WorldWideScience

Sample records for single-stranded dna-dependent atpase

  1. Isolation and characterization of DNA-dependent ATPases from the Novikoff Hepatoma

    International Nuclear Information System (INIS)

    Thomas, D.C.

    1984-01-01

    Four DNA-dependent ATPases have been purified to apparent homogeneity from extracts of the Novikoff Hepatoma, and named ATPases II, III, IV, and V. The physical and enzymological properties of ATPases II, III, and V are nearly identical, and from tryptic peptide mapping these proteins were determined to be related, though they are still chromatographically distinct; all appear to be dimers. ATPaseIV is unique among the ATPases, and is probably a monomer. ATPase V appears much more stable to thermal inactivation than the similar curves generated by ATPases II, and III. ATPase IV, however, projects of a heat-inactivation curve intermediate to these two types. ATPase II is labelled to a much higher degree than the others when treated with a heterologous protein kinase using gamma-[ 32 P]-ATP. When ATPase II was treated with this kinase, and subsequently run over a DNA-cellulose column, the profile of ATPase II was found to contain small peaks of activity in the positions where ATPases III and V normally elute, suggesting that ATPase II may be a dephosphorylated form of the other two. The ATPases have been extensively characterized with respect to reaction products and requirements, substrate utilization, DNA effector requirements, and effects of ATP analogs

  2. Characterization of a bacteriophage T4 mutant lacking DNA-dependent ATPase

    International Nuclear Information System (INIS)

    Behme, M.T.; Ebisuzaki, K.

    1975-01-01

    A DNA-dependent ATPase has previously been purified from bacteriophage T4-infected Escherichia coli. A mutant phage strain lacking this enzyme has been isolated and characterized. Although the mutant strain produced no detectable DNA-dependent ATPase, growth properties were not affected. Burst sizes were similar for the mutant phage and T4D in polAl, recB, recC, uvrA, uvrB, uvrC, and various DNA-negative E. coli. UV sensitivity and genetic recombination were normal in a variety of E. coli hosts. Mapping data indicate that the genetic locus controlling the mutant occurs near gene 56. The nonessential nature of this gene is discussed

  3. Bacterial transformation: ComFA is a DNA-dependent ATPase that forms complexes with ComFC and DprA.

    Science.gov (United States)

    Diallo, Amy; Foster, Hannah R; Gromek, Katarzyna A; Perry, Thomas N; Dujeancourt, Annick; Krasteva, Petya V; Gubellini, Francesca; Falbel, Tanya G; Burton, Briana M; Fronzes, Rémi

    2017-09-01

    Pneumococcal natural transformation contributes to genomic plasticity, antibiotic resistance development and vaccine escape. Streptococcus pneumoniae, like many other naturally transformable species, has evolved sophisticated protein machinery for the binding and uptake of DNA. Two proteins encoded by the comF operon, ComFA and ComFC, are involved in transformation but their exact molecular roles remain unknown. In this study, we provide experimental evidence that ComFA binds to single stranded DNA (ssDNA) and has ssDNA-dependent ATPase activity. We show that both ComFA and ComFC are essential for the transformation process in pneumococci. Moreover, we show that these proteins interact with each other and with other proteins involved in homologous recombination, such as DprA, thus placing the ComFA-ComFC duo at the interface between DNA uptake and DNA recombination during transformation. © 2017 John Wiley & Sons Ltd.

  4. Mycobacterium smegmatis SftH exemplifies a distinctive clade of superfamily II DNA-dependent ATPases with 3' to 5' translocase and helicase activities.

    Science.gov (United States)

    Yakovleva, Lyudmila; Shuman, Stewart

    2012-08-01

    Bacterial DNA helicases are nucleic acid-dependent NTPases that play important roles in DNA replication, recombination and repair. We are interested in the DNA helicases of Mycobacteria, a genus of the phylum Actinobacteria, which includes the human pathogen Mycobacterium tuberculosis and its avirulent relative Mycobacterium smegmatis. Here, we identify and characterize M. smegmatis SftH, a superfamily II helicase with a distinctive domain structure, comprising an N-terminal NTPase domain and a C-terminal DUF1998 domain (containing a putative tetracysteine metal-binding motif). We show that SftH is a monomeric DNA-dependent ATPase/dATPase that translocates 3' to 5' on single-stranded DNA and has 3' to 5' helicase activity. SftH homologs are found in bacteria representing 12 different phyla, being especially prevalent in Actinobacteria (including M. tuberculosis). SftH homologs are evident in more than 30 genera of Archaea. Among eukarya, SftH homologs are present in plants and fungi.

  5. Structural insights into the cryptic DNA-dependent ATPase activity of UvrB.

    Science.gov (United States)

    Eryilmaz, Jitka; Ceschini, Simona; Ryan, James; Geddes, Stella; Waters, Timothy R; Barrett, Tracey E

    2006-03-17

    The UvrABC pathway is a ubiquitously occurring mechanism targeted towards the repair of bulky base damage. Key to this process is UvrB, a DNA-dependent limited helicase that acts as a lesion recognition element whilst part of a tracking complex involving UvrA, and as a DNA-binding platform required for the presentation of damage to UvrC for subsequent processing. We have been able to determine the structure of a ternary complex involving UvrB* (a C-terminal truncation of full-length UvrB), a polythymine trinucleotide and ADP. This structure has highlighted the roles of key conserved residues in DNA binding distinct from those of the beta-hairpin, where most of the attention in previous studies has been focussed. We are also the first to report the structural basis underlying conformational re-modelling of the beta-hairpin that is absolutely required for DNA binding and how this event results in an ATPase primed for catalysis. Our data provide the first insights at the molecular level into the transformation of UvrB into an active helicase.

  6. Double-stranded DNA-dependent ATPase Irc3p is directly involved in mitochondrial genome maintenance.

    Science.gov (United States)

    Sedman, Tiina; Gaidutšik, Ilja; Villemson, Karin; Hou, YingJian; Sedman, Juhan

    2014-12-01

    Nucleic acid-dependent ATPases are involved in nearly all aspects of DNA and RNA metabolism. Previous studies have described a number of mitochondrial helicases. However, double-stranded DNA-dependent ATPases, including translocases or enzymes remodeling DNA-protein complexes, have not been identified in mitochondria of the yeast Saccharomyces cerevisae. Here, we demonstrate that Irc3p is a mitochondrial double-stranded DNA-dependent ATPase of the Superfamily II. In contrast to the other mitochondrial Superfamily II enzymes Mss116p, Suv3p and Mrh4p, which are RNA helicases, Irc3p has a direct role in mitochondrial DNA (mtDNA) maintenance. Specific Irc3p-dependent mtDNA metabolic intermediates can be detected, including high levels of double-stranded DNA breaks that accumulate in irc3Δ mutants. irc3Δ-related topology changes in rho- mtDNA can be reversed by the deletion of mitochondrial RNA polymerase RPO41, suggesting that Irc3p counterbalances adverse effects of transcription on mitochondrial genome stability. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Mycobacterium smegmatis Lhr Is a DNA-dependent ATPase and a 3'-to-5' DNA translocase and helicase that prefers to unwind 3'-tailed RNA:DNA hybrids.

    Science.gov (United States)

    Ordonez, Heather; Shuman, Stewart

    2013-05-17

    We are interested in the distinctive roster of helicases of Mycobacterium, a genus of the phylum Actinobacteria that includes the human pathogen Mycobacterium tuberculosis and its avirulent relative Mycobacterium smegmatis. Here, we identify and characterize M. smegmatis Lhr as the exemplar of a novel clade of superfamily II helicases, by virtue of its biochemical specificities and signature domain organization. Lhr is a 1507-amino acid monomeric nucleic acid-dependent ATPase that uses the energy of ATP hydrolysis to drive unidirectional 3'-to-5' translocation along single strand DNA and to unwind duplexes en route. The ATPase is more active in the presence of calcium than magnesium. ATP hydrolysis is triggered by either single strand DNA or single strand RNA, yet the apparent affinity for a DNA activator is 11-fold higher than for an RNA strand of identical size and nucleobase sequence. Lhr is 8-fold better at unwinding an RNA:DNA hybrid than it is at displacing a DNA:DNA duplex of identical nucleobase sequence. The truncated derivative Lhr-(1-856) is an autonomous ATPase, 3'-to-5' translocase, and RNA:DNA helicase. Lhr-(1-856) is 100-fold better RNA:DNA helicase than DNA:DNA helicase. Lhr homologs are found in bacteria representing eight different phyla, being especially prevalent in Actinobacteria (including M. tuberculosis) and Proteobacteria (including Escherichia coli).

  8. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.

    1978-01-01

    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  9. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  10. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.

    1985-01-01

    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  11. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)

    student

    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  12. Improved single-strand DNA sizing accuracy in capillary electrophoresis.

    OpenAIRE

    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B

    1997-01-01

    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  13. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  14. Programmable autonomous synthesis of single-stranded DNA

    Science.gov (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

    2018-02-01

    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  15. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    Science.gov (United States)

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  16. Elastic properties of alternative versus single-stranded leveling archwires.

    Science.gov (United States)

    Rucker, Brian K; Kusy, Robert P

    2002-11-01

    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  17. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.

    1976-02-01

    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  18. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.

    1984-01-01

    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  19. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  20. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela

    2010-01-01

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  1. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

    Science.gov (United States)

    Richardson, Tomas T; Harran, Omar; Murray, Heath

    2016-06-16

    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

  2. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2003-01-01

    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  3. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.

    OpenAIRE

    Barany, F; Boeke, J D

    1983-01-01

    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  4. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  5. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase.

    Science.gov (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias

    2017-06-02

    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system.

