WorldWideScience

Sample records for single-stranded form show

  1. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  2. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  3. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  4. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.

    1978-01-01

    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  5. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS.

    Science.gov (United States)

    Pachkowski, Brian F; Tano, Keizo; Afonin, Valeriy; Elder, Rhoderick H; Takeda, Shunichi; Watanabe, Masami; Swenberg, James A; Nakamura, Jun

    2009-12-01

    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase beta.

  6. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2016-05-28

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  7. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  8. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    Science.gov (United States)

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  9. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.

    1976-02-01

    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  10. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.

    1984-01-01

    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  11. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  12. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela

    2010-01-01

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  13. Genetic evidence for single-strand lesions initiating Nbs1-dependent homologous recombination in diversification of Ig v in chicken B lymphocytes.

    Directory of Open Access Journals (Sweden)

    Makoto Nakahara

    2009-01-01

    Full Text Available Homologous recombination (HR is initiated by DNA double-strand breaks (DSB. However, it remains unclear whether single-strand lesions also initiate HR in genomic DNA. Chicken B lymphocytes diversify their Immunoglobulin (Ig V genes through HR (Ig gene conversion and non-templated hypermutation. Both types of Ig V diversification are initiated by AID-dependent abasic-site formation. Abasic sites stall replication, resulting in the formation of single-stranded gaps. These gaps can be filled by error-prone DNA polymerases, resulting in hypermutation. However, it is unclear whether these single-strand gaps can also initiate Ig gene conversion without being first converted to DSBs. The Mre11-Rad50-Nbs1 (MRN complex, which produces 3' single-strand overhangs, promotes the initiation of DSB-induced HR in yeast. We show that a DT40 line expressing only a truncated form of Nbs1 (Nbs1(p70 exhibits defective HR-dependent DSB repair, and a significant reduction in the rate--though not the fidelity--of Ig gene conversion. Interestingly, this defective gene conversion was restored to wild type levels by overproduction of Escherichia coli SbcB, a 3' to 5' single-strand-specific exonuclease, without affecting DSB repair. Conversely, overexpression of chicken Exo1 increased the efficiency of DSB-induced gene-targeting more than 10-fold, with no effect on Ig gene conversion. These results suggest that Ig gene conversion may be initiated by single-strand gaps rather than by DSBs, and, like SbcB, the MRN complex in DT40 may convert AID-induced lesions into single-strand gaps suitable for triggering HR. In summary, Ig gene conversion and hypermutation may share a common substrate-single-stranded gaps. Genetic analysis of the two types of Ig V diversification in DT40 provides a unique opportunity to gain insight into the molecular mechanisms underlying the filling of gaps that arise as a consequence of replication blocks at abasic sites, by HR and error

  14. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase.

    Science.gov (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias

    2017-06-02

    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  16. Functional analysis of multiple single-stranded DNA-binding proteins from Methanosarcina acetivorans and their effects on DNA synthesis by DNA polymerase BI.

    Science.gov (United States)

    Robbins, Justin B; Murphy, Mary C; White, Bryan A; Mackie, Roderick I; Ha, Taekjip; Cann, Isaac K O

    2004-02-20

    Single-stranded DNA-binding proteins and their functional homologs, replication protein A, are essential components of cellular DNA replication, repair and recombination. We describe here the isolation and characterization of multiple replication protein A homologs, RPA1, RPA2, and RPA3, from the archaeon Methanosarcina acetivorans. RPA1 comprises four single-stranded DNA-binding domains, while RPA2 and RPA3 are each composed of two such domains and a zinc finger domain. Gel filtration analysis suggested that RPA1 exists as homotetramers and homodimers in solution, while RPA2 and RPA3 form only homodimers. Unlike the multiple RPA proteins found in other Archaea and eukaryotes, each of the M. acetivorans RPAs can act as a distinct single-stranded DNA-binding protein. Fluorescence resonance energy transfer and fluorescence polarization anisotropy studies revealed that the M. acetivorans RPAs bind to as few as 10 single-stranded DNA bases. However, more stable binding is achieved with single-stranded DNA of 18-23 bases, and for such substrates the estimated Kd was 3.82 +/- 0.28 nM, 173.6 +/- 105.17 nM, and 5.92 +/- 0.23 nM, for RPA1, RPA2, and RPA3, respectively. The architectures of the M. acetivorans RPAs are different from those of hitherto reported homologs. Thus, these proteins may represent novel forms of replication protein A. Most importantly, our results show that the three RPAs and their combinations highly stimulate the primer extension capacity of M. acetivorans DNA polymerase BI. Although bacterial SSB and eukaryotic RPA have been shown to stimulate DNA synthesis by their cognate DNA polymerases, our findings provide the first in vitro biochemical evidence for the conservation of this property in an archaeon.

  17. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.

    2002-01-01

    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit...

  18. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP

    1996-01-01

    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  19. Ion assisted structural collapse of a single stranded DNA: A molecular dynamics approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Soumadwip; Dixit, Himanshu; Chakrabarti, Rajarshi, E-mail: rajarshi@chem.iitb.ac.in

    2015-09-28

    Highlights: • The dynamics of a single-stranded DNA in presence of different concentrations of Mg{sup 2+} is investigated. • The initial DNA chain collapse is characterized by the formation of non-sequentially stacked base pairs. • The DNA chain re-swells at high concentrations of Mg{sup 2+} as a consequence of overcharging. - Abstract: The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counterions. It is well known that the structural collapse of DNA is favoured in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl{sub 2}) single stranded DNA with base sequence 5′-CGCGAATTCGCG-3′ (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  20. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    Science.gov (United States)

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  1. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.

    1985-01-01

    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  2. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)

    student

    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  3. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud

    2012-06-01

    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  4. Intercalation of single-strand oligonucleotides between nucleolipid anionic membranes: a neutron diffraction study.

    Science.gov (United States)

    Milani, Silvia; Berti, Debora; Dante, Silvia; Hauss, Thomas; Baglioni, Piero

    2009-04-07

    This contribution presents a neutron diffraction investigation of anionic lamellar phases composed of mixtures of 1-palmitoyl, 2-oleoyl phosphatidyl-nucleosides (POPN, where N is either adenosine or uridine), and POPC (1-palmitoyl,2-oleoyl-phosphatidyl-choline). Their behavior is studied for two different mole ratios and in the presence of nucleic acids. The samples are formed by the evaporation of liposomal dispersions prepared in water or in solutions containing single-strand oligonucleotides. Previous small angle X-ray scattering (SAXS) experiments on the system POPA/polyU (polyuridylic acid, high degree of polymerization, synthetic ribonucleic acid) proved that the insertion and ordering of the biopolymer in the phospholipid lamellae were driven by molecular recognition. In the present study, we extend the previous investigation to single-strand monodisperse oligonucleotides (50-mers). Structural details of the membranes were obtained from the analysis of the neutron diffraction scattering length density profiles. The evidence of direct and specific interactions, driven by molecular recognition between the nucleic polar heads of the nucleolipid and the single-strand nucleic acid, is strengthened by the comparison with identically charged bilayers formed by POPG/POPC. These results contribute to the understanding of the parameters governing the interactions between nucleolipid membranes and oligonucleotides, providing a novel strategy for the design of lipid-based vehicles for nucleic acids.

  5. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-05

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity*

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.

    2015-01-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  7. Highly stable triple helix formation by homopyrimidine (l)-acyclic threoninol nucleic acids with single stranded DNA and RNA

    DEFF Research Database (Denmark)

    Kumar, Vipin; Kesavan, Venkitasamy; Gothelf, Kurt Vesterager

    2015-01-01

    Acyclic (l)-threoninol nucleic acid (aTNA) containing thymine, cytosine and adenine nucleobases were synthesized and shown to form surprisingly stable triplexes with complementary single stranded homopurine DNA or RNA targets. The triplex structures consist of two (l)-aTNA strands and one DNA...... or RNA, and these triplexes are significantly stronger than the corresponding DNA or RNA duplexes as shown in competition experiments. As a unique property the (l)-aTNAs exclusively form triplex structures with DNA and RNA and no duplex structures are observed by gel electrophoresis. The results were...... compared to the known enantiomer (d)-aTNA, which forms much weaker triplexes depending upon temperature and time. It was demonstrated that (l)-aTNA triplexes are able to stop primer extension on a DNA template, showing the potential of (l)-aTNA for antisense applications....

  8. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.

    1982-01-01

    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  9. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.

    2007-01-01

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  10. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop.

    Science.gov (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S

    2009-05-01

    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  11. Empirical model for matching spectrophotometric reflectance of yarn windings and multispectral imaging reflectance of single strands of yarns.

    Science.gov (United States)

    Luo, Lin; Shen, Hui-Liang; Shao, Si-Jie; Xin, John

    2015-08-01

    The state-of-the-art multispectral imaging system can directly acquire the reflectance of a single strand of yarn that is impossible for traditional spectrophotometers. Instead, the spectrophotometric reflectance of a yarn winding, which is constituted by yarns wound on a background card, is regarded as the yarn reflectance in textile. While multispectral imaging systems and spectrophotometers can be separately used to acquire the reflectance of a single strand of yarn and corresponding yarn winding, the quantitative relationship between them is not yet known. In this paper, the relationship is established based on models that describe the spectral response of a spectrophotometer to a yarn winding and that of a multispectral imaging system to a single strand of yarn. The reflectance matching function from a single strand of yarn to corresponding yarn winding is derived to be a second degree polynomial function, which coefficients are the solutions of a constrained nonlinear optimization problem. Experiments on 100 pairs of samples show that the proposed approach can reduce the color difference between yarn windings and single strands of yarns from 2.449 to 1.082 CIEDE2000 units. The coefficients of the optimal reflection matching function imply that the reflectance of a yarn winding measured by a spectrophotometer consists of not only the intrinsic reflectance of yarn but also the nonignorable interreflection component between yarns.

  12. Improved single-strand DNA sizing accuracy in capillary electrophoresis.

    OpenAIRE

    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B

    1997-01-01

    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  13. SuperFormLab: showing SuperFormLab

    DEFF Research Database (Denmark)

    2013-01-01

    3D-printing in clay and ceramic objects shaped by your own sounds and movements! Digital form transferred via CNC-milling to ornamental ceramic wall-cladding. Brave New World… Students and their teacher at SuperFormLab, the new ceramic workshop of the School of Design at the Royal Danish Academy...... of Fine Arts in Copenhagen, will be showing results of their investigations into the potential of combining digital technologies with ceramic materials. It is now possible to shape the most complex mathematical, virtual 3D objects through the use of advanced software-programs. And more than that – you can...... now get these objects out of the computer and be able to hold and experience them with your hands. Even made in clay. At SuperFormLab, workshop for the new education in Ceramic Design at the School of Design, the integration of digital technologies in relation to the ceramic materials and techniques...

  14. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis.

    Science.gov (United States)

    Olszewski, Marcin; Mickiewicz, Małgorzata; Kur, Józef

    2008-07-01

    The thermophilic bacterium Thermoanaerobacter tengcongensis has two single-stranded DNA-binding (SSB) proteins, designated TteSSB2 and TteSSB3. In a SSB complementation assay in Escherichia coli, only TteSSB3 took over the in vivo function of EcoSSB. We have cloned the ssb genes obtained by PCR and have developed E. coli overexpression systems. The TteSSB2 and TteSSB3 consist of 153 and 150 amino acids with a calculated molecular mass of 17.29 and 16.96 kDa, respectively. They are the smallest known bacterial SSB proteins. The homology between amino acid sequences of these proteins is 40% identity and 53% similarity. They are functional as homotetramers, with each monomer encoding one single-stranded DNA binding domain (OB-fold). In fluorescence titrations with poly(dT), both proteins bind single-stranded DNA with a binding site size of about 40 nt per homotetramer. Thermostability with half-life of about 30 s at 95 degrees C makes TteSSB3 similar to the known SSB of Thermus aquaticus (TaqSSB). The TteSSB2 was fully active even after 6 h incubation at 100 degrees C. Here, we show for the first time paralogous thermostable homotetrameric SSBs, which could be an attractive alternative for known homodimeric thermostable SSB proteins in their applications for molecular biology methods and analytical purposes.

  15. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana.

    Science.gov (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L

    2005-04-01

    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  16. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  17. Biophysical characterization of the association of histones with single-stranded DNA.

    Science.gov (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier

    2017-11-01

    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.

    1988-01-01

    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  19. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted

    2014-01-01

    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  20. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  1. Programmable autonomous synthesis of single-stranded DNA

    Science.gov (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

    2018-02-01

    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  2. Elastic properties of alternative versus single-stranded leveling archwires.

    Science.gov (United States)

    Rucker, Brian K; Kusy, Robert P

    2002-11-01

    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  3. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  4. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng

    2015-05-08

    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  5. Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library.

    Directory of Open Access Journals (Sweden)

    Sumate Pengpumkiat

    Full Text Available Chemical synthesis of oligonucleotides is a widely used tool in the field of biochemistry. Several methods for gene synthesis have been introduced in the growing area of genomics. In this paper, a novel method of constructing dsDNA is proposed. Short (28-mer oligo fragments from a library were assembled through successive annealing and ligation processes, followed by PCR. First, two oligo fragments annealed to form a dsDNA molecule. The double-stranded oligo was immobilized onto magnetic beads (solid support via streptavidin-biotin binding. Next, single-stranded oligo fragments were added successively through ligation to form the complete DNA molecule. The synthesized DNA was amplified through PCR and gel electrophoresis was used to characterize the product. Sanger sequencing showed that more than 97% of the nucleotides matched the expected sequence. Extending the length of the DNA molecule by adding single-stranded oligonucleotides from a basis set (library via ligation enables a more convenient and rapid mechanism for the design and synthesis of oligonucleotides on the go. Coupled with an automated dispensing system and libraries of short oligo fragments, this novel DNA synthesis method would offer an efficient and cost-effective method for producing dsDNA.

  6. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora.

    Science.gov (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E

    2003-08-01

    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  7. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H

    2012-02-22

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  8. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)

    2015-04-22

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  9. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.

    2006-01-01

    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  10. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian

    2012-07-06

    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  11. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata).

    Science.gov (United States)

    Jackson, Elliot W; Bistolas, Kalia S I; Button, Jason B; Hewson, Ian

    2016-01-01

    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates.

  12. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.

    1994-01-01

    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  13. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux

    2016-12-01

    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  14. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong

    2011-04-01

    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  15. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.

    1994-01-01

    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  16. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2003-01-01

    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  17. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.

    OpenAIRE

    Barany, F; Boeke, J D

    1983-01-01

    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  18. Development of an Interaction Assay between Single-Stranded Nucleic Acids Trapped with Silica Particles and Fluorescent Compounds

    Directory of Open Access Journals (Sweden)

    R. Maeda

    2012-09-01

    Full Text Available Biopolymers are easily denatured by heating, a change in pH or chemical substances when they are immobilized on a substrate. To prevent denaturation of biopolymers, we developed a method to trap a polynucleotide on a substrate by hydrogen bonding using silica particles with surfaces modified by aminoalkyl chains ([A-AM silane]/SiO2. [A-AM silane]/SiO2 was synthesized by silane coupling reaction of N-2-(aminoethyl-3-aminopropyltrimethoxysilane (A-AM silane with SiO2 particles with a diameter of 5 μm at 100 °C for 20 min. The surface chemical structure of [A-AM silane]/SiO2 was characterized by Fourier transform infrared spectroscopy and molecular orbital calculations. The surface of the silica particles was modified with A-AM silane and primary amine groups were formed. [A-AM silane]/SiO2 was trapped with single-stranded nucleic acids [(Poly-X; X = A (adenine, G (guanine and C (cytosine] in PBS solution at 37 °C for 1 h. The single-stranded nucleic acids were trapped on the surface of the [A-AM silane]/SiO2 by hydrogen bonding to form conjugated materials. The resulting complexes were further conjugated by derivatives of acridine orange (AO as fluorescent labels under the same conditions to form [AO:Poly-X:A-AM silane]/SiO2 complexes. Changes in the fluorescence intensity of these complexes originating from interactions between the single-stranded nucleic acid and aromatic compounds were also evaluated. The change in intensity displayed the order [AO: Poly-G: A-AM silane]/SiO2 > [AO:Poly-A:A-AM silane]/SiO2 >> [AO:Poly-C:A-AM silane]/SiO2. This suggests that the single-stranded nucleic acids conjugated with aminoalkyl chains on the surfaces of SiO2 particles and the change in fluorescence intensity reflected the molecular interaction between AO and the nucleic-acid base in a polynucleotide.

  19. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  20. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  1. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family.

    Science.gov (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław

    2017-05-01

    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  2. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity.

    Science.gov (United States)

    Monnet, Jordan; Kozelka, Jiří

    2012-10-01

    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes

    Science.gov (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.

    2015-01-01

    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  4. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks.

    Science.gov (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P

    2012-09-01

    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  5. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi

    1990-01-01

    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  6. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler

    2007-12-01

    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  7. Effect of Conformational Entropy on the Nanomechanics of Microcantilever-Based Single-Stranded DNA Sensors

    Directory of Open Access Journals (Sweden)

    Zou-Qing Tan

    2014-09-01

    Full Text Available An entropy-controlled bending mechanism is presented to study the nanomechanics of microcantilever-based single-stranded DNA (ssDNA sensors. First; the conformational free energy of the ssDNA layer is given with an improved scaling theory of thermal blobs considering the curvature effect; and the mechanical energy of the non-biological layer is described by Zhang’s two-variable method for laminated beams. Then; an analytical model for static deflections of ssDNA microcantilevers is formulated by the principle of minimum energy. The comparisons of deflections predicted by the proposed model; Utz–Begley’s model and Hagan’s model are also examined. Numerical results show that the conformational entropy effect on microcantilever deflections cannot be ignored; especially at the conditions of high packing density or long chain systems; and the variation of deflection predicted by the proposed analytical model not only accords with that observed in the related experiments qualitatively; but also appears quantitatively closer to the experimental values than that by the preexisting models. In order to improve the sensitivity of static-mode biosensors; it should be as small as possible to reduce the substrate stiffness.

  8. Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages.

    Science.gov (United States)

    Kodaira, K; Godson, N G; Taketo, A

    1995-01-25

    The minus origins for complementary strand DNA synthesis (-ori) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, phi K, alpha 3, and St-1 closely resemble each other in DNA structure and contain two potential secondary hairpin loops (I and II) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the -ori regions of phi K and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the phi K mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several phi K and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway.

  9. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.

    1987-01-01

    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  10. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.

    1978-01-01

    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  11. Characterization of the single-stranded DNA binding protein pV(VGJΦ) of VGJΦ phage from Vibrio cholerae.

    Science.gov (United States)

    Falero, Alina; Caballero, Andy; Trigueros, Sonia; Pérez, Celso; Campos, Javier; Marrero, Karen; Fando, Rafael

    2011-09-01

    pV(VGJΦ), a single-stranded DNA binding protein of the vibriophage VGJΦ was subject to biochemical analysis. Here, we show that this protein has a general affinity for single-stranded DNA (ssDNA) as documented by Electrophoretic Mobility Shift Assay (EMSA). The apparent molecular weight of the monomer is about 12.7kDa as measured by HPLC-SEC. Moreover, isoelectrofocusing showed an isoelectric point for pV(VGJΦ) of 6.82 pH units. Size exclusion chromatography in 150mM NaCl, 50mM sodium phosphate buffer, pH 7.0 revealed a major protein species of 27.0kDa, suggesting homodimeric protein architecture. Furthermore, pV(VGJΦ) binds ssDNA at extreme temperatures and the complex was stable after extended incubation times. Upon frozen storage at -20°C for a year the protein retained its integrity, biological activity and oligomericity. On the other hand, bioinformatics analysis predicted that pV(VGJΦ) protein has a disordered C-terminal, which might be involved in its functional activity. All the aforementioned features make pV(VGJΦ) interesting for biotechnological applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der

    1988-01-01

    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  13. Dynamics of RecA filaments on single-stranded DNA

    NARCIS (Netherlands)

    Van Loenhout, M.T.J.; Van der Heijden, T.; Kanaar, R.; Wyman, C.; Dekker, C.

    2009-01-01

    RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on

  14. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2001-01-01

    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  15. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  16. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket.

    Science.gov (United States)

    Pham, Hanh T; Bergoin, Max; Tijssen, Peter

    2013-03-14

    The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  17. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket

    OpenAIRE

    Pham, Hanh T.; Bergoin, Max; Tijssen, Peter

    2013-01-01

    International audience; The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  18. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.

    1983-01-01

    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  19. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B

    2006-01-01

    by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  20. Complex shapes self-assembled from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng

    2012-05-30

    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  1. Distinct circular single-stranded DNA viruses exist in different soil types.

    Science.gov (United States)

    Reavy, Brian; Swanson, Maud M; Cock, Peter J A; Dawson, Lorna; Freitag, Thomas E; Singh, Brajesh K; Torrance, Lesley; Mushegian, Arcady R; Taliansky, Michael

    2015-06-15

    The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  2. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  3. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

    Science.gov (United States)

    Richardson, Tomas T; Harran, Omar; Murray, Heath

    2016-06-16

    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

  4. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  5. Escherichia coli Single-Stranded DNA-Binding Protein: NanoESI-MS Studies of Salt-Modulated Subunit Exchange and DNA Binding Transactions

    Science.gov (United States)

    Mason, Claire E.; Jergic, Slobodan; Lo, Allen T. Y.; Wang, Yao; Dixon, Nicholas E.; Beck, Jennifer L.

    2013-02-01

    Single-stranded DNA-binding proteins (SSBs) are ubiquitous oligomeric proteins that bind with very high affinity to single-stranded DNA and have a variety of essential roles in DNA metabolism. Nanoelectrospray ionization mass spectrometry (nanoESI-MS) was used to monitor subunit exchange in full-length and truncated forms of the homotetrameric SSB from Escherichia coli. Subunit exchange in the native protein was found to occur slowly over a period of hours, but was significantly more rapid in a truncated variant of SSB from which the eight C-terminal residues were deleted. This effect is proposed to result from C-terminus mediated stabilization of the SSB tetramer, in which the C-termini interact with the DNA-binding cores of adjacent subunits. NanoESI-MS was also used to examine DNA binding to the SSB tetramer. Binding of single-stranded oligonucleotides [one molecule of (dT)70, one molecule of (dT)35, or two molecules of (dT)35] was found to prevent SSB subunit exchange. Transfer of SSB tetramers between discrete oligonucleotides was also observed and is consistent with predictions from solution-phase studies, suggesting that SSB-DNA complexes can be reliably analyzed by ESI mass spectrometry.

  6. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  7. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.

    1985-01-01

    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  8. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    Science.gov (United States)

    Hong, Ka Lok

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  9. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail: meicun2006@163.com; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

    2016-12-01

    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  10. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification

    OpenAIRE

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-01-01

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen...

  11. In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides

    International Nuclear Information System (INIS)

    Oppenheim, Amos B.; Rattray, Alison J.; Bubunenko, Mikhail; Thomason, Lynn C.; Court, Donald L.

    2004-01-01

    We demonstrate that the bacteriophage λ Red functions efficiently recombine linear DNA or single-strand oligonucleotides (ss-oligos) into bacteriophage λ to create specific changes in the viral genome. Point mutations, deletions, and gene replacements have been created. While recombineering with oligonucleotides, we encountered other mutations accompanying the desired point mutational change. DNA sequence analysis suggests that these unwanted mutations are mainly frameshift deletions introduced during oligonucleotide synthesis

  12. Stretching and controlled motion of single-stranded DNA in locally heated solid-state nanopores.

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B; Aksimentiev, Aleksei

    2013-08-27

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4-8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA.

  13. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample.

    Science.gov (United States)

    Cui, Lunbiao; Wu, Binyao; Zhu, Xiaojuan; Guo, Xiling; Ge, Yiyue; Zhao, Kangchen; Qi, Xian; Shi, Zhiyang; Zhu, Fengcai; Sun, Lixin; Zhou, Minghao

    2017-11-01

    Metagenomic analysis through high-throughput sequencing is a tool for detecting both known and novel viruses. Using this technique, a novel circular single-stranded DNA (ssDNA) virus genome was discovered in respiratory secretions from a febrile traveler. The virus, named human respiratory-associated PSCV-5-like virus (HRAPLV), has a genome comprising 3,018 bases, with two major putative ORFs inversely encoding capsid (Cap) and replicase (Rep) protein and separated by two intergenic regions. One stem-loop structure was predicted in the larger intergenic region (LIR). The predicted amino acid sequences of the Cap and Rep proteins of HRAPLV showed highest identity to those of porcine stool-associated circular virus 5 isolate CP3 (PoSCV 5) (53.0% and 48.9%, respectively). The host tropism of the virus is unknown, and further study is warranted to determine whether this novel virus is associated with human disease.

  14. Surface treatment on amorphous InGaZnO4 thin film for single-stranded DNA biosensing

    Science.gov (United States)

    Sun, Dali; Matsui, Hiroaki; Wu, Chun-Nan; Tabata, Hitoshi

    2015-01-01

    Amorphous InGaZnO4 (aIGZO) has been widely used as a transparent semiconductor. However, no research has been found yet applying aIGZO to biosensing. This paper examined the single strand DNA (ssDNA) immobilization on aIGZO by absorption with a comparison to ITO, which is the first step for many biosensing schemas. The DNA quantification by florescence intensity shows that the absorption capacity of aIGZO film to ssDNA is 6.7 times greater than that of ITO. XPS and contact angle analysis proved the high DNA absorption affinity on aIGZO film is related to its high effectiveness to OH- attachment. A feasible method to immobilized ssDNA on aIGZO thin film is evaluated in this paper, and consequently, enables a possible approach to apply aIGZO in biosensing.

  15. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol

    2013-01-01

    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  16. The Adsorption of Short Single-Stranded DNA Oligomers on Mineral Surfaces

    Science.gov (United States)

    Kopstein, M.; Sverjensky, D. A.; Hazen, R. M.; Cleaves, H. J.

    2009-12-01

    Previous studies have described feasible pathways for the synthesis of simple organic building blocks such as formaldehyde and hydrogen cyanide, and their reaction to form more complex biomolecules such as nucleotide bases, amino acids and sugars (Miller and Orgel 1974, Miller and Cleaves 2006). However, the polymerization of monomers into a useful genetic material remains problematic (Orgel 2004). Organic building blocks were unlikely to polymerize from very dilute aqueous solution in the primitive oceans. Mineral surface adsorption has been suggested as a possible mechanism for concentrating the necessary building blocks (Bernal 1951). This study focused on the adsorption behavior of single-stranded DNA homo-oligomers of adenine and thymine (including the monomers, dimers, tetramers, hexamers, octomers, and decamers) with five different mineral surfaces (pyrite, rutile, hematite, olivine and calcite). Adsorption was studied in 0.1 M pH 8.1 KHCO3 with0.05 M NaCl as background electrolyte. Solutions were mixed for 24 hours at room temperature, centrifuged and the supernatants analyzed by UV/visible spectrophotometry. Equilibrium solution concentrations were measured and used to determine the number of moles adsorbed per square meter. Langmuir isotherms were constructed using the experimental data. It was found that adenine-containing molecules tend to bind much more strongly than thymine-containing molecules. It was also found that the number of moles adsorbed at saturation tends to fall with increasing chain length, while adsorption affinity tends to rise. Oligomer length appears to affect adsorption more than the mineral type. These results may have implications for the primordial organization of the first nucleic acid molecules as the persistence of extra-cellular nucleic acids in the environment. References Bernal, J. D. (1951) The Physical Basis of Life (Routledge, London). Miller S.L. and Cleaves, H.J. (2006) Prebiotic chemistry on the primitive Earth. In

  17. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids.

    Science.gov (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R

    2015-04-08

    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  18. Repair of ultraviolet light damage in Saccharomyces cerevisiae as studied with double- and single-stranded incoming DNAs

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, D.; Hieda, K.

    1992-01-01

    Purified double- and single-stranded DNAs of the autonomously replicating vector M13RK9-T were irradiated with ultraviolet light (UV) in vitro and introduced into competent whole cells of Saccharomyces cerevisiae. Incoming double-stranded DNA was more sensitive to UV in excision repair-deficient rad2-1 cells than in proficient repair RAD + cells, while single-stranded DNA exhibited high sensitivity in both host cells. The results indicate that in yeast there is no effective rescue of UV-incoming single-stranded DNA by excision repair or other constitutive dark repair processes

  19. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks.

    Science.gov (United States)

    Pachkowski, Brian; Nakamura, Jun

    2013-01-01

    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  20. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana.

    Science.gov (United States)

    Olszewski, Marcin; Grot, Anna; Wojciechowski, Marek; Nowak, Marta; Mickiewicz, Małgorzata; Kur, Józef

    2010-10-15

    In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. We report the characterization of single-stranded DNA binding proteins (SSBs) from the thermophilic bacteria Thermotoga maritima (TmaSSB) and Thermotoga neapolitana (TneSSB). They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively). They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold) in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC) the melting temperature (Tm) was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR).

  1. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB).

    Science.gov (United States)

    van Loon, Barbara; Samson, Leona D

    2013-03-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  2. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata

    2010-10-01

    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  3. Role of electrostatics in the assembly pathway of a single-stranded RNA virus.

    Science.gov (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M

    2014-09-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  4. Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Krzysztof Lepek

    2015-01-01

    Full Text Available Monitoring and control of infections are key parts of surveillance systems and epidemiological risk prevention. In the case of influenza A viruses (IAVs, which show high variability, a wide range of hosts, and a potential of reassortment between different strains, it is essential to study not only people, but also animals living in the immediate surroundings. If understated, the animals might become a source of newly formed infectious strains with a pandemic potential. Special attention should be focused on pigs, because of the receptors specific for virus strains originating from different species, localized in their respiratory tract. Pigs are prone to mixed infections and may constitute a reservoir of potentially dangerous IAV strains resulting from genetic reassortment. It has been reported that a quadruple reassortant, A(H1N1pdm09, can be easily transmitted from humans to pigs and serve as a donor of genetic segments for new strains capable of infecting humans. Therefore, it is highly desirable to develop a simple, cost-effective, and rapid method for evaluation of IAV genetic variability. We describe a method based on multitemperature single-strand conformational polymorphism (MSSCP, using a fragment of the hemagglutinin (HA gene, for detection of coinfections and differentiation of genetic variants of the virus, difficult to identify by conventional diagnostic.

  5. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.

    1980-01-01

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  6. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth

    2014-01-01

    . We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices......Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells...

  7. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela

    2015-01-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  8. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams

    2014-01-01

    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  9. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy

    OpenAIRE

    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried

    2013-01-01

    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  10. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    Science.gov (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Science.gov (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  12. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification.

    Science.gov (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-10-07

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  13. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA.

    Science.gov (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S

    2000-09-20

    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  14. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  15. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii.

    Science.gov (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten

    2012-01-01

    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  16. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia

    2009-01-01

    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  17. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan

    2015-01-01

    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  18. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik

    1992-04-01

    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  19. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.

    1987-01-01

    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  20. Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Gust, I.D.; Feinstone, S.M.; Purcell, R.H.; Alter, H.J.

    1980-01-01

    A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

  1. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.

    1980-01-01

    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  2. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  3. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif

    Science.gov (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  4. Detection of hybridization of single-strand DNA PCR products in temperature change process by a novel metal-clamping piezoelectric sensor.

    Science.gov (United States)

    Chen, Qinghai; Bian, Zhiheng; Hua, Xing; Yao, Chunyan; Wu, Wei; Zhang, Xue; Zhang, Bo; Huang, Junfu; Tang, Wanli; Fu, Weiling

    2010-05-15

    Oligonucleotide probes on the sensor surface can be hybridized with single-strand DNA (ssDNA) that is formed from PCR products in ice bath after degeneration. Thus, detection of PCR products by piezoelectric sensors requires the participation of ssDNA PCR products in ice bath. When PCR products in ice bath are added into the buffer of the sensor well at room temperature, there will be a temperature change process during mixing. However, it still remains unclear whether the temperature change affects the frequency baseline stability of the sensor and the result judgment, which is the basic condition for detecting hybridization of nucleic acid. In this study, we detected the hybridization of HPV PCR products during temperature change process by a self-designed adjustable metal-clamping piezoelectric sensor. The study mainly involves sensor adjustment, probe immobilization and ice bath sample addition (at different concentrations and different volumes). The response curve of basic frequency in temperature change process showed three stages, i.e., increase, decrease to baseline, and continuous decrease to stability. The early increase of frequency and duration of the time can reach 55+/-7.4 Hz and 39 min when 40 microL sample (0-1 degrees C) was added into 110 microL buffer (25 degrees C). The frequency increase effect caused by temperature difference at early stage depends on the volume ratio of two liquids and on the temperature difference. The results indicate that we should pay more attention to possibly small volume of PCR products in ice bath and minor temperature difference of two liquids in operation. 2010 Elsevier B.V. All rights reserved.

  5. EFFECTOR OF TRANSCRIPTION2 is involved in xylem differentiation and includes a functional DNA single strand cutting domain.

    Science.gov (United States)

    Ivanov, Rumen; Tiedemann, Jens; Czihal, Andreas; Schallau, Anna; Diep, Le Hong; Mock, Hans-Peter; Claus, Bernhard; Tewes, Annegret; Bäumlein, Helmut

    2008-01-01

    EFFECTORS OF TRANSCRIPTION2 (ET) are plant-specific regulatory proteins characterized by the presence of two to five C-terminal DNA- and Zn-binding repeats, and a highly conserved cysteine pattern. We describe the structural characterization of the three member Arabidopsis thaliana ET gene family and reveal some allelic sequence polymorphisms. A mutation analysis showed that AtET2 affects the expression of various KNAT genes involved in the maintenance of the undifferentiated state of cambial meristem cells. It also plays a role in the regulation of GA5 (gibberellin 3-beta-dioxygenase) and the cell-cycle-related GASA4. A correlation was established between AtET2 expression and the cellular differentiation state. AtET-GFP fusion proteins shuttle between the cytoplasm and nucleus, with the AtET2 product prevented from entering the nucleus in non-differentiating cells. Within the nucleus, AtET2 probably acts via a single strand cutting domain. A more general regulatory role for ET factors is proposed, governing cell differentiation in cambial meristems, a crucial process for the development of plant vascular tissues.

  6. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  7. Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1

    DEFF Research Database (Denmark)

    Yang, Jay; Bachrati, Csanad Z; Ou, Jiongwen

    2010-01-01

    -passage mechanism. We generated single-stranded catenanes that resemble the proposed dissolution intermediate recognized by human topoisomerase IIIalpha. We demonstrate that human topoisomerase IIIalpha is a single-stranded DNA decatenase that is specifically stimulated by the BLM-RMI1 pair. In addition, RMI1......Human topoisomerase IIIalpha is a type IA DNA topoisomerase that functions with BLM and RMI1 to resolve DNA replication and recombination intermediates. BLM, human topoisomerase IIIalpha, and RMI1 catalyze the dissolution of double Holliday junctions into noncrossover products via a strand...

  8. Oxidized base damage and single-strand break repair in mammalian genomes: role of disordered regions and posttranslational modifications in early enzymes.

    Science.gov (United States)

    Hegde, Muralidhar L; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic endonuclease 1 (APE1), form complexes with downstream repair (and other noncanonical) proteins via pairwise interactions. Furthermore, a unique feature of mammalian early BER/SSBR enzymes is the presence of a disordered terminal extension that is absent in their Escherichia coli prototypes. These nonconserved segments usually contain organelle-targeting signals, common interaction interfaces, and sites of posttranslational modifications that may be involved in regulating their repair function including lesion scanning. Finally, the linkage of BER/SSBR deficiency to cancer, aging, and human neurodegenerative diseases, and therapeutic targeting of BER/SSBR are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples.

    Science.gov (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J

    2006-03-01

    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  10. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.

    2012-01-01

    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  11. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues

    Science.gov (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak

    2006-01-01

    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  12. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos

    2015-09-01

    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  13. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair

    Science.gov (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.

    2009-01-01

    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  14. Substrate-assisted 2D DNA lattices and algorithmic lattices from single-stranded tiles.

    Science.gov (United States)

    Kim, Junghoon; Ha, Tai Hwan; Park, Sung Ha

    2015-08-07

    We present a simple route to circumvent kinetic traps which affect many types of DNA nanostructures in their self-assembly process. Using this method, a new 2D DNA lattice made up of short, single-stranded tile (SST) motifs was created. Previously, the growth of SST DNA assemblies was restricted to 1D (tubes and ribbons) or finite-sized 2D (molecular canvases). By utilizing the substrate-assisted growth method, sets of SSTs were designed as unit cells to self-assemble into periodic and aperiodic 2D lattices which continuously grow both along and orthogonal to the helical axis. Notably, large-scale (∼1 μm(2)) fully periodic 2D lattices were fabricated using a minimum of just 2 strand species. Furthermore, the ability to create 2D lattices from a few motifs enables certain rules to be encoded into these SSTs to carry out algorithmic self-assembly. A set of these motifs was designed to execute simple 1-input 1-output COPY and NOT algorithms, the space-time manifestations which were aperiodic 2D algorithmic SST lattices. The methodology presented here can be straightforwardly applied to other motifs which fall into this type of kinetic trap to create novel DNA crystals.

  15. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol

    2010-05-01

    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  16. Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems.

    Science.gov (United States)

    Musumeci, Domenica; Rozza, Lucia; Merlino, Antonello; Paduano, Luigi; Marzo, Tiziano; Massai, Lara; Messori, Luigi; Montesarchio, Daniela

    2015-08-21

    The interaction of the anticancer Ru(iii) complex AziRu - in comparison with its analogue NAMI-A, currently in advanced clinical trials as an antimetastatic agent - with DNA model systems, both single stranded and duplex oligonucleotides, was investigated using a combined approach, including absorption UV-vis spectroscopy, circular dichroism (CD) and electrospray mass spectrometry (ESI-MS) techniques. UV-vis absorption spectra of the Ru complexes were recorded at different times in a pseudo-physiological solution, to monitor the ligand exchange processes in the absence and in the presence of the examined oligonucleotides. CD experiments provided information on the overall conformational changes of the DNA model systems induced by these metal complexes. UV- and CD-monitored thermal denaturation studies were performed to analyse the effects of AziRu and NAMI-A on the stability of the duplex structures. ESI-MS experiments, carried out on the oligonucleotide/metal complex mixtures under investigation, allowed us to detect the formation of stable adducts between the guanine-containing oligomers and the ruthenium complexes. These data unambiguously demonstrate that both AziRu and NAMI-A can interact with the DNA model systems. Although very similar in their structures, the two metal compounds manifest a markedly different reactivity with the examined sequences, respectively, with either a naked Ru(3+) ion or a Ru(Im)(3+) (Im = imidazole) fragment being incorporated into the oligonucleotide structure via stable linkages.

  17. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong

    2008-01-01

    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  18. In vitro selection and characterization of single stranded DNA aptamers for luteolin: A possible recognition tool.

    Science.gov (United States)

    Tuma Sabah, Jinan; Zulkifli, Razauden Mohamed; Shahir, Shafinaz; Ahmed, Farediah; Abdul Kadir, Mohammed Rafiq; Zakaria, Zarita

    2018-03-06

    Distinctive bioactivities possessed by luteolin (3', 4', 5, 7-tetrahydroxy-flavone) are advantageous for sundry practical applications. This paper reports the in vitro selection and characterization of single stranded-DNA (ssDNA) aptamers, specific for luteolin (LUT). 76-mer library containing 1015 randomized ssDNA were screened via systematic evolution of ligands by exponential enrichment (SELEX). The recovered ssDNA pool from the 8th round was amplified with unlabeled primers and cloned into PSTBlue-1 vector prior to sequencing. 22 of LUT-binding aptamer variants were further classified into one of the seven groups based on their N40 random sequence regions, wherein one representative from each group was characterized. The dissociation constant of aptamers designated as LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively with high binding affinity towards LUT. Prediction analysis of the secondary structure suggested discrete features with typical loop and stem motifs. Furthermore, LUT#3 displayed higher specificity with insignificant binding toward kaempferol and quercetin despite its structural and functional similarity compared to LUT#28 and LUT#20. Further LUT#3 can detect free luteolin within 0.2-1 mM in solution. It was suggested that LUT#3 aptamer were the most suitable for LUT recognition tool at laboratory scale based on the condition tested. Copyright © 2018. Published by Elsevier Inc.

  19. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska

    2017-12-01

    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  20. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.

