a functional reporter but also simultaneously transcribe shLuc for inhibiting the firefly luciferase expression. In addition, to extend its utility for the establishment of inherited stable clones, we have also reconstructed this bidirectional expression system with the blasticidin S deaminase gene, an effective dominant drug resistance selectable marker, and examined both the selection and inhibition efficiencies in drug resistance and gene expression. Moreover, we have further demonstrated that this bidirectional expression system could efficiently co-regulate the functionally important genes, such as overexpression of tumor suppressor protein p53 and inhibition of anti-apoptotic protein Bcl-2 at the same time. In summary, the bidirectional expression vectors, pbiHsH1 and pbiMmH1, should provide a simple, convenient, and efficient novel tool for manipulating the gene function in mammalian cells

  11. Carbon Nanotube Patterning on a Metal Substrate

    Science.gov (United States)

    Nguyen, Cattien V. (Inventor)

    2016-01-01

    A CNT electron source, a method of manufacturing a CNT electron source, and a solar cell utilizing a CNT patterned sculptured substrate are disclosed. Embodiments utilize a metal substrate which enables CNTs to be grown directly from the substrate. An inhibitor may be applied to the metal substrate to inhibit growth of CNTs from the metal substrate. The inhibitor may be precisely applied to the metal substrate in any pattern, thereby enabling the positioning of the CNT groupings to be more precisely controlled. The surface roughness of the metal substrate may be varied to control the density of the CNTs within each CNT grouping. Further, an absorber layer and an acceptor layer may be applied to the CNT electron source to form a solar cell, where a voltage potential may be generated between the acceptor layer and the metal substrate in response to sunlight exposure.

  12. Verfahren zum Herstellen einer Beschichtung eines Substrats

    OpenAIRE

    Wilke, Martin; Töpper, Michael

    2013-01-01

    The method involves applying coating material (7) on surface (2) of recess (3) formed in substrate (1). A liquid auxiliary agent (6) is applied on substrate surface, such that recess is filled with auxiliary agent. The coating material is subsequently applied to auxiliary agent on substrate. A coating material portion in auxiliary agent is transported by coating material diffusion. The agent is subsequently separated from coating material, such that coating material on substrate surface is le...

  13. Förpackning av keramiska substrat

    OpenAIRE

    Karlsson, Jan

    2008-01-01

    Detta examensarbete handlar om forpackning av keramiska substrat. Canning ar det universella namnet pa forpackning av keramiska substrat. Keramiska substrat kan vara katalysatorer eller partikelfilter som anvands som ett efterbehandlingssystem i bensin och Diesel applikationer. Examensarbetet genomfordes hos Scania CV AB. I installationsprocessen sveps en keramisk fibermatta runt det keramiska substratet. Substratet inkapslas sedan med ett metalholje. Rapporten inleds med att beskriva olika i...

  14. SUPPLEMENTARY INFORMATION Indicators for suicide substrate ...

    Indian Academy of Sciences (India)

    Jatinder

    The usual trend is to apply QSSA to a system with high substrate concentration. But, QSSA, i.e., steadiness in intermediate concentration, may even be achieved at high and even comparable enzyme-substrate ratio. Whether a system will attain a steady state depends not only on the high substrate concentration, but also on ...

  15. Method for coating substrates and mask holder

    NARCIS (Netherlands)

    Bijkerk, Frederik; Yakshin, Andrey; Louis, Eric; Kessels, M.J.H.; Maas, Edward Lambertus Gerardus; Bruineman, Caspar

    2004-01-01

    When coating substrates it is frequently desired that the layer thickness should be a certain function of the position on the substrate to be coated. To control the layer thickness a mask is conventionally arranged between the coating particle source and the substrate. This leads to undesirable

  16. Substrate mediated enzyme prodrug therapy.

    Directory of Open Access Journals (Sweden)

    Betina Fejerskov

    Full Text Available In this report, we detail Substrate Mediated Enzyme Prodrug Therapy (SMEPT as a novel approach in drug delivery which relies on enzyme-functionalized cell culture substrates to achieve a localized conversion of benign prodrug(s into active therapeutics with subsequent delivery to adhering cells or adjacent tissues. For proof-of-concept SMEPT, we use surface adhered micro-structured physical hydrogels based on poly(vinyl alcohol, β-glucuronidase enzyme and glucuronide prodrugs. We demonstrate enzymatic activity mediated by the assembled hydrogel samples and illustrate arms of control over rate of release of model fluorescent cargo. SMEPT was not impaired by adhering cells and afforded facile time - and dose - dependent uptake of the in situ generated fluorescent cargo by hepatic cells, HepG2. With the use of a glucuronide derivative of an anticancer drug, SN-38, SMEPT afforded a decrease in cell viability to a level similar to that achieved using parent drug. Finally, dose response was achieved using SMEPT and administration of judiciously chosen concentration of SN-38 glucuronide prodrug thus revealing external control over drug delivery using drug eluting surface. We believe that this highly adaptable concept will find use in diverse biomedical applications, specifically surface mediated drug delivery and tissue engineering.