    Science.gov (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus

    2011-04-06

    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  7. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi

    1990-01-01

    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  8. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der

    1988-01-01

    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  9. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.

    2002-01-01

    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit...

  10. Ion assisted structural collapse of a single stranded DNA: A molecular dynamics approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Soumadwip; Dixit, Himanshu; Chakrabarti, Rajarshi, E-mail: rajarshi@chem.iitb.ac.in

    2015-09-28

    Highlights: • The dynamics of a single-stranded DNA in presence of different concentrations of Mg{sup 2+} is investigated. • The initial DNA chain collapse is characterized by the formation of non-sequentially stacked base pairs. • The DNA chain re-swells at high concentrations of Mg{sup 2+} as a consequence of overcharging. - Abstract: The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counterions. It is well known that the structural collapse of DNA is favoured in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl{sub 2}) single stranded DNA with base sequence 5′-CGCGAATTCGCG-3′ (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  11. Dynamics of RecA filaments on single-stranded DNA

    NARCIS (Netherlands)

    Van Loenhout, M.T.J.; Van der Heijden, T.; Kanaar, R.; Wyman, C.; Dekker, C.

    2009-01-01

    RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on

  12. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2001-01-01

    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  13. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP

    1996-01-01

    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  14. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  15. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket.

    Science.gov (United States)

    Pham, Hanh T; Bergoin, Max; Tijssen, Peter

    2013-03-14

    The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  16. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket

    OpenAIRE

    Pham, Hanh T.; Bergoin, Max; Tijssen, Peter

    2013-01-01

    International audience; The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  17. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.

    1983-01-01

    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  18. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B

    2006-01-01

    by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  19. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud

    2012-06-01

    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  20. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.

    1985-01-01

    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  1. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    Science.gov (United States)

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  2. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.

    1982-01-01

    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  3. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    Science.gov (United States)

    Hong, Ka Lok

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  4. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification

    OpenAIRE

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-01-01

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen...

  5. In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides

    International Nuclear Information System (INIS)

    Oppenheim, Amos B.; Rattray, Alison J.; Bubunenko, Mikhail; Thomason, Lynn C.; Court, Donald L.

    2004-01-01

    We demonstrate that the bacteriophage λ Red functions efficiently recombine linear DNA or single-strand oligonucleotides (ss-oligos) into bacteriophage λ to create specific changes in the viral genome. Point mutations, deletions, and gene replacements have been created. While recombineering with oligonucleotides, we encountered other mutations accompanying the desired point mutational change. DNA sequence analysis suggests that these unwanted mutations are mainly frameshift deletions introduced during oligonucleotide synthesis

  6. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis.

    Science.gov (United States)

    Olszewski, Marcin; Mickiewicz, Małgorzata; Kur, Józef

    2008-07-01

    The thermophilic bacterium Thermoanaerobacter tengcongensis has two single-stranded DNA-binding (SSB) proteins, designated TteSSB2 and TteSSB3. In a SSB complementation assay in Escherichia coli, only TteSSB3 took over the in vivo function of EcoSSB. We have cloned the ssb genes obtained by PCR and have developed E. coli overexpression systems. The TteSSB2 and TteSSB3 consist of 153 and 150 amino acids with a calculated molecular mass of 17.29 and 16.96 kDa, respectively. They are the smallest known bacterial SSB proteins. The homology between amino acid sequences of these proteins is 40% identity and 53% similarity. They are functional as homotetramers, with each monomer encoding one single-stranded DNA binding domain (OB-fold). In fluorescence titrations with poly(dT), both proteins bind single-stranded DNA with a binding site size of about 40 nt per homotetramer. Thermostability with half-life of about 30 s at 95 degrees C makes TteSSB3 similar to the known SSB of Thermus aquaticus (TaqSSB). The TteSSB2 was fully active even after 6 h incubation at 100 degrees C. Here, we show for the first time paralogous thermostable homotetrameric SSBs, which could be an attractive alternative for known homodimeric thermostable SSB proteins in their applications for molecular biology methods and analytical purposes.

  7. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana.

    Science.gov (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L

    2005-04-01

    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  8. Intercalation of single-strand oligonucleotides between nucleolipid anionic membranes: a neutron diffraction study.

    Science.gov (United States)

    Milani, Silvia; Berti, Debora; Dante, Silvia; Hauss, Thomas; Baglioni, Piero

    2009-04-07

    This contribution presents a neutron diffraction investigation of anionic lamellar phases composed of mixtures of 1-palmitoyl, 2-oleoyl phosphatidyl-nucleosides (POPN, where N is either adenosine or uridine), and POPC (1-palmitoyl,2-oleoyl-phosphatidyl-choline). Their behavior is studied for two different mole ratios and in the presence of nucleic acids. The samples are formed by the evaporation of liposomal dispersions prepared in water or in solutions containing single-strand oligonucleotides. Previous small angle X-ray scattering (SAXS) experiments on the system POPA/polyU (polyuridylic acid, high degree of polymerization, synthetic ribonucleic acid) proved that the insertion and ordering of the biopolymer in the phospholipid lamellae were driven by molecular recognition. In the present study, we extend the previous investigation to single-strand monodisperse oligonucleotides (50-mers). Structural details of the membranes were obtained from the analysis of the neutron diffraction scattering length density profiles. The evidence of direct and specific interactions, driven by molecular recognition between the nucleic polar heads of the nucleolipid and the single-strand nucleic acid, is strengthened by the comparison with identically charged bilayers formed by POPG/POPC. These results contribute to the understanding of the parameters governing the interactions between nucleolipid membranes and oligonucleotides, providing a novel strategy for the design of lipid-based vehicles for nucleic acids.

  9. Stretching and controlled motion of single-stranded DNA in locally heated solid-state nanopores.

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B; Aksimentiev, Aleksei

    2013-08-27

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4-8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA.

  10. Repair of ultraviolet light damage in Saccharomyces cerevisiae as studied with double- and single-stranded incoming DNAs

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, D.; Hieda, K.

    1992-01-01

    Purified double- and single-stranded DNAs of the autonomously replicating vector M13RK9-T were irradiated with ultraviolet light (UV) in vitro and introduced into competent whole cells of Saccharomyces cerevisiae. Incoming double-stranded DNA was more sensitive to UV in excision repair-deficient rad2-1 cells than in proficient repair RAD + cells, while single-stranded DNA exhibited high sensitivity in both host cells. The results indicate that in yeast there is no effective rescue of UV-incoming single-stranded DNA by excision repair or other constitutive dark repair processes

  11. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks.

    Science.gov (United States)

    Pachkowski, Brian; Nakamura, Jun

    2013-01-01

    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  12. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.

    1980-01-01

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  13. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth

    2014-01-01

    . We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices......Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells...

  14. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela

    2015-01-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  15. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted

    2014-01-01

    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  16. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams

    2014-01-01

    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  17. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng

    2015-05-08

    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  18. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    Science.gov (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora.

    Science.gov (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E

    2003-08-01

    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  20. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Science.gov (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  1. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification.

    Science.gov (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-10-07

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  2. Empirical model for matching spectrophotometric reflectance of yarn windings and multispectral imaging reflectance of single strands of yarns.

    Science.gov (United States)

    Luo, Lin; Shen, Hui-Liang; Shao, Si-Jie; Xin, John

    2015-08-01

    The state-of-the-art multispectral imaging system can directly acquire the reflectance of a single strand of yarn that is impossible for traditional spectrophotometers. Instead, the spectrophotometric reflectance of a yarn winding, which is constituted by yarns wound on a background card, is regarded as the yarn reflectance in textile. While multispectral imaging systems and spectrophotometers can be separately used to acquire the reflectance of a single strand of yarn and corresponding yarn winding, the quantitative relationship between them is not yet known. In this paper, the relationship is established based on models that describe the spectral response of a spectrophotometer to a yarn winding and that of a multispectral imaging system to a single strand of yarn. The reflectance matching function from a single strand of yarn to corresponding yarn winding is derived to be a second degree polynomial function, which coefficients are the solutions of a constrained nonlinear optimization problem. Experiments on 100 pairs of samples show that the proposed approach can reduce the color difference between yarn windings and single strands of yarns from 2.449 to 1.082 CIEDE2000 units. The coefficients of the optimal reflection matching function imply that the reflectance of a yarn winding measured by a spectrophotometer consists of not only the intrinsic reflectance of yarn but also the nonignorable interreflection component between yarns.

  3. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  4. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan

    2015-01-01

    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  5. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik

    1992-04-01

    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  6. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.

    1987-01-01

    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  7. Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Gust, I.D.; Feinstone, S.M.; Purcell, R.H.; Alter, H.J.

    1980-01-01

    A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

  8. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata).

    Science.gov (United States)

    Jackson, Elliot W; Bistolas, Kalia S I; Button, Jason B; Hewson, Ian

    2016-01-01

    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates.

  9. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.

    1980-01-01

    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  10. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux

    2016-12-01

    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  11. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  12. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif

    Science.gov (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  13. Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1

    DEFF Research Database (Denmark)

    Yang, Jay; Bachrati, Csanad Z; Ou, Jiongwen

    2010-01-01

    -passage mechanism. We generated single-stranded catenanes that resemble the proposed dissolution intermediate recognized by human topoisomerase IIIalpha. We demonstrate that human topoisomerase IIIalpha is a single-stranded DNA decatenase that is specifically stimulated by the BLM-RMI1 pair. In addition, RMI1......Human topoisomerase IIIalpha is a type IA DNA topoisomerase that functions with BLM and RMI1 to resolve DNA replication and recombination intermediates. BLM, human topoisomerase IIIalpha, and RMI1 catalyze the dissolution of double Holliday junctions into noncrossover products via a strand...