    1985-01-01

    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  1. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Assessing single-stranded oligonucleotide drug-induced effects in vitro reveals key risk factors for thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Sabine Sewing

    Full Text Available Single-stranded oligonucleotides (ON comprise a promising therapeutic platform that enables selective modulation of currently undruggable targets. The development of novel ON drug candidates has demonstrated excellent efficacy, but in certain cases also some safety liabilities were reported. Among them are events of thrombocytopenia, which have recently been evident in late stage trials with ON drugs. The underlying mechanisms are poorly understood and the risk for ON candidates causing such events cannot be sufficiently assessed pre-clinically. We investigated potential thrombocytopenia risk factors of ONs and implemented a set of in vitro assays to assess these risks. Our findings support previous observations that phosphorothioate (PS-ONs can bind to platelet proteins such as platelet collagen receptor glycoprotein VI (GPVI and activate human platelets in vitro to various extents. We also show that these PS-ONs can bind to platelet factor 4 (PF4. Binding to platelet proteins and subsequent activation correlates with ON length and connected to this, the number of PS in the backbone of the molecule. Moreover, we demonstrate that locked nucleic acid (LNA ribosyl modifications in the wings of the PS-ONs strongly suppress binding to GPVI and PF4, paralleled by markedly reduced platelet activation. In addition, we provide evidence that PS-ONs do not directly affect hematopoietic cell differentiation in culture but at higher concentrations show a pro-inflammatory potential, which might contribute to platelet activation. Overall, our data confirm that certain molecular attributes of ONs are associated with a higher risk for thrombocytopenia. We propose that applying the in vitro assays discussed here during the lead optimization phase may aid in deprioritizing ONs with a potential to induce thrombocytopenia.

  3. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  4. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA.

    Science.gov (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee

    2011-03-24

    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  5. Synthesis of a wild-type and three mutant Cucurbita maxima trypsin inhibitor-encoding genes by a single-strand approach.

    Science.gov (United States)

    Botes, D P; Qobose, M D; Corfield, V A

    1991-09-15

    A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.

  6. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  7. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.

    1995-01-01

    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  8. A high throughput system for the preparation of single stranded templates grown in microculture.

    Science.gov (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M

    1994-01-01

    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  9. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)

    1994-09-01

    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  10. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses.

    Science.gov (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn

    2011-06-01

    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  11. The casein genes in goat breeds from different Continents: analysis by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP

    Directory of Open Access Journals (Sweden)

    A. Caroli

    2010-04-01

    Full Text Available A screening of casein gene variability was carried out by Polymerase Chain Reaction – Single Strand Conformation Polymorphism in 8 goat breeds from Sudan (Nubian goat, Turkey (Angora Goat Lalahan Tiftic, Angora Goat Yerkoy, Hair goat and India (Jammu, Maharashtra, Rajasthan, South Goat. A total of 16 different alleles or groups of alleles were found, showing conspicuous differences among breeds. The allele frequencies were submitted to cluster analysis in order to highlight differences between breeds, also including data from Red Sokoto, West African Dwarf Nigeria, West African Dwarf Cameroon, and Borno Goat. The tree obtained from the cluster analysis showed two main lineages. The West African goat clustered together, the Indian and Turkish breeds were in the other group. Nubian goat was found in an intermediate position.

  12. Electrical conduction and photoresponses of gamma-ray-irradiated single-stranded DNA/single-walled carbon nanotube composite systems

    Energy Technology Data Exchange (ETDEWEB)

    Hong, W.; Lee, E.M.; Kim, D.W.; Lee, Cheol Eui, E-mail: rscel@korea.ac.kr

    2015-04-15

    Highlights: •Effects of gamma-ray irradiation on single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. •Barrier for thermally activated conduction in the composite systems modified by the gamma-ray irradiation. •Photoresponses reveal photoexcitation and oxygen photodesorption modified by gamma-ray irradiation. -- Abstract: Effects of gamma-ray irradiation on the electrical conductivity and photoresponse have been studied for single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. The temperature-dependent electrical conductivity of the ssDNA/SWNT composite films, well described by a fluctuation-induced tunneling model, indicated modification of the barrier for thermally activated conduction by the gamma-ray irradiation. Besides, the photoresponse measurements indicated modified photoexcited charge carrier generation and oxygen photodesorption in the composite systems due to the gamma-ray irradiation.

  13. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    Science.gov (United States)

    2014-09-30

    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  14. Selective binding and reverse transcription inhibition of single-strand poly(A) RNA by metal TMPyP complexes.

    Science.gov (United States)

    Zhou, Zhu-Xin; Gao, Feng; Chen, Xing; Tian, Xiang-Jing; Ji, Liang-Nian

    2014-10-06

    Ni-, Cu-, and Zn-TMPyP are capable of binding to single-strand poly(A) RNA with high preference and affinity and inhibiting the reverse transcription of RNA by both M-MuLV and HIV-1 reverse transcriptase. With 10 nM azidothymidine, the IC50 value of M-TMPyP could be lowered to 10(-1) μM order.

  15. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.

    2013-01-01

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  16. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.

    1977-01-01

    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  17. Evidence that single-stranded DNA breaks are a normal feature of koala sperm chromatin, while double-stranded DNA breaks are indicative of DNA damage.

    Science.gov (United States)

    Zee, Yeng Peng; López-Fernández, Carmen; Arroyo, F; Johnston, Stephen D; Holt, William V; Gosalvez, Jaime

    2009-08-01

    In this study, we have used single and double comet assays to differentiate between single- and double-stranded DNA damage in an effort to refine the interpretation of DNA damage in mature koala spermatozoa. We have also investigated the likelihood that single-stranded DNA breakage is part of the natural spermiogenic process in koalas, where its function would be the generation of structural bends in the DNA molecule so that appropriate packaging and compaction can occur. Koala spermatozoa were examined using the sperm chromatin dispersion test (SCDt) and comet assays to investigate non-orthodox double-stranded DNA. Comet assays were conducted under 1) neutral conditions; and 2) neutral followed by alkaline conditions (double comet assay); the latter technique enabled simultaneous visualisation of both single-stranded and double-stranded DNA breaks. Following the SCDt, there was a continuum of nuclear morphotypes, ranging from no apparent DNA fragmentation to those with highly dispersed and degraded chromatin. Dispersion morphotypes were mirrored by a similar diversity of comet morphologies that could be further differentiated using the double comet assay. The majority of koala spermatozoa had nuclei with DNA abasic-like residues that produced single-tailed comets following the double comet assay. The ubiquity of these residues suggests that constitutive alkali-labile sites are part of the structural configuration of the koala sperm nucleus. Spermatozoa with 'true' DNA fragmentation exhibited a continuum of comet morphologies, ranging from a more severe form of alkaline-susceptible DNA with a diffuse single tail to nuclei that exhibited both single- and double-stranded breaks with two comet tails.

  18. Functional roles of the N- and C-terminal regions of the human mitochondrial single-stranded DNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Marcos T Oliveira

    2010-10-01

    Full Text Available Biochemical studies of the mitochondrial DNA (mtDNA replisome demonstrate that the mtDNA polymerase and the mtDNA helicase are stimulated by the mitochondrial single-stranded DNA-binding protein (mtSSB. Unlike Escherichia coli SSB, bacteriophage T7 gp2.5 and bacteriophage T4 gp32, mtSSBs lack a long, negatively charged C-terminal tail. Furthermore, additional residues at the N-terminus (notwithstanding the mitochondrial presequence are present in the sequence of species across the animal kingdom. We sought to analyze the functional importance of the N- and C-terminal regions of the human mtSSB in the context of mtDNA replication. We produced the mature wild-type human mtSSB and three terminal deletion variants, and examined their physical and biochemical properties. We demonstrate that the recombinant proteins adopt a tetrameric form, and bind single-stranded DNA with similar affinities. They also stimulate similarly the DNA unwinding activity of the human mtDNA helicase (up to 8-fold. Notably, we find that unlike the high level of stimulation that we observed previously in the Drosophila system, stimulation of DNA synthesis catalyzed by human mtDNA polymerase is only moderate, and occurs over a narrow range of salt concentrations. Interestingly, each of the deletion variants of human mtSSB stimulates DNA synthesis at a higher level than the wild-type protein, indicating that the termini modulate negatively functional interactions with the mitochondrial replicase. We discuss our findings in the context of species-specific components of the mtDNA replisome, and in comparison with various prokaryotic DNA replication machineries.

  19. Investigation of single-strand conformational polymorphism of the TP53 gene in women with a family history of breast cancer

    Directory of Open Access Journals (Sweden)

    R.R. Burbano

    2000-11-01

    Full Text Available Breast cancer in families with germ line mutations in the TP53 gene has been described in the medical literature. Mutation screening for susceptibility genes should allow effective prophylactic and preventive measures. Using single-strand conformational polymorphism, we screened for mutations in exons 5, 6, 7 and 8 of gene TP53 in the peripheral blood of 8 young non-affected members (17 to 36 years old of families with a history of breast cancer. Studies of this type on young patients (mean age, 25 years are very rare in the literature. The identification of these mutations would contribute to genetic counseling of members of families with predisposition to breast cancer. The results obtained did not show any polymorphism indicating mutation. In our sample, the familial tumorigenesis is probably related to other gene etiologies.

  20. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes

    OpenAIRE

    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  1. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris

    2016-01-01

    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA-binding pro......Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...... leads to enhanced cooperative binding to DNA.Conclusions: Our findings contribute to the emerging picture that bacterial proteins, exemplified here by SsbA, undergo phosphorylation at multiple residues. This results in a complex regulation of cellular functions, and suggests that the complexity...

  2. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  3. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide

    Science.gov (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio

    1998-01-01

    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  4. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism.

    Science.gov (United States)

    Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong

    2016-07-01

    A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.

  5. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles.

    Science.gov (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng

    2015-11-21

    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  6. Human Rad51 filaments on double- and single-stranded DNA: correlating regular and irregular forms with recombination function.

    NARCIS (Netherlands)

    D. Ristic (Dejan); M. Modesti (Mauro); T. van der Heijden (Thijn); J. Noort (John); C. Dekker (Cees); R. Kanaar (Roland); C. Wyman (Claire)

    2005-01-01

    textabstractRecombinase proteins assembled into helical filaments on DNA are believed to be the catalytic core of homologous recombination. The assembly, disassembly and dynamic rearrangements of this structure must drive the DNA strand exchange reactions of homologous recombination. The sensitivity

  7. Human Rad51 filaments on double- and single-stranded DNA : Correlating regular and irregular forms with recombination function

    NARCIS (Netherlands)

    Ristic, D.; Modesti, M.; Van der Heijden, T.; Van Noort, J.; Dekker, C.; Kanaar, R.; Wyman, C.

    Recombinase proteins assembled into helical filaments on DNA are believed to be the catalytic core of homologous recombination. The assembly, disassembly and dynamic rearrangements of this structure must drive the DNA strand exchange reactions of homologous recombination. The sensitivity of

  8. Increased type I collagen content and DNA binding activity of a single-stranded, cytosine-rich sequence in the high-salt buffer protein extract of the copper-deficient rat heart.

    Science.gov (United States)

    Zeng, Huawei; Saari, Jack T

    2004-11-01

    Dietary copper (Cu) deficiency not only causes a hypertrophic cardiomyopathy but also increases cancer risk in rodent models. However, a possible alteration in gene expression has not been fully examined. The present study was undertaken to determine the effect of Cu deficiency on protein profiles in rat heart tissue. Male Sprague-Dawley rats were fed diets that were either a Cu-adequate diet (6.0 microg Cu/g diet, n = 6) or a Cu-deficient diet (0.3 microg Cu/g diet, n = 6) for 5 weeks. The high-salt buffer (HSB) protein extract from heart tissue of Cu-deficient, but not Cu-adequate rats showed a 132 kDa protein band by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. This protein band stained pink with Coomassie Blue, suggesting the presence of collagens or other proline-rich proteins. Dot immunoblotting demonstrated that total type I collagen was increased by 110% in HSB protein extract from Cu-deficient, relative to Cu-adequate, rats. Liquid chromatography with mass spectrometry analysis indicated that the 132 kDa protein band contained a collagen alpha (I) chain precursor as well as a leucine-rich protein 130 (LRP130) in HSB protein extract from Cu-deficient but not Cu-adequate rats. A gel shift assay showed that HSB protein extract from Cu-deficient rats bound to a single-stranded cytosine-rich DNA with higher affinity than the extract of Cu-adequate rats, similar to reports of an increase in LRP130 single-stranded DNA binding activity in several types of tumor cells. Collectively, these results not only suggest an additional feature of altered collagen metabolism with Cu deficiency but also demonstrate for the first time an increase in single-stranded cytosine-rich DNA binding in Cu-deficient rat heart.

  9. Integrative modelling coupled with ion mobility mass spectrometry reveals structural features of the clamp loader in complex with single-stranded DNA binding protein.

    Science.gov (United States)

    Politis, Argyris; Park, Ah Young; Hall, Zoe; Ruotolo, Brandon T; Robinson, Carol V

    2013-11-29

    DNA polymerase III, a decameric 420-kDa assembly, simultaneously replicates both strands of the chromosome in Escherichia coli. A subassembly of this holoenzyme, the seven-subunit clamp loader complex, is responsible for loading the sliding clamp (β2) onto DNA. Here, we use structural information derived from ion mobility mass spectrometry (IM-MS) to build three-dimensional models of one form of the full clamp loader complex, γ3δδ'ψχ (254 kDa). By probing the interaction between the clamp loader and a single-stranded DNA (ssDNA) binding protein (SSB4) and by identifying two distinct conformational states, with and without ssDNA, we assemble models of ψχ-SSB4 (108 kDa) and the clamp loader-SSB4 (340 kDa) consistent with IM data. A significant increase in measured collision cross-section (~10%) of the clamp loader-SSB4 complex upon DNA binding suggests large conformational rearrangements. This DNA bound conformation represents the active state and, along with the presence of ψχ, stabilises the clamp loader-SSB4 complex. Overall, this study of a large heteromeric complex analysed by IM-MS, coupled with integrative modelling, highlights the potential of such an approach to reveal structural features of previously unknown complexes of high biological importance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Characterization of a Novel Megabirnavirus from Sclerotinia sclerotiorum Reveals Horizontal Gene Transfer from Single-Stranded RNA Virus to Double-Stranded RNA Virus.

    Science.gov (United States)

    Wang, Minghong; Wang, Yong; Sun, Xiangzhong; Cheng, Jiasen; Fu, Yanping; Liu, Huiquan; Jiang, Daohong; Ghabrial, Said A; Xie, Jiatao

    2015-08-01

    Mycoviruses have been detected in all major groups of filamentous fungi, and their study represents an important branch of virology. Here, we characterized a novel double-stranded RNA (dsRNA) mycovirus, Sclerotinia sclerotiorum megabirnavirus 1 (SsMBV1), in an apparently hypovirulent strain (SX466) of Sclerotinia sclerotiorum. Two similarly sized dsRNA segments (L1- and L2-dsRNA), the genome of SsMBV1, are packaged in rigid spherical particles purified from strain SX466. The full-length cDNA sequence of L1-dsRNA/SsMBV1 comprises two large open reading frames (ORF1 and ORF2), which encode a putative coat protein and an RNA-dependent RNA polymerase (RdRp), respectively. Phylogenetic analysis of the RdRp domain clearly indicates that SsMBV1 is related to Rosellinia necatrix megabirnavirus 1 (RnMBV1). L2-dsRNA/SsMBV1 comprises two nonoverlapping ORFs (ORFA and ORFB) encoding two hypothetical proteins with unknown functions. The 5'-terminal regions of L1- and L2-dsRNA/SsMBV1 share strictly conserved sequences and form stable stem-loop structures. Although L2-dsRNA/SsMBV1 is dispensable for replication, genome packaging, and pathogenicity of SsMBV1, it enhances transcript accumulation of L1-dsRNA/SsMBV1 and stability of virus-like particles (VLPs). Interestingly, a conserved papain-like protease domain similar to a multifunctional protein (p29) of Cryphonectria hypovirus 1 was detected in the ORFA-encoded protein of L2-dsRNA/SsMBV1. Phylogenetic analysis based on the protease domain suggests that horizontal gene transfer may have occurred from a single-stranded RNA (ssRNA) virus (hypovirus) to a dsRNA virus, SsMBV1. Our results reveal that SsMBV1 has a slight impact on the fundamental biological characteristics of its host regardless of the presence or absence of L2-dsRNA/SsMBV1. Mycoviruses are widespread in all major fungal groups, and they possess diverse genomes of mostly ssRNA and dsRNA and, recently, circular ssDNA. Here, we have characterized a novel dsRNA virus

  11. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Vrushali S. [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Gokhale, Suresh P.; Patil, Kashinath R. [Physical and Material Chemistry Division, National Chemical Laboratory, Pune (India); Haram, Santosh K., E-mail: haram@chem.unipune.ernet.i [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)

    2010-02-15

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 +- 2 mum and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, alpha-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k{sup 0}) and electron transfer coefficient (alpha) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  12. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    International Nuclear Information System (INIS)

    Joshi, Vrushali S.; Gokhale, Suresh P.; Patil, Kashinath R.; Haram, Santosh K.

    2010-01-01

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 ± 2 μm and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, α-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k 0 ) and electron transfer coefficient (α) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  13. Quenching of Single-Walled Carbon Nanotube Fluorescence by Dissolved Oxygen Reveals Selective Single-Stranded DNA Affinities.

    Science.gov (United States)

    Zheng, Yu; Bachilo, Sergei M; Weisman, R Bruce

    2017-05-04

    The selective interactions between short oligomers of single-stranded DNA (ssDNA) and specific structures of single-walled carbon nanotubes have been exploited in powerful methods for nanotube sorting. We report here that nanotubes coated with ssDNA also display selective interactions through the selective quenching of nanotube fluorescence by dissolved oxygen. In aqueous solutions equilibrated under 1 atm of O 2 , emission intensity from semiconducting nanotubes is reduced by between 9 and 40%, varying with the combination of ssDNA sequence and nanotube structure. This quenching reverses promptly and completely on the removal of dissolved O 2 and may be due to physisorption on nanotube surfaces. Fluorescence quenching offers a simple, nondestructive approach for studying the structure-selective interactions of ssDNA with single-walled carbon nanotubes and identifying recognition sequences.

  14. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D

    2010-01-01

    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  15. Charge enhancement of single-stranded DNA in negative electrospray ionization using the supercharging reagent meta-nitrobenzyl alcohol.

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1% m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1% m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  16. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  17. Aptamer based voltammetric determination of ampicillin using a single-stranded DNA binding protein and DNA functionalized gold nanoparticles.

    Science.gov (United States)

    Wang, Jun; Ma, Kui; Yin, Huanshun; Zhou, Yunlei; Ai, Shiyun

    2017-12-20

    An aptamer based method is described for the electrochemical determination of ampicillin. It is based on the use of DNA aptamer, DNA functionalized gold nanoparticles (DNA-AuNPs), and single-stranded DNA binding protein (ssDNA-BP). When the aptamer hybridizes with the target DNA on the AuNPs, the ssDNA-BP is captured on the electrode surface via its specific interaction with ss-DNA. This results in a decreased electrochemical signal of the redox probe Fe(CN) 6 3- which is measured best at a voltage of 0.188 mV (vs. reference electrode). In the presence of ampicillin, the formation of aptamer-ampicillin conjugate blocks the further immobilization of DNA-AuNPs and ssDNA-BP, and this leads to an increased response. The method has a linear reposne that convers the 1 pM to 5 nM ampicillin concentration range, with a 0.38 pM detection limit (at an S/N ratio of 3). The assay is selective, stable and reproducible. It was applied to the determination of ampicillin in spiked milk samples where it gave recoveries ranging from 95.5 to 105.5%. Graphical abstract Schematic of a simple and sensitive electrochemical apta-biosensor for ampicillin detection. It is based on the use of gold nanoparticles (AuNPs), DNA aptamer, DNA functionalized AuNPs (DNA-AuNPs), and single-strand DNA binding protein (SSBP).

  18. A biomarker model of sublethal genotoxicity (DNA single-strand breaks and adducts) using the sentinel organism Aporrectodea longa in spiked soil

    International Nuclear Information System (INIS)

    Martin, Francis L.; Piearce, Trevor G.; Hewer, Alan; Phillips, David H.; Semple, Kirk T.

    2005-01-01

    There is a need to develop risk biomarkers during the remediation of contaminated land. We employed the earthworm, Aporrectodea longa (Ude), to determine whether genotoxicity measures could be applied to this organism's intestinal tissues. Earthworms were added, for 24 h or 7 days, to soil samples spiked with benzo[a]pyrene (B[a]P) and/or lindane. After exposure, intestinal tissues (crop/gizzard or intestine) were removed prior to the measurement in disaggregated cells of DNA single-strand breaks (SSBs) by the alkaline comet assay. Damage was quantified by comet tail length (CTL, μm). B[a]P 24-h exposure induced dose-related increases (P 32 P-postlabelling, showed a two-adduct-spot pattern. This preliminary investigation suggests that earthworm tissues may be incorporated into genotoxicity assays to facilitate hazard identification within terrestrial ecosystems. - Sublethal genotoxicity in the sentinel organism A. longa can be used to monitor the effects of contaminants in soil

  19. Conformation effects of CpG methylation on single-stranded DNA oligonucleotides: analysis of the opioid peptide dynorphin-coding sequences.

    Directory of Open Access Journals (Sweden)

    Malik Mumtaz Taqi

    Full Text Available Single-stranded DNA (ssDNA is characterized by high conformational flexibility that allows these molecules to adopt a variety of conformations. Here we used native polyacrylamide gel electrophoresis (PAGE, circular dichroism (CD spectroscopy and nuclear magnetic resonance (NMR spectroscopy to show that cytosine methylation at CpG sites affects the conformational flexibility of short ssDNA molecules. The CpG containing 37-nucleotide PDYN (prodynorphin fragments were used as model molecules. The presence of secondary DNA structures was evident from differences in oligonucleotide mobilities on PAGE, from CD spectra, and from formation of A-T, G-C, and non-canonical G-T base pairs observed by NMR spectroscopy. The oligonucleotides displayed secondary structures at 4°C, and some also at 37°C. Methylation at CpG sites prompted sequence-dependent formation of novel conformations, or shifted the equilibrium between different existing ssDNA conformations. The effects of methylation on gel mobility and base pairing were comparable in strength to the effects induced by point mutations in the DNA sequences. The conformational effects of methylation may be relevant for epigenetic regulatory events in a chromatin context, including DNA-protein or DNA-DNA recognition in the course of gene transcription, and DNA replication and recombination when double-stranded DNA is unwinded to ssDNA.

  20. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    Science.gov (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system.

    Science.gov (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus

    2011-04-06

    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  2. A simple identification method for spore-forming bacteria showing high resistance against γ-rays

    International Nuclear Information System (INIS)

    Koshikawa, Tomihiko; Sone, Koji; Kobayashi, Toshikazu

    1993-01-01

    A simple identification method was developed for spore-forming bacteria which are highly resistant against γ-rays. Among 23 species of Bacillus studied, the spores of Bacillus megaterium, B. cereus, B. thuringiensis, B. pumilus and B. aneurinolyticus showed high resistance against γ-rays as compared with other spores of Bacillus species. Combination of the seven kinds of biochemical tests, namely, the citrate utilization test, nitrate reduction test, starch hydrolysis test, Voges-Proskauer reaction test, gelatine hydrolysis test, mannitol utilization test and xylose utilization test showed a characteristic pattern for each species of Bacillus. The combination pattern of each the above tests with a few supplementary test, if necessary, was useful to identify Bacillus species showing high radiation resistance against γ-rays. The method is specific for B. megaterium, B. thuringiensis and B. pumilus, and highly selective for B. aneurinolyticus and B. cereus. (author)

  3. Normal rat kidney cells secrete both phosphorylated and nonphosphorylated forms of osteopontin showing different physiological properties

    International Nuclear Information System (INIS)

    Nemir, M.; DeVouge, M.W.; Mukherjee, B.B.

    1989-01-01

    We have reported previously that the 69-kDa major phosphoprotein, secreted by normal rat kidney (NRK) cells, is osteopontin, a glycosylated bone matrix protein. Here we show that this 69-kDa osteopontin is secreted by NRK cells in both phosphorylated (pp69) and nonphosphorylated (np69) forms, with estimated isoelectric points of 3.8 and 4.5, respectively. Electrophoretic analysis of radioiodinated cell surface proteins immunoprecipitated with an anti-69-kDa osteopontin serum, demonstrates that the 69-kDa osteopontin is also present on the cell surface, but only its phosphorylated form (pp69) shows such cell surface association. Because osteopontin mediates cell adhesion and spreading, and contains an Arg-Gly-Asp-Ser cell-binding sequence, our observations strongly suggest that the cell surface localization of pp69 osteopontin is receptor-mediated, and the modification by phosphorylation may be crucial for its receptor binding activity. We also report that antisera directed against either fibronectin or 69-kDa osteopontin co-immunoprecipitate both np69 osteopontin and fibronectin as a heat-dissociable complex. In contrast, pp69 osteopontin does not co-precipitate with fibronectin. Furthermore, compared to NRK cells, vanadyl sulfate-treated NRK cells which acquire a reversible transformed phenotype, including anchorage-independent growth, show increased levels of pp69 on the cell surface, concomitant with significantly decreased levels of pp69 and elevated levels of np69 in the conditioned media. The data presented here establish transformation sensitivity of NRK cell-secreted osteopontin with respect to its secretion and cell surface localization, and demonstrate that phosphorylated and nonphosphorylated forms of osteopontin have different physiological properties, which may regulate the functional roles of this extracellular matrix protein

  4. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-01

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  5. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin.

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-13

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecule, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G • U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G • U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  6. Identification and characterization of single-stranded DNA-binding protein from the facultative psychrophilic bacteria Pseudoalteromonas haloplanktis.

    Science.gov (United States)

    Olszewski, Marcin; Nowak, Marta; Cyranka-Czaja, Anna; Kur, Józef

    2014-01-01

    Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism such as DNA replication, repair, and recombination, and is essential for cell survival. This study reports on the ssb-like gene cloning, gene expression and characterization of a single-stranded DNA-binding protein of Pseudoalteromonas haloplanktis (PhaSSB) and is the first report of such a protein from psychrophilic microorganism. PhaSSB possesses a high sequence similarity to Escherichia coli SSB (48% identity and 57% similarity) and has the longest amino acid sequence (244 amino acid residues) of all the known bacterial SSBs with one OB-fold per monomer. An analysis of purified PhaSSB by means of chemical cross-linking experiments, sedimentation analysis and size exclusion chromatography revealed a stable tetramer in solution. Using EMSA, we characterized the stoichiometry of PhaSSB complexed with a series of ssDNA homopolymers, and the size of the binding site was determined as being approximately 35 nucleotides long. In fluorescence titrations, the occluded site size of PhaSSB on poly(dT) is 34 nucleotides per tetramer under low-salt conditions (2mM NaCl), but increases to 54-64 nucleotides at higher-salt conditions (100-300mM NaCl). This suggests that PhaSSB undergoes a transition between ssDNA binding modes, which is observed for EcoSSB. The binding properties of PhaSSB investigated using SPR technology revealed that the affinity of PhaSSB to ssDNA is typical of SSB proteins. The only difference in the binding mode of PhaSSB to ssDNA is a faster association phase, when compared to EcoSSB, though compensated by faster dissociation rate. When analyzed by differential scanning calorimetry (DSC), the melting temperature (Tm) was determined as 63 °C, which is only a few degrees lower than for EcoSSB. Copyright © 2013 Elsevier GmbH. All rights reserved.

  7. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: skim1@lsuhsc.edu [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  8. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee

    2012-01-01

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  9. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der

    1978-01-01

    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  10. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.

    1982-01-01

    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  11. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

    1982-01-01

    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  12. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.

    2006-01-01

    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  13. Reaction mixtures formed by nitrite and selected sulfa-drugs showed mutagenicity in acidic medium

    Directory of Open Access Journals (Sweden)

    Claudia Trossero

    2009-01-01

    Full Text Available Nitrite, which is present in preserved meat and can be produced in the oral cavity by reduction of nitrate taken from vegetables, could react in stomach with nitrosatable drugs, giving genotoxic-carcinogenic N-nitroso compounds (NOC. The mutagenicity of reaction mixtures formed by sodium nitrite and selected sulfa-drugs (sulfathiazole, HST; phtalylsulfathiazole, PhST; complex Co(II-sulfathiazole, Co(II-ST in acidic medium was evaluated using the Salmonella typhimurium reverse mutation assay (Ames test, with TA98 and TA 100 strains. The reactions were carried out at room temperature, with a mole ratio [nitrite]/[sulfa-drug] > 1. The three reaction mixtures showed mutagenic effects in the considered range.

  14. Heterochromatin Reorganization during Early Mouse Development Requires a Single-Stranded Noncoding Transcript

    Directory of Open Access Journals (Sweden)

    Miguel Casanova

    2013-09-01

    Full Text Available The equalization of pericentric heterochromatin from distinct parental origins following fertilization is essential for genome function and development. The recent implication of noncoding transcripts in this process raises questions regarding the connection between RNA and the nuclear organization of distinct chromatin environments. Our study addresses the interrelationship between replication and transcription of the two parental pericentric heterochromatin (PHC domains and their reorganization during early embryonic development. We demonstrate that the replication of PHC is dispensable for its clustering at the late two-cell stage. In contrast, using parthenogenetic embryos, we show that pericentric transcripts are essential for this reorganization independent of the chromatin marks associated with the PHC domains. Finally, our discovery that only reverse pericentric transcripts are required for both the nuclear reorganization of PHC and development beyond the two-cell stage challenges current views on heterochromatin organization.

  15. Ion Density Analysis of Single-Stranded DNA in Liquid Crystal

    Science.gov (United States)

    Iwabata, Kazuki; Seki, Yasutaka; Toizumi, Ryota; Shimada, Yuki; Furue, Hirokazu; Sakaguchi, Kengo

    2013-09-01

    With the widespread use of liquid crystals (LCs) in liquid crystal displays, we have looked into the application of liquid crystals in biotechnology. The purpose of the study described here is to investigate the physical properties of DNA using LCs. Synthetic oligonucleotide molecules were dispersed in MLC6884, the sample injected into antiparallel cells, and the amount of mobile ions was measured. The LC cell doped with oligonucleotide molecules showed a sequence-dependent, specific correlation between oligonucleotide concentration and the amount of mobile ions in the LC cells. In the framework of the Stokes model and polyacrylamide gel electrophoresis (PAGE) analysis, we speculate that this result arises from the difference in ion mobility, which is caused by the shape of the oligonucleotide molecule in the LC.

  16. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-04-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  17. Differentiation of Short Single-Stranded DNA Homopolymers in Solid-State Nanopores

    Science.gov (United States)

    Venta, Kimberly; Shemer, Gabriel; Puster, Matthew; Rodríguez-Manzo, Julio A.; Balan, Adrian; Rosenstein, Jacob K.; Shepard, Ken; Drndić, Marija

    2013-01-01

    In the last two decades, new techniques that monitor ionic current modulations as single molecules pass through a nanoscale pore have enabled numerous single-molecule studies. While biological nanopores have recently shown the ability to resolve single nucleotides within individual DNA molecules, similar developments with solid-state nanopores have lagged, due to challenges both in fabricating stable nanopores of similar dimensions as biological nanopores and in achieving sufficiently low-noise and high-bandwidth recordings. Here we show that small silicon nitride nanopores (0.8 to 2-nm-diameter in 5 to 8-nm-thick membranes) can resolve differences between ionic current signals produced by short (30 base) ssDNA homopolymers (poly(dA), poly(dC), poly(dT)), when combined with measurement electronics that allow a signal-to-noise ratio of better than 10 to be achieved at 1 MHz bandwidth. While identifying intramolecular DNA sequences with silicon nitride nanopores will require further improvements in nanopore sensitivity and noise levels, homopolymer differentiation represents an important milestone in the development of solid-state nanopores. PMID:23621759

  18. Mismatched single stranded antisense oligonucleotides can induce efficient dystrophin splice switching

    Directory of Open Access Journals (Sweden)

    Kole Ryszard

    2011-10-01

    Full Text Available Abstract Background Antisense oligomer induced exon skipping aims to reduce the severity of Duchenne muscular dystrophy by redirecting splicing during pre-RNA processing such that the causative mutation is by-passed and a shorter but partially functional Becker muscular dystrophy-like dystrophin isoform is produced. Normal exons are generally targeted to restore the dystrophin reading frame however, an appreciable subset of dystrophin mutations are intra-exonic and therefore have the potential to compromise oligomer efficiency, necessitating personalised oligomer design for some patients. Although antisense oligomers are easily personalised, it remains unclear whether all patient polymorphisms within antisense oligomer target sequences will require the costly process of producing and validating patient specific compounds. Methods Here we report preclinical testing of a panel of splice switching antisense oligomers, designed to excise exon 25 from the dystrophin transcript, in normal and dystrophic patient cells. These patient cells harbour a single base insertion in exon 25 that lies within the target sequence of an oligomer shown to be effective at removing exon 25. Results It was anticipated that such a mutation would compromise oligomer binding and efficiency. However, we show that, despite the mismatch an oligomer, designed and optimised to excise exon 25 from the normal dystrophin mRNA, removes the mutated exon 25 more efficiently than the mutation-specific oligomer. Conclusion This raises the possibility that mismatched AOs could still be therapeutically applicable in some cases, negating the necessity to produce patient-specific compounds.

  19. Telomerase suppresses formation of ALT-associated single-stranded telomeric C-circles.

    Science.gov (United States)

    Plantinga, Matthew J; Pascarelli, Kara M; Merkel, Anna S; Lazar, Alexander J; von Mehren, Margaret; Lev, Dina; Broccoli, Dominique

    2013-06-01

    Telomere maintenance is an essential characteristic of cancer cells, most commonly achieved by activation of telomerase. Telomeres can also be maintained by a recombination-based mechanism, alternative lengthening of telomeres (ALT). Cells using ALT are characterized by the presence of ALT-associated promyelocytic leukemia (PML) bodies (APB), long, heterogeneously sized telomeres, extrachromosomal telomeric circular DNA, and elevated telomeric recombination. Consistent with other reports, we found that liposarcomas containing APBs, but lacking telomerase expression, always contained C-rich circles (C-circles), and these C-circles were never present in the absence of APBs, indicating a tight link between these features in ALT cells. However, a rare subgroup of tumors showing evidence of telomere maintenance by both telomerase and ALT did not contain C-circles. To test the hypothesis that telomerase expression disrupts the tight link between APBs and C-circles, we used ALT cell lines that were engineered to express telomerase. Introduction of telomerase activity in these ALT cells resulted in, on average, shorter telomeres with retention of APBs. However, at high passage, the level of C-circles was significantly reduced, which was paralleled by a switch from C-strand overhangs to G-strand overhangs. We propose that by extending critically short telomeres in these cells, telomerase is disrupting a key step in the ALT pathway necessary for production and/or maintenance of C-circles. ©2013 AACR.

  20. Therapeutic Effect of Novel Single-Stranded RNAi Agent Targeting Periostin in Eyes with Retinal Neovascularization

    Directory of Open Access Journals (Sweden)

    Takahito Nakama

    2017-03-01

    Full Text Available Retinal neovascularization (NV due to retinal ischemia remains one of the principal causes of vision impairment in patients with ischemic retinal diseases. We recently reported that periostin (POSTN may play a role in the development of preretinal fibrovascular membranes, but its role in retinal NV has not been determined. The purpose of this study was to examine the expression of POSTN in the ischemic retinas of a mouse model of oxygen-induced retinal NV. We also studied the function of POSTN on retinal NV using Postn KO mice and human retinal endothelial cells (HRECs in culture. In addition, we used a novel RNAi agent, NK0144, which targets POSTN to determine its effect on the development of retinal NV. Our results showed that the expression of POSTN was increased in the vascular endothelial cells, pericytes, and M2 macrophages in ischemic retinas. POSTN promoted the ischemia-induced retinal NV by Akt phosphorylation through integrin αvβ3. NK0144 had a greater inhibitory effect than canonical double-stranded siRNA on preretinal pathological NV in vivo and in vitro. These findings suggest a causal relationship between POSTN and retinal NV, and indicate a potential therapeutic role of intravitreal injection of NK0144 for retinal neovascular diseases.

  1. Double-stranded DNA dissociates into single strands when dragged into a poor solvent.

    Science.gov (United States)

    Cui, Shuxun; Yu, Jin; Kühner, Ferdinand; Schulten, Klaus; Gaub, Hermann E

    2007-11-28

    DNA displays a richness of biologically relevant supramolecular structures, which depend on both sequence and ambient conditions. The effect of dragging double-stranded DNA (dsDNA) from water into poor solvent on the double-stranded structure is still unclear because of condensation. Here, we employed single molecule techniques based on atomic force microscopy and molecular dynamics (MD) simulations to investigate the change in structure and mechanics of DNA during the ambient change. We found that the two strands are split apart when the dsDNA is pulled at one strand from water into a poor solvent. The findings were corroborated by MD simulations where dsDNA was dragged from water into poor solvent, revealing details of the strand separation at the water/poor solvent interface. Because the structure of DNA is of high polarity, all poor solvents show a relatively low polarity. We speculate that the principle of spontaneous unwinding/splitting of dsDNA by providing a low-polarity (in other word, hydrophobic) micro-environment is exploited as one of the catalysis mechanisms of helicases.

  2. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-02-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  3. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)

    2012-04-04

    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  4. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.

    1985-01-01

    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  5. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA

    Science.gov (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana

    2009-04-01

    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  6. Capillary electrophoresis ribosomal RNA single-stranded conformation polymorphism: a new approach for characterization of low-diversity microbial communities.

    Science.gov (United States)

    Nai, Yi H; Zemb, Oliver; Gutierrez-Zamora, Maria-Luisa; Manefield, Mike; Powell, Shane M; Breadmore, Michael C

    2012-10-01

    Capillary electrophoresis (CE) has been the principle system for nucleic acid analysis since the early 1990s due to its inherent advantages such as fast analysis time, high resolution and efficiency, minimal sample requirement, high detection sensitivity, and automation. In the past few decades, microbial community fingerprinting methods such as terminal restriction fragment length polymorphism and single-stranded conformation polymorphism (SSCP) have migrated to CE to utilize its advantages over conventional slab gel electrophoresis. Recently, a gel-based direct rRNA fingerprint method was demonstrated. Different from other existing microbial community characterization approaches, this novel approach is polymerase chain reaction free and capable of providing information on the relative abundance of rRNA from individual phylotypes in low-diversity samples. As a gel-based method, it has a long analysis time and relatively large reagent and sample requirements. Here, we addressed these limitations by transferring the RNA fingerprint approach to the CE platform. Analysis time significantly improved from 24 h to 60 min, and the use of a fluorescently labeled hybridization probe as the detection strategy decreased the sample requirement by ten-fold. The combination of fast analysis time, low sample requirement, and sensitive fluorescence detection makes CE-RNA-SSCP an appealing new approach for characterizing low-diversity microbial communities.

  7. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))

    1993-03-01

    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  8. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA.

    Science.gov (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi

    2008-03-28

    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  9. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  10. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani

    2006-09-01

    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  11. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    Science.gov (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Four-stranded mini microtubules formed byProsthecobacterBtubAB show dynamic instability.

    Science.gov (United States)

    Deng, Xian; Fink, Gero; Bharat, Tanmay A M; He, Shaoda; Kureisaite-Ciziene, Danguole; Löwe, Jan

    2017-07-18

    Microtubules, the dynamic, yet stiff hollow tubes built from αβ-tubulin protein heterodimers, are thought to be present only in eukaryotic cells. Here, we report a 3.6-Å helical reconstruction electron cryomicroscopy structure of four-stranded mini microtubules formed by bacterial tubulin-like Prosthecobacter dejongeii BtubAB proteins. Despite their much smaller diameter, mini microtubules share many key structural features with eukaryotic microtubules, such as an M-loop, alternating subunits, and a seam that breaks overall helical symmetry. Using in vitro total internal reflection fluorescence microscopy, we show that bacterial mini microtubules treadmill and display dynamic instability, another hallmark of eukaryotic microtubules. The third protein in the btub gene cluster, BtubC, previously known as "bacterial kinesin light chain," binds along protofilaments every 8 nm, inhibits BtubAB mini microtubule catastrophe, and increases rescue. Our work reveals that some bacteria contain regulated and dynamic cytomotive microtubule systems that were once thought to be only useful in much larger and sophisticated eukaryotic cells.