  17. Method For Producing Mechanically Flexible Silicon Substrate

    KAUST Repository

    Hussain, Muhammad Mustafa

    2014-08-28

    A method for making a mechanically flexible silicon substrate is disclosed. In one embodiment, the method includes providing a silicon substrate. The method further includes forming a first etch stop layer in the silicon substrate and forming a second etch stop layer in the silicon substrate. The method also includes forming one or more trenches over the first etch stop layer and the second etch stop layer. The method further includes removing the silicon substrate between the first etch stop layer and the second etch stop layer.

  18. Structural Changes of Zn(IIbleomycin Complexes When Bound to DNA Hairpins Containing the 5′-GT-3′ and 5′-GC-3′ Binding Sites, Studied through NMR Spectroscopy

    Directory of Open Access Journals (Sweden)

    Shelby E. Follett

    2017-12-01

    Full Text Available We have previously investigated the diverse levels of disruption caused by Zn(IIBLMs with different C-termini to DNA hairpins containing 5′-GC-3′ and 5′-GT-3′ binding sites. The results of this investigation indicated that both the DNA-binding site and the bleomycin C-termini have an impact on the final conformation of the aforementioned hairpins in the drug-target complexes, as suggested by the different sets of intramolecular NOEs displayed by both oligonucleotides when bound to each Zn(IIBLM. The NMR signals elicited by 1H nuclei in the oligonucleotide bases and sugar moieties were also affected differently (shifted upfield or downfield in various patterns depending on the BLM C-termini and the binding site in the oligonucleotides. The overall conclusion derived from the precedent research is that the spatial conformation of target DNA segments in DNA-Zn(IIBLM complexes could be forged by interactions between drug and DNA that are guided by the DNA binding site and the BLM C-termini. The present study focuses on the structural alterations exhibited by Zn(IIbleomycin-A2, -B2, -A5 and Zn(IIpeplomycin molecules upon binding to the previously studied hairpins. Our main goal is to determine if different spatial conformations of the drugs in their DNA-bound forms are found in drug-DNA complexes that differ in the oligonucleotide binding site and BLM C-termini. Evidence that suggest that each Zn(IIbleomycin is structurally affected depending these two factors, as indicated by different sets of intramolecular NOE connectivities between drug protons and diverse patterns of shifting of their 1H-NMR signals, is provided.

  19. Substrate heater for thin film deposition

    Science.gov (United States)

    Foltyn, Steve R.

    1996-01-01

    A substrate heater for thin film deposition of metallic oxides upon a target substrate configured as a disk including means for supporting in a predetermined location a target substrate configured as a disk, means for rotating the target substrate within the support means, means for heating the target substrate within the support means, the heating means about the support means and including a pair of heating elements with one heater element situated on each side of the predetermined location for the target substrate, with one heater element defining an opening through which desired coating material can enter for thin film deposition and with the heating means including an opening slot through which the target substrate can be entered into the support means, and, optionally a means for thermal shielding of the heating means from surrounding environment is disclosed.

  20. Engineering HIV-1-resistant T-cells from short-hairpin RNA-expressing hematopoietic stem/progenitor cells in humanized BLT mice.

    Directory of Open Access Journals (Sweden)

    Gene-Errol E Ringpis

    Full Text Available Down-regulation of the HIV-1 coreceptor CCR5 holds significant potential for long-term protection against HIV-1 in patients. Using the humanized bone marrow/liver/thymus (hu-BLT mouse model which allows investigation of human hematopoietic stem/progenitor cell (HSPC transplant and immune system reconstitution as well as HIV-1 infection, we previously demonstrated stable inhibition of CCR5 expression in systemic lymphoid tissues via transplantation of HSPCs genetically modified by lentiviral vector transduction to express short hairpin RNA (shRNA. However, CCR5 down-regulation will not be effective against existing CXCR4-tropic HIV-1 and emergence of resistant viral strains. As such, combination approaches targeting additional steps in the virus lifecycle are required. We screened a panel of previously published shRNAs targeting highly conserved regions and identified a potent shRNA targeting the R-region of the HIV-1 long terminal repeat (LTR. Here, we report that human CD4(+ T-cells derived from transplanted HSPC engineered to co-express shRNAs targeting CCR5 and HIV-1 LTR are resistant to CCR5- and CXCR4- tropic HIV-1-mediated depletion in vivo. Transduction with the combination vector suppressed CXCR4- and CCR5- tropic viral replication in cell lines and peripheral blood mononuclear cells in vitro. No obvious cytotoxicity or interferon response was observed. Transplantation of combination vector-transduced HSPC into hu-BLT mice resulted in efficient engraftment and subsequent stable gene marking and CCR5 down-regulation in human CD4(+ T-cells within peripheral blood and systemic lymphoid tissues, including gut-associated lymphoid tissue, a major site of robust viral replication, for over twelve weeks. CXCR4- and CCR5- tropic HIV-1 infection was effectively inhibited in hu-BLT mouse spleen-derived human CD4(+ T-cells ex vivo. Furthermore, levels of gene-marked CD4(+ T-cells in peripheral blood increased despite systemic infection with either