  14. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.

    1988-01-01

    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  15. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.

    2012-01-01

    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  16. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues

    Science.gov (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak

    2006-01-01

    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  17. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes

    Science.gov (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.

    2015-01-01

    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  18. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos

    2015-09-01

    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  19. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair

    Science.gov (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.

    2009-01-01

    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  20. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-05

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity*

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.

    2015-01-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  2. Substrate-assisted 2D DNA lattices and algorithmic lattices from single-stranded tiles.

    Science.gov (United States)

    Kim, Junghoon; Ha, Tai Hwan; Park, Sung Ha

    2015-08-07

    We present a simple route to circumvent kinetic traps which affect many types of DNA nanostructures in their self-assembly process. Using this method, a new 2D DNA lattice made up of short, single-stranded tile (SST) motifs was created. Previously, the growth of SST DNA assemblies was restricted to 1D (tubes and ribbons) or finite-sized 2D (molecular canvases). By utilizing the substrate-assisted growth method, sets of SSTs were designed as unit cells to self-assemble into periodic and aperiodic 2D lattices which continuously grow both along and orthogonal to the helical axis. Notably, large-scale (∼1 μm(2)) fully periodic 2D lattices were fabricated using a minimum of just 2 strand species. Furthermore, the ability to create 2D lattices from a few motifs enables certain rules to be encoded into these SSTs to carry out algorithmic self-assembly. A set of these motifs was designed to execute simple 1-input 1-output COPY and NOT algorithms, the space-time manifestations which were aperiodic 2D algorithmic SST lattices. The methodology presented here can be straightforwardly applied to other motifs which fall into this type of kinetic trap to create novel DNA crystals.

  3. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol

    2010-05-01

    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  4. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.

    2007-01-01

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  5. Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems.

    Science.gov (United States)

    Musumeci, Domenica; Rozza, Lucia; Merlino, Antonello; Paduano, Luigi; Marzo, Tiziano; Massai, Lara; Messori, Luigi; Montesarchio, Daniela

    2015-08-21

    The interaction of the anticancer Ru(iii) complex AziRu - in comparison with its analogue NAMI-A, currently in advanced clinical trials as an antimetastatic agent - with DNA model systems, both single stranded and duplex oligonucleotides, was investigated using a combined approach, including absorption UV-vis spectroscopy, circular dichroism (CD) and electrospray mass spectrometry (ESI-MS) techniques. UV-vis absorption spectra of the Ru complexes were recorded at different times in a pseudo-physiological solution, to monitor the ligand exchange processes in the absence and in the presence of the examined oligonucleotides. CD experiments provided information on the overall conformational changes of the DNA model systems induced by these metal complexes. UV- and CD-monitored thermal denaturation studies were performed to analyse the effects of AziRu and NAMI-A on the stability of the duplex structures. ESI-MS experiments, carried out on the oligonucleotide/metal complex mixtures under investigation, allowed us to detect the formation of stable adducts between the guanine-containing oligomers and the ruthenium complexes. These data unambiguously demonstrate that both AziRu and NAMI-A can interact with the DNA model systems. Although very similar in their structures, the two metal compounds manifest a markedly different reactivity with the examined sequences, respectively, with either a naked Ru(3+) ion or a Ru(Im)(3+) (Im = imidazole) fragment being incorporated into the oligonucleotide structure via stable linkages.

  6. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop.

    Science.gov (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S

    2009-05-01

    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  7. Biophysical characterization of the association of histones with single-stranded DNA.

    Science.gov (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier

    2017-11-01

    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong

    2008-01-01

    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  9. Effect of Conformational Entropy on the Nanomechanics of Microcantilever-Based Single-Stranded DNA Sensors

    Directory of Open Access Journals (Sweden)

    Zou-Qing Tan

    2014-09-01

    Full Text Available An entropy-controlled bending mechanism is presented to study the nanomechanics of microcantilever-based single-stranded DNA (ssDNA sensors. First; the conformational free energy of the ssDNA layer is given with an improved scaling theory of thermal blobs considering the curvature effect; and the mechanical energy of the non-biological layer is described by Zhang’s two-variable method for laminated beams. Then; an analytical model for static deflections of ssDNA microcantilevers is formulated by the principle of minimum energy. The comparisons of deflections predicted by the proposed model; Utz–Begley’s model and Hagan’s model are also examined. Numerical results show that the conformational entropy effect on microcantilever deflections cannot be ignored; especially at the conditions of high packing density or long chain systems; and the variation of deflection predicted by the proposed analytical model not only accords with that observed in the related experiments qualitatively; but also appears quantitatively closer to the experimental values than that by the preexisting models. In order to improve the sensitivity of static-mode biosensors; it should be as small as possible to reduce the substrate stiffness.

  10. In vitro selection and characterization of single stranded DNA aptamers for luteolin: A possible recognition tool.

    Science.gov (United States)

    Tuma Sabah, Jinan; Zulkifli, Razauden Mohamed; Shahir, Shafinaz; Ahmed, Farediah; Abdul Kadir, Mohammed Rafiq; Zakaria, Zarita

    2018-03-06

    Distinctive bioactivities possessed by luteolin (3', 4', 5, 7-tetrahydroxy-flavone) are advantageous for sundry practical applications. This paper reports the in vitro selection and characterization of single stranded-DNA (ssDNA) aptamers, specific for luteolin (LUT). 76-mer library containing 1015 randomized ssDNA were screened via systematic evolution of ligands by exponential enrichment (SELEX). The recovered ssDNA pool from the 8th round was amplified with unlabeled primers and cloned into PSTBlue-1 vector prior to sequencing. 22 of LUT-binding aptamer variants were further classified into one of the seven groups based on their N40 random sequence regions, wherein one representative from each group was characterized. The dissociation constant of aptamers designated as LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively with high binding affinity towards LUT. Prediction analysis of the secondary structure suggested discrete features with typical loop and stem motifs. Furthermore, LUT#3 displayed higher specificity with insignificant binding toward kaempferol and quercetin despite its structural and functional similarity compared to LUT#28 and LUT#20. Further LUT#3 can detect free luteolin within 0.2-1 mM in solution. It was suggested that LUT#3 aptamer were the most suitable for LUT recognition tool at laboratory scale based on the condition tested. Copyright © 2018. Published by Elsevier Inc.

  11. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska

    2017-12-01

    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  12. Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages.

    Science.gov (United States)

    Kodaira, K; Godson, N G; Taketo, A

    1995-01-25

    The minus origins for complementary strand DNA synthesis (-ori) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, phi K, alpha 3, and St-1 closely resemble each other in DNA structure and contain two potential secondary hairpin loops (I and II) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the -ori regions of phi K and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the phi K mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several phi K and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway.

  13. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.

    1985-01-01

    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  14. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  15. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.

    1987-01-01

    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  16. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks.

    Science.gov (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P

    2012-09-01

    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  17. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  18. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.

    1995-01-01

    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  19. Distinct circular single-stranded DNA viruses exist in different soil types.

    Science.gov (United States)

    Reavy, Brian; Swanson, Maud M; Cock, Peter J A; Dawson, Lorna; Freitag, Thomas E; Singh, Brajesh K; Torrance, Lesley; Mushegian, Arcady R; Taliansky, Michael

    2015-06-15

    The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  20. A high throughput system for the preparation of single stranded templates grown in microculture.

    Science.gov (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M

    1994-01-01

    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  1. Complex shapes self-assembled from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng

    2012-05-30

    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  2. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)

    1994-09-01

    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  3. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  4. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses.

    Science.gov (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn

    2011-06-01

    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  5. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  6. Electrical conduction and photoresponses of gamma-ray-irradiated single-stranded DNA/single-walled carbon nanotube composite systems

    Energy Technology Data Exchange (ETDEWEB)

    Hong, W.; Lee, E.M.; Kim, D.W.; Lee, Cheol Eui, E-mail: rscel@korea.ac.kr

    2015-04-15

    Highlights: •Effects of gamma-ray irradiation on single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. •Barrier for thermally activated conduction in the composite systems modified by the gamma-ray irradiation. •Photoresponses reveal photoexcitation and oxygen photodesorption modified by gamma-ray irradiation. -- Abstract: Effects of gamma-ray irradiation on the electrical conductivity and photoresponse have been studied for single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. The temperature-dependent electrical conductivity of the ssDNA/SWNT composite films, well described by a fluctuation-induced tunneling model, indicated modification of the barrier for thermally activated conduction by the gamma-ray irradiation. Besides, the photoresponse measurements indicated modified photoexcited charge carrier generation and oxygen photodesorption in the composite systems due to the gamma-ray irradiation.

  7. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.

    2006-01-01

    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  8. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    Science.gov (United States)

    2014-09-30

    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  9. Selective binding and reverse transcription inhibition of single-strand poly(A) RNA by metal TMPyP complexes.

    Science.gov (United States)

    Zhou, Zhu-Xin; Gao, Feng; Chen, Xing; Tian, Xiang-Jing; Ji, Liang-Nian

    2014-10-06

    Ni-, Cu-, and Zn-TMPyP are capable of binding to single-strand poly(A) RNA with high preference and affinity and inhibiting the reverse transcription of RNA by both M-MuLV and HIV-1 reverse transcriptase. With 10 nM azidothymidine, the IC50 value of M-TMPyP could be lowered to 10(-1) μM order.

  10. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.

    2013-01-01

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  11. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.

    1977-01-01

    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  12. The Adsorption of Short Single-Stranded DNA Oligomers on Mineral Surfaces

    Science.gov (United States)

    Kopstein, M.; Sverjensky, D. A.; Hazen, R. M.; Cleaves, H. J.