  13. Flow cytometry analysis of single-strand DNA damage in neuroblastoma cell lines using the F7-26 monoclonal antibody.

    Science.gov (United States)

    Grigoryan, Rita S; Yang, Bo; Keshelava, Nino; Barnhart, Jerry R; Reynolds, C Patrick

    2007-11-01

    The F7-26 monoclonal antibody (Mab) has been reported to be specific for single-strand DNA damage (ssDNA) and to also identify cells in apoptosis. We carriedout studies to determine if F7-26 binding measured by flow cytometry was able to specifically identify exogenous ssDNA as opposed to DNA damage from apoptosis. Neuroblastoma cells were treated with melphalan (L-PAM), fenretinide, 4-hydroperoxycyclophosphamide (4-HC)+/-pan-caspase inhibitor BOC-d-fmk, topotecan or with 10Gy gamma radiation+/-hydrogen peroxide (H2O2) and fixed immediately postradiation. Cytotoxicity was measured by DIMSCAN digital imaging fluorescence assay. The degree of ssDNA damage was analyzed by flow cytometry using Mab F7-26, with DNA visualized by propidium iodide counterstaining. Flow cytometry was used to measure apoptosis detected by terminal deoxynucleotidyltransferase (TUNEL) assay and reactive oxygen species (ROS) by carboxy-dichlorofluorescein diacetate. Irradiated and immediately fixed neuroblastoma cells showed increased ssDNA, but not apoptosis by TUNEL (TUNEL-negative). 4-HC or L-PAM+/-BOC-d-fmk increased ssDNA (F7-26-positive), but BOC-d-fmk prevented TUNEL staining. Fenretinide increased apoptosis by TUNEL but not ssDNA damage detected with F7-26. Enhanced ssDNA in neuroblastoma cells treated with radiation+H2O2 was associated with increased ROS. Topotecan increased both ssDNA and cytotoxicity in 4-HC-treated cells. These data demonstrate that Mab F7-26 recognized ssDNA due to exogenous DNA damage, rather than apoptosis. This assay should be useful to characterize the mechanism of action of antineoplastic drugs. Copyright (c) 2007 International Society for Analytical Cytology.

  14. Ampelomyces mycoparasites from apple powdery mildew identified as a distinct group based on single-stranded conformation polymorphism analysis of the rDNA ITS region.

    Science.gov (United States)

    Szentiványi, Orsolya; Kiss, Levente; Russell, John C; Kovács, Gábor M; Varga, Krisztina; Jankovics, Tünde; Lesemann, Silke; Xu, Xiang-Ming; Jeffries, Peter

    2005-04-01

    Pycnidial fungi belonging to the genus Ampelomyces are the most common natural antagonists of powdery mildews worldwide. During a study of the interactions between apple powdery mildew (Podosphaera leucotricha) and Ampelomyces mycoparasites, 52 new Ampelomyces isolates were obtained from P. leucotricha and, in addition, 13 new isolates from other species of the Erysiphaceae in four European countries. Their genetic diversity was screened using single-stranded conformation polymorphism (SSCP) analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). For comparison, 24 isolates obtained from genetic resource collections or other sources were included in this study. Based on the ITS-SSCP patterns, the isolates were placed in eight groups. The isolates belonged to two types based on their growth in culture. The faster-growing and the slower-growing isolates were included in different SSCP groups. A phylogenetic analysis of the ITS sequences of representatives of these groups confirmed the results obtained with the SSCP method, and showed that the faster-growing isolates do not belong to Ampelomyces as suggested by earlier studies. All the isolates from P. leucotricha fell into a distinct SSCP group of genetically homogeneous isolates. This suggests that Ampelomyces mycoparasites which occur in apple powdery mildew are slightly different from the other Ampelomyces groups which contain mycoparasites from various powdery mildew species. This may be because the main growth period of Ampelomyces mycoparasites in apple powdery mildew is isolated in time from that of Ampelomyces isolates that occur in other species of the Erysiphaceae. P. leucotricha starts its life-cycle early in the season, usually in March-April, while most powdery mildews are active in the same environments only late in the year.

  15. Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody: a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody.

    Science.gov (United States)

    Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua

    2018-02-01

    Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.

  16. Gauging the Nanotoxicity of h2D-C2N toward Single-Stranded DNA: An in Silico Molecular Simulation Approach.

    Science.gov (United States)

    Mukhopadhyay, Titas Kumar; Bhattacharyya, Kalishankar; Datta, Ayan

    2018-04-12

    Recent toxicological assessments of graphene, graphene oxides, and some other two-dimensional (2D) materials have shown them to be substantially toxic at the nanoscale, where they inhibit and eventually disrupt biological processes. These shortfalls of graphene and analogs have resulted in a quest for novel biocompatible 2D materials with minimum cytotoxicity. In this article, we demonstrate C 2 N (h2D-C 2 N), a newly synthesized 2D porous graphene analog, to be non-nanotoxic toward genetic materials from an "in-silico" point of view through sequence-dependent binding of different polynucleotide single-stranded DNA (ssDNA) onto it. The calculated binding energy of nucleobases and the free energy of binding of polynucleotides follow the common trait, cytosine > guanine > adenine > thymine, and are well within the limits of physisorption. Ab-initio simulations completely exclude the possibility of any chemical reaction, demonstrating purely noncovalent binding of nucleobases with C 2 N through a crucial interplay between hydrogen bonding and π-stacking interactions with the surface. Further, we show that the extent of distortion inflicted upon ssDNA by C 2 N is negligible. Analysis of the density of states of the nucleobase-C 2 N hybrids confirms minimum electronic perturbation of the bases after adsorption. Most importantly, we demonstrate the potency of C 2 N in nucleic acid transportation via reversible binding of ssDNA. The plausible use of C 2 N as a template for DNA repair is illustrated through an example of C 2 N-assisted complementary ssDNA winding.

  17. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA.

    Science.gov (United States)

    Rogers, Cody M; Bochman, Matthew L

    2017-05-13

    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold.

    Science.gov (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G

    2005-05-24

    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  19. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage

    Science.gov (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio

    1998-01-01

    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  20. Slowing single-stranded DNA translocation through a solid-state nanopore by decreasing the nanopore diameter.

    Science.gov (United States)

    Akahori, Rena; Haga, Takanobu; Hatano, Toshiyuki; Yanagi, Itaru; Ohura, Takeshi; Hamamura, Hirotaka; Iwasaki, Tomio; Yokoi, Takahide; Anazawa, Takashi

    2014-07-11

    To slow the translocation of single-stranded DNA (ssDNA) through a solid-state nanopore, a nanopore was narrowed, and the effect of the narrowing on the DNA translocation speed was investigated. In order to accurately measure the speed, long (5.3 kb) ssDNA (namely, ss-poly(dA)) with uniform length (±0.4 kb) was synthesized. The diameters of nanopores fabricated by a transmission electron microscope were controlled by atomic-layer deposition. Reducing the nanopore diameter from 4.5 to 2.3 nm slowed down the translocation of ssDNA by more than 16 times (to 0.18 μs base(-1)) when 300 mV was applied across the nanopore. It is speculated that the interaction between the nanopore and the ssDNA dominates the translocation speed. Unexpectedly, the translocation speed of ssDNA through the 4.5 nm nanopore is more than two orders of magnitude higher than that of double-stranded DNA (dsDNA) through a nanopore of almost the same size. The cause of such a faster translocation of ssDNA can be explained by the weaker drag force inside the nanopore. Moreover, the measured translocation speeds of ssDNA and dsDNA agree well with those calculated by molecular-dynamics (MD) simulation. The MD simulation predicted that reducing the nanopore diameter to almost the same as that of ssDNA (i.e. 1.4 nm) decreases the translocation speed (to 1.4 μs base(-1)). Narrowing the nanopore is thus an effective approach for accomplishing nanopore DNA sequencing.

  1. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines.

    Science.gov (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao

    2017-07-01

    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  2. Alpha-Helical Fragaceatoxin C Nanopore Engineered for Double-Stranded and Single-Stranded Nucleic Acid Analysis

    NARCIS (Netherlands)

    Wloka, Carsten; Mutter, Natalie Lisa; Soskine, Misha; Maglia, Giovanni

    2016-01-01

    Nanopores are used in single-molecule DNA analysis and sequencing. Herein, we show that Fragaceatoxin C (FraC), an α-helical pore-forming toxin from an actinoporin protein family, can be reconstituted in sphingomyelin-free standard planar lipid bilayers. We engineered FraC for DNA analysis and show

  3. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis.

    Science.gov (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J

    2012-01-01

    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  4. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.

    1992-01-01

    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  5. Abrupt and Ramped Flicker-Defined Form Shows Evidence for a Large Magnocellular Impairment in Dyslexia

    Science.gov (United States)

    Laycock, Robin; Crewther, David P.; Crewther, Sheila G.

    2012-01-01

    Controversy still exists over whether there is a magnocellular deficit associated with developmental dyslexia. Here we utilised a magnocellular system-biased phantom contour form discrimination task defined by high temporal frequency contrast reversals to compare contrast sensitivity in a group of children with dyslexia and an age- and nonverbal…

  6. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  7. Synthesis of a gene for the HIV transactivator protein TAT by a novel single stranded approach involving in vivo gap repair.

    OpenAIRE

    Adams, S E; Johnson, I D; Braddock, M; Kingsman, A J; Kingsman, S M; Edwards, R M

    1988-01-01

    The synthesis of a gene for the HIV TAT protein is described using a novel approach that capitalises on the ability to synthesise oligonucleotides of greater than 100 bp in length. It involves the synthesis of large oligomers covering one strand of the desired gene in its entirety and the use of small complementary bridging and adapter oligonucleotides to direct the assembly and cloning of the large oligomers. After ligation to the cloning vector the partially single stranded intermediate is ...

  8. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers

    OpenAIRE

    Antolin, M. F.; Bosio, C. F.; Cotton, J.; Sweeney, W.; Strand, M. R.; Black-IV, W. C.

    1996-01-01

    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  9. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr

    2015-01-01

    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single- strand ed DNA -binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  10. Children show right-lateralized effects of spoken word-form learning.

    Directory of Open Access Journals (Sweden)

    Anni Nora

    Full Text Available It is commonly thought that phonological learning is different in young children compared to adults, possibly due to the speech processing system not yet having reached full native-language specialization. However, the neurocognitive mechanisms of phonological learning in children are poorly understood. We employed magnetoencephalography (MEG to track cortical correlates of incidental learning of meaningless word forms over two days as 6-8-year-olds overtly repeated them. Native (Finnish pseudowords were compared with words of foreign sound structure (Korean to investigate whether the cortical learning effects would be more dependent on previous proficiency in the language rather than maturational factors. Half of the items were encountered four times on the first day and once more on the following day. Incidental learning of these recurring word forms manifested as improved repetition accuracy and a correlated reduction of activation in the right superior temporal cortex, similarly for both languages and on both experimental days, and in contrast to a salient left-hemisphere emphasis previously reported in adults. We propose that children, when learning new word forms in either native or foreign language, are not yet constrained by left-hemispheric segmental processing and established sublexical native-language representations. Instead, they may rely more on supra-segmental contours and prosody.

  11. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.

    1979-10-01

    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  12. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.

    1992-01-01

    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  13. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  14. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: simonaclichici@yahoo.com [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)

    2012-03-15

    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  15. Durum Wheat (Triticum Durum Desf. Lines Show Different Abilities to Form Masked Mycotoxins under Greenhouse Conditions

    Directory of Open Access Journals (Sweden)

    Martina Cirlini

    2013-12-01

    Full Text Available Deoxynivalenol (DON is the most prevalent trichothecene in Europe and its occurrence is associated with infections of Fusarium graminearum and F. culmorum, causal agents of Fusarium head blight (FHB on wheat. Resistance to FHB is a complex character and high variability occurs in the relationship between DON content and FHB incidence. DON conjugation to glucose (DON-3-glucoside, D3G is the primary plant mechanism for resistance towards DON accumulation. Although this mechanism has been already described in bread wheat and barley, no data are reported so far about durum wheat, a key cereal in the pasta production chain. To address this issue, the ability of durum wheat to detoxify and convert deoxynivalenol into D3G was studied under greenhouse controlled conditions. Four durum wheat varieties (Svevo, Claudio, Kofa and Neodur were assessed for DON-D3G conversion; Sumai 3, a bread wheat variety carrying a major QTL for FHB resistance (QFhs.ndsu-3B, was used as a positive control. Data reported hereby clearly demonstrate the ability of durum wheat to convert deoxynivalenol into its conjugated form, D3G.

  16. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W

    2009-12-23

    Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation

  17. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  18. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  19. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus

    Science.gov (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.

    2016-01-01

    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  20. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  1. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.

    1989-01-01

    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  2. A single-stranded RNA copy of the Giardia lamblia virus double-stranded RNA genome is present in the infected Giardia lamblia.

    OpenAIRE

    Furfine, E S; White, T C; Wang, A L; Wang, C C

    1989-01-01

    An isolate of Giardia lamblia infected with the double-stranded RNA virus (GLV) has two major species of RNA that are not present in an uninfected isolate. One of these species is the previously characterized double-stranded RNA genome of GLV (1). The second species of RNA appears to be a full length copy of one strand of the double-stranded RNA genome. This full length single-stranded RNA is not present in viral particles isolated from the growth medium. The cellular concentration of the sin...

  3. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast.

    Science.gov (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A

    2010-08-05

    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  4. Isolation and characterization of a single-stranded DNA virus infecting the marine diatom Chaetoceros sp. strain SS628-11 isolated from western Japan.

    Directory of Open Access Journals (Sweden)

    Kei Kimura

    Full Text Available Diatoms are significant organisms for primary production in the earth's aquatic environment. Hence, their dynamics are an important focus area in current studies. Viruses are a great concern as potential factors of diatom mortality, along with other physical, chemical, and biological factors. We isolated and characterized a new diatom virus (Csp07DNAV that lyses the marine planktonic diatom Chaetoceros sp. strain SS628-11. This paper examines the physiological, morphological, and genomic characteristics of Csp07DNAV. The virus was isolated from a surface water sample that was collected at Hiroshima Bay, Japan. It was icosahedral, had a diameter of 34 nm, and accumulated in the nuclei of host cells. Rod-shaped virus particles also coexisted in the host nuclei. The latent period and burst size were estimated to be <12 h and 29 infectious units per host cell, respectively. Csp07DNAV had a closed circular single-stranded DNA genome (5,552 nucleotides, which included a double-stranded region and 3 open reading frames. The monophyly of Csp07DNAV and other Bacilladnavirus group single-stranded DNA viruses was supported by phylogenetic analysis that was based on the amino acid sequence of each virus protein. On the basis of these results, we considered Csp07DNAV to be a new member of the genus Bacilladnavirus.

  5. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  6. On-site detection of Phytophthora spp.—single-stranded target DNA as the limiting factor to improve on-chip hybridization

    International Nuclear Information System (INIS)

    Schwenkbier, Lydia; Pollok, Sibyll; Popp, Jürgen; Weber, Karina; König, Stephan; Wagner, Stefan; Werres, Sabine; Weber, Jörg; Hentschel, Martin

    2014-01-01

    We report on a lab-on-a-chip approach for on-site detection of Phytophthora species that allows visual signal readout. The results demonstrate the significance of single-stranded DNA (ssDNA) generation in terms of improving the intensity of the hybridization signal and to improve the reliability of the method. Conventional PCR with subsequent heat denaturation, sodium hydroxide-based denaturation, lambda exonuclease digestion and two asymmetric PCR methods were investigated for the species P. fragariae, P. kernoviae, and P. ramorum. The positioning of the capture probe within the amplified yeast GTP-binding protein (YPT1) target DNA was also of interest because it significantly influences the intensity of the signal. Statistical tests were used to validate the impact of the ssDNA generation methods and the capture-target probe position. The single-stranded target DNA generated by Linear-After-The-Exponential PCR (LATE-PCR) was found to produce signal intensities comparable to post-PCR exonuclease treatment. The LATE-PCR is the best method for the on-site detection of Phytophthora because the enzymatic digestion after PCR is more laborious and time-consuming. (author)

  7. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes.

    Science.gov (United States)

    Pietilä, Maija K; Roine, Elina; Sencilo, Ana; Bamford, Dennis H; Oksanen, Hanna M

    2016-01-01

    Viruses infecting archaea show a variety of virion morphotypes, and they are currently classified into more than ten viral families or corresponding groups. A pleomorphic virus morphotype is very common among haloarchaeal viruses, and to date, several such viruses have been isolated. Here, we propose the classification of eight such viruses and formation of a new family, Pleolipoviridae (from the Greek pleo for more or many and lipos for lipid), containing three genera, Alpha-, Beta-, and Gammapleolipovirus. The proposal is currently under review by the International Committee on Taxonomy of Viruses (ICTV). The members of the proposed family Pleolipoviridae infect halophilic archaea and are nonlytic. They share structural and genomic features and differ from any other classified virus. The virion of pleolipoviruses is composed of a pleomorphic membrane vesicle enclosing the genome. All pleolipoviruses have two major structural protein species, internal membrane and spike proteins. Although the genomes of the pleolipoviruses are single- or double-stranded, linear or circular DNA molecules, they share the same genome organization and gene synteny and show significant similarity at the amino acid level. The canonical features common to all members of the proposed family Pleolipoviridae show that they are closely related and thus form a new viral family.

  8. RNA binding to APOBEC3G induces the disassembly of functional deaminase complexes by displacing single-stranded DNA substrates

    Science.gov (United States)

    Polevoda, Bogdan; McDougall, William M.; Tun, Bradley N.; Cheung, Michael; Salter, Jason D.; Friedman, Alan E.; Smith, Harold C.

    2015-01-01

    APOBEC3G (A3G) DNA deaminase activity requires a holoenzyme complex whose assembly on nascent viral reverse transcripts initiates with A3G dimers binding to ssDNA followed by formation of higher-order A3G homo oligomers. Catalytic activity is inhibited when A3G binds to RNA. Our prior studies suggested that RNA inhibited A3G binding to ssDNA. In this report, near equilibrium binding and gel shift analyses showed that A3G assembly and disassembly on ssDNA was an ordered process involving A3G dimers and multimers thereof. Although, fluorescence anisotropy showed that A3G had similar nanomolar affinity for RNA and ssDNA, RNA stochastically dissociated A3G dimers and higher-order oligomers from ssDNA, suggesting a different modality for RNA binding. Mass spectrometry mapping of A3G peptides cross-linked to nucleic acid suggested ssDNA only bound to three peptides, amino acids (aa) 181–194 in the N-terminus and aa 314–320 and 345–374 in the C-terminus that were part of a continuous exposed surface. RNA bound to these peptides and uniquely associated with three additional peptides in the N- terminus, aa 15–29, 41–52 and 83–99, that formed a continuous surface area adjacent to the ssDNA binding surface. The data predict a mechanistic model of RNA inhibition of ssDNA binding to A3G in which competitive and allosteric interactions determine RNA-bound versus ssDNA-bound conformational states. PMID:26424853

  9. OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

    Directory of Open Access Journals (Sweden)

    Kevin M. Bradley

    2014-08-01

    Full Text Available Synthetic biologists wishing to self-assemble large DNA (L-DNA constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson–Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS, and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting" software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

  10. Influence of the single-strand linker composition on the structural/dynamical properties of a truncated octahedral DNA nano-cage family.

    Science.gov (United States)

    Iacovelli, Federico; Alves, Cassio; Falconi, Mattia; Oteri, Francesco; de Oliveira, Cristiano L P; Desideri, Alessandro

    2014-10-01

    The structural/dynamical properties of three truncated octahedral DNA nano-cages composed by identical double helices but single strand linkers with different composition, namely 7 thymidines, 7 adenines, and 7 alternated thymidines and adenines, have been investigated through classical molecular dynamics simulations. Trajectories have been analyzed to investigate the role of the linkers in defining nano-cages stability and flexibility, including possible influence on the internal cages motions. The data indicate that the cages behavior is almost identical and that the structural/dynamical parameters measured along the trajectories are not particularly affected by the presence of different bases. These results demonstrate that the constraints imposed by the nano-structure geometry are the main factor in modulating these properties

  11. Localization of specific sequences and DNA single-strand breaks in individual UV-A-irradiated human lymphocytes by COMET FISH

    Science.gov (United States)

    Bock, Claudia; Rapp, Alexander; Dittmar, Heike; Monajembashi, Shamci; Greulich, Karl-Otto

    1999-01-01

    The COMET assay, a single cell electrophoresis technique which allows to separate electrophoretically fractionated DNA according to size has been combined with fluorescence in situ hybridization (FISH) which allows to localize specific genes or gene regions. This combination (COMET FISH) allows the detection of DNA single strand breaks in specific regions of the genome of human lymphocytes at the single cell level. Various types of DNA probes, e.g. centromere-, (alpha) - satellite-, telomere-, whole chromosome-, single copy- and region specific DNA probes have been used to investigate whether the UV-A induced DNA single strand breaks are distributed randomly all over the human genome or induced at specific sites ('hot spots'). In the investigated human peripheral blood lymphocytes all but one centromere reveal low sensitivity for UV-A irradiation (500 kJ/m2), while telomeres are randomly distributed over COMET heads and tails. The human chromosome 1 is fractionated by irradiation, but remains in the COMET head, indicating an only moderate degree of fractionation. Among three tested single copy probes, c- myc, p53 and p58, the p53 gene located on chromosome 17p13.1 and the p58 gene (1p36) appear to be located in UV-A stable regions of the human genome in 95% of 65 investigated lymphocytes. In contrast, the c-myc proto-oncogene (8q24) is found in the COMET tail in 90% of the 27 investigated lymphocytes and thus appears to be more sensitive to UV-A irradiation.

  12. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  13. Analysis of the interaction of platelet collagen receptor glycoprotein VI (GPVI) with collagen. A dimeric form of GPVI, but not the monomeric form, shows affinity to fibrous collagen.

    Science.gov (United States)

    Miura, Yoshiki; Takahashi, Tsuyoshi; Jung, Stephanie M; Moroi, Masaaki

    2002-11-29

    Glycoprotein VI (GPVI) is a platelet-specific glycoprotein that has been indicated to react with collagen and activate platelets. Its structure was recently identified by cDNA cloning (Clemetson, J. M., Polgar, J., Magnenat, E., Wells, T. N., and Clemetson, K. J. (1999) J. Biol. Chem. 274, 29019-29024). However, the mechanism of the interaction between collagen and GPVI has not been analyzed in detail because both collagen and GPVI are insoluble molecules. In this study, we expressed the extracellular domain of GPVI as soluble forms as follows: the monomeric form (GPVIex) and the dimeric form of GPVI fused with the human immunoglobulin Fc domain (GPVI-Fc(2)). Purified GPVIex strongly inhibited convulxin (Cvx)-induced platelet aggregation but only weakly inhibited that induced by collagen-related peptide. However, only GPVI-Fc(2), and not GPVIex, inhibited collagen-induced platelet aggregation. The dimeric form of GPVI exhibits high affinity for collagen, as concluded from measurements of GPVI binding to immobilized collagen by both the enzyme-linked immunosorbent assay and surface plasmon resonance methods. GPVI-Fc(2) bound to the surface of immobilized collagen with a dissociation constant (K(D)) of 5.76 x 10(-7) m, but the binding of GPVIex was too weak to allow estimation of this parameter. Cvx did not inhibit the binding of dimeric GPVI to collagen, indicating that the binding site of GPVI to collagen was different from that to Cvx. Taken together, our data indicate that the high affinity binding site for collagen is composed from two chains of GPVI. Furthermore, they suggest that the binding sites for Cvx are different from the collagen-binding sites and do not need to be formed by two GPVI molecules. Because dimeric GPVI is the only form that shows high affinity to fibrous collagen, our results indicate that GPVI would be present as a dimeric form on the platelet. Moreover, surface plasmon resonance indicated that there is no detectable interaction between

  14. Effect of Zn2+ and temperature on the conformational equilibrium of single-stranded polyA in neutral solutions

    Czech Academy of Sciences Publication Activity Database

    Sorokin, V. A.; Valeev, V. A.; Usenko, E. L.; Andrushchenko, Valery

    2013-01-01

    Roč. 61, Oct (2013), s. 448-452 ISSN 0141-8130 R&D Projects: GA ČR GAP208/10/0559 Institutional support: RVO:61388963 Keywords : metal ions * polyA * metal lized form * differential UV spectroscopy * thermal denaturation * phase diagram Subject RIV: CE - Biochemistry Impact factor: 3.096, year: 2013

  15. Activation of 2'-5' oligoadenylate synthetase by single-stranded and double-stranded RNA aptamers

    DEFF Research Database (Denmark)

    Hartmann, R; Norby, P L; Martensen, P M

    1998-01-01

    A number of small RNA molecules that are high affinity ligands for the 46-kDa form of human 2'-5' oligoadenylate synthetase have been identified by the SELEX method. Surface plasmon resonance analysis indicates that these RNAs bind to the enzyme with dissociation constants in the nanomolar range....... Competition experiments indicate that the binding site for the small RNAs on the 2'-5' oligoadenylate synthetase molecule at least partially overlaps that for the synthetic double-stranded RNA, poly(I).poly(C). Several of the RNAs function as potent activators of 2'-5' oligoadenylate synthetase in vitro......-stranded RNA, can also be activated by RNA ligands with little secondary structure. Since 2'-5' oligoadenylate synthetase possesses no homology to other known RNA-binding proteins, the development of small specific ligands by SELEX should facilitate studies of RNA-protein interactions and may reveal novel...

  16. ALMA Shows that Gas Reservoirs of Star-forming Disks over the Past 3 Billion Years Are Not Predominantly Molecular

    Energy Technology Data Exchange (ETDEWEB)

    Cortese, Luca; Catinella, Barbara; Janowiecki, Steven, E-mail: luca.cortese@uwa.edu.au [International Centre for Radio Astronomy Research, The University of Western Australia, 35 Stirling Highway, Crawley, WA 6009 (Australia)

    2017-10-10

    Cold hydrogen gas is the raw fuel for star formation in galaxies, and its partition into atomic and molecular phases is a key quantity for galaxy evolution. In this Letter, we combine Atacama Large Millimeter/submillimeter Array and Arecibo single-dish observations to estimate the molecular-to-atomic hydrogen mass ratio for massive star-forming galaxies at z ∼ 0.2 extracted from the HIGHz survey, i.e., some of the most massive gas-rich systems currently known. We show that the balance between atomic and molecular hydrogen in these galaxies is similar to that of local main-sequence disks, implying that atomic hydrogen has been dominating the cold gas mass budget of star-forming galaxies for at least the past three billion years. In addition, despite harboring gas reservoirs that are more typical of objects at the cosmic noon, HIGHz galaxies host regular rotating disks with low gas velocity dispersions suggesting that high total gas fractions do not necessarily drive high turbulence in the interstellar medium.

  17. Coping Strategies in Mothers of Children with Intellectual Disabilities Showing Multiple Forms of Challenging Behaviour: Associations with Maternal Mental Health.

    Science.gov (United States)

    Adams, D; Rose, J; Jackson, N; Karakatsani, E; Oliver, C

    2017-11-29

    It is well documented that mothers of children with intellectual disabilities experience elevated mental health difficulties and that these are exacerbated by the presence of challenging behaviour. However, comparatively little is known about the effect of specific coping strategies for managing such behaviours. This paper aims to document coping strategies used by mothers of children showing multiple forms of challenging behaviour and to explore how these relate to positive and negative maternal mental health. Eighty-nine mothers of children with intellectual disabilities completed questionnaires assessing maternal mental health (Hospital Anxiety and Depression Scale, Positive and Negative Affect Scale) and maternal coping strategies (Brief COPE). Coping strategies were not associated with child age or ability, but were associated with maternal mental health. Higher levels of problem- and positive-coping strategies were associated with higher positive affect. Although active-avoidance coping was the least frequently reported, it was associated with higher levels of negative affect and increased anxiety and depression. Moderated mediation analyses identified that active-avoidance coping mediated the relationship between the number of forms of challenging behaviour and poor maternal mental health, but only in mothers with lower levels of problem-focused coping. Active-avoidance coping is associated with poorer negative mental health in mothers of children with intellectual disabilities who have average to low levels of problem-focused coping. This is reflective of that noted within a range of populations, highlighting it as a key area for intervention.

  18. Characterisation of DNA forms associated with cassava latent virus infection.

    Science.gov (United States)

    Stanley, J; Townsend, R

    1985-04-11

    In addition to the major encapsidated DNA species found in preparations of cassava latent virus (genomic DNAs 1 and 2) there are minor DNA populations of twice (dimeric) and approximately half genome length. Both minor species resemble the genomic DNAs in that they are composed of predominantly circular single-stranded DNA. All of these size groups have a corresponding covalently-closed circular double-stranded DNA form in infected tissue. Infectivity studies using cloned DNAs 1 and 2 show that dimeric DNA routinely appears, suggesting it to be an intermediate in the DNA replicative cycle that can be encapsidated at low efficiency. In contrast, half unit length DNA has not yet been detected after multiple passaging of virus derived from the cloned DNA inoculum. Half unit length DNAs appear to be derived exclusively from DNA 2 and consist of a population of molecules exhibiting a relatively specific deletion. As they have an inhibitory effect on virus multiplication, their encapsidated forms are analogous to defective interfering particles associated with other eukaryotic DNA containing viruses. Small primer molecules associated with the genomic single-stranded DNAs, as reported for another geminivirus, have not been detected in CLV.

  19. Detection of benzo[a]pyrene-guanine adducts in single-stranded DNA using the α-hemolysin nanopore

    Science.gov (United States)

    Perera, Rukshan T.; Fleming, Aaron M.; Johnson, Robert P.; Burrows, Cynthia J.; White, Henry S.

    2015-02-01

    The carcinogenic precursor benzo[a]pyrene (BP), a polycyclic aromatic hydrocarbon, is released into the environment through the incomplete combustion of hydrocarbons. Metabolism of BP in the human body yields a potent alkylating agent (benzo[a]pyrene diol epoxide, BPDE) that reacts with guanine (G) in DNA to form an adduct implicated in cancer initiation. We report that the α-hemolysin (αHL) nanopore platform can be used to detect a BPDE adduct to G in synthetic oligodeoxynucleotides. Translocation of a 41-mer poly-2‧-deoxycytidine strand with a centrally located BPDE adduct to G through αHL in 1 M KCl produces a unique multi-level current signature allowing the adduct to be detected. This readily distinguishable current modulation was observed when the BPDE-adducted DNA strand translocated from either the 5‧ or 3‧ directions. This study suggests that BPDE adducts and other large aromatic biomarkers can be detected with αHL, presenting opportunities for the monitoring, quantification, and sequencing of mutagenic compounds from cellular DNA samples.

  20. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide

    2015-10-01

    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  1. The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange.

    Science.gov (United States)

    Qian, Yufeng; Johnson, Kenneth A

    2017-08-04

    The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB-ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB) 30 and (SSB) 60 , defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB) 60 and (SSB) 30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 10 9 m -1 s -1 ) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy

    2008-01-01

    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  3. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray.

    Science.gov (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino

    2008-08-25

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  4. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Science.gov (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino

    2008-01-01

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  5. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against the Pesticide Fipronil and Sensitive Detection in River Water

    Directory of Open Access Journals (Sweden)

    Ka L. Hong

    2017-12-01

    Full Text Available Fipronil is a commonly used insecticide that has been shown to have environmental and human health risks. The current standard methods of detection for fipronil and its metabolites, such as GC-MS, are time consuming and labor intensive. In this study, a variant of systematic evolution of ligands by exponential enrichment (SELEX, was utilized to identify the first single-stranded DNA (ssDNA molecular recognition element (MRE that binds to fipronil with high affinity (Kd = 48 ± 8 nM. The selected MRE displayed low cross binding activity on various environmentally relevant, structurally unrelated herbicides and pesticides, in addition to broad-spectrum binding activity on major metabolites of fipronil and a structurally similar pesticide in prepared river samples. Additionally, a proof-of-principle fluorescent detection assay was developed by using the selected ssDNA MRE as a signal-reporting element, with a limit of detection of 105 nM in a prepared river water sample.

  6. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Boye, E.; Johansen, I.; Brustad, T.

    1976-01-01

    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 2 0 C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 2 0 C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  7. Clonal origin of multiple lung cancers: K-ras and p53 mutations determined by nonradioisotopic single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Lau, D H; Yang, B; Hu, R; Benfield, J R

    1997-08-01

    Disease stage is the most important factor in determining prognosis and treatment of lung cancer. Staging of lung cancer is complicated by presentation of multiple pulmonary malignant lesions with a similar histology. It is a dilemma to decide if these lesions are synchronous primaries arising from different malignant clones or metastases from a single clone. Lung cancer is associated with multiple genetic abnormalities including mutations of K-ras and p53, which are believed to occur prior to onset of metastasis. To determine the clonal origin of multiple pulmonary malginant nodules, we analyzed point-mutations of K-ras and p53 by microdissection, polymerase chain reactions (PCR), nonradioisotopic single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. Each pulmonary lesion was microdissected from paraffin slides. Genomic DNA was amplified by two sequential PCRs followed by electrophoresis in a minigel and silver staining. Deoxyribonucleic acid sequencing was performed if necessary to confirm a mutation found upon SSCP analysis. Applying this molecular approach, we were able to differentiate the clonal origins of multiple malignant nodules of the lung as exemplified by the two cases presented.

  8. Simultaneous identification of seven foodborne pathogens and Escherichia coli (pathogenic and nonpathogenic) using capillary electrophoresis-based single-strand conformation polymorphism coupled with multiplex PCR.

    Science.gov (United States)

    Oh, Mi-Hwa; Paek, Se-Hee; Shin, Gi Won; Kim, Hae-Yeong; Jung, Gyoo Yeol; Oh, Sangsuk

    2009-06-01

    The objective of this study was to develop a novel technique for parallel analysis of eight important foodborne microbes using capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) coupled with multiplex PCR. Specific primers for multiplex PCR amplification of the 16S rRNA gene were designed, corresponding to eight species of bacteria, including Escherichia coli, Clostridium perfringens, Campylobacter jejuni, Salmonella enterica, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Bacillus cereus, for the species-specific identification and optimal separation of their PCR products in subsequent analysis by CE-SSCP. Multiplex PCR conditions including annealing temperature, extension time, the number of PCR cycles, and primer concentrations were then optimized for simultaneous detection of all target foodborne bacteria. The diagnostic system using CE-SSCP combined with multiplex PCR developed here can be used for rapid investigation of causative agents of foodborne illness. The simplicity and high sensitivity of the method may lead to improved management of safety and illness related to food.

  9. Selection and Characterization of Single-Stranded DNA Aptamers Binding Human B-Cell Surface Protein CD20 by Cell-SELEX

    Directory of Open Access Journals (Sweden)

    Mansoureh Haghighi

    2018-03-01

    Full Text Available The B-lymphocyte antigen (CD20 is a suitable target for single-stranded (ss nucleic acid oligomer (aptamers. The aim of study was selection and characterization of a ssDNA aptamer against CD20 using Cell-Systematic Evolution of Ligands by Exponential Enrichment (Cell-SELEX. The cDNA clone of CD20 (pcDNA-CD20 was transfected to human embryonic kidney (HEK293T cells. Ten rounds of Cell-SELEX was performed on recombinant HEK-CD20 cells. The final eluted ssDNA pool was amplified and ligated in T/A vector for cloning. The plasmids of positive clones were extracted, sequenced and the secondary structures of the aptamers predicted using DNAMAN® software. The sequencing results revealed 10 different types; three of them had the highest thermodynamic stability, named AP-1, AP-2 and AP-3. The AP-1 aptamer was the most thermodynamically stable one (ΔGAP-1 = −10.87 kcal/mol with the highest binding affinity to CD20 (96.91 ± 4.5 nM. Since, the CD20 is a suitable target for recognition of B-Cell. The selected aptamers could be comparable to antibodies with many advantages. The AP-1, AP-2 and AP-3 could be candidate instead of antibodies for diagnostic and therapeutic applications in immune deficiency, autoimmune diseases, leukemia and lymphoma.

  10. porphyrin with single strand DNAs

    Indian Academy of Sciences (India)

    for organization of porphyrin molecules into extended assemblies, providing opportunities for construction of supramolecular structures.6–8 Among the porphyrin .... and consequently the mono- and bi-exponential nature of the decays were judged by the reduced chi-square. (χ2) values and distribution of the weighted ...

  11. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

    2003-01-01

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  12. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  13. A single-stranded conformational polymorphism (SSCP)-derived quantitative variable to monitor the virulence of a Barley yellow dwarf virus-PAV (BYDV-PAV) isolate during adaptation to the TC14 resistant wheat line.

    Science.gov (United States)

    Delaunay, Agnes; Lacroix, Christelle; Morliere, Stephanie; Riault, Gerard; Chain, Florian; Trottet, Maxime; Jacquot, Emmanuel

    2010-09-01

    A standardized single-stranded conformational polymorphism (SSCP) procedure is proposed as an alternative to the time-consuming biological characterization of Barley yellow dwarf virus-PAV (BYDV-PAV) isolates. Using this procedure, six of 21 overlapping regions used to scan the viral genome gave patterns specific to '4E' (avirulent) or '4T' ('4E'-derived virulent) isolates. The calibration of samples and integration of SSCP patterns corresponding to the nucleotide region 1482-2023 allowed the estimation of P(T) values that reflect the proportions of a '4T'-specific band. Analysis of the biological (area under the pathogen progress curve) and molecular (P(T)) data suggested a positive linear relation between these variables. Moreover, sequence analysis of the nucleotide region 1482-2023 highlighted the presence of a nucleotide polymorphism (C/A(1835)) which can be considered as a candidate for virus-host interactions linked to the monitored virulence. According to these parameters, P(T) values associated with '4E'- and '4T'-derived populations show that: (i) long-term infection of a BYDV-PAV isolate on the 'TC14' resistant host leads to the fixation of virulent individuals in viral populations; and (ii) the introduction of susceptible hosts in successive 'TC14' infections results in the maintenance of low virulence of the populations. Thus, the presented study demonstrates that SSCP is a useful tool for monitoring viral populations during the host adaptation process. The described impact of host alternation provides new opportunities for the use of the 'TC14' resistance source in BYDV-resistant breeding programmes. This study is part of the global effort made by the scientific community to propose sustainable alternatives to the chemical control of this viral disease.

  14. Ex vivo gene editing of the dystrophin gene in muscle stem cells mediated by peptide nucleic acid single stranded oligodeoxynucleotides induces stable expression of dystrophin in a mouse model for Duchenne muscular dystrophy.

    Science.gov (United States)

    Nik-Ahd, Farnoosh; Bertoni, Carmen

    2014-07-01

    Duchenne muscular dystrophy (DMD) is a fatal disease caused by mutations in the dystrophin gene, which result in the complete absence of dystrophin protein throughout the body. Gene correction strategies hold promise to treating DMD. Our laboratory has previously demonstrated the ability of peptide nucleic acid single-stranded oligodeoxynucleotides (PNA-ssODNs) to permanently correct single-point mutations at the genomic level. In this study, we show that PNA-ssODNs can target and correct muscle satellite cells (SCs), a population of stem cells capable of self-renewing and differentiating into muscle fibers. When transplanted into skeletal muscles, SCs transfected with correcting PNA-ssODNs were able to engraft and to restore dystrophin expression. The number of dystrophin-positive fibers was shown to significantly increase over time. Expression was confirmed to be the result of the activation of a subpopulation of SCs that had undergone repair as demonstrated by immunofluorescence analyses of engrafted muscles using antibodies specific to full-length dystrophin transcripts and by genomic DNA analysis of dystrophin-positive fibers. Furthermore, the increase in dystrophin expression detected over time resulted in a significant improvement in muscle morphology. The ability of transplanted cells to return into quiescence and to activate upon demand was confirmed in all engrafted muscles following injury. These results demonstrate the feasibility of using gene editing strategies to target and correct SCs and further establish the therapeutic potential of this approach to permanently restore dystrophin expression into muscle of DMD patients. © 2014 AlphaMed Press.

  15. DNA CTG triplet repeats involved in dynamic mutations of neurologically related gene sequences form stable duplexes

    Science.gov (United States)

    Smith, G. K.; Jie, J.; Fox, G. E.; Gao, X.