    2009-12-01

    Previous studies have described feasible pathways for the synthesis of simple organic building blocks such as formaldehyde and hydrogen cyanide, and their reaction to form more complex biomolecules such as nucleotide bases, amino acids and sugars (Miller and Orgel 1974, Miller and Cleaves 2006). However, the polymerization of monomers into a useful genetic material remains problematic (Orgel 2004). Organic building blocks were unlikely to polymerize from very dilute aqueous solution in the primitive oceans. Mineral surface adsorption has been suggested as a possible mechanism for concentrating the necessary building blocks (Bernal 1951). This study focused on the adsorption behavior of single-stranded DNA homo-oligomers of adenine and thymine (including the monomers, dimers, tetramers, hexamers, octomers, and decamers) with five different mineral surfaces (pyrite, rutile, hematite, olivine and calcite). Adsorption was studied in 0.1 M pH 8.1 KHCO3 with0.05 M NaCl as background electrolyte. Solutions were mixed for 24 hours at room temperature, centrifuged and the supernatants analyzed by UV/visible spectrophotometry. Equilibrium solution concentrations were measured and used to determine the number of moles adsorbed per square meter. Langmuir isotherms were constructed using the experimental data. It was found that adenine-containing molecules tend to bind much more strongly than thymine-containing molecules. It was also found that the number of moles adsorbed at saturation tends to fall with increasing chain length, while adsorption affinity tends to rise. Oligomer length appears to affect adsorption more than the mineral type. These results may have implications for the primordial organization of the first nucleic acid molecules as the persistence of extra-cellular nucleic acids in the environment. References Bernal, J. D. (1951) The Physical Basis of Life (Routledge, London). Miller S.L. and Cleaves, H.J. (2006) Prebiotic chemistry on the primitive Earth. In

  13. Role of electrostatics in the assembly pathway of a single-stranded RNA virus.

    Science.gov (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M

    2014-09-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  14. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids.

    Science.gov (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R

    2015-04-08

    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  15. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong

    2011-04-01

    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  16. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes

    OpenAIRE

    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  17. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity.

    Science.gov (United States)

    Monnet, Jordan; Kozelka, Jiří

    2012-10-01

    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris

    2016-01-01

    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA-binding pro......Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...... leads to enhanced cooperative binding to DNA.Conclusions: Our findings contribute to the emerging picture that bacterial proteins, exemplified here by SsbA, undergo phosphorylation at multiple residues. This results in a complex regulation of cellular functions, and suggests that the complexity...

  19. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  20. Development of an Interaction Assay between Single-Stranded Nucleic Acids Trapped with Silica Particles and Fluorescent Compounds

    Directory of Open Access Journals (Sweden)

    R. Maeda

    2012-09-01

    Full Text Available Biopolymers are easily denatured by heating, a change in pH or chemical substances when they are immobilized on a substrate. To prevent denaturation of biopolymers, we developed a method to trap a polynucleotide on a substrate by hydrogen bonding using silica particles with surfaces modified by aminoalkyl chains ([A-AM silane]/SiO2. [A-AM silane]/SiO2 was synthesized by silane coupling reaction of N-2-(aminoethyl-3-aminopropyltrimethoxysilane (A-AM silane with SiO2 particles with a diameter of 5 μm at 100 °C for 20 min. The surface chemical structure of [A-AM silane]/SiO2 was characterized by Fourier transform infrared spectroscopy and molecular orbital calculations. The surface of the silica particles was modified with A-AM silane and primary amine groups were formed. [A-AM silane]/SiO2 was trapped with single-stranded nucleic acids [(Poly-X; X = A (adenine, G (guanine and C (cytosine] in PBS solution at 37 °C for 1 h. The single-stranded nucleic acids were trapped on the surface of the [A-AM silane]/SiO2 by hydrogen bonding to form conjugated materials. The resulting complexes were further conjugated by derivatives of acridine orange (AO as fluorescent labels under the same conditions to form [AO:Poly-X:A-AM silane]/SiO2 complexes. Changes in the fluorescence intensity of these complexes originating from interactions between the single-stranded nucleic acid and aromatic compounds were also evaluated. The change in intensity displayed the order [AO: Poly-G: A-AM silane]/SiO2 > [AO:Poly-A:A-AM silane]/SiO2 >> [AO:Poly-C:A-AM silane]/SiO2. This suggests that the single-stranded nucleic acids conjugated with aminoalkyl chains on the surfaces of SiO2 particles and the change in fluorescence intensity reflected the molecular interaction between AO and the nucleic-acid base in a polynucleotide.

  1. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide

    Science.gov (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio

    1998-01-01

    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  2. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism.

    Science.gov (United States)

    Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong

    2016-07-01

    A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.

  3. Characterization of the single-stranded DNA binding protein pV(VGJΦ) of VGJΦ phage from Vibrio cholerae.

    Science.gov (United States)

    Falero, Alina; Caballero, Andy; Trigueros, Sonia; Pérez, Celso; Campos, Javier; Marrero, Karen; Fando, Rafael

    2011-09-01

    pV(VGJΦ), a single-stranded DNA binding protein of the vibriophage VGJΦ was subject to biochemical analysis. Here, we show that this protein has a general affinity for single-stranded DNA (ssDNA) as documented by Electrophoretic Mobility Shift Assay (EMSA). The apparent molecular weight of the monomer is about 12.7kDa as measured by HPLC-SEC. Moreover, isoelectrofocusing showed an isoelectric point for pV(VGJΦ) of 6.82 pH units. Size exclusion chromatography in 150mM NaCl, 50mM sodium phosphate buffer, pH 7.0 revealed a major protein species of 27.0kDa, suggesting homodimeric protein architecture. Furthermore, pV(VGJΦ) binds ssDNA at extreme temperatures and the complex was stable after extended incubation times. Upon frozen storage at -20°C for a year the protein retained its integrity, biological activity and oligomericity. On the other hand, bioinformatics analysis predicted that pV(VGJΦ) protein has a disordered C-terminal, which might be involved in its functional activity. All the aforementioned features make pV(VGJΦ) interesting for biotechnological applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles.

    Science.gov (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng

    2015-11-21

    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  5. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  6. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.

    1978-01-01

    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  7. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail: meicun2006@163.com; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

    2016-12-01

    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  8. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  9. Highly stable triple helix formation by homopyrimidine (l)-acyclic threoninol nucleic acids with single stranded DNA and RNA

    DEFF Research Database (Denmark)

    Kumar, Vipin; Kesavan, Venkitasamy; Gothelf, Kurt Vesterager

    2015-01-01

    Acyclic (l)-threoninol nucleic acid (aTNA) containing thymine, cytosine and adenine nucleobases were synthesized and shown to form surprisingly stable triplexes with complementary single stranded homopurine DNA or RNA targets. The triplex structures consist of two (l)-aTNA strands and one DNA...... or RNA, and these triplexes are significantly stronger than the corresponding DNA or RNA duplexes as shown in competition experiments. As a unique property the (l)-aTNAs exclusively form triplex structures with DNA and RNA and no duplex structures are observed by gel electrophoresis. The results were...... compared to the known enantiomer (d)-aTNA, which forms much weaker triplexes depending upon temperature and time. It was demonstrated that (l)-aTNA triplexes are able to stop primer extension on a DNA template, showing the potential of (l)-aTNA for antisense applications....

  10. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample.

    Science.gov (United States)

    Cui, Lunbiao; Wu, Binyao; Zhu, Xiaojuan; Guo, Xiling; Ge, Yiyue; Zhao, Kangchen; Qi, Xian; Shi, Zhiyang; Zhu, Fengcai; Sun, Lixin; Zhou, Minghao

    2017-11-01

    Metagenomic analysis through high-throughput sequencing is a tool for detecting both known and novel viruses. Using this technique, a novel circular single-stranded DNA (ssDNA) virus genome was discovered in respiratory secretions from a febrile traveler. The virus, named human respiratory-associated PSCV-5-like virus (HRAPLV), has a genome comprising 3,018 bases, with two major putative ORFs inversely encoding capsid (Cap) and replicase (Rep) protein and separated by two intergenic regions. One stem-loop structure was predicted in the larger intergenic region (LIR). The predicted amino acid sequences of the Cap and Rep proteins of HRAPLV showed highest identity to those of porcine stool-associated circular virus 5 isolate CP3 (PoSCV 5) (53.0% and 48.9%, respectively). The host tropism of the virus is unknown, and further study is warranted to determine whether this novel virus is associated with human disease.

  11. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Vrushali S. [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Gokhale, Suresh P.; Patil, Kashinath R. [Physical and Material Chemistry Division, National Chemical Laboratory, Pune (India); Haram, Santosh K., E-mail: haram@chem.unipune.ernet.i [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)

    2010-02-15

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 +- 2 mum and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, alpha-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k{sup 0}) and electron transfer coefficient (alpha) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  12. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    International Nuclear Information System (INIS)

    Joshi, Vrushali S.; Gokhale, Suresh P.; Patil, Kashinath R.; Haram, Santosh K.

    2010-01-01

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 ± 2 μm and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, α-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k 0 ) and electron transfer coefficient (α) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  13. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  14. Quenching of Single-Walled Carbon Nanotube Fluorescence by Dissolved Oxygen Reveals Selective Single-Stranded DNA Affinities.

    Science.gov (United States)

    Zheng, Yu; Bachilo, Sergei M; Weisman, R Bruce

    2017-05-04

    The selective interactions between short oligomers of single-stranded DNA (ssDNA) and specific structures of single-walled carbon nanotubes have been exploited in powerful methods for nanotube sorting. We report here that nanotubes coated with ssDNA also display selective interactions through the selective quenching of nanotube fluorescence by dissolved oxygen. In aqueous solutions equilibrated under 1 atm of O 2 , emission intensity from semiconducting nanotubes is reduced by between 9 and 40%, varying with the combination of ssDNA sequence and nanotube structure. This quenching reverses promptly and completely on the removal of dissolved O 2 and may be due to physisorption on nanotube surfaces. Fluorescence quenching offers a simple, nondestructive approach for studying the structure-selective interactions of ssDNA with single-walled carbon nanotubes and identifying recognition sequences.

  15. Surface treatment on amorphous InGaZnO4 thin film for single-stranded DNA biosensing

    Science.gov (United States)

    Sun, Dali; Matsui, Hiroaki; Wu, Chun-Nan; Tabata, Hitoshi

    2015-01-01

    Amorphous InGaZnO4 (aIGZO) has been widely used as a transparent semiconductor. However, no research has been found yet applying aIGZO to biosensing. This paper examined the single strand DNA (ssDNA) immobilization on aIGZO by absorption with a comparison to ITO, which is the first step for many biosensing schemas. The DNA quantification by florescence intensity shows that the absorption capacity of aIGZO film to ssDNA is 6.7 times greater than that of ITO. XPS and contact angle analysis proved the high DNA absorption affinity on aIGZO film is related to its high effectiveness to OH- attachment. A feasible method to immobilized ssDNA on aIGZO thin film is evaluated in this paper, and consequently, enables a possible approach to apply aIGZO in biosensing.

  16. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol

    2013-01-01

    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  17. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana.

    Science.gov (United States)

    Olszewski, Marcin; Grot, Anna; Wojciechowski, Marek; Nowak, Marta; Mickiewicz, Małgorzata; Kur, Józef

    2010-10-15

    In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. We report the characterization of single-stranded DNA binding proteins (SSBs) from the thermophilic bacteria Thermotoga maritima (TmaSSB) and Thermotoga neapolitana (TneSSB). They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively). They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold) in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC) the melting temperature (Tm) was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR).

  18. Charge enhancement of single-stranded DNA in negative electrospray ionization using the supercharging reagent meta-nitrobenzyl alcohol.

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1% m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1% m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  19. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  20. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB).

    Science.gov (United States)

    van Loon, Barbara; Samson, Leona D

    2013-03-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  1. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata

    2010-10-01

    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  2. Aptamer based voltammetric determination of ampicillin using a single-stranded DNA binding protein and DNA functionalized gold nanoparticles.

    Science.gov (United States)

    Wang, Jun; Ma, Kui; Yin, Huanshun; Zhou, Yunlei; Ai, Shiyun

    2017-12-20

    An aptamer based method is described for the electrochemical determination of ampicillin. It is based on the use of DNA aptamer, DNA functionalized gold nanoparticles (DNA-AuNPs), and single-stranded DNA binding protein (ssDNA-BP). When the aptamer hybridizes with the target DNA on the AuNPs, the ssDNA-BP is captured on the electrode surface via its specific interaction with ss-DNA. This results in a decreased electrochemical signal of the redox probe Fe(CN) 6 3- which is measured best at a voltage of 0.188 mV (vs. reference electrode). In the presence of ampicillin, the formation of aptamer-ampicillin conjugate blocks the further immobilization of DNA-AuNPs and ssDNA-BP, and this leads to an increased response. The method has a linear reposne that convers the 1 pM to 5 nM ampicillin concentration range, with a 0.38 pM detection limit (at an S/N ratio of 3). The assay is selective, stable and reproducible. It was applied to the determination of ampicillin in spiked milk samples where it gave recoveries ranging from 95.5 to 105.5%. Graphical abstract Schematic of a simple and sensitive electrochemical apta-biosensor for ampicillin detection. It is based on the use of gold nanoparticles (AuNPs), DNA aptamer, DNA functionalized AuNPs (DNA-AuNPs), and single-strand DNA binding protein (SSBP).

  3. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.

    1994-01-01

    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  4. Genetic evidence for single-strand lesions initiating Nbs1-dependent homologous recombination in diversification of Ig v in chicken B lymphocytes.

    Directory of Open Access Journals (Sweden)

    Makoto Nakahara

    2009-01-01

    Full Text Available Homologous recombination (HR is initiated by DNA double-strand breaks (DSB. However, it remains unclear whether single-strand lesions also initiate HR in genomic DNA. Chicken B lymphocytes diversify their Immunoglobulin (Ig V genes through HR (Ig gene conversion and non-templated hypermutation. Both types of Ig V diversification are initiated by AID-dependent abasic-site formation. Abasic sites stall replication, resulting in the formation of single-stranded gaps. These gaps can be filled by error-prone DNA polymerases, resulting in hypermutation. However, it is unclear whether these single-strand gaps can also initiate Ig gene conversion without being first converted to DSBs. The Mre11-Rad50-Nbs1 (MRN complex, which produces 3' single-strand overhangs, promotes the initiation of DSB-induced HR in yeast. We show that a DT40 line expressing only a truncated form of Nbs1 (Nbs1(p70 exhibits defective HR-dependent DSB repair, and a significant reduction in the rate--though not the fidelity--of Ig gene conversion. Interestingly, this defective gene conversion was restored to wild type levels by overproduction of Escherichia coli SbcB, a 3' to 5' single-strand-specific exonuclease, without affecting DSB repair. Conversely, overexpression of chicken Exo1 increased the efficiency of DSB-induced gene-targeting more than 10-fold, with no effect on Ig gene conversion. These results suggest that Ig gene conversion may be initiated by single-strand gaps rather than by DSBs, and, like SbcB, the MRN complex in DT40 may convert AID-induced lesions into single-strand gaps suitable for triggering HR. In summary, Ig gene conversion and hypermutation may share a common substrate-single-stranded gaps. Genetic analysis of the two types of Ig V diversification in DT40 provides a unique opportunity to gain insight into the molecular mechanisms underlying the filling of gaps that arise as a consequence of replication blocks at abasic sites, by HR and error

  5. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian

    2012-07-06

    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  6. Identification and characterization of single-stranded DNA-binding protein from the facultative psychrophilic bacteria Pseudoalteromonas haloplanktis.

    Science.gov (United States)

    Olszewski, Marcin; Nowak, Marta; Cyranka-Czaja, Anna; Kur, Józef

    2014-01-01

    Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism such as DNA replication, repair, and recombination, and is essential for cell survival. This study reports on the ssb-like gene cloning, gene expression and characterization of a single-stranded DNA-binding protein of Pseudoalteromonas haloplanktis (PhaSSB) and is the first report of such a protein from psychrophilic microorganism. PhaSSB possesses a high sequence similarity to Escherichia coli SSB (48% identity and 57% similarity) and has the longest amino acid sequence (244 amino acid residues) of all the known bacterial SSBs with one OB-fold per monomer. An analysis of purified PhaSSB by means of chemical cross-linking experiments, sedimentation analysis and size exclusion chromatography revealed a stable tetramer in solution. Using EMSA, we characterized the stoichiometry of PhaSSB complexed with a series of ssDNA homopolymers, and the size of the binding site was determined as being approximately 35 nucleotides long. In fluorescence titrations, the occluded site size of PhaSSB on poly(dT) is 34 nucleotides per tetramer under low-salt conditions (2mM NaCl), but increases to 54-64 nucleotides at higher-salt conditions (100-300mM NaCl). This suggests that PhaSSB undergoes a transition between ssDNA binding modes, which is observed for EcoSSB. The binding properties of PhaSSB investigated using SPR technology revealed that the affinity of PhaSSB to ssDNA is typical of SSB proteins. The only difference in the binding mode of PhaSSB to ssDNA is a faster association phase, when compared to EcoSSB, though compensated by faster dissociation rate. When analyzed by differential scanning calorimetry (DSC), the melting temperature (Tm) was determined as 63 °C, which is only a few degrees lower than for EcoSSB. Copyright © 2013 Elsevier GmbH. All rights reserved.

  7. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  8. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii.

    Science.gov (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten

    2012-01-01

    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  9. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der

    1978-01-01

    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  10. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.

    1982-01-01

    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  11. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

    1982-01-01

    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  12. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.

    2006-01-01

    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  13. Functional analysis of multiple single-stranded DNA-binding proteins from Methanosarcina acetivorans and their effects on DNA synthesis by DNA polymerase BI.

    Science.gov (United States)

    Robbins, Justin B; Murphy, Mary C; White, Bryan A; Mackie, Roderick I; Ha, Taekjip; Cann, Isaac K O

    2004-02-20

    Single-stranded DNA-binding proteins and their functional homologs, replication protein A, are essential components of cellular DNA replication, repair and recombination. We describe here the isolation and characterization of multiple replication protein A homologs, RPA1, RPA2, and RPA3, from the archaeon Methanosarcina acetivorans. RPA1 comprises four single-stranded DNA-binding domains, while RPA2 and RPA3 are each composed of two such domains and a zinc finger domain. Gel filtration analysis suggested that RPA1 exists as homotetramers and homodimers in solution, while RPA2 and RPA3 form only homodimers. Unlike the multiple RPA proteins found in other Archaea and eukaryotes, each of the M. acetivorans RPAs can act as a distinct single-stranded DNA-binding protein. Fluorescence resonance energy transfer and fluorescence polarization anisotropy studies revealed that the M. acetivorans RPAs bind to as few as 10 single-stranded DNA bases. However, more stable binding is achieved with single-stranded DNA of 18-23 bases, and for such substrates the estimated Kd was 3.82 +/- 0.28 nM, 173.6 +/- 105.17 nM, and 5.92 +/- 0.23 nM, for RPA1, RPA2, and RPA3, respectively. The architectures of the M. acetivorans RPAs are different from those of hitherto reported homologs. Thus, these proteins may represent novel forms of replication protein A. Most importantly, our results show that the three RPAs and their combinations highly stimulate the primer extension capacity of M. acetivorans DNA polymerase BI. Although bacterial SSB and eukaryotic RPA have been shown to stimulate DNA synthesis by their cognate DNA polymerases, our findings provide the first in vitro biochemical evidence for the conservation of this property in an archaeon.