    1995-01-01

    DNA triplet repeats, 5'-d(CTG)n and 5'-d(CAG)n, are present in genes which have been implicated in several neurodegenerative disorders. To investigate possible stable structures formed by these repeating sequences, we have examined d(CTG)n, d(CAG)n and d(CTG).d(CAG)n (n = 2 and 3) using NMR and UV optical spectroscopy. These studies reveal that single stranded (CTG)n (n > 2) forms stable, antiparallel helical duplexes, while the single stranded (CAG)n requires at least three repeating units to form a duplex. NMR and UV melting experiments show that the Tm increases in the order of [(CAG)3]2 DNA. However, unique NOE and 1H-31P coupling patterns associated with the repetitive T.T mismatches in the CTG repeats are discerned. These results, in conjunction with recent in vitro studies suggest that longer CTG repeats may form hairpin structures, which can potentially cause interruption in replication, leading to dynamic expansion or deletion of triplet repeats.

  16. Detection of p53 mutations by single-strand conformation polymorphisms (SSCP) gel electrophoresis. A comparative study of radioactive and nonradioactive silver-stained SSCP analysis.

    Science.gov (United States)

    Bosari, S; Marchetti, A; Buttitta, F; Graziani, D; Borsani, G; Loda, M; Bevilacqua, G; Coggi, G

    1995-12-01

    p53 mutations are the most common genetic abnormality in humans tumors, but their clinical significance remains to be precisely elucidated. Conventional single-strand conformation polymorphism (SSCP) analysis, a well-established technique for detecting p53 mutations, uses radioactively labeled polymerase chain reaction (PCR) products, which migrate abnormally in the presence of mutations. We performed radioactive PCR-SSCP analysis in a series of 30 formalin-fixed, paraffin-embedded ovarian carcinomas and two cell lines (SW480 and Caov4) harboring known homozygous p53 mutations and compared the results with nonradioactive silver-stained SSCP. The purpose was to assess whether nonradioactive SSCP is suitable for detecting p53 mutations in a rapid, sensitive, cost-effective fashion, without the need of radioactive isotopes. We accomplished PCR amplification of p53 exons 5 through 8 in 26 carcinomas, and radioactive SSCP detected p53 mutations in 13 tumors; three mutations were localized in exon 5, six in exon 6, two in exon 7, and two in exon 8. All mutations were correctly identified with nonradioactive SSCP, except for one exon 8 mutation. To establish the sensitivity of nonradioactive SSCP, DNA samples of SW480 and Caov4 were mixed with increasing amounts (0-90%) of normal DNA and subjected to PCR-SSCP analysis. Mutations were detected until the concentration of SW480 and Caov4 was 15% and 10%, respectively, of the total sample. The results of our investigation demonstrate that nonradioactive silver-stained SSCP is a sensitive, rapid, and simple technique to detect p53 mutations, even in formalin-fixed tissues, and could be easily used to investigate large series of patients to assess the clinical significance of p53 mutations in human tumors.

  17. Variabilidad genética de Aedes aegypti en algunas áreas del Perú usando Single Stranded Conformational Polymorphism (SSCP

    Directory of Open Access Journals (Sweden)

    Nélida Leiva G

    2004-07-01

    Full Text Available Aedes aegypti es el vector responsable de la transmisión del virus del dengue, su distribución geográfica se ha ampliado rápidamente debido principalmente a la intervención de los seres humanos. Objetivo: Analizar la variabilidad genética de este mosquito mediante la comparación del Segundo Espaciador Transcrito Interno (ITS 2 perteneciente al ADN ribosomal (rADN. Materiales y Métodos: Se analizaron muestras de ocho localidades (Jaén, Tingo María, Iquitos, Lambayeque, el distrito de El Rimac, Sullana y Zarumilla y uno de la provincia de Huaquillas (Ecuador. El análisis de la variabilidad se determinó usando la técnica conocida como SSCP (Single Stranded Conformation Polymorphism. Resultados: El estudio muestra que existe variabilidad genética entre las poblaciones analizadas, principalmente entre las muestras localizadas en la costa del Perú (Zarumilla, El Rímac, Sullana y Huaquillas y las muestras del nororiente (Tingo María, Iquitos, Jaén y Lambayeque Conclusión: Se determinaron dos variantes genéticas entre las poblaciones de Aedes aegypti: Costeña y Nororiental, que probablemente provienen de dos ancestros diferentes y cuyo ancestro común sufrió de aislamiento por distancia. Se observó que no existe relación entre las distancias genéticas y las distancias geográficas indicando que la migración de estas poblaciones es el resultado de la intervención de los seres humanos que diseminan al vector y no por la migración activa del mosquito. Se plantea el papel de la Cordillera de los Andes en la migración y separación de las poblaciones de Aedes.

  18. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms.

    Science.gov (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A

    2012-05-01

    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. MicroRNAs of the mesothorax in Qinlingacris elaeodes, an alpine grasshopper showing a wing polymorphism with unilateral wing form.

    Science.gov (United States)

    Li, R; Jiang, G F; Ren, Q P; Wang, Y T; Zhou, X M; Zhou, C F; Qin, D Z

    2016-04-01

    MicroRNAs (miRNAs) are now recognized as key post-transcriptional regulators in regulation of phenotypic diversity. Qinlingacris elaeodes is a species of the alpine grasshopper, which is endemic to China. Adult individuals have three wing forms: wingless, unilateral-winged and short-winged. This is an ideal species to investigate the phenotypic plasticity, development and evolution of insect wings because of its case of unilateral wing form in both the sexes. We sequenced a small RNA library prepared from mesothoraxes of the adult grasshoppers using the Illumina deep sequencing technology. Approximately 12,792,458 raw reads were generated, of which the 854,580 high-quality reads were used only for miRNA identification. In this study, we identified 49 conserved miRNAs belonging to 41 families and 69 species-specific miRNAs. Moreover, seven miRNA*s were detected both for conserved miRNAs and species-specific miRNAs, which were supported by hairpin forming precursors based on polymerase chain reaction. This is the first description of miRNAs in alpine grasshoppers. The results provide a useful resource for further studies on molecular regulation and evolution of miRNAs in grasshoppers. These findings not only enrich the miRNAs for insects but also lay the groundwork for the study of post-transcriptional regulation of wing forms.

  1. Characterization of the nanostructure of complexes formed by single- or double-stranded oligonucleotides with a cationic surfactant.

    Science.gov (United States)

    Liu, Xiaoyang; Abbott, Nicholas L

    2010-12-02

    We report the use of dynamic light scattering (DLS), small-angle neutron scattering (SANS), and small-angle X-ray scattering (SAXS) to characterize the nanostructure of complexes formed by either single- or double-stranded oligonucleotides with a cationic surfactant (cetyltrimethylammonium bromide, CTAB) in aqueous solution (1 mM Li(2)SO(4)). For single-stranded oligonucleotides 5'-A(20)-3' and 5'-CCCCATTCTAGCAGCCCGGG-3', both the appearance of two Bragg peaks (at 0.14 and 0.28 Å(-1)) in SAXS spectra with a spacing of 1:2 and form factor fits to SANS spectra are consistent with the presence of multilamellar vesicles (with, on average, 6-9 layers with a periodicity of 45-48 Å). Some samples showed evidence of an additional Bragg peak (at 0.20 Å(-1)) associated with periodic packing (with a periodicity of 31 Å) of the oligonucleotides within the lamellae of the nanostructure. The nucleotide composition of the single-stranded oligonucleotides was also found to impact the number and size of the complexes formed with CTAB. In contrast to 5'-A(20)-3' and 5'-CCCCATTCTAGCAGCCCGGG-3', 5'-T(20)-3' did not change the state of aggregation of CTAB (globular micelles) over a wide range of oligonucleotide:CTAB charge ratios. These results support the proposition that hydrophobic interactions, as well as electrostatics, play a central role in the formation of complexes between cationic amphiphiles and single-stranded oligonucleotides and thus give rise to nanostructures that depend on nucleotide composition. In contrast to the single-stranded oligonucleotides, for double-stranded oligonucleotides mixed with CTAB, three Bragg peaks (0.13, 0.23, and 0.25 Å(-1)) in SAXS spectra with a spacing ratio of 1:√3:√4 and characteristic changes in SANS spectra indicate formation of a hexagonal nanostructure. Also, the composition of the double-stranded oligonucleotides did not measurably impact the nanostructure of complexes formed with CTAB, suggesting that electrostatic

  2. Monounsaturated fatty acid ether oligomers formed during heating of virgin olive oil show agglutination activity against human red blood cells.

    Science.gov (United States)

    Patrikios, Ioannis S; Mavromoustakos, Thomas M

    2014-01-29

    The present work focuses on the characterization of molecules formed when virgin olive oil is heated at 130 °C for 24 h open in air, which are found to be strong agglutinins. The hemagglutinating activity of the newly formed molecule isolated from the heated virgin olive oil sample was estimated against human red blood cells (RBCs). Dimers and polymers (high molecular weight molecules) were identified through thin layer chromatography (TLC) of the oil mixture. (1)H and (13)C nuclear magnetic resonance (NMR) and gas chromatography-mass spectroscopy (GC-MS) were the methods used for structural characterization. Among others, oligomerization of at least two monounsaturated fatty acids (FA) by an ether linkage between the hydrocarbon chains is involved. Light microscopy was used to characterize and visualize the agglutination process. Agglutination without fusion or lysis was observed. It was concluded that the heating of virgin olive oil open in air, among other effects, produces oligomerization as well as polymerization of unsaturated FA, possibly of monohydroxy, monounsaturated FA that is associated with strong hemagglutinating activity against human RBCs. The nutritional value and the effects on human health of such oligomers are not discussed in the literature and remain to be investigated.

  3. Quantitative analysis of free and bonded forms of volatile sulfur compouds in wine. Basic methodologies and evidences showing the existence of reversible cation-complexed forms.

    Science.gov (United States)

    Franco-Luesma, Ernesto; Ferreira, Vicente

    2014-09-12

    This paper examines first some basic aspects critical to the analysis of Volatile Sulfur Compounds (VSCs), such as the analytical characteristics of the GC-pFPD system and the stability of the different standard solutions required for a proper calibration. Following, a direct static headspace analytical method for the determination of exclusively free forms of VSCs has been developed. Method repeatability is better than 4%, detection limits for main analytes are below 0.5μgL(-1), and the method dynamic linear range (r(2)>0.99) is expanded by controlling the split ratio in the chromatographic inlet to cover the natural range of occurrence of these compounds in wines. The method gives reliable estimates of headspace concentrations but, as expected, suffers from strong matrix effects with recoveries ranging from 0 to 100% or from 60 to 100 in the cases of H2S and the other mercaptans, respectively. This demonstrates the existence of strong interactions of these compounds with different matrix components. The complexing ability of Cu(2+) and to a lower extent Fe(2+) and Zn(2+) has been experimentally checked. A previously developed method in which the wine is strongly diluted with brine and the volatiles are preconcentrated by HS-SPME, was found to give a reliable estimation of the total amount (free+complexed) of mercaptans, demonstrating that metal-mercaptan complexes are reversible. The comparative analysis of different wines by the two procedures reveals that in normal wines H2S and methanethiol can be complexed at levels above 99%, with averages around 97% for H2S and 75% for methanethiol, while thioethers such as dimethyl sulfide (DMS) are not complexed. Overall, the proposed strategy may be generalized to understand problems caused by VSCs in different matrices. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Inner experience of pain: imagination of pain while viewing images showing painful events forms subjective pain representation in human brain.

    Science.gov (United States)

    Ogino, Yuichi; Nemoto, Hidenori; Inui, Koji; Saito, Shigeru; Kakigi, Ryusuke; Goto, Fumio

    2007-05-01

    Pain is an unpleasant sensation, and at the same time, it is always subjective and affective. Ten healthy subjects viewed 3 counterbalanced blocks of images from the International Affective Picture System: images showing painful events and those evoking emotions of fear and rest. They were instructed to imagine pain in their own body while viewing each image showing a painful event (the imagination of pain). Using functional magnetic resonance imaging, we compared cerebral hemodynamic responses during the imagination of pain with those to emotions of fear and rest. The results show that the imagination of pain is associated with increased activity in several brain regions involved in the pain-related neural network, notably the anterior cingulate cortex (ACC), right anterior insula, cerebellum, posterior parietal cortex, and secondary somatosensory cortex region, whereas increased activity in the ACC and amygdala is associated with the viewing of images evoking fear. Our results indicate that the imagination of pain even without physical injury engages the cortical representations of the pain-related neural network more specifically than emotions of fear and rest; it also engages the common representation (i.e., in ACC) between the imagination of pain and the emotion of fear.

  5. Contribution of single-strand breaks and alkali-labile bonds to the loss of infectivity of γ-irradiated phiX174 RF-DNA in E. coli cells mutant in various repair functions

    International Nuclear Information System (INIS)

    McKee, R.H.

    1975-01-01

    Twenty-one radiation sensitive mutants have been examined for their capacity to support gamma-irradiated phiX174 RF-DNA. The survival of phiX174 RF-DNA was reduced in essentially all of the sensitive mutants. The irradiated phiX174 RF-DNA was then separated into populations containing either single-strand breaks or alkali-labile bonds to examine the capacity of the mutants to repair each of the classes of lesions. It was found that all E. coli strains are unable to repair 22 percent of the single-strand breaks and all sensitive mutants are unable to repair an additional 10 percent of the breaks. All the repair functions examined are involved in single-strand break repair and none are more or less necessary than any of the others. PhiX174 RF-DNA is also inactivated by alkali-labile bonds. In the normal strains the inactivation efficiency is 0.16 lethal events per lesion with a threshold dose of 15 to 20 krads. The mutants are divided into two classes by their sensitivity to alkali-labile bonds. Both classes of mutants are also inactivated by alkali-labile bonds with efficiencies of about 0.17 and 0.29 lethal events per lesion, respectively. It is proposed that the differences seen in survival curves of phiX174 measured in the sensitive mutants is due to this difference. Although in normal cells the efficiency of inactivation of phiX174 by single-strand breaks is 50 percent greater than by alkali-labile bonds, alkali-labile bonds are produced at approximately twice the rate of single-strand breaks so alkali-labile bonds account for about 61 percent of the overall inactivation. In the mutants of least sensitivity alkali-labile bonds account for about 54 percent of the inactivating events and in the most sensitive about 67 percent

  6. Mutagenesis of the Agrobacterium VirE2 single-stranded DNA-binding protein identifies regions required for self-association and interaction with VirE1 and a permissive site for hybrid protein construction.

    Science.gov (United States)

    Zhou, X R; Christie, P J

    1999-07-01

    The VirE2 single-stranded DNA-binding protein (SSB) of Agrobacterium tumefaciens is required for delivery of T-DNA to the nuclei of susceptible plant cells. By yeast two-hybrid and immunoprecipitation analyses, VirE2 was shown to self-associate and to interact with VirE1. VirE2 mutants with small deletions or insertions of a 31-residue oligopeptide (i31) at the N or C terminus or with an i31 peptide insertion at Leu236 retained the capacity to form homomultimers. By contrast, VirE2 mutants with modifications outside a central region located between residues 320 and 390 retained the capacity to interact with VirE1. These findings suggest the tertiary structure of VirE2 is important for homomultimer formation whereas a central domain mediates formation of a complex with VirE1. The capacity of VirE2 mutants to interact with full-length VirE2 in the yeast Saccharomyces cerevisiae correlated with the abundance of the mutant proteins in A. tumefaciens, suggesting that VirE2 is stabilized by homomultimerization in the bacterium. We further characterized the promoter and N- and C-terminal sequence requirements for synthesis of functional VirE2. A PvirB::virE2 construct yielded functional VirE2 protein as defined by complementation of a virE2 null mutation. By contrast, PvirE or Plac promoter constructs yielded functional VirE2 only if virE1 was coexpressed with virE2. Deletion of 10 or 9 residues from the N or C terminus of VirE2, respectively, or addition of heterologous peptides or proteins to either terminus resulted in a loss of protein function. However, an i31 peptide insertion at Tyr39 had no effect on protein function as defined by the capacity of the mutant protein to (i) interact with native VirE2, (ii) interact with VirE1, (iii) accumulate at abundant levels in A. tumefaciens, and (iv) restore wild-type virulence to a virE2 null mutant. We propose that Tyr39 of VirE2 corresponds to a permissive site for insertion of heterologous peptides or proteins of interest

  7. Man's underground best friend: domestic ferrets, unlike the wild forms, show evidence of dog-like social-cognitive skills.

    Directory of Open Access Journals (Sweden)

    Anna Hernádi

    Full Text Available Recent research has shown that dogs' possess surprisingly sophisticated human-like social communication skills compared to wolves or chimpanzees. The effects of domestication on the emergence of socio-cognitive skills, however, are still highly debated. One way to investigate this is to compare socialized individuals from closely related domestic and wild species. In the present study we tested domestic ferrets (Mustela furo and compared their performance to a group of wild Mustela hybrids and to domestic dogs (Canis familiaris. We found that, in contrast to wild Mustela hybrids, both domestic ferrets and dogs tolerated eye-contact for a longer time when facing their owners versus the experimenter and they showed a preference in a two-way choice task towards their owners. Furthermore, domestic ferrets, unlike the wild hybrids, were able to follow human directional gestures (sustained touching; momentary pointing and could reach the success rate of dogs. Our study provides the first evidence that domestic ferrets, in a certain sense, are more dog-like than their wild counterparts. These findings support the hypothesis that domestic species may share basic socio-cognitive skills that enable them to engage in effectively orchestrated social interactions with humans.

  8. Man's underground best friend: domestic ferrets, unlike the wild forms, show evidence of dog-like social-cognitive skills.

    Science.gov (United States)

    Hernádi, Anna; Kis, Anna; Turcsán, Borbála; Topál, József

    2012-01-01

    Recent research has shown that dogs' possess surprisingly sophisticated human-like social communication skills compared to wolves or chimpanzees. The effects of domestication on the emergence of socio-cognitive skills, however, are still highly debated. One way to investigate this is to compare socialized individuals from closely related domestic and wild species. In the present study we tested domestic ferrets (Mustela furo) and compared their performance to a group of wild Mustela hybrids and to domestic dogs (Canis familiaris). We found that, in contrast to wild Mustela hybrids, both domestic ferrets and dogs tolerated eye-contact for a longer time when facing their owners versus the experimenter and they showed a preference in a two-way choice task towards their owners. Furthermore, domestic ferrets, unlike the wild hybrids, were able to follow human directional gestures (sustained touching; momentary pointing) and could reach the success rate of dogs. Our study provides the first evidence that domestic ferrets, in a certain sense, are more dog-like than their wild counterparts. These findings support the hypothesis that domestic species may share basic socio-cognitive skills that enable them to engage in effectively orchestrated social interactions with humans.

  9. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: tcheng@ntu.edu.tw [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)

    2013-02-01

    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ► To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ► ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ► PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ► The findings

  10. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  11. Clostridium perfringens delta toxin is sequence related to beta toxin, NetB, and Staphylococcus pore-forming toxins, but shows functional differences.

    Directory of Open Access Journals (Sweden)

    Maria Manich

    Full Text Available Clostridium perfringens produces numerous toxins, which are responsible for severe diseases in man and animals. Delta toxin is one of the three hemolysins released by a number of C. perfringens type C and possibly type B strains. Delta toxin was characterized to be cytotoxic for cells expressing the ganglioside G(M2 in their membrane. Here we report the genetic characterization of Delta toxin and its pore forming activity in lipid bilayers. Delta toxin consists of 318 amino acids, its 28 N-terminal amino acids corresponding to a signal peptide. The secreted Delta toxin (290 amino acids; 32619 Da is a basic protein (pI 9.1 which shows a significant homology with C. perfringens Beta toxin (43% identity, with C. perfringens NetB (40% identity and, to a lesser extent, with Staphylococcus aureus alpha toxin and leukotoxins. Recombinant Delta toxin showed a preference for binding to G(M2, in contrast to Beta toxin, which did not bind to gangliosides. It is hemolytic for sheep red blood cells and cytotoxic for HeLa cells. In artificial diphytanoyl phosphatidylcholine membranes, Delta and Beta toxin formed channels. Conductance of the channels formed by Delta toxin, with a value of about 100 pS to more than 1 nS in 1 M KCl and a membrane potential of 20 mV, was higher than those formed by Beta toxin and their distribution was broader. The results of zero-current membrane potential measurements and single channel experiments suggest that Delta toxin forms slightly anion-selective channels, whereas the Beta toxin channels showed a preference for cations under the same conditions. C. perfringens Delta toxin shows a significant sequence homolgy with C. perfringens Beta and NetB toxins, as well as with S. aureus alpha hemolysin and leukotoxins, but exhibits different channel properties in lipid bilayers. In contrast to Beta toxin, Delta toxin recognizes G(M2 as receptor and forms anion-selective channels.

  12. After Nerve Injury, Lineage Tracing Shows That Myelin and Remak Schwann Cells Elongate Extensively and Branch to Form Repair Schwann Cells, Which Shorten Radically on Remyelination.

    Science.gov (United States)

    Gomez-Sanchez, Jose A; Pilch, Kjara S; van der Lans, Milou; Fazal, Shaline V; Benito, Cristina; Wagstaff, Laura J; Mirsky, Rhona; Jessen, Kristjan R

    2017-09-13

    There is consensus that, distal to peripheral nerve injury, myelin and Remak cells reorganize to form cellular columns, Bungner's bands, which are indispensable for regeneration. However, knowledge of the structure of these regeneration tracks has not advanced for decades and the structure of the cells that form them, denervated or repair Schwann cells, remains obscure. Furthermore, the origin of these cells from myelin and Remak cells and their ability to give rise to myelin cells after regeneration has not been demonstrated directly, although these conversions are believed to be central to nerve repair. Using genetic lineage-tracing and scanning-block face electron microscopy, we show that injury of sciatic nerves from mice of either sex triggers extensive and unexpected Schwann cell elongation and branching to form long, parallel processes. Repair cells are 2- to 3-fold longer than myelin and Remak cells and 7- to 10-fold longer than immature Schwann cells. Remarkably, when repair cells transit back to myelinating cells, they shorten ∼7-fold to generate the typically short internodes of regenerated nerves. The present experiments define novel morphological transitions in injured nerves and show that repair Schwann cells have a cell-type-specific structure that differentiates them from other cells in the Schwann cell lineage. They also provide the first direct evidence using genetic lineage tracing for two basic assumptions in Schwann cell biology: that myelin and Remak cells generate the elongated cells that build Bungner bands in injured nerves and that such cells can transform to myelin cells after regeneration. SIGNIFICANCE STATEMENT After injury to peripheral nerves, the myelin and Remak Schwann cells distal to the injury site reorganize and modify their properties to form cells that support the survival of injured neurons, promote axon growth, remove myelin-associated growth inhibitors, and guide regenerating axons to their targets. We show that the

  13. ASACUSA's radio-frequency quadrupole decelerator, open to show the four-rod structure along the centre, which crosses 35 resonator chambers formed by the vertical partitions.

    CERN Multimedia

    Laurent Guiraud

    2000-01-01

    The Radio-Frequency Quadrupole, RFQD, which further decelerates antiprotons ejected from the Antiproton Decelerator (AD). Starting from a momentum of 100 MeV/c (kinetic energy 5.3 MeV), the RFQD delivers very-low-energy antiprotons, adjustable between 10 and 110 keV, to the experiment ASACUSA. In picture _02, the view from the upstream end shows its 4-rod structure, traversing 35 resonator chambers formed by the vertical partitions. The tank has an inner diameter of 390 mm and is pumped to a vacuum of a few E-8 Torr.

  14. Identified lhb-expressing cells from medaka (Oryzias latipes) show similar Ca(2+)-response to all endogenous Gnrh forms, and reveal expression of a novel fourth Gnrh receptor.

    Science.gov (United States)

    Strandabø, Rønnaug A U; Grønlien, Heidi K; Ager-Wick, Eirill; Nourizadeh-Lillabadi, Rasoul; Hildahl, Jon P; Weltzien, Finn-Arne; Haug, Trude M

    2016-04-01

    We have previously characterized the response to gonadotropin-releasing hormone (Gnrh) 2 in luteinizing hormone (lhb)-expressing cells from green fluorescent protein (Gfp)-transgenic medaka (Oryzias latipes), with regard to changes in the cytosolic Ca(2+) concentration. In the current study we present the corresponding responses to Gnrh1 and Gnrh3. Ca(2+) imaging revealed three response patterns to Gnrh1 and Gnrh3, one monophasic and two types of biphasic patterns. There were few significant differences in the shape of the response patterns between the three Gnrh forms, although the amplitude of the Ca(2+) signal was considerably lower for Gnrh1 and Gnrh3 than for Gnrh2, and the distribution between the two different biphasic patterns differed. The different putative Ca(2+) sources were examined by depleting intracellular Ca(2+) stores with thapsigargin, or preventing influx of extracellular Ca(2+) by either extracellular Ca(2+) depletion or the L-type Ca(2+)-channel blocker verapamil. Both Gnrh1 and 3 relied on Ca(2+) from both intracellular and extracellular sources, with some unexpected differences in the relative contribution. Furthermore, gene expression of Gnrh-receptors (gnrhr) in whole pituitaries was studied during development from juvenile to adult. Only two of the four identified medaka receptors were expressed in the pituitary, gnrhr1b and gnrhr2a, with the newly discovered gnrhr2a showing the highest expression level at all stages as analyzed by quantitative PCR. While both receptors differed in expression level according to developmental stage, only the expression of gnrhr2a showed a clear-cut increase with gonadal maturation. RNA sequencing analysis of FACS-sorted Gfp-positive lhb-cells revealed that both gnrhr1b and gnrhr2a were expressed in lhb-expressing cells, and confirmed the higher expression of gnrhr2a compared to gnrhr1b. These results show that although lhb-expressing gonadotropes in medaka show similar Ca(2+) response patterns to all three

  15. Mice expressing a "hyper-sensitive" form of the CB1 cannabinoid receptor (CB1 show modestly enhanced alcohol preference and consumption.

    Directory of Open Access Journals (Sweden)

    David J Marcus

    Full Text Available We recently characterized S426A/S430A mutant mice expressing a desensitization-resistant form of the CB1 receptor. These mice display an enhanced response to endocannabinoids and ∆9-THC. In this study, S426A/S430A mutants were used as a novel model to test whether ethanol consumption, morphine dependence, and reward for these drugs are potentiated in mice with a "hyper-sensitive" form of CB1. Using an unlimited-access, two-bottle choice, voluntary drinking paradigm, S426A/S430A mutants exhibit modestly increased intake and preference for low (6% but not higher concentrations of ethanol. S426A/S430A mutants and wild-type mice show similar taste preference for sucrose and quinine, exhibit normal sensitivity to the hypothermic and ataxic effects of ethanol, and have normal blood ethanol concentrations following administration of ethanol. S426A/S430A mutants develop robust conditioned place preference for ethanol (2 g/kg, morphine (10 mg/kg, and cocaine (10 mg/kg, demonstrating that drug reward is not changed in S426A/S430A mutants. Precipitated morphine withdrawal is also unchanged in opioid-dependent S426A/S430A mutant mice. Although ethanol consumption is modestly changed by enhanced CB1 signaling, reward, tolerance, and acute sensitivity to ethanol and morphine are normal in this model.

  16. Comparison of various methods of detection of different forms of dengue virus type 2 RNA in cultured cells

    International Nuclear Information System (INIS)

    Liu, H.S.; Lin, Y.L.; Chen, C.C.

    1997-01-01

    In this report, the sensitivity of various methods of detection of dengue virus type 2 (DEN-2) sense, antisense, replicative intermediate (RI) and replicative form (RF) RNAs in infected mosquito Aedes pseudoscutellaris AP-61 and mammalian baby hamster kidney BHK-21 cells is compared. LiCl precipitation was used for separation of viral RF RNA from RI RNA. Our results show that reverse transcription-polymerase chain reaction (RT-PCR) followed by Southern blot analysis and slot blot hybridisation of LiCl-fractionated RNA were the most sensitive methods of detection of viral RNA and determination of its single-stranded form. Northern blot analysis was the least sensitive method of detection of any form of viral RNA. U sing slot blot hybridisation of LiCl-precipitated RNA, viral RI RNA containing de novo synthesised negative strand viral RNA was first detected 30 min after virus inoculation in both cell lines. This is the earliest time of detection of DEN viral RNA synthesis in host cells so far reported. However, RF RNA could not be detected until 24 hrs post infection (p.i.) in AP-61 and 2 days p.i. in BHK-21 cells, respectively. The sequential order of individual forms of viral RNA detected in the infected cells was RI, RF and genomic RNAs. Viral RNA was detected in AP-61 cells always earlier than in BHK-21 cells. Moreover, the level of viral RNA in AP-61 cells was higher than that in BHK-21 cells, suggesting that the virus replicated more actively in AP-61 cells. In conclusion, the LiCl separation of viral RNA followed by slot blot hybridisation was found to be the most sensitive and reliable method of detection of DEN virus RI, RF and genomic RNAs in the infected cells. Moreover, this method can be applied to determine the replication status of any single-stranded RNA virus in the host. (authors)

  17. A novel single-stranded RNA virus isolated from a phytopathogenic filamentous fungus, Rosellinia necatrix, with similarity to hypo-like viruses

    Directory of Open Access Journals (Sweden)

    Rui eZhang

    2014-07-01

    Full Text Available Here we report a biological and molecular characterization of a novel positive-sense RNA virus isolated from a field isolate (NW10 of a filamentous phytopathogenic fungus, the white root rot fungus that is designated as Rosellinia necatrix fusarivirus 1 (RnFV1. A recently developed technology using zinc ions allowed us to transfer RnFV1 to two mycelially incompatible Rosellinia necatrix strains. A biological comparison of the virus-free and -recipient isogenic fungal strains suggested that RnFV1 infects latently and thus has no potential as a virocontrol agent. The virus has an undivided positive-sense RNA genome of 6286 nucleotides excluding a poly (A tail. The genome possesses two non-overlapping open reading frames (ORFs: a large ORF1 that encodes polypeptides with RNA replication functions and a smaller ORF2 that encodes polypeptides of unknown function. A lack of coat protein genes was suggested by the failure of virus particles from infected mycelia. No evidence was obtained by Northern analysis or classical 5'-RACE for the presence of subgenomic RNA for the downstream ORF. Sequence similarities were found in amino-acid sequence between RnFV1 putative proteins and counterparts of a previously reported mycovirus, Fusarium graminearum virus 1 (FgV1. Interestingly, several related sequences were detected by BLAST searches of independent transcriptome assembly databases one of which probably represents an entire virus genome. Phylogenetic analysis based on the conserved RNA-dependent RNA polymerase showed that RnFV1, FgV1, and these similar sequences are grouped in a cluster distinct from distantly related hypoviruses. It is proposed that a new taxonomic family termed Fusariviridae be created to include RnFV1and FgV1.

  18. The Rev1 interacting region (RIR) motif in the scaffold protein XRCC1 mediates a low-affinity interaction with polynucleotide kinase/phosphatase (PNKP) during DNA single-strand break repair.

    Science.gov (United States)

    Breslin, Claire; Mani, Rajam S; Fanta, Mesfin; Hoch, Nicolas; Weinfeld, Michael; Caldecott, Keith W

    2017-09-29

    The scaffold protein X-ray repair cross-complementing 1 (XRCC1) interacts with multiple enzymes involved in DNA base excision repair and single-strand break repair (SSBR) and is important for genetic integrity and normal neurological function. One of the most important interactions of XRCC1 is that with polynucleotide kinase/phosphatase (PNKP), a dual-function DNA kinase/phosphatase that processes damaged DNA termini and that, if mutated, results in ataxia with oculomotor apraxia 4 (AOA4) and microcephaly with early-onset seizures and developmental delay (MCSZ). XRCC1 and PNKP interact via a high-affinity phosphorylation-dependent interaction site in XRCC1 and a forkhead-associated domain in PNKP. Here, we identified using biochemical and biophysical approaches a second PNKP interaction site in XRCC1 that binds PNKP with lower affinity and independently of XRCC1 phosphorylation. However, this interaction nevertheless stimulated PNKP activity and promoted SSBR and cell survival. The low-affinity interaction site required the highly conserved Rev1-interacting region (RIR) motif in XRCC1 and included three critical and evolutionarily invariant phenylalanine residues. We propose a bipartite interaction model in which the previously identified high-affinity interaction acts as a molecular tether, holding XRCC1 and PNKP together and thereby promoting the low-affinity interaction identified here, which then stimulates PNKP directly. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  20. The interaction of hyperthermophilic TATA-box binding protein with single-stranded DNA is entropically favorable and exhibits a large negative heat capacity change at high salt concentration.

    Science.gov (United States)

    Nagatoishi, Satoru; Tanaka, Yoshikazu; Kudou, Motonori; Tsumoto, Kouhei

    2009-09-01

    We have investigated the thermodynamics of the interaction between the TATA-box-binding protein from Pyrococcus horikoshii (PhoTBP) and its target DNA (TATA-1). The interaction between PhoTBP and double-stranded DNA (dsDNA) is entropically favorable and enthalpically unfavorable. The thermodynamic parameters for TATA-1 duplex formation in the presence of PhoTBP, that is, ternary PhoTBP-dsDNA complexation, are similar to those for TATA-1 duplex formation, which is enthalpically favorable. Surface plasmon resonance analysis indicates that the interaction between PhoTBP and single-stranded DNA (ssDNA) of TATA-1 is entropy driven and has a large negative heat capacity change (-1.19 kcal mol(-1) K(-1)) at high salt concentration (800 mM NaCl). These results suggest that the favorable entropic effect corresponding to the interaction between PhoTBP and dsDNA is due not to ternary complexation but to the interaction between PhoTBP and ssDNA. This report is the first to describe the thermodynamics of the interaction between TBP and ssDNA.

  1. A G-C-rich palindromic structural motif and a stretch of single-stranded purines are required for optimal packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA.

    Science.gov (United States)

    Jaballah, Soumeya Ali; Aktar, Suriya J; Ali, Jahabar; Phillip, Pretty Susan; Al Dhaheri, Noura Salem; Jabeen, Aayesha; Rizvi, Tahir A

    2010-09-03

    During retroviral RNA packaging, two copies of genomic RNA are preferentially packaged into the budding virus particles whereas the spliced viral RNAs and the cellular RNAs are excluded during this process. Specificity towards retroviral RNA packaging is dependent upon sequences at the 5' end of the viral genome, which at times extend into Gag sequences. It has earlier been suggested that the Mason-Pfizer monkey virus (MPMV) contains packaging sequences within the 5' untranslated region (UTR) and Gag. These studies have also suggested that the packaging determinants of MPMV that lie in the UTR are bipartite and are divided into two regions both upstream and downstream of the major splice donor. However, the precise boundaries of these discontinuous regions within the UTR and the role of the intervening sequences between these dipartite sequences towards MPMV packaging have not been investigated. Employing a combination of genetic and structural prediction analyses, we have shown that region "A", immediately downstream of the primer binding site, is composed of 50 nt, whereas region "B" is composed of the last 23 nt of UTR, and the intervening 55 nt between these two discontinuous regions do not contribute towards MPMV RNA packaging. In addition, we have identified a 14-nt G-C-rich palindromic sequence (with 100% autocomplementarity) within region A that has been predicted to fold into a structural motif and is essential for optimal MPMV RNA packaging. Furthermore, we have also identified a stretch of single-stranded purines (ssPurines) within the UTR and 8 nt of these ssPurines are duplicated in region B. The native ssPurines or its repeat in region B when predicted to refold as ssPurines has been shown to be essential for RNA packaging, possibly functioning as a potential nucleocapsid binding site. Findings from this study should enhance our understanding of the steps involved in MPMV replication including RNA encapsidation process. Copyright (c) 2010 Elsevier Ltd

  2. Early-onset and classical forms of type 2 diabetes show impaired expression of genes involved in muscle branched-chain amino acids metabolism

    DEFF Research Database (Denmark)

    Hernández-Alvarez, María Isabel; Díaz-Ramos, Angels; Berdasco, María

    2017-01-01

    The molecular mechanisms responsible for the pathophysiological traits of type 2 diabetes are incompletely understood. Here we have performed transcriptomic analysis in skeletal muscle, and plasma metabolomics from subjects with classical and early-onset forms of type 2 diabetes (T2D). Focused...... that the BCAA genes are relevant in the pathophysiology of type 2 diabetes, and that mitochondrial BCAA management is impaired in skeletal muscle from T2D patients. In diabetic mice model we detected alterations in skeletal muscle proteins involved in BCAA metabolism but not in obese mice. Metabolomic analysis...... revealed increased levels of branched-chain keto acids (BCKA), and BCAA in plasma of T2D patients, which may result from the disruption of muscle BCAA management. Our data support the view that inhibition of genes involved in BCAA handling in skeletal muscle takes place as part of the pathophysiology...

  3. Recombination analysis and structure prediction show correlation between breakpoint clusters and RNA hairpins in the pol gene of human immunodeficiency virus type 1 unique recombinant forms

    DEFF Research Database (Denmark)

    Galli, Andrea; Lai, Alessia; Corvasce, Stefano

    2008-01-01

    throughout the genome, leading to viral recombination. Some recombination hotspots have been identified and found to correlate with RNA structure or sequence features. The aim of this study was to evaluate the presence of recombination hotspots in the pol gene of HIV-1 and to assess their correlation......Recombination is recognized as a primary force in human immunodeficiency virus type 1 (HIV-1) evolution, increasing viral diversity through reshuffling of genomic portions. The strand-switching activity of reverse transcriptase is required to complete HIV-1 replication and can occur randomly...... with the underlying RNA structure. Analysis of the recombination pattern and breakpoint distribution in a group of unique recombinant forms (URFs) detected two recombination hotspots in the pol region. Two stable and conserved hairpins were consistently predicted corresponding to the identified hotspots using six...

  4. Early-onset and classical forms of type 2 diabetes show impaired expression of genes involved in muscle branched-chain amino acids metabolism

    DEFF Research Database (Denmark)

    Hernández-Alvarez, María Isabel; Díaz-Ramos, Angels; Berdasco, María

    2017-01-01

    studies were also performed in tissues from ob/ob and db/db mice. We document that T2D, both early and late onset, are characterized by reduced muscle expression of genes involved in branched-chain amino acids (BCAA) metabolism. Weighted Co-expression Networks Analysis provided support to idea......The molecular mechanisms responsible for the pathophysiological traits of type 2 diabetes are incompletely understood. Here we have performed transcriptomic analysis in skeletal muscle, and plasma metabolomics from subjects with classical and early-onset forms of type 2 diabetes (T2D). Focused...... that the BCAA genes are relevant in the pathophysiology of type 2 diabetes, and that mitochondrial BCAA management is impaired in skeletal muscle from T2D patients. In diabetic mice model we detected alterations in skeletal muscle proteins involved in BCAA metabolism but not in obese mice. Metabolomic analysis...

  5. Purine- and pyrimidine-triple-helix-forming oligonucleotides recognize qualitatively different target sites at the ribosomal DNA locus.

    Science.gov (United States)

    Maldonado, Rodrigo; Filarsky, Michael; Grummt, Ingrid; Längst, Gernot

    2018-03-01

    Triplexes are noncanonical DNA structures, which are functionally associated with regulation of gene expression through ncRNA targeting to chromatin. Based on the rules of Hoogsteen base-pairing, polypurine sequences of a duplex can potentially form triplex structures with single-stranded oligonucleotides. Prediction of triplex-forming sequences by bioinformatics analyses have revealed enrichment of potential triplex targeting sites (TTS) at regulatory elements, mainly in promoters and enhancers, suggesting a potential function of RNA-DNA triplexes in transcriptional regulation. Here, we have quantitatively evaluated the potential of different sequences of human and mouse ribosomal RNA genes ( rDNA ) to form triplexes at different salt and pH conditions. We show by biochemical and biophysical approaches that some of these predicted sequences form triplexes with high affinity, following the canonical rules for triplex formation. We further show that RNA triplex-forming oligos (TFOs) are more stable than their DNA counterpart, and point mutations strongly affect triplex formation. We further show differential sequence requirements of pyrimidine and purine TFO sequences for efficient binding, depending on the G-C content of the TTS. The unexpected sequence specificity, revealing distinct sequence requirements for purine and pyrimidine TFOs, shows that in addition to the Hoogsteen pairing rules, a sequence code and mutations have to be taken into account to predict genomic TTS. © 2018 Maldonado et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  6. Novel form of miR-29b suppresses bleomycin-induced pulmonary fibrosis.

    Directory of Open Access Journals (Sweden)

    Yuko Yamada

    Full Text Available MicroRNA 29b (miR-29b replacement therapy is effective for suppressing fibrosis in a mouse model. However, to develop clinical applications for miRNA mimics, the side effects of nucleic acid drugs have to be addressed. In this study, we focused on miRNA mimics in order to develop therapies for idiopathic pulmonary fibrosis. We developed a single-stranded RNA, termed "miR-29b Psh-match," that has a unique structure to avoid problems associated with the therapeutic uses of miRNAs. A comparison of miR-29b Psh-match and double-stranded one, termed "miR-29b mimic" indicated that the single-stranded form was significantly effective towards fibrosis according to both in vivo and in vitro experiments. This novel form of miR-29b may become the foundation for developing an effective therapeutic drug for pulmonary fibrosis.

  7. The Bipolar Filaments Formed by Herpes Simplex Virus Type 1 SSB/Recombination Protein (ICP8) Suggest a Mechanism for DNA Annealing

    Energy Technology Data Exchange (ETDEWEB)

    Makhov, A.M.; Simon, M.; Sen, A.; Yu, X.; Griffith, J. D.; Egelman, E. H.

    2009-02-20

    Herpes simplex virus type 1 encodes a multifunctional protein, ICP8, which serves both as a single-strand binding protein and as a recombinase, catalyzing reactions involved in replication and recombination of the viral genome. In the presence of divalent ions and at low temperature, previous electron microscopic studies showed that ICP8 will form long left-handed helical filaments. Here, electron microscopic image reconstruction reveals that the filaments are bipolar, with an asymmetric unit containing two subunits of ICP8 that constitute a symmetrical dimer. This organization of the filament has been confirmed using scanning transmission electron microscopy. The pitch of the filaments is {approx} 250 {angstrom}, with {approx} 6.2 dimers per turn. Docking of a crystal structure of ICP8 into the reconstructed filament shows that the C-terminal domain of ICP8, attached to the body of the subunit by a flexible linker containing {approx} 10 residues, is packed into a pocket in the body of a neighboring subunit in the crystal in a similar manner as in the filament. However, the interactions between the large N-terminal domains are quite different in the filament from that observed in the crystal. A previously proposed model for ICP8 binding single-stranded DNA (ssDNA), based upon the crystal structure, leads to a model for a continuous strand of ssDNA near the filament axis. The bipolar nature of the ICP8 filaments means that a second strand of ssDNA would be running through this filament in the opposite orientation, and this provides a potential mechanism for how ICP8 anneals complementary ssDNA into double-stranded DNA, where each strand runs in opposite directions.

  8. The novel influenza A virus protein PA-X and its naturally deleted variant show different enzymatic properties in comparison to the viral endonuclease PA.

    Science.gov (United States)

    Bavagnoli, Laura; Cucuzza, Stefano; Campanini, Giulia; Rovida, Francesca; Paolucci, Stefania; Baldanti, Fausto; Maga, Giovanni

    2015-10-30

    The PA protein of Influenza A virus (IAV) encoded by segment 3 acts as a specialized RNA endonuclease in the transcription of the viral genome. The same genomic segment encodes for a second shorter protein, termed PA-X, with the first 191 N-terminal aminoacids (aa) identical to PA, but with a completely different C-ter domain of 61 aa, due to a ribosomal frameshifting. In addition, it has been shown that several IAV isolates encode for a naturally truncated PA-X variant, PAXΔC20, missing the last 20 aa. The biochemical properties of PA-X and PAXΔC20 have been poorly investigated so far. Here, we have carried out an enzymatic characterization of PA-X and its naturally deleted form, in comparison with PA from the human IAV strain A/WSN/33 (H1N1). Our results showed, to the best of our knowledge for the first time, that PA-X possesses an endonucleolytic activity. Both PA and PA-X preferentially cut single stranded RNA regions, but with some differences. In addition, we showed that PAXΔC20 has severely reduced nuclease activity. These results point to a previously undetected role of the last C-ter 20 aa for the catalytic activity of PA-X and support distinct roles for these proteins in the viral life cycle. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. The skin migratory stage of the schistosomulum of Schistosoma mansoni has a surface showing greater permeability and activity in membrane internalisation than other forms of skin or mechanical schistosomula.

    Science.gov (United States)

    DE Jesus Jeremias, Wander; DA Cunha Melo, Jose Renan; Baba, Elio Hideo; Coelho, Paulo Marcos Zech; Kusel, John Robert

    2015-08-01

    Skin schistosomula can be prepared by collecting them after isolated mouse skin have been penetrated by cercariae in vitro. The schistosomula can also migrate out of isolated mouse skin penetrated by cercariae in vitro and from mouse skin penetrated by cercariae in vivo. Schistosomula can also be produced from cercariae applied through a syringe or in a vortex. When certain surface properties of the different forms of schistosomula were compared, those migrating from mouse skin penetrated by cercariae in vivo or in vitro had greatly increased permeability to membrane impermeant molecules such as Lucifer yellow and high molecular weight dextrans. These migrating forms also possessed surfaces which showed greatly enhanced uptake into internal membrane vesicles of the dye FM 143, a marker for endocytosis. This greatly enhanced activity and permeability of the surfaces of tissue migrating schistosomula is likely to be of great importance in the adaptation to the new host.

  10. Nucleolin forms a specific complex with a fragment of the viral (minus) strand of minute virus of mice DNA.

    Science.gov (United States)

    Barrijal, S; Perros, M; Gu, Z; Avalosse, B L; Belenguer, P; Amalric, F; Rommelaere, J

    1992-01-01

    Nucleolin, a major nucleolar protein, forms a specific complex with the genome (a single-stranded DNA molecule of minus polarity) of parvovirus MVMp in vitro. By means of South-western blotting experiments, we mapped the binding site to a 222-nucleotide motif within the non-structural transcription unit, referred to as NUBE (nucleolin-binding element). The specificity of the interaction was confirmed by competitive gel retardation assays. DNaseI and nuclease S1 probing showed that NUBE folds into a secondary structure, in agreement with a computer-assisted conformational prediction. The whole NUBE may be necessary for the interaction with nucleolin, as suggested by the failure of NUBE subfragments to bind the protein and by the nuclease footprinting experiments. The present work extends the previously reported ability of nucleolin to form a specific complex with ribosomal RNA, to a defined DNA substrate. Considering the tropism of MVMp DNA replication for host cell nucleoli, these data raise the possibility that nucleolin may contribute to the regulation of the parvoviral life-cycle. Images PMID:1408821

  11. Free mRNA in excess upon polysome dissociation is a scaffold for protein multimerization to form stress granules.

    Science.gov (United States)

    Bounedjah, Ouissame; Desforges, Bénédicte; Wu, Ting-Di; Pioche-Durieu, Catherine; Marco, Sergio; Hamon, Loic; Curmi, Patrick A; Guerquin-Kern, Jean-Luc; Piétrement, Olivier; Pastré, David

    2014-07-01

    The sequence of events leading to stress granule assembly in stressed cells remains elusive. We show here, using isotope labeling and ion microprobe, that proportionally more RNA than proteins are present in stress granules than in surrounding cytoplasm. We further demonstrate that the delivery of single strand polynucleotides, mRNA and ssDNA, to the cytoplasm can trigger stress granule assembly. On the other hand, increasing the cytoplasmic level of mRNA-binding proteins like YB-1 can directly prevent the aggregation of mRNA by forming isolated mRNPs, as evidenced by atomic force microscopy. Interestingly, we also discovered that enucleated cells do form stress granules, demonstrating that the translocation to the cytoplasm of nuclear prion-like RNA-binding proteins like TIA-1 is dispensable for stress granule assembly. The results lead to an alternative view on stress granule formation based on the following sequence of events: after the massive dissociation of polysomes during stress, mRNA-stabilizing proteins like YB-1 are outnumbered by the burst of nonpolysomal mRNA. mRNA freed of ribosomes thus becomes accessible to mRNA-binding aggregation-prone proteins or misfolded proteins, which induces stress granule formation. Within the frame of this model, the shuttling of nuclear mRNA-stabilizing proteins to the cytoplasm could dissociate stress granules or prevent their assembly. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. A comparative study on the u.v. resistance of double-stranded and single-stranded encephalomyocarditis virus RNAs: evaluation of the possible contribution of host-mediated repair

    International Nuclear Information System (INIS)

    Koonin, E.V.; Chumakov, K.M.; Agol, V.I.; Moscow State Univ.; Academy of Medical Sciences, Moscow

    1980-01-01

    To reveal previously suggested host-mediated repair of u.v.-induced lesions in dsRNA of encephalomyocarditis (EMC) virus, two sets of experiments have been carried out: (i) samples of dsRNA of EMC virus were irradiated with different doses of u.v. light and their infectivity was assayed in Krebs II cells, before and after conversion of dsRNA into a ss form; (ii) samples of ssRNA of EMC virus were similarly irradiated and their infectivity was assayed before and after conversion of ssRNA into a ds form. No evidence for a significant host-mediated repair of dsRNA in this virus-cell system has been obtained. (U.K.)

  13. Rapid identification of cyst (Heterodera spp., Globodera spp.) and root-knot (Meloidogyne spp.) nematodes on the basis of ITS2 sequence variation detected by PCR-single-strand conformational polymorphism (PCR-SSCP) in cultures and field samples

    NARCIS (Netherlands)

    Clapp, J.P.; Van der Stoel, C.D.; Van der Putten, W.H.

    2000-01-01

    Cyst and root-knot nematodes show high levels of gross morphological similarity. This presents difficulties for the study of their ecology in natural ecosystems. In this study, cyst and root-knot nematode species, as well as some ectoparasitic nematode species, were identified using the second

  14. Leptin gene polymorphism in Indian Sahiwal cattle by single strand ...

    African Journals Online (AJOL)

    These leptin gene variants can be sequenced and screened in the entire population to develop single nucleotide polymorphisms (SNPs) for association studies with different productive and reproductive performances and marker assisted selection. Keywords: Leptin gene, PCR-SSCP, genetic variability, dairy cattle

  15. Teaching Form as Form

    DEFF Research Database (Denmark)

    Keiding, Tina Bering

    2012-01-01

    understanding of form per se, or, to use an expression from this text, of form as form. This challenge can be reduced to one question: how can design teaching support students in achieving not only the ability to recognize and describe different form-related concepts in existing design (i.e. analytical...... and concepts from real designs by studying form in abstract contexts. The challenge for the first approach is how to support students in decoupling form from the work as a whole. The challenge for the second approach is how to translate general form into real design. Hence, choosing between the two approaches...

  16. Survey of familial glaucoma shows a high incidence of cytochrome P450, family 1, subfamily B, polypeptide 1 (CYP1B1) mutations in non-consanguineous congenital forms in a Spanish population

    Science.gov (United States)

    Millá, Elena; Mañé, Begoña; Duch, Susana; Hernan, Imma; Borràs, Emma; Planas, Ester; Dias, Miguel de Sousa; Carballo, Miguel

    2013-01-01

    Purpose To identify myocilin (MYOC) and cytochrome P450, family 1, subfamily B, polypeptide 1 (CYP1B1) mutations in a Spanish population with different clinical forms of familial glaucoma or ocular hypertension (OHT). Methods Index patients from 226 families participated in this study. Patients were diagnosed with familial glaucoma or OHT by complete ophthalmologic examination. Screening for MYOC mutations was performed in 207 index patients: 96 with adult-onset primary open-angle glaucoma (POAG), 21 with primary congenital glaucoma (PCG), 18 with juvenile-onset open-angle glaucoma (JOAG), five with Axenfeld-Rieger syndrome (ARS), and 67 with other types of glaucoma. One hundred two of the families (including all those in whom a MYOC mutation was detected) were also screened for CYP1B1 mutations: 45 POAG, 25 PCG, 21 JOAG, four ARS, and seven others. Results We examined 292 individuals (patients and relatives) with a positive family history of glaucoma or OHT. We identified two novel MYOC variants, p.Lys39Arg and p.Glu218Lys, in two families with POAG, and six previously reported MYOC mutations in seven families with POAG (four), JOAG (one), PCG (one), and normotensive glaucoma (one). CYP1B1 mutations were found in 16 index patients with PCG (nine), POAG (three), JOAG (two), and ARS (two). Conclusions The high percentage (9/25=36%) of mutations in CYP1B1 found in non-consanguineous patients with congenital glaucoma mandates genetic testing. However, the percentage of mutations (9/207=4.4%) in MYOC associated with glaucoma is relatively low in our population. The variable phenotype expression of glaucoma, even in families, cannot be explained with a digenic mechanism between MYOC and CYP1B1. PMID:23922489

  17. Organizing DNA Origami Tiles Into Larger Structures Using Pre-formed Scaffold Frames

    Science.gov (United States)

    Zhao, Zhao; Liu, Yan; Yan, Hao

    2012-01-01

    Structural DNA nanotechnology utilizes DNA molecules as programmable information-coding polymers to create higher order structures at the nanometer scale. An important milestone in structural DNA nanotechnology was the development of scaffolded DNA origami in which a long single-stranded viral genome (scaffold strand) is folded into arbitrary shapes by hundreds of short synthetic oligonucleotides (staple strands). The achievable dimensions of the DNA origami tiles units are currently limited by the length of the scaffold strand. Here we demonstrate a strategy referred to as ‘super-origami’ or ‘origami of origami’ to scale up DNA origami technology. First, this method uses a collection of bridge strands to pre-fold a single stranded DNA scaffold into a loose framework. Subsequently, pre-formed individual DNA origami tiles are directed onto the loose framework so that each origami tile serves as a large staple. Using this strategy, we demonstrate the ability to organize DNA origami nanostructures into larger spatially addressable architectures. PMID:21682348

  18. Multimers formed by the rotavirus nonstructural protein NSP2 bind to RNA and have nucleoside triphosphatase activity.

    Science.gov (United States)

    Taraporewala, Z; Chen, D; Patton, J T

    1999-12-01

    The nonstructural protein NSP2 is a component of rotavirus replication intermediates and accumulates in cytoplasmic inclusions (viroplasms), sites of genome RNA replication and the assembly of subviral particles. To better understand the structure and function of the protein, C-terminally His-tagged NSP2 was expressed in bacteria and purified to homogeneity. In its purified form, the protein did not exist as a monomer but rather was present as an 8S-10S homomultimer consisting of 6 +/- 2 subunits of recombinant NSP2 (rNSP2). As shown by gel mobility shift assays, the rNSP2 multimers bound to RNA in discrete cooperative steps to form higher-order RNA-protein complexes. The RNA-binding activity of the rNSP2 multimers was determined to be nonspecific and to have a strong preference for single-stranded RNA over double-stranded RNA, for which it displayed little affinity. Enzymatic analysis revealed that rNSP2 possessed an associated nucleoside triphosphatase (NTPase) activity in vitro, which in the presence of Mg(2+) catalyzed the hydrolysis of each of the four NTPs to NDPs with equal efficiency. Evidence indicating that the hydrolysis of NTP resulted in the covalent linkage of the gamma-phosphate to rNSP2 was obtained. Additional experiments showed that NSP2 expressed transiently in MA014 cells is phosphorylated. We propose that NSP2 functions as a molecular motor, catalyzing the packaging of viral mRNA into core-like replication intermediates through the energy derived from its NTPase activity.

  19. Show-Bix &

    DEFF Research Database (Denmark)

    2014-01-01

    The anti-reenactment 'Show-Bix &' consists of 5 dias projectors, a dial phone, quintophonic sound, and interactive elements. A responsive interface will enable the Dias projectors to show copies of original dias slides from the Show-Bix piece ”March på Stedet”, 265 images in total. The copies are...

  20. Talk Show Science.

    Science.gov (United States)

    Moore, Mitzi Ruth

    1992-01-01

    Proposes having students perform skits in which they play the roles of the science concepts they are trying to understand. Provides the dialog for a skit in which hot and cold gas molecules are interviewed on a talk show to study how these properties affect wind, rain, and other weather phenomena. (MDH)

  1. Physics Reality Show

    Science.gov (United States)

    Erukhimova, Tatiana

    The attention span of K-12 students is very short; they are used to digesting information in short snippets through social media and TV. To get the students interested in physics, we created the Physics Reality Show: a series of staged short videos with duration no longer than a few minutes. Each video explains and illustrates one physics concept or law through a fast-paced sequence of physics demonstrations and experiments. The cast consists entirely of physics undergraduate students with artistic abilities and substantial experience in showing physics demonstrations at current outreach events run by the department: Physics Shows and Physics & Engineering Festival. Undergraduate students are of almost the same age as their high-school audience. They are in the best position to connect with kids and convey their fascination with physics. The PI and other faculty members who are involved in the outreach advise and coach the cast. They help students in staging the episodes and choosing the most exciting and relevant demonstrations. Supported by the APS mini-outreach Grant.

  2. Not a "reality" show.

    Science.gov (United States)

    Wrong, Terence; Baumgart, Erica

    2013-01-01

    The authors of the preceding articles raise legitimate questions about patient and staff rights and the unintended consequences of allowing ABC News to film inside teaching hospitals. We explain why we regard their fears as baseless and not supported by what we heard from individuals portrayed in the filming, our decade-long experience making medical documentaries, and the full un-aired context of the scenes shown in the broadcast. The authors don't and can't know what conversations we had, what documents we reviewed, and what protections we put in place in each televised scene. Finally, we hope to correct several misleading examples cited by the authors as well as their offhand mischaracterization of our program as a "reality" show.

  3. Chemically Modified Oligonucleotides Modulate an Epigenetically Varied and Transient Form of Transcription Silencing of HIV-1 in Human Cells

    Directory of Open Access Journals (Sweden)

    Stuart Knowling

    2012-01-01

    Full Text Available Small noncoding RNAs (ncRNAs have been shown to guide epigenetic silencing complexes to target loci in human cells. When targeted to gene promoters, these small RNAs can lead to long-term stable epigenetic silencing of gene transcription. To date, small RNAs have been shown to modulate transcriptional gene silencing (TGS of human immunodeficiency virus type 1 (HIV-1 as well as several other disease-related genes, but it has remained unknown as to what extent particular chemistries can be used to generate single-stranded backbone-modified oligonucleotides that are amenable to this form of gene targeting and regulation. Here, we present data indicating that specific combinations of backbone modifications can be used to generate single-stranded antisense oligonucleotides that can functionally direct TGS of HIV-1 in a manner that is however, independent of epigenetic changes at the target loci. Furthermore, this functionality appears contingent on the absence of a 5′ phosphate in the oligonucleotide. These data suggest that chemically modified oligonucleotide based approaches could be implemented as a means to regulate gene transcription in an epigenetically independent manner.

  4. Showing Value (Editorial

    Directory of Open Access Journals (Sweden)

    Denise Koufogiannakis

    2009-06-01

    Full Text Available When Su Cleyle and I first decided to start Evidence Based Library and Information Practice, one of the things we agreed upon immediately was that the journal be open access. We knew that a major obstacle to librarians using the research literature was that they did not have access to the research literature. Although Su and I are both academic librarians who can access a wide variety of library and information literature from our institutions, we belong to a profession where not everyone has equal access to the research in our field. Without such access to our own body of literature, how can we ever hope for practitioners to use research evidence in their decision making? It would have been contradictory to the principles of evidence based library and information practice to do otherwise.One of the specific groups we thought could use such an open access venue for discovering research literature was school librarians. School librarians are often isolated and lacking access to the research literature that may help them prove to stakeholders the importance of their libraries and their role within schools. Certainly, school libraries have been in decline and the use of evidence to show value is needed. As Ken Haycock noted in his 2003 report, The Crisis in Canada’s School Libraries: The Case for Reform and Reinvestment, “Across the country, teacher-librarians are losing their jobs or being reassigned. Collections are becoming depleted owing to budget cuts. Some principals believe that in the age of the Internet and the classroom workstation, the school library is an artifact” (9. Within this context, school librarians are looking to our research literature for evidence of the impact that school library programs have on learning outcomes and student success. They are integrating that evidence into their practice, and reflecting upon what can be improved locally. They are focusing on students and showing the impact of school libraries and

  5. γ Sulphate PNA (PNA S: highly selective DNA binding molecule showing promising antigene activity.

    Directory of Open Access Journals (Sweden)

    Concetta Avitabile

    Full Text Available Peptide Nucleic Acids (PNAs, nucleic acid analogues showing high stability to enzyme degradation and strong affinity and specificity of binding toward DNA and RNA are widely investigated as tools to interfere in gene expression. Several studies have been focused on PNA analogues with modifications on the backbone and bases in the attempt to overcome solubility, uptake and aggregation issues. γ PNAs, PNA derivatives having a substituent in the γ position of the backbone show interesting properties in terms of secondary structure and affinity of binding toward complementary nucleic acids. In this paper we illustrate our results obtained on new analogues, bearing a sulphate in the γ position of the backbone, developed to be more DNA-like in terms of polarity and charge. The synthesis of monomers and oligomers is described. NMR studies on the conformational properties of monomers and studies on the secondary structure of single strands and triplexes are reported. Furthermore the hybrid stability and the effect of mismatches on the stability have also been investigated. Finally, the ability of the new analogue to work as antigene, interfering with the transcription of the ErbB2 gene on a human cell line overexpressing ErbB2 (SKBR3, assessed by FACS and qPCR, is described.

  6. Genetic transformation of Neisseria gonorrhoeae shows a strand preference

    OpenAIRE

    Duffin, Paul M.; Seifert, H. Steven

    2012-01-01

    Natural transformation is the main means of horizontal genetic exchange in the obligate human pathogen Neisseria gonorrhoeae. Neisseria spp. have been shown to preferentially take up and transform their own DNA by recognizing a non-palindromic 10 or 12 nucleotide DNA uptake sequence (DUS10 or DUS12). We investigated the ability of the DUS12 to enhance single-stranded DNA (ssDNA) transformation. Given the non-palindromic nature of the DUS12, we tested whether both strands of the DUS equally en...

  7. Modular forms

    NARCIS (Netherlands)

    Edixhoven, B.; van der Geer, G.; Moonen, B.; Edixhoven, B.; van der Geer, G.; Moonen, B.

    2008-01-01

    Modular forms are functions with an enormous amount of symmetry that play a central role in number theory, connecting it with analysis and geometry. They have played a prominent role in mathematics since the 19th century and their study continues to flourish today. Modular forms formed the

  8. Precise control of quantum dot location within the P3HT-b-P2VP/QD nanowires formed by crystallization-driven 1D growth of hybrid dimeric seeds.

    Science.gov (United States)

    Kim, Yong-Jae; Cho, Chul-Hee; Paek, Kwanyeol; Jo, Mijung; Park, Mi-kyoung; Lee, Na-Eun; Kim, Youn-joong; Kim, Bumjoon J; Lee, Eunji

    2014-02-19

    Herein, we report a simple fabrication of hybrid nanowires (NWs) composed of a p-type conjugated polymer (CP) and n-type inorganic quantum dots (QDs) by exploiting the crystallization-driven solution assembly of poly(3-hexylthiophene)-b-poly(2-vinylpyridine) (P3HT-b-P2VP) rod-coil amphiphiles. The visualization of the crystallization-driven growth evolution of hybrid NWs through systematic transmission electron microscopy experiments showed that discrete dimeric CdSe QDs bridged by P3HT-b-P2VP polymers were generated during the initial state of crystallization. These, in turn, assemble into elongated fibrils, forming the coaxial P3HT-b-P2VP/QDs hybrid NWs. In particular, the location of the QD arrays within the single strand of P3HT-b-P2VP can be controlled precisely by manipulating the regioregularity (RR) values of P3HT block and the relative lengths of P2VP block. The degree of coaxiality of the QD arrays was shown to depend on the coplanarity of the thiophene rings of P3HT block, which can be controlled by the RR value of P3HT block. In addition, the location of QDs could be regulated at the specific-local site of P3HT-b-P2VP NW according to the surface characteristics of QDs. As an example, the comparison of two different QDs coated with hydrophobic alkyl-terminated and hydroxyl-terminated molecules, respectively, is used to elucidate the effect of the surface properties of QDs on their nanolocation in the NW.

  9. Structure of the replicative form of bacteriophage φX174 : VI. Studies on alkali-denatured double-stranded φX DNA

    NARCIS (Netherlands)

    Pouwels, P.H.; Knijnenburg, C.M.; Rotterdam, J. van; Cohen, J.A.; Jansz, H.S.

    1968-01-01

    Double-stranded φX DNA which accumulates after infection with bacteriophage φX174 in the presence of chloramphenicol consists mainly of twisted circular double-stranded DNA with no single-strand breaks (component I) and of circular double-stranded DNA, in which single-strand breaks are present

  10. Late-night talk show v USA

    OpenAIRE

    Halamásek, Šimon

    2013-01-01

    This thesis focuses on the history of talk show in USA with emphasis on its specific form, which is late-night talk show. The first chapter focuses on the creation of new television networks and the overall state of american broadcasting during the first era of the television talk show format. The thesis briefly describes radio broadcasting which served not only as an important source of inspiration for television but also as a starting platform for most talk show hosts. Next chapter theoreti...

  11. Risk Aversion in Game Shows

    DEFF Research Database (Denmark)

    Andersen, Steffen; Harrison, Glenn W.; Lau, Morten I.

    2008-01-01

    We review the use of behavior from television game shows to infer risk attitudes. These shows provide evidence when contestants are making decisions over very large stakes, and in a replicated, structured way. Inferences are generally confounded by the subjective assessment of skill in some games...

  12. Measuring performance at trade shows

    DEFF Research Database (Denmark)

    Hansen, Kåre

    2004-01-01

    Trade shows is an increasingly important marketing activity to many companies, but current measures of trade show performance do not adequately capture dimensions important to exhibitors. Based on the marketing literature's outcome and behavior-based control system taxonomy, a model is built...... that captures a outcome-based sales dimension and four behavior-based dimensions (i.e. information-gathering, relationship building, image building, and motivation activities). A 16-item instrument is developed for assessing exhibitors perceptions of their trade show performance. The paper presents evidence...... of the scale's reliability, factor structure, and validity on the basis of analyzing data from independent samples of exhibitors at the international trade shows SIAL (Paris) and ANUGA (Cologne); and it concludes with a discussion of potential managerial applications and implications for future research. New...

  13. Tokyo Motor Show 2003; Tokyo Motor Show 2003

    Energy Technology Data Exchange (ETDEWEB)

    Joly, E.

    2004-01-01

    The text which follows present the different techniques exposed during the 37. Tokyo Motor Show. The report points out the great tendencies of developments of the Japanese automobile industry. The hybrid electric-powered vehicles or those equipped with fuel cells have been highlighted by the Japanese manufacturers which allow considerable budgets in the research of less polluting vehicles. The exposed models, although being all different according to the manufacturer, use always a hybrid system: fuel cell/battery. The manufacturers have stressed too on the intelligent systems for navigation and safety as well as on the design and comfort. (O.M.)

  14. Gravitation and quadratic forms

    Science.gov (United States)

    Ananth, Sudarshan; Brink, Lars; Majumdar, Sucheta; Mali, Mahendra; Shah, Nabha

    2017-03-01

    The light-cone Hamiltonians describing both pure ( N = 0) Yang-Mills and N = 4 super Yang-Mills may be expressed as quadratic forms. Here, we show that this feature extends to theories of gravity. We demonstrate how the Hamiltonians of both pure gravity and N = 8 supergravity, in four dimensions, may be written as quadratic forms. We examine the effect of residual reparametrizations on the Hamiltonian and the resulting quadratic form.

  15. Gravitation and quadratic forms

    Energy Technology Data Exchange (ETDEWEB)

    Ananth, Sudarshan [Indian Institute of Science Education and Research,Pune 411008 (India); Brink, Lars [Department of Physics, Chalmers University of Technology,S-41296 Göteborg (Sweden); Institute of Advanced Studies and Department of Physics & Applied Physics,Nanyang Technological University,Singapore 637371 (Singapore); Majumdar, Sucheta [Indian Institute of Science Education and Research,Pune 411008 (India); Mali, Mahendra [School of Physics, Indian Institute of Science Education and Research,Thiruvananthapuram, Trivandrum 695016 (India); Shah, Nabha [Indian Institute of Science Education and Research,Pune 411008 (India)

    2017-03-31

    The light-cone Hamiltonians describing both pure (N=0) Yang-Mills and N=4 super Yang-Mills may be expressed as quadratic forms. Here, we show that this feature extends to theories of gravity. We demonstrate how the Hamiltonians of both pure gravity and N=8 supergravity, in four dimensions, may be written as quadratic forms. We examine the effect of residual reparametrizations on the Hamiltonian and the resulting quadratic form.

  16. Create a Polarized Light Show.

    Science.gov (United States)

    Conrad, William H.

    1992-01-01

    Presents a lesson that introduces students to polarized light using a problem-solving approach. After illustrating the concept using a slinky and poster board with a vertical slot, students solve the problem of creating a polarized light show using Polya's problem-solving methods. (MDH)

  17. Producing Talent and Variety Shows.

    Science.gov (United States)

    Szabo, Chuck

    1995-01-01

    Identifies key aspects of producing talent shows and outlines helpful hints for avoiding pitfalls and ensuring a smooth production. Presents suggestions concerning publicity, scheduling, and support personnel. Describes types of acts along with special needs and problems specific to each act. Includes a list of resources. (MJP)

  18. Mastering HTML5 forms

    CERN Document Server

    Gupta, Gaurav

    2013-01-01

    This tutorial will show you how to create stylish forms, not only visually appealing, but interactive and customized, in order to gather valuable user inputs and information.Enhance your skills in building responsive and dynamic web forms using HTML5, CSS3, and related technologies. All you need is a basic understanding of HTML and PHP.

  19. Bacterial transformation: ComFA is a DNA-dependent ATPase that forms complexes with ComFC and DprA.

    Science.gov (United States)

    Diallo, Amy; Foster, Hannah R; Gromek, Katarzyna A; Perry, Thomas N; Dujeancourt, Annick; Krasteva, Petya V; Gubellini, Francesca; Falbel, Tanya G; Burton, Briana M; Fronzes, Rémi

    2017-09-01

    Pneumococcal natural transformation contributes to genomic plasticity, antibiotic resistance development and vaccine escape. Streptococcus pneumoniae, like many other naturally transformable species, has evolved sophisticated protein machinery for the binding and uptake of DNA. Two proteins encoded by the comF operon, ComFA and ComFC, are involved in transformation but their exact molecular roles remain unknown. In this study, we provide experimental evidence that ComFA binds to single stranded DNA (ssDNA) and has ssDNA-dependent ATPase activity. We show that both ComFA and ComFC are essential for the transformation process in pneumococci. Moreover, we show that these proteins interact with each other and with other proteins involved in homologous recombination, such as DprA, thus placing the ComFA-ComFC duo at the interface between DNA uptake and DNA recombination during transformation. © 2017 John Wiley & Sons Ltd.

  20. "Medicine show." Alice in Doctorland.

    Science.gov (United States)

    1987-01-01

    This is an excerpt from the script of a 1939 play provided to the Institute of Social Medicine and Community Health by the Library of Congress Federal Theater Project Collection at George Mason University Library, Fairfax, Virginia, pages 2-1-8 thru 2-1-14. The Federal Theatre Project (FTP) was part of the New Deal program for the arts 1935-1939. Funded by the Works Progress Administration (WPA) its goal was to employ theater professionals from the relief rolls. A number of FTP plays deal with aspects of medicine and public health. Pageants, puppet shows and documentary plays celebrated progress in medical science while examining social controversies in medical services and the public health movement. "Medicine Show" sharply contrasts technological wonders with social backwardness. The play was rehearsed by the FTP but never opened because funding ended. A revised version ran on Broadway in 1940. The preceding comments are adapted from an excellent, well-illustrated review of five of these plays by Barabara Melosh: "The New Deal's Federal Theatre Project," Medical Heritage, Vol. 2, No. 1 (Jan/Feb 1986), pp. 36-47.

  1. Automorphic Forms

    DEFF Research Database (Denmark)

    von Essen, Flemming Brændgaard

    The Taylor coefficients of weight k Eisenstein series wrt. SL2(Z) are related to values of L-functions for Hecke characters in the point k. We show some congruences for Taylor coefficients of Eisenstein series of weight 4 and 6 and use them to establish congruences for values of L...

  2. Metallization of Single-Stranded Polyl by Zn2+ Ions in Neutral Solutions

    Czech Academy of Sciences Publication Activity Database

    Sorokin, V. A.; Valeev, V. A.; Usenko, E. L.; Andrushchenko, Valery

    2014-01-01

    Roč. 118, č. 43 (2014), s. 12360-12365 ISSN 1520-6106 Institutional support: RVO:61388963 Keywords : nucleic acid metallization * zinc ion * differential UV spectroscopy Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.302, year: 2014

  3. Oligo(dT) is not a correct native PAGE marker for single-stranded DNA

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Kypr, Jaroslav; Vorlíčková, Michaela

    2007-01-01

    Roč. 353, č. 3 (2007), s. 776-779 ISSN 0006-291X R&D Projects: GA AV ČR(CZ) IAA4004201; GA AV ČR(CZ) IAA1004201 Institutional research plan: CEZ:AV0Z50040702 Keywords : polyacrylamide gel electrophoresis * DNA length markers * oligo(dT) Subject RIV: BO - Biophysics Impact factor: 2.749, year: 2007

  4. Determination of nanogram quantities of osmium-labeled single stranded DNA by differential pulse stripping voltammetry

    Czech Academy of Sciences Publication Activity Database

    Kizek, René; Havran, Luděk; Fojta, Miroslav; Paleček, Emil

    2002-01-01

    Roč. 55, 1/2 (2002), s. 199-121 ISSN 1567-5394 R&D Projects: GA ČR GV204/97/K084; GA ČR GA204/00/D049; GA AV ČR IAA4004108 Institutional research plan: CEZ:AV0Z5004920 Keywords : differential pulse stripping voltammetry * microdetermination of DNA * chemical modification of DNA Subject RIV: BO - Biophysics Impact factor: 1.463, year: 2002

  5. Single stranded loops of quadruplex DNA as key benchmark for testing nucleic acids force fields

    Czech Academy of Sciences Publication Activity Database

    Fadrná, E.; Špačková, Naďa; Sarzynska, J.; Koča, J.; Orozco, M.; Cheatham III, T.E.; Kulinski, T.; Šponer, Jiří

    2009-01-01

    Roč. 5, č. 9 (2009), s. 2514-2530 ISSN 1549-9618 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802 Grant - others:GA ČR(CZ) GA203/09/1476 Program:GA Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA quadruplex * MD simulation * force fields Subject RIV: BO - Biophysics Impact factor: 4.804, year: 2009

  6. Absorption by DNA single strands of adenine isolated in vacuo: The role of multiple chromophores

    DEFF Research Database (Denmark)

    Nielsen, L.M.; Pedersen, S.O.; Kirketerp, M.-B.S.

    2012-01-01

    to that for the adenine molecule and the dAMP mononucleotide. Desolvation has little effect on the bandwidth, which implies that inhomogenous broadening of the absorption bands in aqueous solution is of minor importance compared to, e.g., conformational disorder. Finally, at high photon energies, internal conversion...

  7. RADX interacts with single-stranded DNA to promote replication fork stability

    DEFF Research Database (Denmark)

    Schubert, Lisa; Ho, Teresa; Hoffmann, Saskia

    2017-01-01

    has an essential genome maintenance role, protecting ssDNA regions from nucleolytic degradation and providing a recruitment platform for proteins involved in responses to replication stress and DNA damage. Here, we identify the uncharacterized protein RADX (CXorf57) as an ssDNA-binding factor in human...... cells. RADX binds ssDNA via an N-terminal OB fold cluster, which mediates its recruitment to sites of replication stress. Deregulation of RADX expression and ssDNA binding leads to enhanced replication fork stalling and degradation, and we provide evidence that a balanced interplay between RADX and RPA...

  8. Role of Electrostatics in the assembly pathway of a single-stranded RNA virus

    NARCIS (Netherlands)

    Garmann, R.F.; Comas-Garcia, M.; Koay, M.S.T.; Cornelissen, Jeroen Johannes Lambertus Maria; Knobler, C.M.; Gelbart, W.M.

    2014-01-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318–3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of

  9. Comment on "Monomer Dynamics in Double- and Single-Stranded DNA Polymers"

    OpenAIRE

    Tothova, J.; Brutovsky, B.; Lisy, V.

    2005-01-01

    It is discussed that the kinetics observed by Shusterman et al. [Phys. Rev. Lett. 92, 048303] for long dsDNA is not the Rouse one and, in fact, the macromolecule behaves (approximately) as the Zimm polymer.

  10. Toxin MqsR Cleaves Single-Stranded mRNA with Various 5 Ends

    Science.gov (United States)

    2016-08-24

    decreases persisence about 2400- fold (Harrison et al. 2009). Another type II TA toxin, MazF, induces growth arrest that results in up to a 700- fold...Life Technologies, Waltham, MA). In brief, 25 pmol of RNA was first treated with 0.1 U of calf intestine alkaline phosphatase (CIP, 0.1 U/μL) for 1...MqsR/MqsA regulate toxin CspD. Environ. Microbiol. 12:1105–1121. Kwan, B. W., J. A. Valenta, M. J. Benedik, and T. K. Wood. 2013. Arrested protein

  11. Detection of short single-strand DNA homopolymers with ultrathin Si3N4 nanopores.

    Science.gov (United States)

    Ma, Jian; Qiu, Yinghua; Yuan, Zhishan; Zhang, Yin; Sha, Jingjie; Liu, Lei; Sun, Litao; Ni, Zhonghua; Yi, Hong; Li, Deyu; Chen, Yunfei

    2015-08-01

    A series of nanopores with diameters ranging from 2.5 to 63 nm are fabricated on a reduced Si3N4 membrane by focused ion beam and high energy electron beam. Through measuring the blocked ionic currents for DNA strands threading linearly through those solid-state nanopores, it is found that the blockade ionic current is proportional to the square of the hydrodynamic diameter of the DNA strand. With the nanopore diameter reduced to be comparable with that of DNA strands, the hydrodynamic diameter of the DNA becomes smaller, which is attributed to the size confinement effects. The duration time for the linear DNA translocation events increases monotonically with the nanopore length. By comparing the spatial configurations of DNA strands through nanopores with different diameters, it is found that the nanopore with large diameter has enough space to allow the DNA strand to translocate through with complex conformation. With the decrease of the nanopore diameter, the folded part of the DNA is prone to be straightened by the nanopore, which leads to the increase in the occurrence frequency of the linear DNA translocation events. Reducing the diameter of the nanopore to 2.5 nm allows the detection and discrimination of three nucleotide "G" and three nucleotide "T" homopolymer DNA strands based on differences in their physical dimensions.

  12. Source-based nomenclature for single-strand homopolymers and copolymers (IUPAC Recommendations 2016)

    Czech Academy of Sciences Publication Activity Database

    Jones, R. G.; Kitayama, T.; Hellwich, K. H.; Hess, M.; Jenkins, A. D.; Kahovec, Jaroslav; Kratochvíl, Pavel; Mita, I.; Mormann, W.; Ober, C. K.; Penczek, S.; Stepto, R. F. T.; Thurlow, K.; Vohlídal, J.; Wilks, E. S.

    2016-01-01

    Roč. 88, 10-11 (2016), s. 1073-1100 ISSN 0033-4545 Institutional support: RVO:61389013 Keywords : apparent monomer * copolymer * end-groups Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.626, year: 2016

  13. Theoretical Study of the Transpore Velocity Control of Single-Stranded DNA

    Directory of Open Access Journals (Sweden)

    Weixin Qian

    2014-08-01

    Full Text Available The electrokinetic transport dynamics of deoxyribonucleic acid (DNA molecules have recently attracted significant attention in various fields of research. Our group is interested in the detailed examination of the behavior of DNA when confined in micro/nanofluidic channels. In the present study, the translocation mechanism of a DNA-like polymer chain in a nanofluidic channel was investigated using Langevin dynamics simulations. A coarse-grained bead-spring model was developed to simulate the dynamics of a long polymer chain passing through a rectangular cross-section nanopore embedded in a nanochannel, under the influence of a nonuniform electric field. Varying the cross-sectional area of the nanopore was found to allow optimization of the translocation process through modification of the electric field in the flow channel, since a drastic drop in the electric potential at the nanopore was induced by changing the cross-section. Furthermore, the configuration of the polymer chain in the nanopore was observed to determine its translocation velocity. The competition between the strength of the electric field and confinement in the small pore produces various transport mechanisms and the results of this study thus represent a means of optimizing the design of nanofluidic devices for single molecule detection.