  14. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  15. EFFECTOR OF TRANSCRIPTION2 is involved in xylem differentiation and includes a functional DNA single strand cutting domain.

    Science.gov (United States)

    Ivanov, Rumen; Tiedemann, Jens; Czihal, Andreas; Schallau, Anna; Diep, Le Hong; Mock, Hans-Peter; Claus, Bernhard; Tewes, Annegret; Bäumlein, Helmut

    2008-01-01

    EFFECTORS OF TRANSCRIPTION2 (ET) are plant-specific regulatory proteins characterized by the presence of two to five C-terminal DNA- and Zn-binding repeats, and a highly conserved cysteine pattern. We describe the structural characterization of the three member Arabidopsis thaliana ET gene family and reveal some allelic sequence polymorphisms. A mutation analysis showed that AtET2 affects the expression of various KNAT genes involved in the maintenance of the undifferentiated state of cambial meristem cells. It also plays a role in the regulation of GA5 (gibberellin 3-beta-dioxygenase) and the cell-cycle-related GASA4. A correlation was established between AtET2 expression and the cellular differentiation state. AtET-GFP fusion proteins shuttle between the cytoplasm and nucleus, with the AtET2 product prevented from entering the nucleus in non-differentiating cells. Within the nucleus, AtET2 probably acts via a single strand cutting domain. A more general regulatory role for ET factors is proposed, governing cell differentiation in cambial meristems, a crucial process for the development of plant vascular tissues.

  16. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)

    2012-04-04

    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  17. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)

    2015-04-22

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  18. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.

    1985-01-01

    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  19. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA

    Science.gov (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana

    2009-04-01

    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  20. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia

    2009-01-01

    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  1. Capillary electrophoresis ribosomal RNA single-stranded conformation polymorphism: a new approach for characterization of low-diversity microbial communities.

    Science.gov (United States)

    Nai, Yi H; Zemb, Oliver; Gutierrez-Zamora, Maria-Luisa; Manefield, Mike; Powell, Shane M; Breadmore, Michael C

    2012-10-01

    Capillary electrophoresis (CE) has been the principle system for nucleic acid analysis since the early 1990s due to its inherent advantages such as fast analysis time, high resolution and efficiency, minimal sample requirement, high detection sensitivity, and automation. In the past few decades, microbial community fingerprinting methods such as terminal restriction fragment length polymorphism and single-stranded conformation polymorphism (SSCP) have migrated to CE to utilize its advantages over conventional slab gel electrophoresis. Recently, a gel-based direct rRNA fingerprint method was demonstrated. Different from other existing microbial community characterization approaches, this novel approach is polymerase chain reaction free and capable of providing information on the relative abundance of rRNA from individual phylotypes in low-diversity samples. As a gel-based method, it has a long analysis time and relatively large reagent and sample requirements. Here, we addressed these limitations by transferring the RNA fingerprint approach to the CE platform. Analysis time significantly improved from 24 h to 60 min, and the use of a fluorescently labeled hybridization probe as the detection strategy decreased the sample requirement by ten-fold. The combination of fast analysis time, low sample requirement, and sensitive fluorescence detection makes CE-RNA-SSCP an appealing new approach for characterizing low-diversity microbial communities.

  2. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))

    1993-03-01

    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  3. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA.

    Science.gov (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi

    2008-03-28

    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  4. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  5. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  6. DNA requirements for interaction of the C-terminal region of Ku80 with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs).

    Science.gov (United States)

    Radhakrishnan, Sarvan Kumar; Lees-Miller, Susan P

    2017-09-01

    Non-homologous end joining (NHEJ) is the major pathway for the repair of ionizing radiation induced DNA double strand breaks (DSBs) in human cells. Critical to NHEJ is the DNA-dependent interaction of the Ku70/80 heterodimer with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) to form the DNA-PK holoenzyme. However, precisely how Ku recruits DNA-PKcs to DSBs ends to enhance its kinase activity has remained enigmatic, with contradictory findings reported in the literature. Here we address the role of the Ku80 C-terminal region (CTR) in the DNA-dependent interaction of Ku70/80 with DNA-PKcs using purified components and defined DNA structures. Our results show that the Ku80 CTR is required for interaction with DNA-PKcs on short segments of blunt ended 25bp dsDNA or 25bp dsDNA with a 15-base poly dA single stranded (ss) DNA extension, but this requirement is less stringent on longer dsDNA molecules (35bp blunt ended dsDNA) or 25bp duplex DNA with either a 15-base poly dT or poly dC ssDNA extension. Moreover, the DNA-PKcs-Ku complex preferentially forms on 25 bp DNA with a poly-pyrimidine ssDNA extension.Our work clarifies the role of the Ku80 CTR and dsDNA ends on the interaction of DNA-PKcs with Ku and provides key information to guide assembly and biology of NHEJ complexes. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Assessing single-stranded oligonucleotide drug-induced effects in vitro reveals key risk factors for thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Sabine Sewing

    Full Text Available Single-stranded oligonucleotides (ON comprise a promising therapeutic platform that enables selective modulation of currently undruggable targets. The development of novel ON drug candidates has demonstrated excellent efficacy, but in certain cases also some safety liabilities were reported. Among them are events of thrombocytopenia, which have recently been evident in late stage trials with ON drugs. The underlying mechanisms are poorly understood and the risk for ON candidates causing such events cannot be sufficiently assessed pre-clinically. We investigated potential thrombocytopenia risk factors of ONs and implemented a set of in vitro assays to assess these risks. Our findings support previous observations that phosphorothioate (PS-ONs can bind to platelet proteins such as platelet collagen receptor glycoprotein VI (GPVI and activate human platelets in vitro to various extents. We also show that these PS-ONs can bind to platelet factor 4 (PF4. Binding to platelet proteins and subsequent activation correlates with ON length and connected to this, the number of PS in the backbone of the molecule. Moreover, we demonstrate that locked nucleic acid (LNA ribosyl modifications in the wings of the PS-ONs strongly suppress binding to GPVI and PF4, paralleled by markedly reduced platelet activation. In addition, we provide evidence that PS-ONs do not directly affect hematopoietic cell differentiation in culture but at higher concentrations show a pro-inflammatory potential, which might contribute to platelet activation. Overall, our data confirm that certain molecular attributes of ONs are associated with a higher risk for thrombocytopenia. We propose that applying the in vitro assays discussed here during the lead optimization phase may aid in deprioritizing ONs with a potential to induce thrombocytopenia.

  8. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA.

    Science.gov (United States)

    Rogers, Cody M; Bochman, Matthew L

    2017-05-13

    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold.

    Science.gov (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G

    2005-05-24

    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  10. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage

    Science.gov (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio

    1998-01-01

    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  11. Slowing single-stranded DNA translocation through a solid-state nanopore by decreasing the nanopore diameter.

    Science.gov (United States)

    Akahori, Rena; Haga, Takanobu; Hatano, Toshiyuki; Yanagi, Itaru; Ohura, Takeshi; Hamamura, Hirotaka; Iwasaki, Tomio; Yokoi, Takahide; Anazawa, Takashi

    2014-07-11

    To slow the translocation of single-stranded DNA (ssDNA) through a solid-state nanopore, a nanopore was narrowed, and the effect of the narrowing on the DNA translocation speed was investigated. In order to accurately measure the speed, long (5.3 kb) ssDNA (namely, ss-poly(dA)) with uniform length (±0.4 kb) was synthesized. The diameters of nanopores fabricated by a transmission electron microscope were controlled by atomic-layer deposition. Reducing the nanopore diameter from 4.5 to 2.3 nm slowed down the translocation of ssDNA by more than 16 times (to 0.18 μs base(-1)) when 300 mV was applied across the nanopore. It is speculated that the interaction between the nanopore and the ssDNA dominates the translocation speed. Unexpectedly, the translocation speed of ssDNA through the 4.5 nm nanopore is more than two orders of magnitude higher than that of double-stranded DNA (dsDNA) through a nanopore of almost the same size. The cause of such a faster translocation of ssDNA can be explained by the weaker drag force inside the nanopore. Moreover, the measured translocation speeds of ssDNA and dsDNA agree well with those calculated by molecular-dynamics (MD) simulation. The MD simulation predicted that reducing the nanopore diameter to almost the same as that of ssDNA (i.e. 1.4 nm) decreases the translocation speed (to 1.4 μs base(-1)). Narrowing the nanopore is thus an effective approach for accomplishing nanopore DNA sequencing.

  12. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  13. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler

    2007-12-01

    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  14. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines.

    Science.gov (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao

    2017-07-01

    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  15. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA.

    Science.gov (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee

    2011-03-24

    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  16. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis.

    Science.gov (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J

    2012-01-01

    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  18. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.

    1992-01-01

    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  19. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  20. Synthesis of a gene for the HIV transactivator protein TAT by a novel single stranded approach involving in vivo gap repair.

    OpenAIRE

    Adams, S E; Johnson, I D; Braddock, M; Kingsman, A J; Kingsman, S M; Edwards, R M

    1988-01-01

    The synthesis of a gene for the HIV TAT protein is described using a novel approach that capitalises on the ability to synthesise oligonucleotides of greater than 100 bp in length. It involves the synthesis of large oligomers covering one strand of the desired gene in its entirety and the use of small complementary bridging and adapter oligonucleotides to direct the assembly and cloning of the large oligomers. After ligation to the cloning vector the partially single stranded intermediate is ...