  14. Electric light scattering from single-stranded DNA in linear polyacrylamide solutions.

    Science.gov (United States)

    Todorov, R; Starchev, K; Stoylov, S P

    2001-01-01

    The electric light scattering (ELS) of ssDNA (calf thymus, 10 kbp, 55 micrograms/mL) in denaturing polyacrylamide (PAA) solutions was studied as a function of applied sinusoidal electric field and polymer concentration. Electric fields of strengths up to 300 V/cm and of frequencies between 100 and 5000 Hz were applied. It was found that the ELS effect increases with the field strength and decreases at high frequencies. The dependence of the ELS effect of ssDNA on polymer concentration passes through a maximum at 1% PAA. The relaxation times of decay of the ELS effect increase with increasing polymer concentrations. It was demonstrated that ELS is a useful method for investigation of ssDNA behavior in the course of pulse-field electrophoresis in polymer solutions.

  15. Expansion during PCR of short single-stranded DNA fragments carrying nonselfcomplementary dinucleotide or trinucleotide repeats

    Czech Academy of Sciences Publication Activity Database

    Reichová, Naďa; Kypr, Jaroslav

    2003-01-01

    Roč. 30, č. 3 (2003), s. 155-163 ISSN 0301-4851 R&D Projects: GA ČR GA301/01/0590 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA * PCR * expansion Subject RIV: BO - Biophysics Impact factor: 0.565, year: 2003

  16. Genomic analysis of Pseudomonas putida phage tf with localized single-strand DNA interruptions.

    Directory of Open Access Journals (Sweden)

    Anatoly S Glukhov

    Full Text Available The complete sequence of the 46,267 bp genome of the lytic bacteriophage tf specific to Pseudomonas putida PpG1 has been determined. The phage genome has two sets of convergently transcribed genes and 186 bp long direct terminal repeats. The overall genomic architecture of the tf phage is similar to that of the previously described Pseudomonas aeruginosa phages PaP3, LUZ24 and phiMR299-2, and 39 out of the 72 products of predicted tf open reading frames have orthologs in these phages. Accordingly, tf was classified as belonging to the LUZ24-like bacteriophage group. However, taking into account very low homology levels between tf DNA and that of the other phages, tf should be considered as an evolutionary divergent member of the group. Two distinguishing features not reported for other members of the group were found in the tf genome. Firstly, a unique end structure--a blunt right end and a 4-nucleotide 3'-protruding left end--was observed. Secondly, 14 single-chain interruptions (nicks were found in the top strand of the tf DNA. All nicks were mapped within a consensus sequence 5'-TACT/RTGMC-3'. Two nicks were analyzed in detail and were shown to be present in more than 90% of the phage population. Although localized nicks were previously found only in the DNA of T5-like and phiKMV-like phages, it seems increasingly likely that this enigmatic structural feature is common to various other bacteriophages.

  17. A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B.

    Directory of Open Access Journals (Sweden)

    Jeffrey A DeGrasse

    Full Text Available The bacterium Staphylococcus aureus is a common foodborne pathogen capable of secreting a cocktail of small, stable, and strain-specific, staphylococcal enterotoxins (SEs. Staphylococcal food poisoning (SFP results when improperly handled food contaminated with SEs is consumed. Gastrointestinal symptoms of SFP include emesis, diarrhea and severe abdominal pain, which manifest within hours of ingesting contaminated food. Immuno-affinity based methods directly detect, identify, and quantify several SEs within a food or clinical sample. However, the success of these assays depends upon the availability of a monoclonal antibody, the development of which is non-trivial and costly. The current scope of the available immuno-affinity based methods is limited to the classical SEs and does not encompass all of the known or emergent SEs. In contrast to antibodies, aptamers are short nucleic acids that exhibit high affinity and specificity for their targets without the high-costs and ethical concerns of animal husbandry. Further, researchers may choose to freely distribute aptamers and develop assays without the proprietary issues that increase the per-sample cost of immuno-affinity assays. This study describes a novel aptamer, selected in vitro, with affinity to staphylococcal enterotoxin B (SEB that may be used in lieu of antibodies in SE detection assays. The aptamer, designated APT(SEB1, successfully isolates SEB from a complex mixture of SEs with extremely high discrimination. This work sets the foundation for future aptamer and assay development towards the entire family of SEs. The rapid, robust, and low-cost identification and quantification of all of the SEs in S. aureus contaminated food is essential for food safety and epidemiological efforts. An in vitro generated library of SE aptamers could potentially allow for the comprehensive and cost-effective analysis of food samples that immuno-affinity assays currently cannot provide.

  18. Comparative Error-Free and Error-Prone Translesion Synthesis of N(2)-2'-Deoxyguanosine Adducts Formed by Mitomycin C and Its Metabolite, 2,7-Diaminomitosene, in Human Cells.

    Science.gov (United States)

    Bose, Arindam; Surugihalli, Chaitra; Pande, Paritosh; Champeil, Elise; Basu, Ashis K

    2016-05-16

    Mitomycin C (MC) is a cytotoxic and mutagenic antitumor agent that alkylates DNA upon reductive activation. 2,7-Diaminomitosene (2,7-DAM) is a major metabolite of MC in tumor cells, which also alkylates DNA. MC forms seven DNA adducts, including monoadducts and inter- and intrastrand cross-links, whereas 2,7-DAM forms two monoadducts. Herein, the biological effects of the dG-N(2) adducts formed by MC and 2,7-DAM have been compared by constructing single-stranded plasmids containing these adducts and replicating them in human embryonic kidney 293T cells. Translesion synthesis (TLS) efficiencies of dG-N(2)-MC and dG-N(2)-2,7-DAM were 38 ± 3 and 27 ± 3%, respectively, compared to that of a control plasmid. This indicates that both adducts block DNA synthesis and that dG-N(2)-2,7-DAM is a stronger replication block than dG-N(2)-MC. TLS of each adducted construct was reduced upon siRNA knockdown of pol η, pol κ, or pol ζ. For both adducts, the most significant reduction occurred with knockdown of pol κ, which suggests that pol κ plays a major role in TLS of these dG-N(2) adducts. Analysis of the progeny showed that both adducts were mutagenic, and the mutation frequencies (MF) of dG-N(2)-MC and dG-N(2)-2,7-DAM were 18 ± 3 and 10 ± 1%, respectively. For both adducts, the major type of mutation was G → T transversions. Knockdown of pol η and pol ζ reduced the MF of dG-N(2)-MC and dG-N(2)-2,7-DAM, whereas knockdown of pol κ increased the MF of these adducts. This suggests that pol κ predominantly carries out error-free TLS, whereas pol η and pol ζ are involved in error-prone TLS. The largest reduction in MF by 78 and 80%, respectively, for dG-N(2)-MC and dG-N(2)-2,7-DAM constructs occurred when pol η, pol ζ, and Rev1 were simultaneously knocked down. This result strongly suggests that, unlike pol κ, these three TLS polymerases cooperatively perform the error-prone TLS of these adducts.

  19. Contributors Form

    Directory of Open Access Journals (Sweden)

    Chief Editor

    2016-06-01

    to produce preprints or reprints and translate into languages other than English for sale or free distribution; and 4 the right to republish the work in a collection of articles in any other mechanical or electronic format. We give the rights to the corresponding author to make necessary changes as per the request of the journal, do the rest of the correspondence on our behalf and he/she will act as the guarantor for the manuscript on our behalf. All persons who have made substantial contributions to the work reported in the manuscript, but who are not contributors, are named in the Acknowledgment and have given me/us their written permission to be named. If I/we do not include an Acknowledgment that means I/we have not received substantial contributions from non-contributors and no contributor has been omitted.S NoAuthors' NamesContribution (IJCME Guidelines{1 substantial contributions to conception and design, acquisition of data, or analysis and interpretation of data; 2 drafting the article or revising it critically for important intellectual content; and 3 final approval of the version to be published. Authors should meet conditions 1, 2, and 3}.SignatureDate                              Note: All the authors are required to sign independently in this form in the sequence given above. In case an author has left the institution/country and whose whereabouts are not known, the senior author may sign on his/her behalf taking the responsibility.No addition/deletion/ or any change in the sequence of the authorship will be permissible at a later stage, without valid reasons and permission of the Editor.If the authorship is contested at any stage, the article will be either returned or will not be processed for publication till the issue is solved.Maximum up to 4 authors for short communication and up to 6 authors for original article.

  20. Structure of a hexameric form of RadA recombinase from Methanococcus voltae.

    Science.gov (United States)

    Du, Liqin; Luo, Yu

    2012-05-01

    Archaeal RadA proteins are close homologues of eukaryal Rad51 and DMC1 proteins and are remote homologues of bacterial RecA proteins. For the repair of double-stranded breaks in DNA, these recombinases promote a pivotal strand-exchange reaction between homologous single-stranded and double-stranded DNA substrates. This DNA-repair function also plays a key role in the resistance of cancer cells to chemotherapy and radiotherapy and in the resistance of bacterial cells to antibiotics. A hexameric form of a truncated Methanococcus voltae RadA protein devoid of its small N-terminal domain has been crystallized. The RadA hexamers further assemble into two-ringed assemblies. Similar assemblies can be observed in the crystals of Pyrococcus furiosus RadA and Homo sapiens DMC1. In all of these two-ringed assemblies the DNA-interacting L1 region of each protomer points inward towards the centre, creating a highly positively charged locus. The electrostatic characteristics of the central channels can be utilized in the design of novel recombinase inhibitors.

  1. Polyphony and verb forms

    Directory of Open Access Journals (Sweden)

    Jelena Rajić

    2012-12-01

    Full Text Available This paper examines some special uses of indicative and subjunctive verb forms in Spanish, which contemporary linguistics explains using the notions of polyphony, evidentials, echoic representation, quotatives, etc. These terms, even though they refer to different characteristics and belong to different theoretical frameworks, share one common feature: they all refer to diverse linguistic forms (discourse markers, linguistic negation, quotatives, echoic utterances, etc. characterized by the presence and interaction of different voices or points of view in one discourse sequence. In this study we are interested in a description of quotative or polyphonic meanings expressed by specific verb forms and tenses, the imperfect and the conditional, and also by indicative forms in subordinate substantive clauses with a negative main verb and by subjunctive forms in subordinate concessive clauses. Our research focuses on the analysis of the linguistic conditions that make possible the evidential use of the conditional, the imperfect and the echoic (metarepresentative interpretation of indicative and subjunctive forms in the above-mentioned contexts. The examples we discuss show that evidential and echoic interpretations are inferential meanings derived from the extralinguistic situation and the knowledge that speakers have of the world.

  2. Molecular data show that Omphalina foliacea is a lichen-forming basidiomycete

    Czech Academy of Sciences Publication Activity Database

    Palice, Zdeněk; Schmitt, I.; Lumbsch, H. T.

    2005-01-01

    Roč. 109, č. 4 (2005), s. 447-451 ISSN 0953-7562 Institutional research plan: CEZ:AV0Z60050516 Keywords : basidiolichens * molecular phylogeny * LSU DNA Subject RIV: EF - Botanics Impact factor: 1.572, year: 2005

  3. SSCP and segregation analysis of the human type X collagen gene (COL10A1) in heritable forms of chondrodysplasia

    Energy Technology Data Exchange (ETDEWEB)

    Sweetman, W.A.; Rash, B.; Thomas, J.T.; Boot-Handford, R.; Grant, M.E.; Wallis, G.A. (Univ. of Manchester (United Kingdom)); Sykes, B. (Univ. of Oxford (United Kingdom)); Beighton, P. (Univ. of Cape Town (South Africa)); Hecht, J.T. (Univ. of Texas, Houston, TX (United States)); Zabell, B. (Johannes Gutenburg Universitaet, Mainz (Germany))

    1992-10-01

    Type X collagen is a homotrimeric, short chain, nonfibrillar collagen that is expressed exclusively by hypertrophic chondrocytes at the sites of endochondral ossification. The distribution and pattern of expression of the type X collagen gene (COL10A1) suggests that mutations altering the structure and synthesis of the protein may be responsible for causing heritable forms of chondrodysplasia. The authors investigated whether mutations within the human COL10A1 gene were responsible for causing the disorders achondroplasia, hypochondroplasia, pseudoachondroplasia, and thanatophoric dysplasia, by analyzing the coding regions of the gene by using PCR and the single-stranded conformational polymorphism technique. By this approach, seven sequence changes were identified within and flanking the coding regions of the gene of the affected persons. The authors demonstrated that six of these sequence changes were not responsible for causing these forms of chondrodysplasia but were polymorphic in nature. The sequence changes were used to demonstrate discordant segregation between the COL10A1 locus and achondroplasia and pseudoachondroplasia, in nuclear families. This lack of segregation suggests that mutations within or near the COL101A1 locus are not responsible for these disorders. The seventh sequence change resulted in a valine-to-methionine substitution in the carboxyl-terminal domain of the molecule and was identified in only two hypochondroplasic individuals from a single family. Segregation analysis in this family was inconclusive, and the significance of this substitution remains uncertain. 47 refs., 3 figs., 2 tabs.

  4. Geoscience is Important? Show Me Why

    Science.gov (United States)

    Boland, M. A.

    2017-12-01

    "The public" is not homogenous and no single message or form of messaging will connect the entire public with the geosciences. One approach to promoting trust in, and engagement with, the geosciences is to identify specific sectors of the public and then develop interactions and communication products that are immediately relevant to that sector's interests. If the content and delivery are appropriate, this approach empowers people to connect with the geosciences on their own terms and to understand the relevance of the geosciences to their own situation. Federal policy makers are a distinct and influential subgroup of the general public. In preparation for the 2016 presidential election, the American Geosciences Institute (AGI) in collaboration with its 51 member societies prepared Geoscience for America's Critical Needs: Invitation to a National Dialogue, a document that identified major geoscience policy issues that should be addressed in a national policy platform. Following the election, AGI worked with eight other geoscience societies to develop Geoscience Policy Recommendations for the New Administration and the 115th Congress, which outlines specific policy actions to address national issues. State and local decision makers are another important subgroup of the public. AGI has developed online content, factsheets, and case studies with different levels of technical complexity so people can explore societally-relevant geoscience topics at their level of technical proficiency. A related webinar series is attracting a growing worldwide audience from many employment sectors. Partnering with government agencies and other scientific and professional societies has increased the visibility and credibility of these information products with our target audience. Surveys and other feedback show that these products are raising awareness of the geosciences and helping to build reciprocal relationships between geoscientists and decision makers. The core message of all

  5. Harmonic Maass forms and mock modular forms

    CERN Document Server

    Bringmann, Kathrin; Ono, Ken

    2017-01-01

    Modular forms and Jacobi forms play a central role in many areas of mathematics. Over the last 10-15 years, this theory has been extended to certain non-holomorphic functions, the so-called "harmonic Maass forms". The first glimpses of this theory appeared in Ramanujan's enigmatic last letter to G. H. Hardy written from his deathbed. Ramanujan discovered functions he called "mock theta functions" which over eighty years later were recognized as pieces of harmonic Maass forms. This book contains the essential features of the theory of harmonic Maass forms and mock modular forms, together with a wide variety of applications to algebraic number theory, combinatorics, elliptic curves, mathematical physics, quantum modular forms, and representation theory.

  6. Harmonic maass forms and mock modular forms

    CERN Document Server

    Bringmann, Kathrin; Ono, Ken

    2017-01-01

    Modular forms and Jacobi forms play a central role in many areas of mathematics. Over the last 10-15 years, this theory has been extended to certain non-holomorphic functions, the so-called "harmonic Maass forms". The first glimpses of this theory appeared in Ramanujan's enigmatic last letter to G. H. Hardy written from his deathbed. Ramanujan discovered functions he called "mock theta functions" which over eighty years later were recognized as pieces of harmonic Maass forms. This book contains the essential features of the theory of harmonic Maass forms and mock modular forms, together with a wide variety of applications to algebraic number theory, combinatorics, elliptic curves, mathematical physics, quantum modular forms, and representation theory.

  7. On good ETOL forms

    DEFF Research Database (Denmark)

    Skyum, Sven

    1978-01-01

    This paper continues the study of ETOL forms and good EOL forms done by Maurer, Salomaa and Wood. It is proven that binary very complete ETOL forms exist, good synchronized ETOL forms exist and that no propagating or synchronized ETOL form can be very complete.......This paper continues the study of ETOL forms and good EOL forms done by Maurer, Salomaa and Wood. It is proven that binary very complete ETOL forms exist, good synchronized ETOL forms exist and that no propagating or synchronized ETOL form can be very complete....

  8. Modular Forms and Weierstrass Mock Modular Forms

    Directory of Open Access Journals (Sweden)

    Amanda Clemm

    2016-02-01

    Full Text Available Alfes, Griffin, Ono, and Rolen have shown that the harmonic Maass forms arising from Weierstrass ζ-functions associated to modular elliptic curves “encode” the vanishing and nonvanishing for central values and derivatives of twisted Hasse-Weil L-functions for elliptic curves. Previously, Martin and Ono proved that there are exactly five weight 2 newforms with complex multiplication that are eta-quotients. In this paper, we construct a canonical harmonic Maass form for these five curves with complex multiplication. The holomorphic part of this harmonic Maass form arises from the Weierstrass ζ-function and is referred to as the Weierstrass mock modular form. We prove that the Weierstrass mock modular form for these five curves is itself an eta-quotient or a twist of one. Using this construction, we also obtain p-adic formulas for the corresponding weight 2 newform using Atkin’s U-operator.

  9. Showing Area Matters: A Work of Friction

    Science.gov (United States)

    Van Domelen, David

    2010-01-01

    Typically, we teach the simplified friction equation of the form F[subscript s] = [mu][subscript s]N for static friction, where F[subscript s] is the maximum static friction, [mu][subscript s] is the coefficient of static friction, and "N" is the normal force pressing the surfaces together. However, this is a bit too simplified, and…

  10. Manufacturing processes 4 forming

    CERN Document Server

    Klocke, Fritz

    2013-01-01

    This book provides essential information on metal forming, utilizing a practical distinction between bulk and sheet metal forming. In the field of bulk forming, it examines processes of cold, warm and hot bulk forming, as well as rolling and a new addition, the process of thixoforming. As for the field of sheet metal working, on the one hand it deals with sheet metal forming processes (deep drawing, flange forming, stretch drawing, metal spinning and bending). In terms of special processes, the chapters on internal high-pressure forming and high rate forming have been revised and refined. On the other, the book elucidates and presents the state of the art in sheet metal separation processes (shearing and fineblanking). Furthermore, joining by forming has been added to the new edition as a new chapter describing mechanical methods for joining sheet metals. The new chapter “Basic Principles” addresses both sheet metal and bulk forming, in addition to metal physics, plastomechanics and computational basics; ...

  11. INFORMATIONAL EFFECT OF A FORM

    Directory of Open Access Journals (Sweden)

    Kovalenko V.F.

    2016-02-01

    Full Text Available The study was conducted by method of light scattering of laser emission. The influence of the form field, mutual influence of mental informational and form torsional fields as well as the following exposure of water samples in the form field after the cease of informational influence on water structure were examined. Paper forms of a pyramid, a cylinder, and a prism were used. The experimental findings show that mechanism of mutual influence on water structure of the form and informational torsional fields depended on the initial conditions of spin restructuring process – the configuration of a form, the type of the form field (internal and external ones, and the initial water structure. The influence of the form field on informational aftereffect was determined, the character of which was defined by ratio of intensities of torsional form field and an informational soliton. The phenomenon of the abnormally large amplification of the informational aftereffect in the internal field of a pyramid demonstrating the attributes of positive reverse connection between the informational soliton and torsional field of water structure and selection of generated cluster sizes were discovered.

  12. Acculturation, Cultivation, and Daytime TV Talk Shows.

    Science.gov (United States)

    Woo, Hyung-Jin; Dominick, Joseph R.

    2003-01-01

    Explores the cultivation phenomenon among international college students in the United States by examining the connection between levels of acculturation, daytime TV talk show viewing, and beliefs about social reality. Finds that students who scored low on acculturation and watched a great deal of daytime talk shows had a more negative perception…

  13. Effects of Talk Show Viewing on Adolescents.

    Science.gov (United States)

    Davis, Stacy; Mares, Marie-Louise

    1998-01-01

    Investigates the effects of talk-show viewing on high-school students' social-reality beliefs. Supports the hypothesis that viewers overestimate the frequency of deviant behaviors; does not find support for the hypothesis that viewers become desensitized to the suffering of others; and finds that talk-show viewing was positively related, among…

  14. Career development at London Vet Show.

    Science.gov (United States)

    2016-09-03

    Are you considering a career change? Perhaps you want help to develop within your current role? Either way, you will find a relevant session in the BVA Career Development stream at the London Vet Show in November. British Veterinary Association.

  15. Method for forming ammonia

    Science.gov (United States)

    Kong, Peter C.; Pink, Robert J.; Zuck, Larry D.

    2008-08-19

    A method for forming ammonia is disclosed and which includes the steps of forming a plasma; providing a source of metal particles, and supplying the metal particles to the plasma to form metal nitride particles; and providing a substance, and reacting the metal nitride particles with the substance to produce ammonia, and an oxide byproduct.

  16. Mesonic Form Factors

    International Nuclear Information System (INIS)

    Bonnet, Frederic D.R.; Edwards, Robert G.; Felming, George T.; Randal Lewis; David Richards

    2003-01-01

    We have started a program to compute the electromagnetic form factors of mesons. We discuss the techniques used to compute the pion form factor and present preliminary results computed with domain wall valence fermions on MILC asqtad lattices, as well as Wilson fermions on quenched lattices. These methods can easily be extended to rho-to-gamma-pi transition form factors

  17. Isotropy of quadratic forms

    Indian Academy of Sciences (India)

    V. Suresh University Of Hyderabad Hyderabad

    2008-10-31

    Oct 31, 2008 ... Historically, the study of quadratic forms was part of number theory; Minkowski, Siegel, Hasse, Eichler, Kneser and several other mathematicians created a rich arithmetic theory of quadratic forms. V. Suresh University Of Hyderabad Hyderabad. Isotropy of quadratic forms ...

  18. Online Italian fandoms of American TV shows

    Directory of Open Access Journals (Sweden)

    Eleonora Benecchi

    2015-06-01

    Full Text Available The Internet has changed media fandom in two main ways: it helps fans connect with each other despite physical distance, leading to the formation of international fan communities; and it helps fans connect with the creators of the TV show, deepening the relationship between TV producers and international fandoms. To assess whether Italian fan communities active online are indeed part of transnational online communities and whether the Internet has actually altered their relationship with the creators of the original text they are devoted to, qualitative analysis and narrative interviews of 26 Italian fans of American TV shows were conducted to explore the fan-producer relationship. Results indicated that the online Italian fans surveyed preferred to stay local, rather than using geography-leveling online tools. Further, the sampled Italian fans' relationships with the show runners were mediated or even absent.

  19. 2008 LHC Open Days Physics: the show

    CERN Multimedia

    2008-01-01

    A host of events and activities await visitors to the LHC Open Days on 5 and 6 April. A highlight will be the physics shows funded by the European Physical Society (EPS), which are set to surprise and challenge children and adults alike! School children use their experience of riding a bicycle to understand how planets move around the sun (Copyright : Circus Naturally) Participating in the Circus Naturally show could leave a strange taste in your mouth! (Copyright : Circus Naturally) The Rino Foundation’s experiments with liquid nitrogen can be pretty exciting! (Copyright: The Rino Foundation)What does a bicycle have in common with the solar system? Have you ever tried to weigh air or visualise sound? Ever heard of a vacuum bazooka? If you want to discover the answers to these questions and more then come to the Physics Shows taking place at the CERN O...

  20. A Talk Show from the Past.

    Science.gov (United States)

    Gallagher, Arlene F.

    1991-01-01

    Describes a two-day activity in which elementary students examine voting rights, the right to assemble, and women's suffrage. Explains the game, "Assemble, Reassemble," and a student-produced talk show with five students playing the roles of leaders of the women's suffrage movement. Profiles Elizabeth Cady Stanton, Lucretia Mott, Susan…

  1. See you at London Vet Show.

    Science.gov (United States)

    2016-11-05

    London Vet Show is fast approaching: it takes place from November 17 to 18 and is being held at ExCeL London for the first time. Zoe Davies, marketing manager, highlights some of what BVA is offering at the event. British Veterinary Association.

  2. Show Them You Really Want the Job

    Science.gov (United States)

    Perlmutter, David D.

    2012-01-01

    Showing that one really "wants" the job entails more than just really wanting the job. An interview is part Broadway casting call, part intellectual dating game, part personality test, and part, well, job interview. When there are 300 applicants for a position, many of them will "fit" the required (and even the preferred) skills listed in the job…

  3. Identification of genes showing differential expression profile

    Indian Academy of Sciences (India)

    Suppression subtractive hybridization was used to identify genes showing differential expression profile associated withgrowth rate in skeletal muscle tissue of Landrace weanling pig. Two subtracted cDNA populations were generated from mus-culus longissimus muscle tissues of selected pigs with extreme expected ...

  4. Mike Pentz showing visitors around CESAR

    CERN Multimedia

    CERN PhotoLab

    1964-01-01

    Mike Pentz, leader of the CESAR Group, shows visitors around the 2 MeV electron storage ring. Here they are in the vault of the injector (a 2 MV van de Graaff generator), next to the 2 beam lines, one leading to the ring, the other to the spectrometer.

  5. Identification of genes showing differential expression profile ...

    Indian Academy of Sciences (India)

    Abstract. Suppression subtractive hybridization was used to identify genes showing differential expression profile associated with growth rate in skeletal muscle tissue of Landrace weanling pig. Two subtracted cDNA populations were generated from mus- culus longissimus muscle tissues of selected pigs with extreme ...

  6. Laser entertainment and light shows in education

    Science.gov (United States)

    Sabaratnam, Andrew T.; Symons, Charles

    2002-05-01

    Laser shows and beam effects have been a source of entertainment since its first public performance May 9, 1969, at Mills College in Oakland, California. Since 1997, the Photonics Center, NgeeAnn Polytechnic, Singapore, has been using laser shows as a teaching tool. Students are able to exhibit their creative skills and learn at the same time how lasers are used in the entertainment industry. Students will acquire a number of skills including handling three- phase power supply, operation of cooling system, and laser alignment. Students also acquire an appreciation of the arts, learning about shapes and contours as they develop graphics for the shows. After holography, laser show animation provides a combination of the arts and technology. This paper aims to briefly describe how a krypton-argon laser, galvanometer scanners, a polychromatic acousto-optic modulator and related electronics are put together to develop a laser projector. The paper also describes how students are trained to make their own laser animation and beam effects with music, and at the same time have an appreciation of the operation of a Class IV laser and the handling of optical components.

  7. Tilapia show immunization response against Ich

    Science.gov (United States)

    This study compares the immune response of Nile tilapia and red tilapia against parasite Ichthyophthirius multifiliis (Ich) using a cohabitation challenge model. Both Nile and red tilapia showed strong immune response post immunization with live Ich theronts by IP injection or immersion. Blood serum...

  8. The Last Great American Picture Show

    NARCIS (Netherlands)

    Elsaesser, Thomas; King, Noel; Horwath, Alexander

    2004-01-01

    The Last Great American Picture Show brings together essays by scholars and writers who chart the changing evaluations of the American cinema of the 1970s, sometimes referred to as the decade of the lost generation, but now more and more recognized as the first New Hollywood, without which the

  9. The British Show in Australia, 1985

    Directory of Open Access Journals (Sweden)

    Anthony Bond

    2016-07-01

    Full Text Available In 1984–85, The British Show, an exhibition largely made up of New British Sculpture, was curated for Australia and New Zealand. This essay discusses the context and effects of the exhibition on art in Australia. It also seeks to define the sources of originality and innovation of the artists included.

  10. Identification of genes showing differential expression profile ...

    Indian Academy of Sciences (India)

    Suppression subtractive hybridization was used to identify genes showing differential expression profile associated withgrowth rate in skeletal muscle tissue of Landrace weanling pig. Two subtracted cDNA populations were generated from mus-culus longissimus muscle tissues of selected pigs with extreme expected ...

  11. Mismatch repair protein hMSH2–hMSH6 recognizes mismatches and forms sliding clamps within a D-loop recombination intermediate

    Science.gov (United States)

    Honda, Masayoshi; Okuno, Yusuke; Hengel, Sarah R.; Martín-López, Juana V.; Cook, Christopher P.; Amunugama, Ravindra; Soukup, Randal J.; Subramanyam, Shyamal; Fishel, Richard; Spies, Maria

    2014-01-01

    High fidelity homologous DNA recombination depends on mismatch repair (MMR), which antagonizes recombination between divergent sequences by rejecting heteroduplex DNA containing excessive nucleotide mismatches. The hMSH2–hMSH6 heterodimer is the first responder in postreplicative MMR and also plays a prominent role in heteroduplex rejection. Whether a similar molecular mechanism underlies its function in these two processes remains enigmatic. We have determined that hMSH2–hMSH6 efficiently recognizes mismatches within a D-loop recombination initiation intermediate. Mismatch recognition by hMSH2–hMSH6 is not abrogated by human replication protein A (HsRPA) bound to the displaced single-stranded DNA (ssDNA) or by HsRAD51. In addition, ATP-bound hMSH2–hMSH6 sliding clamps that are essential for downstream MMR processes are formed and constrained within the heteroduplex region of the D-loop. Moreover, the hMSH2–hMSH6 sliding clamps are stabilized on the D-loop by HsRPA bound to the displaced ssDNA. Our findings reveal similarities and differences in hMSH2–hMSH6 mismatch recognition and sliding-clamp formation between a D-loop recombination intermediate and linear duplex DNA. PMID:24395779

  12. Mining by-products show potential

    International Nuclear Information System (INIS)

    Douglas, Grant

    2013-01-01

    Full text: Many mining and industrial processes generate wastewater that contains a variety of contaminants, such as metals and metalloids. These must be removed to ensure the wastewater is suitable for reuse or safe discharge to the environment. However, mining wastewater treatment processes have traditionally been difficult due to the large range of different contaminants present, requiring a number of complex steps. In current processes, the mining industry generally adds lime to the wastewater to purify it. While often effective, the key issue with this method has been the volume of sludge that forms and the subsequent problems with dealing with this sludge - either to extract the contained water, which often requires additional treatment, or to find enough space for long-term disposal. This complex practice could end soon thanks to a new treatment solution that utilises hydrotalcites. Developed by CSIRO, the treatment overcomes the complexities of lime-based methods and offers a simpler and more water smart process. The CSIRO team found that hydrotalcites, which are layered minerals consisting of aluminium- and magnesium- rich layers, can simultaneously remove a variety of contaminants in wastewater in a single step. Scientists noticed that hydrotalcites begin to form when aluminium and magnesium are present at an ideal ratio and under conditions during neutralisation of acidic waters. As hydrotalcites form, the contaminants become trapped and are easily removed from the wastewater as a solid. Mining wastewater often contains substantial magnesium and aluminium concentrations. This means that we can create hydrotalcites utilising common contaminants that are already present in the wastewater, by simply adjusting their concentrations and adding alkaline compounds to rapidly increase pH. Initial applications have focussed on treating wastewater generated from the mining and extraction of uranium. A range of contaminants including uranium, rare earth elements

  13. RecFOR Is Not Required for Pneumococcal Transformation but Together with XerS for Resolution of Chromosome Dimers Frequently Formed in the Process

    Science.gov (United States)

    Johnston, Calum; Mortier-Barrière, Isabelle; Granadel, Chantal; Polard, Patrice; Martin, Bernard; Claverys, Jean-Pierre

    2015-01-01

    Homologous recombination (HR) is required for both genome maintenance and generation of diversity in eukaryotes and prokaryotes. This process initiates from single-stranded (ss) DNA and is driven by a universal recombinase, which promotes strand exchange between homologous sequences. The bacterial recombinase, RecA, is loaded onto ssDNA by recombinase loaders, RecBCD and RecFOR for genome maintenance. DprA was recently proposed as a third loader dedicated to genetic transformation. Here we assessed the role of RecFOR in transformation of the human pathogen Streptococcus pneumoniae. We firstly established that RecFOR proteins are not required for plasmid transformation, strongly suggesting that DprA ensures annealing of plasmid single-strands internalized in the process. We then observed no reduction in chromosomal transformation using a PCR fragment as donor, contrasting with the 10,000-fold drop in dprA - cells and demonstrating that RecFOR play no role in transformation. However, a ∼1.45-fold drop in transformation was observed with total chromosomal DNA in recFOR mutants. To account for this limited deficit, we hypothesized that transformation with chromosomal DNA stimulated unexpectedly high frequency (>30% of cells) formation of chromosome dimers as an intermediate in the generation of tandem duplications, and that RecFOR were crucial for dimer resolution. We validated this hypothesis, showing that the site-specific recombinase XerS was also crucial for dimer resolution. An even higher frequency of dimer formation (>80% of cells) was promoted by interspecies transformation with Streptococcus mitis chromosomal DNA, which contains numerous inversions compared to pneumococcal chromosome, each potentially promoting dimerization. In the absence of RecFOR and XerS, dimers persist, as confirmed by DAPI staining, and can limit the efficiency of transformation, since resulting in loss of transformant chromosome. These findings strengthen the view that different HR

  14. RecFOR is not required for pneumococcal transformation but together with XerS for resolution of chromosome dimers frequently formed in the process.

    Directory of Open Access Journals (Sweden)

    Calum Johnston

    2015-01-01

    Full Text Available Homologous recombination (HR is required for both genome maintenance and generation of diversity in eukaryotes and prokaryotes. This process initiates from single-stranded (ss DNA and is driven by a universal recombinase, which promotes strand exchange between homologous sequences. The bacterial recombinase, RecA, is loaded onto ssDNA by recombinase loaders, RecBCD and RecFOR for genome maintenance. DprA was recently proposed as a third loader dedicated to genetic transformation. Here we assessed the role of RecFOR in transformation of the human pathogen Streptococcus pneumoniae. We firstly established that RecFOR proteins are not required for plasmid transformation, strongly suggesting that DprA ensures annealing of plasmid single-strands internalized in the process. We then observed no reduction in chromosomal transformation using a PCR fragment as donor, contrasting with the 10,000-fold drop in dprA- cells and demonstrating that RecFOR play no role in transformation. However, a ∼1.45-fold drop in transformation was observed with total chromosomal DNA in recFOR mutants. To account for this limited deficit, we hypothesized that transformation with chromosomal DNA stimulated unexpectedly high frequency (>30% of cells formation of chromosome dimers as an intermediate in the generation of tandem duplications, and that RecFOR were crucial for dimer resolution. We validated this hypothesis, showing that the site-specific recombinase XerS was also crucial for dimer resolution. An even higher frequency of dimer formation (>80% of cells was promoted by interspecies transformation with Streptococcus mitis chromosomal DNA, which contains numerous inversions compared to pneumococcal chromosome, each potentially promoting dimerization. In the absence of RecFOR and XerS, dimers persist, as confirmed by DAPI staining, and can limit the efficiency of transformation, since resulting in loss of transformant chromosome. These findings strengthen the view that

  15. Hepatitis C virus double-stranded RNA is the predominant form in human liver and in interferon-treated cells.

    Science.gov (United States)

    Klepper, Arielle; Eng, Francis J; Doyle, Erin H; El-Shamy, Ahmed; Rahman, Adeeb H; Fiel, M Isabel; Avino, Gonzalo Carrasco; Lee, Moonju; Ye, Fei; Roayaie, Sasan; Bansal, Meena B; MacDonald, Margaret R; Schiano, Thomas D; Branch, Andrea D

    2017-08-01

    Hepatitis C virus (HCV) is unique among RNA viruses in its ability to establish chronic infection in the majority of exposed adults. HCV persists in the liver despite interferon (IFN)-stimulated gene (ISG) induction; robust induction actually predicts treatment failure and viral persistence. It is unclear which forms of HCV RNA are associated with ISG induction and IFN resistance during natural infections. To thoroughly delineate HCV RNA populations, we developed conditions that fully separate the strands of long double-stranded RNA (dsRNA) and allow the released RNAs to be quantified in reverse transcription/polymerase chain reaction assays. These methods revealed that dsRNA, a pathogen-associated molecular pattern (PAMP), comprised 52% (standard deviation, 28%) of the HCV RNA in the livers of patients with chronic infection. HCV dsRNA was proportionally higher in patients with the unfavorable IL28B TT (rs12979860) genotype. Higher ratios of HCV double-stranded to single-stranded RNA (ssRNA) correlated positively with ISG induction. In Huh-7.5 cells, IFN treatment increased the total amount of HCV dsRNA through a process that required de novo viral RNA synthesis and shifted the ratio of viral dsRNA/ssRNA in favor of dsRNA. This shift was blocked by ribavirin (RBV), an antiviral drug that reduces relapse in HCV patients. Northern blotting established that HCV dsRNA contained genome-length minus strands. HCV dsRNA is the predominant form in the HCV-infected liver and has features of both a PAMP and a genomic reservoir. Interferon treatment increased rather than decreased HCV dsRNA. This unexpected finding suggests that HCV produces dsRNA in response to IFN, potentially to antagonize antiviral defenses. (Hepatology 2017;66:357-370). © 2016 The Authors. Hepatology published by Wiley Periodicals, Inc., on behalf of the American Association for the Study of Liver Diseases.

  16. Cyclic voltammetry of echinomycin and its interaction with double-stranded and single-stranded DNA adsorbed at the electrode

    Czech Academy of Sciences Publication Activity Database

    Jelen, František; Erdem, A.; Paleček, Emil

    2002-01-01

    Roč. 55, 1/2 (2002), s. 165-167 ISSN 1567-5394 R&D Projects: GA AV ČR IAA4004901; GA ČR GV204/97/K084 Institutional research plan: CEZ:AV0Z5004920 Keywords : electrochemistry of DNA * interaction of DNA with echinomycin * hanging mercury drop electrode Subject RIV: BO - Biophysics Impact factor: 1.463, year: 2002

  17. Characterization of the Single Stranded DNA Binding Protein SsbB Encoded in the Gonoccocal Genetic Island

    NARCIS (Netherlands)

    Jain, Samta; Zweig, Maria; Peeters, Eveline; Siewering, Katja; Hackett, Kathleen T.; Dillard, Joseph P.; van der Does, Chris

    2012-01-01

    Background: Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in

  18. Guanine quadruplex monoclonal antibody 1H6 cross-reacts with restrained thymidine-rich single stranded DNA

    NARCIS (Netherlands)

    Kazemier, Hinke G.; Paeschke, Katrin; Lansdorp, Peter M.

    2017-01-01

    Previously we reported the production and characterization of monoclonal antibody 1H6 raised against (T(4)G(4))(2) intermolecular guanine quadruplex (G4) DNA structures (Henderson A. et al. (2014) Nucleic Acids Res., 42, 860-869; Hoffmann R. F. et al. (2016) Nucleic Acids Res., 44, 152-163). It was

  19. Genomic sequences of two novel Levivirus single-stranded RNA coliphages (family Leviviridae): Evidence for recombination in environmental strains

    Science.gov (United States)

    Bacteriophages are likely the most abundant entities in the aquatic environment, yet knowledge of their ecology is limited. During a fecal source-tracking study, two genetically novel Leviviridae strains were discovered. Although the novel strains were isolated from coastal wat...

  20. The Effectiveness of a Weight Maintenance Intervention for Adults with Intellectual Disabilities and Obesity: A Single Stranded Study

    Science.gov (United States)

    Spanos, Dimitrios; Hankey, Catherine R.; Melville, Craig A.

    2016-01-01

    Background: The evidence base for weight management programmes incorporating a weight loss and a weight maintenance phase for adults with intellectual disabilities (ID) is limited. This study describes the weight maintenance phase of a multicomponent weight management programme for adults with intellectual disability and obesity (TAKE 5).…

  1. Data mining cDNAs reveals three new single stranded RNA viruses in Nasonia (Hymenopetera:Pteromalidae)

    Science.gov (United States)

    Hymenopteran viruses may provide insights into colony collapse disorder in honey bees and other insect species. Three novel small RNA viruses were discovered during the genomics effort for the beneficial parasitoid of flies in the genus Nasonia (Hymenoptera). Genomics provides a great deal of inform...

  2. Cytogenetic Markers, DNA Single-Strand Breaks, Urinary Metabolites, and DNA Repair Rates in Styrene-Exposed Lamination Workers

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Tuimala, J.; Štětina, R.; Kumar, R.; Manini, P.; Naccarati, Alessio; Maestri, L.; Vodičková, L.; Kuricová, Miroslava; Jarventaus, H.; Majvalková, Z.; Hirvonen, A.; Imbriani, M.; Mutti, A.; Norppa, H.; Hemminki, K.

    2004-01-01

    Roč. 112, č. 8 (2004), s. 867-871 ISSN 0091-6765 R&D Projects: GA ČR GA310/03/0437; GA ČR GA310/01/0802 Institutional research plan: CEZ:AV0Z5039906 Keywords : DNA repair rates * genotoxicity Subject RIV: FM - Hygiene Impact factor: 3.929, year: 2004

  3. Analysis of major histocompatibility complex class II gene in water voles using capillary electrophoresis-single stranded conformation polymorphism

    Czech Academy of Sciences Publication Activity Database

    Bryja, Josef; Galan, M.; Charbonnel, N.; Cosson, J.-F.

    2005-01-01

    Roč. 5, č. 1 (2005), s. 173-176 ISSN 1471-8278 Institutional research plan: CEZ:AV0Z6093917 Keywords : water vole * population genetics Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.219, year: 2005

  4. Cuprolinic Blue: a specific dye for single-stranded RNA in the presence of magnesium chloride. I. Fundamental aspects

    NARCIS (Netherlands)

    Tas, J.; MENDELSON, D.; NOORDEN, C. J. F.

    1983-01-01

    Qualitative and quantitative aspects of the cationic dye Cuprolinic Blue were investigated with model films of polyacrylamide gel in which RNA, DNA and other biological polyanionic compounds had been incorporated. In the presence of 1 M MgCl2, Curpolinic Blue was found to bind specifically to

  5. Conformational Diversity of Single-Stranded DNA from Bacterial Repetitive Extragenic Palindromes: Implications for the DNA Recognition Elements of Transposases

    Czech Academy of Sciences Publication Activity Database

    Charnavets, Tatsiana; Nunvář, Jaroslav; Nečasová, Iva; Voelker, J.; Breslauer, K.J.; Schneider, Bohdan

    2015-01-01

    Roč. 103, č. 10 (2015), s. 585-596 ISSN 0006-3525 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109; GA ČR GAP305/12/1801; GA MŠk(CZ) EE2.3.30.0020 Institutional support: RVO:86652036 Keywords : bacterial repetitive extragenic palindromes (REP) * circular dichroism spectroscopy * REP associated tyrosine transposases (RAYTs) Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.248, year: 2015

  6. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB)

    OpenAIRE

    van Loon, Barbara; Samson, Leona D.

    2013-01-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known...

  7. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes

    Czech Academy of Sciences Publication Activity Database

    Pietilä, M.K.; Roine, E.; Sencilo, Ana; Bamford, D.H.; Oksanen, H.M.

    2016-01-01

    Roč. 161, č. 1 (2016), s. 249-256 ISSN 0304-8608 R&D Projects: GA ČR(CZ) GAP302/11/ 1940 Institutional support: RVO:61388971 Keywords : VIRION ARCHITECTURE * HALOVIRUSES * SPINDLE Subject RIV: EE - Microbiology, Virology Impact factor: 2.058, year: 2016

  8. Direct imaging of hexaamine-ruthenium(III) in domain boundaries in monolayers of single-stranded DNA

    DEFF Research Database (Denmark)

    Grubb, Mikala; Wackerbarth, Hainer; Wengel, J.

    2007-01-01

    We describe adsorption and identification of the binding sites of [Ru(NH3)(6)](3+) (RuHex) molecules in a closely packed monolayer of a 13-base ss-DNA on Au(111) electrodes by electrochemical in situ scanning tunneling microscopy (STM), cyclic voltammetry and interfacial capacitance data. In situ...

  9. Characterization of a novel single-stranded RNA virus, closely related to fusariviruses, infecting the plant pathogenic fungus Alternaria brassicicola.

    Science.gov (United States)

    Zhong, Jie; Shang, Hong Hong; Zhu, Chuan Xia; Zhu, Jun Zi; Zhu, Hong Jian; Hu, Yan; Gao, Bi Da

    2016-06-02

    The alternaria blackspot of rapeseed is one of the most prominent diseases of rapeseed. It is caused by three species of the genus Alternaria: Alternaria brassicicola, Alternaria brassicae, and Alternaria raphanin. Here we report a novel positive-sense RNA virus from an A. brassicicola strain 817-14. The virus has a 6639 nucleotide (nt) long genome, excluding a poly (A)-tail, and was predicted to contain three putative open reading frames (ORF1, ORF2, and ORF3). The large ORF1 encoded a 174-kDa polyprotein (composed of 1522 amino acid residues) containing a conserved RNA-dependent RNA polymerase (RdRp) domain and a helicase domain. The other two smaller ORFs encoded polypeptides with unknown function. Homology search and phylogenetic analysis, based on the RdRp and helicase domains, suggest that this virus is related to and grouped with Sclerotinia sclerotiorum fusarivirus 1 (SsFV1), Rosellinia necatrix fusarivirus 1 (RnFV1), Fusarium graminearum virus-DK21 (FgV1), and Penicillium roqueforti RNA mycovirus 1 (PrRV1), all of which belong to a newly proposed family Fusariviridae. For this study, we designed the virus as "Alternaria brassicicola fusarivirus 1" (AbFV1). Virus elimination revealed that AbFV1 has no conspicuous impact on the biological properties of its host. Copyright © 2016. Published by Elsevier B.V.

  10. Interaction of Zn2+ Ions with Single-Stranded PolyU and PolyC in Neutral Solutions

    Czech Academy of Sciences Publication Activity Database

    Sorokin, V. A.; Usenko, E. L.; Valeev, V. A.; Berezniak, E. G.; Andrushchenko, Valery

    2015-01-01

    Roč. 119, č. 12 (2015), s. 4409-4416 ISSN 1520-6106 R&D Projects: GA ČR GAP208/11/0105; GA ČR GA15-09072S Institutional support: RVO:61388963 Keywords : metal ions * polyU * polyC * metallized DNA * differential UV spectroscopy * thermal denaturation * phase diagram Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.187, year: 2015

  11. Using single strand conformational polymorphisms (SSCP) to identify Phytophthora species in Oregon forests affected by sudden oak death

    Science.gov (United States)

    E. Hansen; C. Hesse; P. Reeser; W. Sutton; L. Winton

    2006-01-01

    Phytophthora species are abundant in streams, widespread in soils and occasionally found in diseased plants in the tanoak forests of southwestern Oregon. It is time-consuming and expensive to identify hundreds of isolates to species using morphology or internal transribed spacer (ITS) sequencing. We modified a published Phytophthora...

  12. La mujer, en los talk shows

    Directory of Open Access Journals (Sweden)

    Antrop. José Gamboa Cetina

    2001-01-01

    Full Text Available Dentro de los medios de comunicación, uno de los que más ha impactado a la población latinoamericana ha sido la televisión, y en la barra programática de las televisoras ha surgido un tipo de programas denominados talk shows. En los últimos meses, la sociedad mexicana ha vivido el "boom" de los talk shows, que en poco tiempo han saturado la barra de la programación vespertina de las dos principales empresas televisivas de la república mexicana. Este fenómeno puede estudiarse desde diversas perspectivas. Sin embargo, por motivos de espacio, en esta ocasión analizaremos su impacto en las mujeres, desde diferentes dimensiones.

  13. Reality, ficción o show

    Directory of Open Access Journals (Sweden)

    Sandra Ruíz Moreno

    2002-01-01

    Full Text Available Para tener un punto de vista claro y objetivo frente a la polémica establecida en torno al programa “Protagonistas de novela” y la tendiente proliferación de los reality show en las parrillas de programación de la televisión colombiana, se realizó un análisis de texto y contenido de dicho programa, intentando definirlo desde sus posibilidades de realidad, ficción y show. Las unidades de análisis y el estudio de su tratamiento arrojaron un alto contenido que gira en torno a las emociones del ser humano relacionadas con la convivencia, tratadas a manera de show y con algunos aportes textuales de ficción, pero sin su elemento mediador básico, el actor, quitándole toda la posibilidad de tener un tratamiento con la profundidad, distancia y ética que requieren los temas de esta índole. El resultado es un formato que sólo busca altos índices de sintonía y que pertenece más a la denominada televisión “trash”, que a una búsqueda de realidad del hombre y mucho menos de sociedad.

  14. Micro metal forming

    CERN Document Server

    2013-01-01

    Micro Metal Forming, i. e. forming of parts and features with dimensions below 1 mm, is a young area of research in the wide field of metal forming technologies, expanding the limits for applying metal forming towards micro technology. The essential challenges arise from the reduced geometrical size and the increased lot size. In order to enable potential users to apply micro metal forming in production, information about the following topics are given: tribological behavior: friction between tool and work piece as well as tool wear mechanical behavior: strength and formability of the work piece material, durability of the work pieces size effects: basic description of effects occurring due to the fact, that the quantitative relation between different features changes with decreasing size process windows and limits for forming processes tool making methods numerical modeling of processes and process chains quality assurance and metrology All topics are discussed with respect to the questions relevant to micro...

  15. Smooth functors vs. differential forms

    NARCIS (Netherlands)

    Schreiber, U.; Waldorf, K.

    2011-01-01

    We establish a relation between smooth 2-functors defined on the path 2-groupoid of a smooth manifold and differential forms on this manifold. This relation can be understood as a part of a dictionary between fundamental notions from category theory and differential geometry. We show that smooth

  16. Varicose veins show enhanced chemokine expression.

    Science.gov (United States)

    Solá, L del Rio; Aceves, M; Dueñas, A I; González-Fajardo, J A; Vaquero, C; Crespo, M Sanchez; García-Rodríguez, C

    2009-11-01

    Leucocyte infiltration in the wall of varicose veins has been reported previously. This study was designed to investigate the expression of pro-inflammatory cytokines and chemokines in control and in patients with varicose veins and to test the effect of treating varicose vein patients with acetylsalicylic acid (ASA) on cytokine expression prior to removal of varices. Sections of vein were removed during operation from both patient groups, and ribonuclease protection assays (RPAs) were performed to assess the expression of chemokines. Group I included non-varicose saphenous veins from healthy patients undergoing amputation for trauma. Varicose veins were obtained from patients with primary varicose undergoing surgical treatment who received no drug (group II) or treatment with 300 mg day(-1) of ASA for 15 days before surgery (group III). Non-varicose veins constitutively expressed low levels of monocyte-chemoattractant protein (MCP-1) and interleukin (IL)-8 mRNA. Varicose veins had a distinct chemokine expression pattern, since significant up-regulation of MCP-1 and IL-8 and a marked expression of IP-10, RANTES, MIP-1alpha and MIP-1beta mRNA were detected. Removal of the endothelium did not alter this pattern. Varicose veins obtained from patients treated with ASA showed a consistent decrease in chemokine expression, although it did not reach statistical significance. Varicose veins showed increased expression of several chemokines compared to control veins. A non-significant reduction of activation was observed following treatment with ASA for 15 days.

  17. PowerForms

    DEFF Research Database (Denmark)

    Brabrand, Claus; Møller, Anders; Ricky, Mikkel

    2000-01-01

    such validation. Today, CGI programmers often use Perl libraries for simple server-side validation or program customized JavaScript solutions for client-side validation. We present PowerForms, which is an add-on to HTML forms that allows a purely declarative specification of input formats and sophisticated...... interdependencies of form fields. While our work may be seen as inspiration for a future extension of HTML, it is also available for CGI programmers today through a preprocessor that translates a PowerForms document into a combination of standard HTML and JavaScript that works on all combinations of platforms...

  18. Cooperative Station History Forms

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Various forms, photographs and correspondence documenting the history of Cooperative station instrumentation, location changes, inspections, and...

  19. Electronic Capitalization Asset Form -

    Data.gov (United States)

    Department of Transportation — National Automated Capitalization Authorization Form used by ATO Engineering Services, Logistics, Accounting for the purpose of identifying and capturing FAA project...

  20. Microbiological and environmental issues in show caves.

    Science.gov (United States)

    Saiz-Jimenez, Cesareo

    2012-07-01

    Cultural tourism expanded in the last half of the twentieth century, and the interest of visitors has come to include caves containing archaeological remains. Some show caves attracted mass tourism, and economical interests prevailed over conservation, which led to a deterioration of the subterranean environment and the rock art. The presence and the role of microorganisms in caves is a topic that is often ignored in cave management. Knowledge of the colonisation patterns, the dispersion mechanisms, and the effect on human health and, when present, over rock art paintings of these microorganisms is of the utmost importance. In this review the most recent advances in the study of microorganisms in caves are presented, together with the environmental implications of the findings.

  1. Ancient bacteria show evidence of DNA repair

    DEFF Research Database (Denmark)

    Johnson, Sarah Stewart; Hebsgaard, Martin B; Christensen, Torben R

    2007-01-01

    Recent claims of cultivable ancient bacteria within sealed environments highlight our limited understanding of the mechanisms behind long-term cell survival. It remains unclear how dormancy, a favored explanation for extended cellular persistence, can cope with spontaneous genomic decay over......-term survival of bacteria sealed in frozen conditions for up to one million years. Our results show evidence of bacterial survival in samples up to half a million years in age, making this the oldest independently authenticated DNA to date obtained from viable cells. Additionally, we find strong evidence...... that this long-term survival is closely tied to cellular metabolic activity and DNA repair that over time proves to be superior to dormancy as a mechanism in sustaining bacteria viability....

  2. Hepatitis E: Epidemiological forms

    Indian Academy of Sciences (India)

    In these endemic countries, the disease takes two major epidemiological forms. The form that was recognized first was occurrence of large outbreaks affecting several hundred to several thousand cases of acute hepatitis, usually over a short period of a few weeks. However, it was soon realized that the viral agent was also ...

  3. Plant species descriptions show signs of disease.

    Science.gov (United States)

    Hood, Michael E; Antonovics, Janis

    2003-11-07

    It is well known that diseases can greatly influence the morphology of plants, but often the incidence of disease is either too rare or the symptoms too obvious for the 'abnormalities' to cause confusion in systematics. However, we have recently come across several misinterpretations of disease-induced traits that may have been perpetuated into modern species inventories. Anther-smut disease (caused by the fungus Microbotryum violaceum) is common in many members of the Caryophyllaceae and related plant families. This disease causes anthers of infected plants to be filled with dark-violet fungal spores rather than pollen. Otherwise, their vegetative morphology is within the normal range of healthy plants. Here, we present the results of a herbarium survey showing that a number of type specimens (on which the species name and original description are based) in the genus Silene from Asia are diseased with anther smut. The primary visible disease symptom, namely the dark-violet anthers, is incorporated into the original species descriptions and some of these descriptions have persisted unchanged into modern floras. This raises the question of whether diseased type specimens have erroneously been given unique species names.

  4. NASA GIBS Use in Live Planetarium Shows

    Science.gov (United States)

    Emmart, C. B.

    2015-12-01

    The American Museum of Natural History's Hayden Planetarium was rebuilt in year 2000 as an immersive theater for scientific data visualization to show the universe in context to our planet. Specific astrophysical movie productions provide the main daily programming, but interactive control software, developed at AMNH allows immersive presentation within a data aggregation of astronomical catalogs called the Digital Universe 3D Atlas. Since 2006, WMS globe browsing capabilities have been built into a software development collaboration with Sweden's Linkoping University (LiU). The resulting Uniview software, now a product of the company SCISS, is operated by about fifty planetariums around that world with ability to network amongst the sites for global presentations. Public presentation of NASA GIBS has allowed authoritative narratives to be presented within the range of data available in context to other sources such as Science on a Sphere, NASA Earth Observatory and Google Earth KML resources. Specifically, the NOAA supported World Views Network conducted a series of presentations across the US that focused on local ecological issues that could then be expanded in the course of presentation to national and global scales of examination. NASA support of for GIBS resources in an easy access multi scale streaming format like WMS has tremendously enabled particularly facile presentations of global monitoring like never before. Global networking of theaters for distributed presentations broadens out the potential for impact of this medium. Archiving and refinement of these presentations has already begun to inform new types of documentary productions that examine pertinent, global interdependency topics.

  5. Characterization of a mutagenic DNA adduct formed from 1,2-dibromoethane by O6-alkylguanine-DNA alkyltransferase.

    Science.gov (United States)

    Liu, Liping; Hachey, David L; Valadez, Gerardo; Williams, Kevin M; Guengerich, F Peter; Loktionova, Natalia A; Kanugula, Sreenivas; Pegg, Anthony E

    2004-02-06

    It has been proposed that the DNA repair protein O6-alkylguanine-DNA alkyltransferase increases the mutagenicity of 1,2-dibromoethane by reacting with it at its cysteine acceptor site to form a highly reactive half-mustard, which can then react with DNA (Liu, L., Pegg, A. E., Williams, K. M., and Guengerich, F. P. (2002) J. Biol. Chem. 277, 37920-37928). Incubation of Escherichia coli-expressed human alkyltransferase with 1,2-dibromoethane and single-stranded oligodeoxyribonucleotides led to the formation of covalent transferaseoligo complexes. The order of reaction determined was Gua>Thy>Cyt>Ade. Mass spectrometry analysis of the tryptic digest of the reaction product indicated that some of the adducts led to depurination with the release of the Gly136-Arg147 peptide cross-linked to a Gua at the N7 position, with the site of reaction being the active site Cys145 as established by chromatographic retention time and the fragmentation pattern determined by tandem mass spectrometry of a synthetic peptide adduct. The alkyltransferase-mediated mutations produced by 1,2-dibromoethane were predominantly Gua to Ade transitions but, in the spectrum of such rifampicin-resistant mutations in the RpoB gene, 20% were Gua to Thy transversions. The latter are likely to have arisen from the apurinic site generated from the Gua-N7 adduct. Support exists for an additional adduct/mutagenic pathway because evidence was obtained for DNA adducts other than at the Gua N7 atom and for mutations other than those attributable to depurination. Thus, chemical and biological evidence supports the existence of at least two alkyltransferase-dependent pathways for 1,2-dibromoethane-induced mutagenicity, one involving Gua N7-alkylation by alkyltransferase-S-CH2CH2Br and depurination, plus another as yet uncharacterized system(s).

  6. Forms of Arthritis

    Science.gov (United States)

    ... Today, Linda Saisselin takes joy in holding her new grandson—pain free. Photo courtesy of Linda Saisselin Osteoarthritis (OA) — the form of arthritis typically occurring during middle or old age, this is a joint disease that mostly affects ...

  7. NOAA Form 370 Database

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The data set contains information from submitted NOAA Form 370s, also known as the Fisheries Certificate of Origin, for imported shipments of frozen and/or processed...

  8. MAPS Appraisal Report Form

    CERN Multimedia

    HR Department

    2005-01-01

    As announced in Weekly Bulletin 48/2004, from now onwards, the paper MAPS appraisal report form has been replaced by an electronic form, which is available via EDH (on the EDH desktop under Other Tasks / HR & Training) No changes have been made to the contents of the form. Practical information will be available on the web page http://cern.ch/ais/projs/forms/maps/info.htm, and information meetings will be held on the following dates: 18 January 2005: MAIN AUDITORIUM (500-1-001) from 14:00 to 15:30. 20 January 2005: AB AUDITORIUM II (864-1-D02) from14:00 to 15:30. 24 January 2005: AT AUDITORIUM (30-7-018) from 10:00 to 11:30. Human Resources Department Tel. 73566

  9. Science on form

    International Nuclear Information System (INIS)

    Ishizaka, Shozo; Kato, Yoshihiro; Takaki, Ryuji; Toriwaki, Jun-ichiro

    1987-01-01

    The purpose of the Symposium was to discuss interdisciplinal science aspects of form. 'Form' depends on the material and the changes. But, it is the form that appears evident at once and endures. Form is absorbed from every field as media of information. One part of the work covers the description of non-periodic phenomena, morphogenesis or evolution. Irreducible stubborn facts as diseases or social problems, or whatever else that could not be analyzed are integrally challenged to be systematized by computer simulation. The other part covers the finding of laws for determining how systems behave. Attention should be paid to pattern recognition, image processing and pattern formation. The Symposium proceeded with no parallel sessions, and participants from various fields made exciting discussions in an interdisciplinal atmosphere. (Auth.)

  10. VMS forms Output Tables

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — These output tables contain parsed and format validated data from the various VMS forms that are sent from any given vessel, while at sea, from the VMS devices on...

  11. Forms of Dystonia

    Science.gov (United States)

    ... Special Events Faces of Dystonia Donate Donate Online Membership Find an Event Donor Bill of Rights About Dystonia Symptoms & Diagnosis Forms of Dystonia Genetics Glossary Treatment Find a Doctor Oral Medications Botulinum Neurotoxin Neurosurgery ...

  12. Forms of global governence

    Directory of Open Access Journals (Sweden)

    Maxim V. Kharkevich

    2014-01-01

    Full Text Available Global governance as a concept defines the meaning of contemporary world politics both as a discipline and as reality. Interdependent and globalized world requires governance, and a global government has not been formed yet. The theoretical possibility of global governance without global government is proved and justified. The purpose of this article is to analytically identify possible forms of global governance. Three such forms of global governance are identified: hierarchical, market and network. In a hierarchy the governance is due to the asymmetry of power between the parties. Market control happens via anonymous pricing mechanism. Network, in contrast to the market is characterized by a closer value link between the actors, but unlike the hierarchical relationship actors are free to leave the network. Global governance takes three forms and is being implemented by different actors. To determine the most efficient form of global governance is impossible. Efficiency depends on the match between a form and an object of government. It should be noted that meta governance is likely to remain a monopoly of institutionally strong states in global governance.

  13. A novel form of pectinesterase in tomato.

    Science.gov (United States)

    Warrilow, A G; Turner, R J; Jones, M G

    1994-03-01

    The pectinesterases in tomato pericarp were fractionated by cation exchange into four forms (A-D). Form A was the most abundant and C the second most abundant. Forms A-C were further purified by gel filtration, and antibodies were raised against A and C. Comparison of the different forms by dot blots and Western blots showed that although all three forms shared common immunological characteristics, there were also differences in their behaviour, indicative of structural differences. Form A had an N-terminal sequence identical to that published previously for the major pectinesterase in tomato fruit. In contrast, form C had a completely novel N-terminal sequence. Form A was absent from hypocotyls and roots. Forms B and C were present in comparable amounts in hypocotyls, while from C predominated in roots.

  14. Designing usable web forms- Empirical evaluation of web form improvement guidelines

    DEFF Research Database (Denmark)

    Seckler, Mirjam; Heinz, Silvia; Bargas-Avila, Javier A.

    2014-01-01

    This study reports a controlled eye tracking experiment (N = 65) that shows the combined effectiveness of 20 guidelines to improve interactive online forms when applied to forms found on real company websites. Results indicate that improved web forms lead to faster completion times, fewer form su...... submission trials, and fewer eye movements. Data from subjective questionnaires and interviews further show increased user satisfaction. Overall, our findings highlight the importance for web designers to improve their web forms using UX guidelines.......This study reports a controlled eye tracking experiment (N = 65) that shows the combined effectiveness of 20 guidelines to improve interactive online forms when applied to forms found on real company websites. Results indicate that improved web forms lead to faster completion times, fewer form...

  15. Comparative waste forms study

    International Nuclear Information System (INIS)

    Wald, J.W.; Lokken, R.O.; Shade, J.W.; Rusin, J.M.

    1980-12-01

    A number of alternative process and waste form options exist for the immobilization of nuclear wastes. Although data exists on the characterization of these alternative waste forms, a straightforward comparison of product properties is difficult, due to the lack of standardized testing procedures. The characterization study described in this report involved the application of the same volatility, mechanical strength and leach tests to ten alternative waste forms, to assess product durability. Bulk property, phase analysis and microstructural examination of the simulated products, whose waste loading varied from 5% to 100% was also conducted. The specific waste forms investigated were as follows: Cold Pressed and Sintered PW-9 Calcine; Hot Pressed PW-9 Calcine; Hot Isostatic Pressed PW-9 Calcine; Cold Pressed and Sintered SPC-5B Supercalcine; Hot Isostatic pressed SPC-5B Supercalcine; Sintered PW-9 and 50% Glass Frit; Glass 76-68; Celsian Glass Ceramic; Type II Portland Cement and 10% PW-9 Calcine; and Type II Portland Cement and 10% SPC-5B Supercalcine. Bulk property data were used to calculate and compare the relative quantities of waste form volume produced at a spent fuel processing rate of 5 metric ton uranium/day. This quantity ranged from 3173 L/day (5280 Kg/day) for 10% SPC-5B supercalcine in cement to 83 L/day (294 Kg/day) for 100% calcine. Mechanical strength, volatility, and leach resistance tests provide data related to waste form durability. Glass, glass-ceramic and supercalcine ranked high in waste form durability where as the 100% PW-9 calcine ranked low. All other materials ranked between these two groupings

  16. The integral form of supergravity

    Energy Technology Data Exchange (ETDEWEB)

    Castellani, L. [Dipartimento di Scienze e Innovazione Tecnologica, Università del Piemonte Orientale,Viale T. Michel, 11, 15121 Alessandria (Italy); INFN - Sezione di Torino,via P. Giuria 1, 10125 Torino (Italy); Catenacci, R. [Dipartimento di Scienze e Innovazione Tecnologica, Università del Piemonte Orientale,Viale T. Michel, 11, 15121 Alessandria (Italy); Gruppo Nazionale di Fisica Matematica, INdAM,P.le Aldo Moro 5, 00185 Roma (Italy); Grassi, P.A. [Dipartimento di Scienze e Innovazione Tecnologica, Università del Piemonte Orientale,Viale T. Michel, 11, 15121 Alessandria (Italy); INFN - Sezione di Torino,via P. Giuria 1, 10125 Torino (Italy)

    2016-10-11

    By using integral forms we derive the superspace action of D=3,N=1 supergravity as an integral on a supermanifold. The construction is based on target space picture changing operators, here playing the rôle of Poincaré duals to the lower-dimensional spacetime surfaces embedded into the supermanifold. We show how the group geometrical action based on the group manifold approach interpolates between the superspace and the component supergravity actions, thus providing another proof of their equivalence.

  17. Chemical forms of radioiodine

    International Nuclear Information System (INIS)

    Tachikawa, Enzo

    1979-01-01

    Release of radioiodine built-up during reactor operations presents a potential problem from the standpoint of environmental safety. Among the chemical forms of radioiodine, depending upon the circumstances, organic iodides cast a most serious problem because of its difficulties in the trapping and because of its stability compared to other chemical forms. Furthermore, pellet-cladding interaction (PCl) fuel failures in LWR fuel rods are believed to be stress corrosion cracks caused by embrittling fission product species, radioiodine. To deal with these problems, knowledge is required on the chemical behaviors of radioiodine in and out of fuels, as well as the release behaviors from fuels. Here a brief review is given of these respects, in aiming at clearing-up the questions still remaining unknown. The data seem to indicate that radioiodine exists as a combined form in fuels. upon heating slightly irradiated fuels, the iodine atoms are released in a chemical form associated with uranium atoms. Experiments, however, as needed with specimen of higher burnup, where the interactions of radioiodine with metallic fission products could be favored. The dominant release mechanism of radioiodine under normal operating temperatures will be diffusion to grain boundaries leading to open surfaces. Radiation-induced internal traps, however, after the rate of diffusion significantly. The carbon sources of organic iodides formed under various conditions and its formation mechanisms have also been considered. (author)

  18. On Growth and Form

    Science.gov (United States)

    Maartens, Aidan

    2017-12-01

    D'Arcy Thompson was born in 1860, trained in Edinburgh and Cambridge, and held positions in Dundee and St Andrews, where he worked until his death in 1948. On Growth and Form , his classic work on the mathematical patterns and physical rules underlying biological forms, was first published in 1917. To learn more about the book's context, we met Matthew Jarron, Curator of Museum Services at the University of Dundee, in the University's D'Arcy Thompson Zoology Museum. Surrounded by specimens, many of which were collected by Thompson himself, we discussed the legacy of On Growth and Form and the life of the man behind it. © 2017. Published by The Company of Biologists Ltd.

  19. Waste-form development

    International Nuclear Information System (INIS)

    Neilson, R.M. Jr.; Colombo, P.

    1982-01-01

    Contemporary solidification agents are being investigated relative to their applications to major fuel cycle and non-fuel cycle low-level waste (LLW) streams. Work is being conducted to determine the range of conditions under which these solidification agents can be applied to specific LLW streams. These studies are directed primarily towards defining operating parameters for both improved solidification of problem wastes and solidification of new LLW streams generated from advanced volume reduction technologies. Work is being conducted to measure relevant waste form properties. These data will be compiled and evaluated to demonstrate compliance with waste form performance and shallow land burial acceptance criteria and transportation requirements

  20. Sixth form pure mathematics

    CERN Document Server

    Plumpton, C

    1968-01-01

    Sixth Form Pure Mathematics, Volume 1, Second Edition, is the first of a series of volumes on Pure Mathematics and Theoretical Mechanics for Sixth Form students whose aim is entrance into British and Commonwealth Universities or Technical Colleges. A knowledge of Pure Mathematics up to G.C.E. O-level is assumed and the subject is developed by a concentric treatment in which each new topic is used to illustrate ideas already treated. The major topics of Algebra, Calculus, Coordinate Geometry, and Trigonometry are developed together. This volume covers most of the Pure Mathematics required for t

  1. Many Forms of Culture

    Science.gov (United States)

    Cohen, Adam B.

    2009-01-01

    Psychologists interested in culture have focused primarily on East-West differences in individualism-collectivism, or independent-interdependent self-construal. As important as this dimension is, there are many other forms of culture with many dimensions of cultural variability. Selecting from among the many understudied cultures in psychology,…

  2. Sesotho Address Forms

    Directory of Open Access Journals (Sweden)

    Akindele, Dele Femi

    2008-01-01

    Full Text Available Address forms constitute an integral part of Basotho sociolinguistic etiquette. They are regarded as a kind of emotional capital that may be invested in putting others at ease. They are indicators of deference, politeness and markers of social distance. (Fasold 1990, Akindele 1990, 1991, 1993 This paper examines the address forms used by the Basotho people. It analyzes and discusses the various types and the factors determining their use. The discussion of address forms in Sesotho focuses on First Name, Title plus First Name, Title plus Last Name, Nickname, Multiple Names, and Teknonym. Drawing data from semi-literate and literate urban and rural population of Maseru district of Lesotho, it was found that the commonest form of address used by the Basotho people is title plus first name. e.g. ntate Thabo (father Thabo, 'm'e Puleng (mother Puleng, ausi Maneo (sister Maneo, abuti Mahao (brother Mahao. It is used by close relations, associates, and familiar people in both formal and informal situations.

  3. Documentary form no. 1

    International Nuclear Information System (INIS)

    2002-12-01

    This first documentary form, edited by the national association of local commissions of information about nuclear activities (ANCLI), briefly presents the radioactivity phenomenon, the ionising radiations, the characteristics of radiation sources (activity, half life, energy), and the dosimetry (absorbed, equivalent, efficient doses). (J.S.)

  4. Getting in-formed

    DEFF Research Database (Denmark)

    Hansbøl, Mikala

    Work-in-progress paper præsenteret ved PhD Seminar: Analytical strategies and methodologies for the study of virtual worlds at RUC. September 28th to October 1st 2009. I paperet diskuteres den dobbelte bevægelse at vi som forskere via vores undersøgelser bliver informeret og i samme moment putter...... det vi undersøger på form gennem vores beskrivelser. Paperet tager afsæt i empiriske eksempler fra et postdoc projekt om et såkaldt 'serious game' - Mingoville. Projektet følger circuleringer og etableringer af Mingoville 'på en global markedsplads'. I paperet diskuteres hvordan vi som forskere samler....../performer de fænomener vi forsker i. Aktør-Netværks-Teoretiker Bruno Latour (2005) pointerer at enhver beskrivelse også er en form for forklaring. En form for forklaring, der putter ting ind i et skript og dermed også putter ting på form. Paperet diskuterer to tilgange til at gøre serious games og derved skabe viden om...

  5. Manifolds admitting stable forms

    Czech Academy of Sciences Publication Activity Database

    Le, Hong-Van; Panák, Martin; Vanžura, Jiří

    2008-01-01

    Roč. 49, č. 1 (2008), s. 101-11 ISSN 0010-2628 R&D Projects: GA ČR(CZ) GP201/05/P088 Institutional research plan: CEZ:AV0Z10190503 Keywords : stable forms * automorphism groups Subject RIV: BA - General Mathematics

  6. Inequalities for Differential Forms

    CERN Document Server

    Agarwal, Ravi P

    2009-01-01

    Presents a series of local and global estimates and inequalities for differential forms, in particular the ones that satisfy the A-harmonic equations. This work focuses on the Hardy-Littlewood, Poincare, Cacciooli, imbedded and reverse Holder inequalities. It is for researchers, instructors and graduate students

  7. Metal forming and lubrication

    DEFF Research Database (Denmark)

    Bay, Niels

    2000-01-01

    Lubrication is essential in most metal forming processes. The lubricant film has two basic functions, [1]: i. to separate the work piece and tool surfaces and ii. to cool the workpiece and the tool. Separation of the two surfaces implies lower friction facilitating deformation and lowering the tool...

  8. Normalized cDNA libraries

    Science.gov (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  9. Biofilm Growth and Fossil Form

    Directory of Open Access Journals (Sweden)

    A. P. Petroff

    2013-11-01

    Full Text Available Stromatolites can grow under the influence of microbial processes, but it is often unclear whether and how the macroscopic morphology of these rocks records biological processes. Conical stromatolites, which formed in the absence of sedimentation, provide a comparatively simple record of the interplay between microbial growth and lithification. Here, we show that the dynamics shaping conical stromatolites result from diffusive gradients within the overlying microbial mat. These gradients cause minerals to precipitate faster in regions of high curvature, resulting in measurable properties of the shapes of stromatolite laminas. This model allows us to estimate the thickness of ancient stromatolite-forming mats to be approximately 1  mm, consistent with modern systems. Proceeding from the assumption that the ubiquitous process of diffusion is recorded in the translating form of a stromatolite, we derive the shape of a diffusion-driven stromatolite. The conical morphology—a distinctive feature of stromatolites growing in the absence of sedimentation—arises from these dynamics. This form is quantitatively consistent with the shape of conical stromatolites that grew for more than 2.9×10^{9} yrs of Earth history.

  10. Waste form development

    International Nuclear Information System (INIS)

    Neilson, R.M. Jr.; Colombo, P.

    1982-01-01

    In this program, contemporary solidification agents are being investigated relative to their applications to major fuel cycle and non-fuel cycle low-level waste (LLW) streams. Work is being conducted to determine the range of conditions under which these solidification agents can be applied to specific LLW streams. These studies are directed primarily towards defining operating parameters for both improved solidification of problem wastes and solidification of new LLW streams generated from advanced volume reduction technologies. Work is being conducted to measure relevant waste form properties. These data will be compiled and evaluated to demonstrate compliance with waste form performance and shallow land burial acceptance criteria and transportation requirements (both as they exist and as they are modified with time). 6 tables

  11. Formed HIP Can Processing

    Energy Technology Data Exchange (ETDEWEB)

    Clarke, Kester Diederik [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-07-27

    The intent of this report is to document a procedure used at LANL for HIP bonding aluminum cladding to U-10Mo fuel foils using a formed HIP can for the Domestic Reactor Conversion program in the NNSA Office of Material, Management and Minimization, and provide some details that may not have been published elsewhere. The HIP process is based on the procedures that have been used to develop the formed HIP can process, including the baseline process developed at Idaho National Laboratory (INL). The HIP bonding cladding process development is summarized in the listed references. Further iterations with Babcock & Wilcox (B&W) to refine the process to meet production and facility requirements is expected.

  12. Forms of Inattentiveness

    DEFF Research Database (Denmark)

    Knudsen, Morten

    2011-01-01

    and kept out of sight in the decision processes by looking at a specific case study involving the construction of a model intended to control, and render transparent, the quality of health services in Denmark. This paper outlines the forms of inattentiveness which make communication blind to information...... that could question the quality model. Five forms of inattentiveness are identified that function as answers to the question of how communication avoids actualizing relevant but also potentially destructive information. This study documents a considerable amount of blindness to potentially relevant themes...... effect of the categories applied. This paper puts forward a fourth type of organizational blindness in addition to the already documented ones, namely self-imposed blindness to potentially destructive information. This paper studies how relevant - but problematic - information is actively ignored...

  13. Differential forms of supermanifolds

    International Nuclear Information System (INIS)

    Beresin, P.A.

    1979-01-01

    The theory of differential and pseUdo-differential forms on supermanifolds is constructed. The definition and notations of superanalogy of the Pontryagin and Chern characteristic classes are given. The theory considered is purely local. The scheme suggested here generalizes the so-called Weil homomorphism for superspace which lays on the basis of the Chern and Potryagin characteristic class theory. The theory can be extended to the global supermanifolds

  14. Personal Information Request Form

    International Development Research Centre (IDRC) Digital Library (Canada)

    PC Forms Inc. 834-4048

    Request Form. Head Office / Siège : PO Box / CP 8500, Ottawa, ON, Canada K1G 3H9 www.idrc.ca www.crdi.ca. (150 Kent Street, Constitution Square / 150, rue Kent, Complexe Constitution Square). Phone / Tél. : 613-236-6163, ext./poste 2348 Fax / Téléc. : 613-565-8212 Email / Courriel : ATIP-AIPRP@idrc.ca. Privacy Act.

  15. Forms of Life

    Directory of Open Access Journals (Sweden)

    Peter Hacker

    2015-10-01

    Full Text Available The phrase ‘Lebensform’ (form of life had a long and varied history prior to Wittgenstein’s use of it on a mere three occasions in the Philosophical Investigations. It is not a pivotal concept in Wittgenstein’s philosophy. But it is a minor signpost of a major reorientation of philosophy, philosophy of language and logic, and philosophy of mathematics that Wittgenstein instigated. For Wittgenstein sought to replace the conception of a language as a meaning calculus (Frege, Russell, the Tractatus by an anthropological or ethnological conception. A language is not a class of sentences that can be formed from a set of axioms (definitions, formation and transformation rules and the meanings of which is given by their truth-conditions, but an open-ended series of interlocking language-games constituting a form of life or way of living (a culture. Wittgenstein’s uses of ‘Lebensform’ and its cognates, both in the Investigations and in his Nachlass are severally analysed, and various exegetical misinterpretations are clarified.

  16. Pion form factor in QCD

    International Nuclear Information System (INIS)

    Radyushkin, A.V.

    1980-01-01

    The calculation of the next-to-leading order corrections to pion form factor Fsub(π)(Q) in the QCD shows that analysis of Fsub(π)(Q) is not a short-distance problem up to Q 2 =10 4 -10 6 GeV 2 . A QCD-inspired model is proposed which in a semi-phenomenological way, takes into account the most important confinement effects. The curve obtained for Fsub(π)(Q) is in good agreement with existing experimental data

  17. D-Ser-containing humanin shows promotion of fibril formation.

    Science.gov (United States)

    Hayashi, Kanehiro; Sasabe, Jumpei; Chiba, Tomohiro; Aiso, Sadakazu; Utsunomiya-Tate, Naoko

    2012-06-01

    Humanin (HN), a peptide of 24 amino acid residues, suppresses the neuronal cell death that is induced by the gene products of Alzheimer's disease. HN contains two Ser residues at positions 7 and 14. Because the proportion of D-Ser isomerized from L-Ser in proteins appears to increase as cellular organs age, we explored the structural effects of the isomerization of each Ser residue in HN. By using a thioflavin-T assay to detect fibril formation, we found that an HN derivative that contained two isomerized D-Ser residues had a greater tendency to form fibrils than did wild-type HN or HNs containing single D-Ser residues. A previous report showed that HN containing two D-Ser residues exerts neuroprotective activity. Our data, therefore, suggest that the fibril formation by HN that contains two D-Ser residues may promote HN neuroprotective activity.

  18. Bipolar pulse forming line

    Science.gov (United States)

    Rhodes, Mark A.

    2008-10-21

    A bipolar pulse forming transmission line module for linear induction accelerators having first, second, third, fourth, and fifth planar conductors which form an interleaved stack with dielectric layers between the conductors. Each conductor has a first end, and a second end adjacent an acceleration axis. The first and second planar conductors are connected to each other at the second ends, the fourth and fifth planar conductors are connected to each other at the second ends, and the first and fifth planar conductors are connected to each other at the first ends via a shorting plate adjacent the first ends. The third planar conductor is electrically connectable to a high voltage source, and an internal switch functions to short a high voltage from the first end of the third planar conductor to the first end of the fourth planar conductor to produce a bipolar pulse at the acceleration axis with a zero net time integral. Improved access to the switch is enabled by an aperture through the shorting plate and the proximity of the aperture to the switch.