  1. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers

    OpenAIRE

    Antolin, M. F.; Bosio, C. F.; Cotton, J.; Sweeney, W.; Strand, M. R.; Black-IV, W. C.

    1996-01-01

    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  2. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr

    2015-01-01

    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single- strand ed DNA -binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  3. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.

    1979-10-01

    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  4. Escherichia coli Single-Stranded DNA-Binding Protein: NanoESI-MS Studies of Salt-Modulated Subunit Exchange and DNA Binding Transactions

    Science.gov (United States)

    Mason, Claire E.; Jergic, Slobodan; Lo, Allen T. Y.; Wang, Yao; Dixon, Nicholas E.; Beck, Jennifer L.

    2013-02-01

    Single-stranded DNA-binding proteins (SSBs) are ubiquitous oligomeric proteins that bind with very high affinity to single-stranded DNA and have a variety of essential roles in DNA metabolism. Nanoelectrospray ionization mass spectrometry (nanoESI-MS) was used to monitor subunit exchange in full-length and truncated forms of the homotetrameric SSB from Escherichia coli. Subunit exchange in the native protein was found to occur slowly over a period of hours, but was significantly more rapid in a truncated variant of SSB from which the eight C-terminal residues were deleted. This effect is proposed to result from C-terminus mediated stabilization of the SSB tetramer, in which the C-termini interact with the DNA-binding cores of adjacent subunits. NanoESI-MS was also used to examine DNA binding to the SSB tetramer. Binding of single-stranded oligonucleotides [one molecule of (dT)70, one molecule of (dT)35, or two molecules of (dT)35] was found to prevent SSB subunit exchange. Transfer of SSB tetramers between discrete oligonucleotides was also observed and is consistent with predictions from solution-phase studies, suggesting that SSB-DNA complexes can be reliably analyzed by ESI mass spectrometry.

  5. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  6. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.

    1992-01-01

    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  7. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  8. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: simonaclichici@yahoo.com [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)

    2012-03-15

    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  9. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus

    Science.gov (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.

    2016-01-01

    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  10. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy

    OpenAIRE

    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried

    2013-01-01

    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  11. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  12. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.

    1989-01-01

    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  13. A single-stranded RNA copy of the Giardia lamblia virus double-stranded RNA genome is present in the infected Giardia lamblia.

    OpenAIRE

    Furfine, E S; White, T C; Wang, A L; Wang, C C

    1989-01-01

    An isolate of Giardia lamblia infected with the double-stranded RNA virus (GLV) has two major species of RNA that are not present in an uninfected isolate. One of these species is the previously characterized double-stranded RNA genome of GLV (1). The second species of RNA appears to be a full length copy of one strand of the double-stranded RNA genome. This full length single-stranded RNA is not present in viral particles isolated from the growth medium. The cellular concentration of the sin...

  14. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  15. Oxidized base damage and single-strand break repair in mammalian genomes: role of disordered regions and posttranslational modifications in early enzymes.

    Science.gov (United States)

    Hegde, Muralidhar L; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic endonuclease 1 (APE1), form complexes with downstream repair (and other noncanonical) proteins via pairwise interactions. Furthermore, a unique feature of mammalian early BER/SSBR enzymes is the presence of a disordered terminal extension that is absent in their Escherichia coli prototypes. These nonconserved segments usually contain organelle-targeting signals, common interaction interfaces, and sites of posttranslational modifications that may be involved in regulating their repair function including lesion scanning. Finally, the linkage of BER/SSBR deficiency to cancer, aging, and human neurodegenerative diseases, and therapeutic targeting of BER/SSBR are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples.

    Science.gov (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J

    2006-03-01

    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  17. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast.

    Science.gov (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A

    2010-08-05

    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  18. Isolation and characterization of a single-stranded DNA virus infecting the marine diatom Chaetoceros sp. strain SS628-11 isolated from western Japan.

    Directory of Open Access Journals (Sweden)

    Kei Kimura

    Full Text Available Diatoms are significant organisms for primary production in the earth's aquatic environment. Hence, their dynamics are an important focus area in current studies. Viruses are a great concern as potential factors of diatom mortality, along with other physical, chemical, and biological factors. We isolated and characterized a new diatom virus (Csp07DNAV that lyses the marine planktonic diatom Chaetoceros sp. strain SS628-11. This paper examines the physiological, morphological, and genomic characteristics of Csp07DNAV. The virus was isolated from a surface water sample that was collected at Hiroshima Bay, Japan. It was icosahedral, had a diameter of 34 nm, and accumulated in the nuclei of host cells. Rod-shaped virus particles also coexisted in the host nuclei. The latent period and burst size were estimated to be <12 h and 29 infectious units per host cell, respectively. Csp07DNAV had a closed circular single-stranded DNA genome (5,552 nucleotides, which included a double-stranded region and 3 open reading frames. The monophyly of Csp07DNAV and other Bacilladnavirus group single-stranded DNA viruses was supported by phylogenetic analysis that was based on the amino acid sequence of each virus protein. On the basis of these results, we considered Csp07DNAV to be a new member of the genus Bacilladnavirus.

  19. Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library.

    Directory of Open Access Journals (Sweden)

    Sumate Pengpumkiat

    Full Text Available Chemical synthesis of oligonucleotides is a widely used tool in the field of biochemistry. Several methods for gene synthesis have been introduced in the growing area of genomics. In this paper, a novel method of constructing dsDNA is proposed. Short (28-mer oligo fragments from a library were assembled through successive annealing and ligation processes, followed by PCR. First, two oligo fragments annealed to form a dsDNA molecule. The double-stranded oligo was immobilized onto magnetic beads (solid support via streptavidin-biotin binding. Next, single-stranded oligo fragments were added successively through ligation to form the complete DNA molecule. The synthesized DNA was amplified through PCR and gel electrophoresis was used to characterize the product. Sanger sequencing showed that more than 97% of the nucleotides matched the expected sequence. Extending the length of the DNA molecule by adding single-stranded oligonucleotides from a basis set (library via ligation enables a more convenient and rapid mechanism for the design and synthesis of oligonucleotides on the go. Coupled with an automated dispensing system and libraries of short oligo fragments, this novel DNA synthesis method would offer an efficient and cost-effective method for producing dsDNA.

  20. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  1. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H

    2012-02-22

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  2. On-site detection of Phytophthora spp.—single-stranded target DNA as the limiting factor to improve on-chip hybridization

    International Nuclear Information System (INIS)

    Schwenkbier, Lydia; Pollok, Sibyll; Popp, Jürgen; Weber, Karina; König, Stephan; Wagner, Stefan; Werres, Sabine; Weber, Jörg; Hentschel, Martin

    2014-01-01

    We report on a lab-on-a-chip approach for on-site detection of Phytophthora species that allows visual signal readout. The results demonstrate the significance of single-stranded DNA (ssDNA) generation in terms of improving the intensity of the hybridization signal and to improve the reliability of the method. Conventional PCR with subsequent heat denaturation, sodium hydroxide-based denaturation, lambda exonuclease digestion and two asymmetric PCR methods were investigated for the species P. fragariae, P. kernoviae, and P. ramorum. The positioning of the capture probe within the amplified yeast GTP-binding protein (YPT1) target DNA was also of interest because it significantly influences the intensity of the signal. Statistical tests were used to validate the impact of the ssDNA generation methods and the capture-target probe position. The single-stranded target DNA generated by Linear-After-The-Exponential PCR (LATE-PCR) was found to produce signal intensities comparable to post-PCR exonuclease treatment. The LATE-PCR is the best method for the on-site detection of Phytophthora because the enzymatic digestion after PCR is more laborious and time-consuming. (author)

  3. Synthesis of a wild-type and three mutant Cucurbita maxima trypsin inhibitor-encoding genes by a single-strand approach.

    Science.gov (United States)

    Botes, D P; Qobose, M D; Corfield, V A

    1991-09-15

    A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.

  4. The casein genes in goat breeds from different Continents: analysis by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP

    Directory of Open Access Journals (Sweden)

    A. Caroli

    2010-04-01

    Full Text Available A screening of casein gene variability was carried out by Polymerase Chain Reaction – Single Strand Conformation Polymorphism in 8 goat breeds from Sudan (Nubian goat, Turkey (Angora Goat Lalahan Tiftic, Angora Goat Yerkoy, Hair goat and India (Jammu, Maharashtra, Rajasthan, South Goat. A total of 16 different alleles or groups of alleles were found, showing conspicuous differences among breeds. The allele frequencies were submitted to cluster analysis in order to highlight differences between breeds, also including data from Red Sokoto, West African Dwarf Nigeria, West African Dwarf Cameroon, and Borno Goat. The tree obtained from the cluster analysis showed two main lineages. The West African goat clustered together, the Indian and Turkish breeds were in the other group. Nubian goat was found in an intermediate position.

  5. Investigation of single-strand conformational polymorphism of the TP53 gene in women with a family history of breast cancer

    Directory of Open Access Journals (Sweden)

    R.R. Burbano

    2000-11-01

    Full Text Available Breast cancer in families with germ line mutations in the TP53 gene has been described in the medical literature. Mutation screening for susceptibility genes should allow effective prophylactic and preventive measures. Using single-strand conformational polymorphism, we screened for mutations in exons 5, 6, 7 and 8 of gene TP53 in the peripheral blood of 8 young non-affected members (17 to 36 years old of families with a history of breast cancer. Studies of this type on young patients (mean age, 25 years are very rare in the literature. The identification of these mutations would contribute to genetic counseling of members of families with predisposition to breast cancer. The results obtained did not show any polymorphism indicating mutation. In our sample, the familial tumorigenesis is probably related to other gene etiologies.