  19. Tomato Fruits Show Wide Phenomic Diversity but Fruit Developmental Genes Show Low Genomic Diversity.

    Directory of Open Access Journals (Sweden)

    Vijee Mohan

    Full Text Available Domestication of tomato has resulted in large diversity in fruit phenotypes. An intensive phenotyping of 127 tomato accessions from 20 countries revealed extensive morphological diversity in fruit traits. The diversity in fruit traits clustered the accessions into nine classes and identified certain promising lines having desirable traits pertaining to total soluble salts (TSS, carotenoids, ripening index, weight and shape. Factor analysis of the morphometric data from Tomato Analyzer showed that the fruit shape is a complex trait shared by several factors. The 100% variance between round and flat fruit shapes was explained by one discriminant function having a canonical correlation of 0.874 by stepwise discriminant analysis. A set of 10 genes (ACS2, COP1, CYC-B, RIN, MSH2, NAC-NOR, PHOT1, PHYA, PHYB and PSY1 involved in various plant developmental processes were screened for SNP polymorphism by EcoTILLING. The genetic diversity in these genes revealed a total of 36 non-synonymous and 18 synonymous changes leading to the identification of 28 haplotypes. The average frequency of polymorphism across the genes was 0.038/Kb. Significant negative Tajima'D statistic in two of the genes, ACS2 and PHOT1 indicated the presence of rare alleles in low frequency. Our study indicates that while there is low polymorphic diversity in the genes regulating plant development, the population shows wider phenotype diversity. Nonetheless, morphological and genetic diversity of the present collection can be further exploited as potential resources in future.

  20. Pion form factor

    Energy Technology Data Exchange (ETDEWEB)

    Ryong Ji, C.; Pang, A.; Szczepaniak, A. [North Carolina State Univ., Raleigh, NC (United States)

    1994-04-01

    It is pointed out that the correct criterion to define the legal PQCD contribution to the exclusive processes in the lightcone perturbative expansion should be based on the large off-shellness of the lightcone energy in the intermediate states. In the lightcone perturbative QCD calculation of the pion form factor, the authors find that the legal PQCD contribution defined by the lightcone energy cut saturates in the smaller Q{sup 2} region compared to that defined by the gluon four-momentum square cut. This is due to the contribution by the highly off-energy-shell gluons in the end point regions of the phase space, indicating that the gluon four-momentum-square cut may have cut too much to define the legal PQCD.

  1. Image forming apparatus

    DEFF Research Database (Denmark)

    2005-01-01

    An image H(x, y) for displaying a target image G(x, y) is displayed on a liquid-crystal display panel and illumination light from an illumination light source is made to pass therethrough to form an image on a PALSLM. Read light hv is radiated to the PALSLM and a phase-modulated light image alpha...... (x, y) read out of the PALSLM is subjected to Fourier transform by a lens. A phase contrast filter gives a predetermined phase shift to only the zero-order light component of Fourier light image alpha f(x, y). The phase-shifted light image is subjected to inverse Fourier transform by a lens...... characteristics of the illumination light source, PALSLM, and phase contrast filter, based on the evaluation result....

  2. ELEMENTAL FORMS OF HOSPITALITY

    Directory of Open Access Journals (Sweden)

    Maximiliano Emanuel Korstanje

    2010-11-01

    Full Text Available Modern studies emphasized on the needs of researching the hospitality as relevant aspects of tourism and hospitality fields. Anyway, these approaches are inextricably intertwined to the industry of tourism and do not take seriously the anthropological and sociological roots of hospitality. In fact, the hotel seems to be a partial sphere of hospitality at all. Under this context, the present paper explores the issue of hospitality enrooted in the political and economic indo-European principle of free-transit which is associated to a much broader origin.  Starting from the premise etymologically hostel and hospital share similar origins, we follow the contributions of J Derrida to determine the elements that formed the hospitality up to date.

  3. Le forme del fondo

    Directory of Open Access Journals (Sweden)

    Michel Maffesoli

    2004-12-01

    Full Text Available Non è vero che la natura ha paura del vuoto. Forse addirittura si completa. Il vuoto è anche una modalità dell'essere. È possibile nidificarvisi, avvolgersi pigramente e, così, proteggersi dall'angoscia del tempo che passa. Il vuoto delle apparenze è, in alcuni momenti, una delle forme d'espressione della vita sociale. Oltretutto occorre saperle riconoscere. Certamente, abbiamo tutti un'esistenza personale, ma siamo, ugualmente, i rappresentanti, a volte anche le vittime, di uno "spirito comune", forse anche di un "inconscio collettivo" che si è costituito di secolo in secolo. E, molto spesso, quando crediamo di esprimere le nostre idee, siamo soltanto dei portavoce, comparse di un vasto "theatrum mundi" dalle dimensioni infinite.

  4. Dimeric form of peroxynitrite

    Science.gov (United States)

    Simon, K. V.; Tulub, A. V.

    2009-07-01

    The (ONOO)- anion, known as peroxynitrite, is characterized by a singlet spin state. A new stable dimer form of peroxynitrite [NO-O2]- in the triplet state at distances close to r(O-N) ≈ 2.885 Å between oxygen in the O2 structure and nitrogen has been established within the quantum-chemical CASSCF approximation. The vibrational motion of the dimer is significantly anharmonic; for the 16O and 14N isotopes, the differences in the energies of two neighboring levels correspond to frequencies of about 70-30 cm-1. The triplet dimer structure retains stability in the case of interaction with water molecules. The activation barriers caused by rearrangement of the peroxynitrite structure into the ground state of the NO{3/-} anion with the symmetry D 3 h are found.

  5. Nucleon Electromagnetic Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    Marc Vanderhaeghen; Charles Perdrisat; Vina Punjabi

    2007-10-01

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has greatly improved by performing double polarization experiments, in comparison with previous unpolarized data. Here we review the experimental data base in view of the new results for the proton, and neutron, obtained at JLab, MAMI, and MIT-Bates. The rapid evolution of phenomenological models triggered by these high-precision experiments will be discussed, including the recent progress in the determination of the valence quark generalized parton distributions of the nucleon, as well as the steady rate of improvements made in the lattice QCD calculations.

  6. Moon (Form-Origin)

    Science.gov (United States)

    Tsiapas, Elias; Soumelidou, Despina; Tsiapas, Christos

    2017-04-01

    When the Earth was formed, it was in a state of burning heat. As time went by, temperature on the planet's surface was falling due to radiation and heat transfer, and various components (crusts) began taking solid form at the Earth's poles. The formation of crusts took place at the Earth's poles, because the stirring of burning and fluid masses on the surface of the Earth was significantly slighter there than it was on the equator. Due to centrifugal force and Coriolis Effect, these solid masses headed towards the equator; those originating from the North Pole followed a south-western course, while those originating from the South Pole followed a north-western course and there they rotated from west to east at a lower speed than the underlying burning and liquid earth, because of their lower initial linear velocity, their solid state and inertia. Because inertia is proportional to mass, the initially larger solid body swept all new solid ones, incorporating them to its western side. The density of the new solid masses was higher, because the components on the surface would freeze and solidify first, before the underlying thicker components. As a result, the western side of the initial islet of solid rocks submerged, while the east side elevated. . As a result of the above, this initial islet began to spin in reverse, and after taking on the shape of a sphere, it formed the "heart" of the Moon. The Moon-sphere, rolling on the equator, would sink the solid rocks that continued to descend from the Earth's poles. The sinking rocks partially melted because of higher temperatures in the greater depths that the Moon descended to, while part of the rocks' mass bonded with the Moon and also served as a heat-insulating material, preventing the descended side of the sphere from melting. Combined with the Earth's liquid mass that covered its emerging eastern surface, new sphere-shaped shells were created, with increased density and very powerful structural cohesion. During the

  7. Cavitation During Superplastic Forming

    Directory of Open Access Journals (Sweden)

    John Campbell

    2011-07-01

    Full Text Available Cavitation is the opening of pores during superplastic forming, typically at grain boundary triple points or on second phase grain boundary particles during slip of grain boundaries. Theories for the initiation of cavitation are reviewed. It seems that cavitation is unlikely to occur by processes intrinsic to metals such as dislocation mechanisms or point defect condensation. It is proposed that cavitation can only occur at non-bonded interfaces such as those introduced extrinsically (i.e., from the outside during the original casting of the metal. These defects, known as oxide bifilms, are naturally introduced during pouring of the liquid metal, and are frozen into the solid, often pushed by dendritic growth into grain boundaries where they are difficult to detect because of their extreme thinness, often measured in nanometres. Their unbonded central interface acts as a crack and can initiate cavitation. Second phase precipitates probably do not nucleate and grow on grain boundaries but grow on bifilms in the boundaries, explaining the apparent association between boundaries, second phase particles and failure initiation. Improved melting and casting techniques can provide metal with reduced or zero bifilm population for which cavitation would not be possible, promising significant improvements in superplastic behaviour.

  8. Les formes du fond

    Directory of Open Access Journals (Sweden)

    Michel Maffesoli

    2004-12-01

    Full Text Available Il n'est pas vrai que la nature a horreur du vide. Peut-être même s'y complait-elle. Le creux est aussi une modalité de l'être. Il est possible de s'y nicher, de s'y lover paresseusement et, ainsi, de se protéger contre l'angoisse du temps qui passe. Le creux des apparences est, à certains moments, une des formes d'expression de la vie sociale. Encore faut-il savoir le reconnaître. Certes, nous avons tous une existence personnelle, mais nous sommes, également, les représentants, parfois même les victimes, d'un "esprit commun", peut-être même d'un "inconscient collectif" qui s'est constitué de siècle en siècle. Et, très souvent, là où nous croyons exprimer nos propres idées, nous ne sommes que les porte-voix, les figurants d'un vaste "theatrum mundi" aux dimensions infinies.

  9. Image forming apparatus

    DEFF Research Database (Denmark)

    2005-01-01

    An image H(x, y) for displaying a target image G(x, y) is displayed on a liquid-crystal display panel and illumination light from an illumination light source is made to pass therethrough to form an image on a PALSLM. Read light hv is radiated to the PALSLM and a phase-modulated light image alpha...... (x, y) read out of the PALSLM is subjected to Fourier transform by a lens. A phase contrast filter gives a predetermined phase shift to only the zero-order light component of Fourier light image alpha f(x, y). The phase-shifted light image is subjected to inverse Fourier transform by a lens...... to project an output image O(x, y) to an output plane. A light image O'(x, y) branched by a beam sampler is picked up by a pickup device and an evaluation value calculating unit evaluates conformity between the image O(x, y) and the image G(x, y).; A control unit performs feedback control of optical...

  10. Bone marrow and tumor cell colony-forming units and human tumor xenograft efficacy of noncamptothecin and camptothecin topoisomerase I inhibitors.

    Science.gov (United States)

    Kurtzberg, Leslie S; Battle, Traci; Rouleau, Cecile; Bagley, Rebecca G; Agata, Naoki; Yao, Min; Schmid, Steven; Roth, Stephanie; Crawford, Jennifer; Krumbholz, Roy; Ewesuedo, Reginald; Yu, Xian-Jie; Wang, Fei; Lavoie, Edmond J; Teicher, Beverly A

    2008-10-01

    Topoisomerase I (TopoI), an established anticancer target, is an enzyme producing a single-strand DNA break during transcription. Several noncamptothecin TopoI inhibitors have been identified. One of these, ARC-111, was compared with two clinically used camptothecins, topotecan and irinotecan/SN-38. In mouse and human bone marrow colony formation [colony-forming units granulocyte-macrophage (CFU-GM)] assays, the IC(90) values were 519 and 331 nmol/L for topotecan and SN-38 mouse CFU-GM and were 19 and 26 nmol/L for human CFU-GM, giving mouse to human differentials of 28- and 13-fold. ARC-111 produced IC(90) values of 28 nmol/L in mouse and 6.2 nmol/L in human CFU-GM, thus only a 4.5-fold differential between species. Human bone marrow CFU-GM was more sensitive to topotecan than were several human cancer cell lines, but ARC-111 cytotoxicity was similar for human bone marrow CFU-GM and the seven human tumor cell lines tested. In HCT-116 xenografts, tumor growth delays (TGD) were 17 days for irinotecan and 20 days for ARC-111. In HT-29 xenografts, the TGD was 9 days for both irinotecan and ARC-111. Both ARC-111 and docetaxel had a TGD of 21 days in NCI-H460 xenografts, and both ARC-111 and gemcitabine had a TGD of 7 days in MiaPaCa2 xenograft. Current TopoI inhibitors have broad antitumor activity in human tumor xenografts that is not achieved in the clinic. This may be due to greater sensitivity of human bone marrow than mouse to the cytotoxicity of these agents. It may be possible to achieve similar levels of ARC-111 in patients as in mice allowing improved antitumor activity.

  11. Torsional regulation of hRPA-induced unwinding of double-stranded DNA

    NARCIS (Netherlands)

    De Vlaminck, I.; Vidic, I.; Van Loenhout, M.T.J.; Kanaar, R.; Lebbink, J.H.G.; Dekker, C.

    2010-01-01

    All cellular single-stranded (ss) DNA is rapidly bound and stabilized by single stranded DNA-binding proteins (SSBs). Replication protein A, the main eukaryotic SSB, is able to unwind double-stranded (ds) DNA by binding and stabilizing transiently forming bubbles of ssDNA. Here, we study the

  12. Forms of War

    International Nuclear Information System (INIS)

    Vogel, H.; Bartelt, D.

    2007-01-01

    Purpose: Under war conditions, employed weapons can be identified on radiographs obtained in X-ray diagnostic. The analysis of such X-ray films allows concluding that there are additional information about the conditions of transport and treatment; it shall be shown that there are X-ray findings which are typical and characteristic for certain forms of warfare. Material and method: The radiograms have been collected during thirty years; they come from hospitals, where war casualties had been treated, and personal collections. Results: The material is selected, because in war X-ray diagnostic will be limited and the interest of the opposing parties influence the access to the material; furthermore the possibilities to publish or to communicate facts and thoughts are different. Citizens of the USA, GB, France, or Israel will have easier access to journals than those of Vietnam, Chad, and Zimbabwe. Under war conditions, poor countries, like North Vietnam may develop own concepts of medical care. There are X-ray findings which are typical or even characteristic for air warfare, guerrilla warfare, gas war, desert warfare, conventional warfare, and annihilation warfare, and city guerrilla warfare/civil war. The examples demonstrate that weapons and the conditions of transport and treatment can be recognized by X-ray findings. The radiogram can be read like a document. Conclusion: In War, there are differences between a treatment and imaging diagnostic in countries, which control the air space and in those who do not. Medical care of the poor, i.e. in countries (in general those opposing the western nations) will hardly be published, and poverty has no advocate

  13. How Do Atmospheric Rivers Form?

    Science.gov (United States)

    Dacre, H.; Martinez-Alvarado, O.; Clark, P. A.; Stringer, M. A.; Lavers, D.

    2017-12-01

    The term "atmospheric river" is used to describe corridors of strong water vapor transport in the troposphere. Filaments of enhanced water vapor, commonly observed in satellite imagery extending from the subtropics to the extratropics, are routinely used as a proxy for identifying these regions of strong water vapor transport. The precipitation associated with these filaments of enhanced water vapor can lead to high-impact flooding events. However, there remains some debate as to how these filaments form. In this study, the authors analyze the transport of water vapor within a climatology of wintertime North Atlantic extratropical cyclones. Results show that atmospheric rivers are formed by the cold front that sweeps up water vapor in the warm sector as it catches up with the warm front. This causes a narrow band of high water vapor content to form ahead of the cold front at the base of the warm conveyor belt airflow. Thus, water vapor in the cyclone's warm sector, not long-distance transport of water vapor from the subtropics, is responsible for the generation of filaments of high water vapor content. A continuous cycle of evaporation and moisture convergence within the cyclone replenishes water vapor lost via precipitation. Thus, rather than representing a direct and continuous feed of moist air from the subtropics into the center of a cyclone (as suggested by the term "atmospheric river"), these filaments are, in fact, the result of water vapor exported from the cyclone, and thus they represent the footprints left behind as cyclones travel poleward from the subtropics.

  14. Temporal form in interaction design

    DEFF Research Database (Denmark)

    Vallgårda, Anna; Winther, Morten Trøstrup; Mørch, Nina

    2015-01-01

    Interaction design is distinguished from most other design disciplines through its temporal form. Temporal form is the computational structure that enables and demands a temporal expression in the resulting design. Temporal form is what enables poetry. In music, temporal form is the composition o...

  15. Special Geometry and Automorphic Forms

    CERN Document Server

    Berglund, P; Wyllard, N; Berglund, Per; Henningson, Mans; Wyllard, Niclas

    1997-01-01

    We consider special geometry of the vector multiplet moduli space in compactifications of the heterotic string on $K3 \\times T^2$ or the type IIA string on $K3$-fibered Calabi-Yau threefolds. In particular, we construct a modified dilaton that is invariant under $SO(2, n; Z)$ T-duality transformations at the non-perturbative level and regular everywhere on the moduli space. The invariant dilaton, together with a set of other coordinates that transform covariantly under $SO(2, n; Z)$, parameterize the moduli space. The construction involves a meromorphic automorphic function of $SO(2, n; Z)$, that also depends on the invariant dilaton. In the weak coupling limit, the divisor of this automorphic form is an integer linear combination of the rational quadratic divisors where the gauge symmetry is enhanced classically. We also show how the non-perturbative prepotential can be expressed in terms of meromorphic automorphic forms, by expanding a T-duality invariant quantity both in terms of the standard special coord...

  16. Association of in vitro radiosensitivity and cancer in a family with acute myelogenous leukemia

    International Nuclear Information System (INIS)

    Bech-Hansen, N.T.; Sell, B.M.; Mulvihill, J.J.; Paterson, M.C.

    1981-01-01

    The γ-ray sensitivity of skin fibroblasts from six members of a cancer family was investigated using a colony-forming assay. Fibroblasts from the three members with cancer (two sisters with acute myelogenous leukemia and the mother with cervical carcinoma) showed a significant ( p > 0.05) increase in radiosensitivity, while three members without cancer (the father and two sons) showed a normal radioresponse. The possiblity that the increased γ-ray sensitivity was due to defective DNA repair was investigated using assays for DNA repair replication, single-strand break rejoining, and removal of enzyme-sensitive sites in γ-irradiated DNA. Results of these assays indicate that the kinetics of enzymatic repair of radiogenic DNA damage in general, and the rejoining of single-strand scissions and excision repair of base and sugar radioproducts in partigular, were the same in the cell lines from the sensitive and clinically normal family members

  17. Forms and Linear Network Codes

    DEFF Research Database (Denmark)

    Hansen, Johan P.

    We present a general theory to obtain linear network codes utilizing forms and obtain explicit families of equidimensional vector spaces, in which any pair of distinct vector spaces intersect in the same small dimension. The theory is inspired by the methods of the author utilizing the osculating...... spaces of Veronese varieties. Linear network coding transmits information in terms of a basis of a vector space and the information is received as a basis of a possibly altered vector space. Ralf Koetter and Frank R. Kschischang introduced a metric on the set af vector spaces and showed that a minimal...... distance decoder for this metric achieves correct decoding if the dimension of the intersection of the transmitted and received vector space is sufficiently large. The vector spaces in our construction are equidistant in the above metric and the distance between any pair of vector spaces is large making...

  18. Prestin shows divergent evolution between constant frequency echolocating bats.

    Science.gov (United States)

    Shen, Bin; Avila-Flores, Rafael; Liu, Yang; Rossiter, Stephen J; Zhang, Shuyi

    2011-10-01

    The gene Prestin encodes a motor protein that is thought to confer the high-frequency sensitivity and selectivity that characterizes the mammalian auditory system. Recent research shows that the Prestin gene has undergone a burst of positive selection on the ancestral branch of the Old World horseshoe and leaf-nosed bats (Rhinolophidae and Hipposideridae, respectively), and also on the branch leading to echolocating cetaceans. Moreover, these two groups share a large number of convergent amino acid sequence replacements. Horseshoe and leaf-nosed bats exhibit narrowband echolocation, in which the emitted calls are based on the second harmonic of a predominantly constant frequency (CF) component, the frequency of which is also over-represented in the cochlea. This highly specialized form of echolocation has also evolved independently in the neotropical Parnell's mustached bat (Pteronotus parnellii). To test whether the convergent evolution of CF echolocation between lineages has arisen from common changes in the Prestin gene, we sequenced the Prestin coding region (~2,212 bp, >99% coverage) in P. parnellii and several related species that use broadband echolocation calls. Our reconstructed Prestin gene tree and amino acid tree showed that P. parnellii did not group together with Old World horseshoe and leaf-nosed bats, but rather clustered within its true sister species. Comparisons of sequences confirmed that P. parnellii shared most amino acid changes with its congeners, and we found no evidence of positive selection in the branch leading to the genus of Pteronotus. Our result suggests that the adaptive changes seen in Prestin in horseshoe and leaf-nosed bats are not necessary for CF echolocation in P. parnellii.

  19. Serotonin transporter knockout rats show improved strategy set-shifting and reduced latent inhibition

    NARCIS (Netherlands)

    Nonkes, L.J.P.; Vondervoort, I.I.G.M. van de; Leeuw, M.J.C. de; Wijlaars, L.P.; Maes, J.H.R.; Homberg, J.R.

    2012-01-01

    Behavioral flexibility is a cognitive process depending on prefrontal areas allowing adaptive responses to environmental changes. Serotonin transporter knockout (5-HTT−/−) rodents show improved reversal learning in addition to orbitofrontal cortex changes. Another form of behavioral flexibility,

  20. Serotonin transporter knockout rats show improved strategy set-shifting and reduced latent inhibition.

    NARCIS (Netherlands)

    Nonkes, L.J.P.; Vondervoort, I.I. van de; Leeuw, M.J. de; Wijlaars, L.P.; Maes, J.H.; Homberg, J.R.

    2012-01-01

    Behavioral flexibility is a cognitive process depending on prefrontal areas allowing adaptive responses to environmental changes. Serotonin transporter knockout (5-HTT(-/-)) rodents show improved reversal learning in addition to orbitofrontal cortex changes. Another form of behavioral flexibility,

  1. Limonene hydroperoxide analogues show specific patch test reactions.

    Science.gov (United States)

    Christensson, Johanna Bråred; Hellsén, Staffan; Börje, Anna; Karlberg, Ann-Therese

    2014-05-01

    The fragrance terpene R-limonene is a very weak sensitizer, but forms allergenic oxidation products upon contact with air. The primary oxidation products of oxidized limonene, the hydroperoxides, have an important impact on the sensitizing potency of the oxidation mixture. One analogue, limonene-1-hydroperoxide, was experimentally shown to be a significantly more potent sensitizer than limonene-2-hydroperoxide in the local lymph node assay with non-pooled lymph nodes. To investigate the pattern of reactivity among consecutive dermatitis patients to two structurally closely related limonene hydroperoxides, limonene-1-hydroperoxide and limonene-2-hydroperoxide. Limonene-1-hydroperoxide, limonene-2-hydroperoxide, at 0.5% in petrolatum, and oxidized limonene 3.0% pet. were tested in 763 consecutive dermatitis patients. Of the tested materials, limonene-1-hydroperoxide gave most reactions, with 2.4% of the patients showing positive patch test reactions. Limonene-2-hydroperoxide and oxidized R-limonene gave 1.7% and 1.2% positive patch test reactions, respectively. Concomitant positive patch test reactions to other fragrance markers in the baseline series were frequently noted. The results are in accordance with the experimental studies, as limonene-1-hydroperoxide gave more positive patch test reactions in the tested patients than limonene-2-hydroperoxide. Furthermore, the results support the specificity of the allergenic activity of the limonene hydroperoxide analogues and the importance of oxidized limonene as a cause of contact allergy. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Experimental taphonomy shows the feasibility of fossil embryos.

    Science.gov (United States)

    Raff, Elizabeth C; Villinski, Jeffrey T; Turner, F Rudolf; Donoghue, Philip C J; Raff, Rudolf A

    2006-04-11

    The recent discovery of apparent fossils of embryos contemporaneous with the earliest animal remains may provide vital insights into the metazoan radiation. However, although the putative fossil remains are similar to modern marine animal embryos or larvae, their simple geometric forms also resemble other organic and inorganic structures. The potential for fossilization of animals at such developmental stages and the taphonomic processes that might affect preservation before mineralization have not been examined. Here, we report experimental taphonomy of marine embryos and larvae similar in size and inferred cleavage mode to presumptive fossil embryos. Under conditions that prevent autolysis, embryos within the fertilization envelope can be preserved with good morphology for sufficiently long periods for mineralization to occur. The reported fossil record exhibits size bias, but we show that embryo size is unlikely to be a major factor in preservation. Under some conditions of death, fossilized remains will not accurately reflect the cell structure of the living organism. Although embryos within the fertilization envelope have high preservation potential, primary larvae have negligible preservation potential. Thus the paleo-embryological record may have strong biases on developmental stages preserved. Our data provide a predictive basis for interpreting the fossil record to unravel the evolution of ontogeny in the origin of metazoans.

  3. The Analysis of Forming Forces in Single Point Incremental Forming

    Directory of Open Access Journals (Sweden)

    Koh Kyung Hee

    2016-01-01

    Full Text Available Incremental forming is a process to produce sheet metal parts in quick. Because there is no need for dedicated dies and molds, this process is less cost and time spent. The purpose of this study is to investigate forming forces in single point incremental forming. Producing a cone frustum of aluminum is tested for forming forces. A dynamometer is used to collect forming forces and analyze them. These forces are compared with cutting forces upon producing same geometrical shapes of experimental parts. The forming forces in Z direction are 40 times larger than the machining forces. A spindle and its axis of a forming machine should be designed enough to withstand the forming forces.

  4. Estimation of uranium forms in oceanic water

    International Nuclear Information System (INIS)

    Krylov, O.T.; Novikov, P.D.; Nesterova, M.P.

    1985-01-01

    A critical consideration is given to the notions about uranium forms in ocean water. To estimate uranium forms a model is suggested which takes into account possjble formation of complexes of uranyl ions and ocean water anions Cl - , SO 4 2- , CO 3 2- , HCO 3 - , OH - , F - . The available published data are used to estimate necessary thermodynamic stability constants of the complexes, activity coefficients and concentration of componenets. The thermodynamic calculation shows that uranium hydroxocomplex compounds UO 2 (OH) 4 2- (99.17%) and UO 2 (OH) 3 - (083%) are the most probable uranium forms in ocear water of 34.3% salinity at 25 deg C and 1 atm pressure

  5. Low temperature waste form process intensification

    Energy Technology Data Exchange (ETDEWEB)

    Fox, K. M. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Cozzi, A. D. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Hansen, E. K. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Hill, K. A. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2015-09-30

    This study successfully demonstrated process intensification of low temperature waste form production. Modifications were made to the dry blend composition to enable a 50% increase in waste concentration, thus allowing for a significant reduction in disposal volume and associated costs. Properties measurements showed that the advanced waste form can be produced using existing equipment and processes. Performance of the waste form was equivalent or better than the current baseline, with approximately double the amount of waste incorporation. The results demonstrate the feasibility of significantly accelerating low level waste immobilization missions across the DOE complex and at environmental remediation sites worldwide.

  6. Advances in metal forming expert system for metal forming

    CERN Document Server

    Hingole, Rahulkumar Shivajirao

    2015-01-01

    This comprehensive book offers a clear account of the theory and applications of advanced metal forming. It provides a detailed discussion of specific forming processes, such as deep drawing, rolling, bending extrusion and stamping. The author highlights recent developments of metal forming technologies and explains sound, new and powerful expert system techniques for solving advanced engineering problems in metal forming. In addition, the basics of expert systems, their importance and applications to metal forming processes, computer-aided analysis of metalworking processes, formability analysis, mathematical modeling and case studies of individual processes are presented.

  7. Mathematical ratio in defining arch form

    Directory of Open Access Journals (Sweden)

    Johan A Budiman

    2017-01-01

    Full Text Available Introduction: The treatment of Class I malocclusion aims to arrange teeth position in a good arch form. The arch form consists of tooth size and arch dimension (intercanine width, canine depth, intermolar width, molar depth. Numerous methods have been used to describe the arch form quantitatively. The aim of this study was to develop a mathematical ratio for identifying arch form (square, oval, tapered using arch dimension variables (intercanine width, canine depth, intermolar width, molar depth. Materials and Methods: Dental cast pre and post-orthodontic treatments from 190 Indonesian patients were scanned to obtain digital data. All data were measured using “Image Tool.” The measured data (tooth size, intercanine width, intercanine depth, intermolar width, intermolar depth, and arch perimeter were analyzed statistically using ordered logistic to find out determining variables to the arch form. Results: The validity, reliability, and normality of all the data were analyzed using Stata. From analyzing the data using ordered logistic, intercanine width and intermolar depth showed a reverse relation to the arch form. The shape of the arch form (square, oval, and tapered can be described quantitatively by using ratio (CD/CW/(MD/MW; a ratio less than 45.30% indicates square, 45.30–53.37% indicates oval, and more than 53.37% indicates tapered. Conclusions: (CD/CW/(MD/MW ratio can be used to describe arch form quantitatively.

  8. Tectonics: The meaning of form

    DEFF Research Database (Denmark)

    Christiansen, Karl; Brandt, Per Aage

    Tectonics – The meaning of form deals with one of the core topics of architecture: the relationship between form and content. In the world of architecture, form is not only made from brick, glass and wood. Form means something. When a material is processed with sufficient technical skill and insi......Tectonics – The meaning of form deals with one of the core topics of architecture: the relationship between form and content. In the world of architecture, form is not only made from brick, glass and wood. Form means something. When a material is processed with sufficient technical skill...... perspectives. You can read the chapters in any order you like – from the beginning, end or the middle. There is no correct order. The project is methodologically inductive: the more essays you read, the broader your knowledge of tectonics get....

  9. Adaptive Municipal e-forms

    NARCIS (Netherlands)

    Kuiper, P.M.; van Dijk, Elisabeth M.A.G.; Boerma, A.K.; Weibelzahl, S.; Cristea, A.

    2006-01-01

    Adaptation of electronic forms seems to be a step forward to reduce the burden for people who fill in forms. Municipalities more and more offer eforms online that can be used to request a municipal product or service. To create adaptive e-forms that satisfy the need of end-users, involvement of

  10. Role of pH controlled DNA secondary structures in the reversible dispersion/precipitation and separation of metallic and semiconducting single-walled carbon nanotubes.

    Science.gov (United States)

    Maji, Basudeb; Samanta, Suman K; Bhattacharya, Santanu

    2014-04-07

    Single-stranded DNA (ss-DNA) oligomers (dA20, d[(C3TA2)3C3] or dT20) are able to disperse single-walled carbon nanotubes (SWNTs) in water at pH 7 through non-covalent wrapping on the nanotube surface. At lower pH, an alteration of the DNA secondary structure leads to precipitation of the SWNTs from the dispersion. The structural change of dA20 takes place from the single-stranded to the A-motif form at pH 3.5 while in case of d[(C3TA2)3C3] the change occurs from the single-stranded to the i-motif form at pH 5. Due to this structural change, the DNA is no longer able to bind the nanotube and hence the SWNT precipitates from its well-dispersed state. However, this could be reversed on restoring the pH to 7, where the DNA again relaxes in the single-stranded form. In this way the dispersion and precipitation process could be repeated over and over again. Variable temperature UV-Vis-NIR and CD spectroscopy studies showed that the DNA-SWNT complexes were thermally stable even at ∼90 °C at pH 7. Broadband NIR laser (1064 nm) irradiation also demonstrated the stability of the DNA-SWNT complex against local heating introduced through excitation of the carbon nanotubes. Electrophoretic mobility shift assay confirmed the formation of a stable DNA-SWNT complex at pH 7 and also the generation of DNA secondary structures (A/i-motif) upon acidification. The interactions of ss-DNA with SWNTs cause debundling of the nanotubes from its assembly. Selective affinity of the semiconducting SWNTs towards DNA than the metallic ones enables separation of the two as evident from spectroscopic as well as electrical conductivity studies.

  11. Measuring the Thermophysical and Structural Properties of Glass-Forming and Quasicrystal-Forming Liquids

    Science.gov (United States)

    Hyers, Robert W.; Bradshaw, Richard C.; Rogers, Jan R.; Gangopadhyay, Anup K.; Kelton, Ken F.

    2006-01-01

    The thermophysical properties of glass-forming and quasicrystal-forming alloys show many interesting features in the undercooled liquid range. Some of the features in the thermophysical property curves are expected to reflect changes in the structure and coordination of the liquid. These measurements require containerless processing such as electrostatic levitation to access the undercooled liquid regime. An overview of the state of the art in measuring the thermophysical properties and structure of undercooled liquid glass-forming and quasicrystal-forming alloys will be presented, along with the status of current measurements.

  12. P-nflation: generating cosmic Inflation with p-forms

    Energy Technology Data Exchange (ETDEWEB)

    Germani, Cristiano [LUTH, Observatoire de Paris, CNRS UMR 8102, Universite Paris Diderot, 5 Place Jules Janssen, 92195 Meudon Cedex (France); Kehagias, Alex, E-mail: cristiano.germani@obspm.fr, E-mail: kehagias@central.ntua.gr [Department of Physics, National Technical University of Athens, GR-15773, Zografou, Athens (Greece)

    2009-03-15

    We show that an inflationary background might be realized by using any p-form non-minimally coupled to gravity. Standard scalar field inflation corresponds to the 0-form case and vector inflation to the 1-form. Moreover, we show that the 2- and 3-form fields are dual to a new vector and scalar inflationary theories where the kinetic terms are non-minimally coupled to gravity.

  13. 33 CFR 100.736 - Annual Fort Myers Beach air show; Fort Myers Beach, FL.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Annual Fort Myers Beach air show; Fort Myers Beach, FL. 100.736 Section 100.736 Navigation and Navigable Waters COAST GUARD, DEPARTMENT... Fort Myers Beach air show; Fort Myers Beach, FL. (a)(1) Regulated Area. The regulated area is formed by...

  14. Droplet networks with incorporated protein diodes show collective properties

    Science.gov (United States)

    Maglia, Giovanni; Heron, Andrew J.; Hwang, William L.; Holden, Matthew A.; Mikhailova, Ellina; Li, Qiuhong; Cheley, Stephen; Bayley, Hagan

    2009-07-01

    Recently, we demonstrated that submicrolitre aqueous droplets submerged in an apolar liquid containing lipid can be tightly connected by means of lipid bilayers to form networks. Droplet interface bilayers have been used for rapid screening of membrane proteins and to form asymmetric bilayers with which to examine the fundamental properties of channels and pores. Networks, meanwhile, have been used to form microscale batteries and to detect light. Here, we develop an engineered protein pore with diode-like properties that can be incorporated into droplet interface bilayers in droplet networks to form devices with electrical properties including those of a current limiter, a half-wave rectifier and a full-wave rectifier. The droplet approach, which uses unsophisticated components (oil, lipid, salt water and a simple pore), can therefore be used to create multidroplet networks with collective properties that cannot be produced by droplet pairs.

  15. Dry lubricant films for aluminum forming.

    Energy Technology Data Exchange (ETDEWEB)

    Wei, J.; Erdemir, A.; Fenske, G. R.

    1999-03-30

    During metal forming process, lubricants are crucial to prevent direct contact, adhesion, transfer and scuffing of workpiece materials and tools. Boric acid films can be firmly adhered to the clean aluminum surfaces by spraying their methanol solutions and provide extremely low friction coefficient (about 0.04). The cohesion strengths of the bonded films vary with the types of aluminum alloys (6061, 6111 and 5754). The sheet metal forming tests indicate that boric acid films and the combined films of boric acid and mineral oil can create larger strains than the commercial liquid and solid lubricants, showing that they possess excellent lubricities for aluminum forming. SEM analyses indicate that boric acid dry films separate the workpiece and die materials, and prevent their direct contact and preserve their surface qualities. Since boric acid is non-toxic and easily removed by water, it can be expected that boric acid films are environmentally friendly, cost effective and very efficient lubricants for sheet aluminum cold forming.

  16. [Oral films as perspective dosage form].

    Science.gov (United States)

    Walicová, Veronika; Gajdziok, Jan

    Oral films, namely buccal mucoadhesive films and orodispersible films represent innovative formulations for administration of a wide range of drugs. Oral films show many advantageous properties and are intended for systemic drug delivery or for local treatment of the oral mucosa. In both cases, the film represents a thin layer, which could be intended to adhere to the oral mucosa by means of mucoadhesion; or to rapid dissolution and subsequent swallowing without the need of liquid intake, in the case of orodispersible films. Main constitutive excipients are film-forming polymers, which must in the case of mucoadhesive forms remain on the mucosa within the required time interval. Oral films are currently available on the pharmaceutical market and could compete with conventional oral dosage forms in the future. oral cavity oral films buccal mucoadhesive films orodispersible films film-forming polymers.

  17. Make Projects Small Form Factor PCs

    CERN Document Server

    Wessels, Duane

    2006-01-01

    Shoebox sized and smaller, small-form-factor PCs can pack as much computing muscle as a full-sized desktop computer. They consumer less power, have few or no moving parts, and are very quiet. Whether you plan to use one as a standalone PC or want to embed it in your next hacking project, a small-form-factor PC can be a lot of fun to build. Make Projects: Small Form Factor PCs is the only book available that shows you how to build small-form-factor PCs -- from kits and from scratch -- that are more interesting and more personalized than what a full-sized PC can give you. Included in the book

  18. Timeability in Extensive-Form Games

    DEFF Research Database (Denmark)

    Jakobsen, Sune K.; Sørensen, Troels Bjerre; Conitzer, Vincent

    2016-01-01

    Extensive-form games constitute the standard representation scheme for games with a temporal component. But do all extensive-form games correspond to protocols that we can implement in the real world? We often rule out games with imperfect recall, which prescribe that an agent forget something...... that she knew before. In this paper, we show that even some games with perfect recall can be problematic to implement. Specifically, we show that if the agents have a sense of time passing (say, access to a clock), then some extensive-form games can no longer be implemented; no matter how we attempt...... to time the game, some information will leak to the agents that they are not supposed to have. We say such a game is not exactly timeable. We provide easy-to-check necessary and sufficient conditions for a game to be exactly timeable. Most of the technical depth of the paper concerns how to approximately...

  19. Harmony of super form factors

    Science.gov (United States)

    Brandhuber, A.; Gürdoğan, Ö.; Mooney, R.; Travaglini, G.; Yang, G.

    2011-10-01

    In this paper we continue our systematic study of form factors of half-BPS operators in mathcal{N} = 4 super Yang-Mills. In particular, we extend various on-shell techniques known for amplitudes to the case of form factors, including MHV rules, recursion relations, unitarity and dual MHV rules. As an application, we present the solution of the recursion relation for split-helicity form factors. We then consider form factors of the stress-tensor multiplet operator and of its chiral truncation, and write down supersymmetric Ward identities using chiral as well as non-chiral superspace formalisms. This allows us to obtain compact formulae for families of form factors, such as the maximally non-MHV case. Finally we generalise dual MHV rules in dual momentum space to form factors.

  20. FormTracer. A mathematica tracing package using FORM

    Science.gov (United States)

    Cyrol, Anton K.; Mitter, Mario; Strodthoff, Nils

    2017-10-01

    We present FormTracer, a high-performance, general purpose, easy-to-use Mathematica tracing package which uses FORM. It supports arbitrary space and spinor dimensions as well as an arbitrary number of simple compact Lie groups. While keeping the usability of the Mathematica interface, it relies on the efficiency of FORM. An additional performance gain is achieved by a decomposition algorithm that avoids redundant traces in the product tensors spaces. FormTracer supports a wide range of syntaxes which endows it with a high flexibility. Mathematica notebooks that automatically install the package and guide the user through performing standard traces in space-time, spinor and gauge-group spaces are provided. Program Files doi:http://dx.doi.org/10.17632/7rd29h4p3m.1 Licensing provisions: GPLv3 Programming language: Mathematica and FORM Nature of problem: Efficiently compute traces of large expressions Solution method: The expression to be traced is decomposed into its subspaces by a recursive Mathematica expansion algorithm. The result is subsequently translated to a FORM script that takes the traces. After FORM is executed, the final result is either imported into Mathematica or exported as optimized C/C++/Fortran code. Unusual features: The outstanding features of FormTracer are the simple interface, the capability to efficiently handle an arbitrary number of Lie groups in addition to Dirac and Lorentz tensors, and a customizable input-syntax.