  6. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.

    1994-01-01

    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  7. Influence of the single-strand linker composition on the structural/dynamical properties of a truncated octahedral DNA nano-cage family.

    Science.gov (United States)

    Iacovelli, Federico; Alves, Cassio; Falconi, Mattia; Oteri, Francesco; de Oliveira, Cristiano L P; Desideri, Alessandro

    2014-10-01

    The structural/dynamical properties of three truncated octahedral DNA nano-cages composed by identical double helices but single strand linkers with different composition, namely 7 thymidines, 7 adenines, and 7 alternated thymidines and adenines, have been investigated through classical molecular dynamics simulations. Trajectories have been analyzed to investigate the role of the linkers in defining nano-cages stability and flexibility, including possible influence on the internal cages motions. The data indicate that the cages behavior is almost identical and that the structural/dynamical parameters measured along the trajectories are not particularly affected by the presence of different bases. These results demonstrate that the constraints imposed by the nano-structure geometry are the main factor in modulating these properties

  8. P4-ATPases

    DEFF Research Database (Denmark)

    Lopez Marques, Rosa Laura; Theorin, Lisa; Palmgren, Michael Broberg

    2014-01-01

    Cellular membranes, notably eukaryotic plasma membranes, are equipped with special proteins that actively translocate lipids from one leaflet to the other and thereby help generate membrane lipid asymmetry. Among these ATP-driven transporters, the P4 subfamily of P-type ATPases (P4-ATPases......-ATPases differ in their substrate specificities and mediate transport of a broader range of lipid substrates, including lysophospholipids and synthetic alkylphospholipids. At the same time, the cellular processes known to be directly or indirectly affected by this class of transporters have expanded...... to include the regulation of membrane traffic, cytoskeletal dynamics, cell division, lipid metabolism, and lipid signaling. In this review, we will summarize the basic features of P4-ATPases and the physiological implications of their lipid transport activity in the cell....

  9. Localization of specific sequences and DNA single-strand breaks in individual UV-A-irradiated human lymphocytes by COMET FISH

    Science.gov (United States)

    Bock, Claudia; Rapp, Alexander; Dittmar, Heike; Monajembashi, Shamci; Greulich, Karl-Otto

    1999-01-01

    The COMET assay, a single cell electrophoresis technique which allows to separate electrophoretically fractionated DNA according to size has been combined with fluorescence in situ hybridization (FISH) which allows to localize specific genes or gene regions. This combination (COMET FISH) allows the detection of DNA single strand breaks in specific regions of the genome of human lymphocytes at the single cell level. Various types of DNA probes, e.g. centromere-, (alpha) - satellite-, telomere-, whole chromosome-, single copy- and region specific DNA probes have been used to investigate whether the UV-A induced DNA single strand breaks are distributed randomly all over the human genome or induced at specific sites ('hot spots'). In the investigated human peripheral blood lymphocytes all but one centromere reveal low sensitivity for UV-A irradiation (500 kJ/m2), while telomeres are randomly distributed over COMET heads and tails. The human chromosome 1 is fractionated by irradiation, but remains in the COMET head, indicating an only moderate degree of fractionation. Among three tested single copy probes, c- myc, p53 and p58, the p53 gene located on chromosome 17p13.1 and the p58 gene (1p36) appear to be located in UV-A stable regions of the human genome in 95% of 65 investigated lymphocytes. In contrast, the c-myc proto-oncogene (8q24) is found in the COMET tail in 90% of the 27 investigated lymphocytes and thus appears to be more sensitive to UV-A irradiation.

  10. Evidence that single-stranded DNA breaks are a normal feature of koala sperm chromatin, while double-stranded DNA breaks are indicative of DNA damage.

    Science.gov (United States)

    Zee, Yeng Peng; López-Fernández, Carmen; Arroyo, F; Johnston, Stephen D; Holt, William V; Gosalvez, Jaime

    2009-08-01

    In this study, we have used single and double comet assays to differentiate between single- and double-stranded DNA damage in an effort to refine the interpretation of DNA damage in mature koala spermatozoa. We have also investigated the likelihood that single-stranded DNA breakage is part of the natural spermiogenic process in koalas, where its function would be the generation of structural bends in the DNA molecule so that appropriate packaging and compaction can occur. Koala spermatozoa were examined using the sperm chromatin dispersion test (SCDt) and comet assays to investigate non-orthodox double-stranded DNA. Comet assays were conducted under 1) neutral conditions; and 2) neutral followed by alkaline conditions (double comet assay); the latter technique enabled simultaneous visualisation of both single-stranded and double-stranded DNA breaks. Following the SCDt, there was a continuum of nuclear morphotypes, ranging from no apparent DNA fragmentation to those with highly dispersed and degraded chromatin. Dispersion morphotypes were mirrored by a similar diversity of comet morphologies that could be further differentiated using the double comet assay. The majority of koala spermatozoa had nuclei with DNA abasic-like residues that produced single-tailed comets following the double comet assay. The ubiquity of these residues suggests that constitutive alkali-labile sites are part of the structural configuration of the koala sperm nucleus. Spermatozoa with 'true' DNA fragmentation exhibited a continuum of comet morphologies, ranging from a more severe form of alkaline-susceptible DNA with a diffuse single tail to nuclei that exhibited both single- and double-stranded breaks with two comet tails.

  11. Functional roles of the N- and C-terminal regions of the human mitochondrial single-stranded DNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Marcos T Oliveira

    2010-10-01

    Full Text Available Biochemical studies of the mitochondrial DNA (mtDNA replisome demonstrate that the mtDNA polymerase and the mtDNA helicase are stimulated by the mitochondrial single-stranded DNA-binding protein (mtSSB. Unlike Escherichia coli SSB, bacteriophage T7 gp2.5 and bacteriophage T4 gp32, mtSSBs lack a long, negatively charged C-terminal tail. Furthermore, additional residues at the N-terminus (notwithstanding the mitochondrial presequence are present in the sequence of species across the animal kingdom. We sought to analyze the functional importance of the N- and C-terminal regions of the human mtSSB in the context of mtDNA replication. We produced the mature wild-type human mtSSB and three terminal deletion variants, and examined their physical and biochemical properties. We demonstrate that the recombinant proteins adopt a tetrameric form, and bind single-stranded DNA with similar affinities. They also stimulate similarly the DNA unwinding activity of the human mtDNA helicase (up to 8-fold. Notably, we find that unlike the high level of stimulation that we observed previously in the Drosophila system, stimulation of DNA synthesis catalyzed by human mtDNA polymerase is only moderate, and occurs over a narrow range of salt concentrations. Interestingly, each of the deletion variants of human mtSSB stimulates DNA synthesis at a higher level than the wild-type protein, indicating that the termini modulate negatively functional interactions with the mitochondrial replicase. We discuss our findings in the context of species-specific components of the mtDNA replisome, and in comparison with various prokaryotic DNA replication machineries.

  12. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide

    2015-10-01

    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  13. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2016-05-28

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  14. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy

    2008-01-01

    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  15. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray.

    Science.gov (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino

    2008-08-25

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  16. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Science.gov (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino

    2008-01-01

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  17. A biomarker model of sublethal genotoxicity (DNA single-strand breaks and adducts) using the sentinel organism Aporrectodea longa in spiked soil

    International Nuclear Information System (INIS)

    Martin, Francis L.; Piearce, Trevor G.; Hewer, Alan; Phillips, David H.; Semple, Kirk T.

    2005-01-01

    There is a need to develop risk biomarkers during the remediation of contaminated land. We employed the earthworm, Aporrectodea longa (Ude), to determine whether genotoxicity measures could be applied to this organism's intestinal tissues. Earthworms were added, for 24 h or 7 days, to soil samples spiked with benzo[a]pyrene (B[a]P) and/or lindane. After exposure, intestinal tissues (crop/gizzard or intestine) were removed prior to the measurement in disaggregated cells of DNA single-strand breaks (SSBs) by the alkaline comet assay. Damage was quantified by comet tail length (CTL, μm). B[a]P 24-h exposure induced dose-related increases (P 32 P-postlabelling, showed a two-adduct-spot pattern. This preliminary investigation suggests that earthworm tissues may be incorporated into genotoxicity assays to facilitate hazard identification within terrestrial ecosystems. - Sublethal genotoxicity in the sentinel organism A. longa can be used to monitor the effects of contaminants in soil

  18. Conformation effects of CpG methylation on single-stranded DNA oligonucleotides: analysis of the opioid peptide dynorphin-coding sequences.

    Directory of Open Access Journals (Sweden)

    Malik Mumtaz Taqi

    Full Text Available Single-stranded DNA (ssDNA is characterized by high conformational flexibility that allows these molecules to adopt a variety of conformations. Here we used native polyacrylamide gel electrophoresis (PAGE, circular dichroism (CD spectroscopy and nuclear magnetic resonance (NMR spectroscopy to show that cytosine methylation at CpG sites affects the conformational flexibility of short ssDNA molecules. The CpG containing 37-nucleotide PDYN (prodynorphin fragments were used as model molecules. The presence of secondary DNA structures was evident from differences in oligonucleotide mobilities on PAGE, from CD spectra, and from formation of A-T, G-C, and non-canonical G-T base pairs observed by NMR spectroscopy. The oligonucleotides displayed secondary structures at 4°C, and some also at 37°C. Methylation at CpG sites prompted sequence-dependent formation of novel conformations, or shifted the equilibrium between different existing ssDNA conformations. The effects of methylation on gel mobility and base pairing were comparable in strength to the effects induced by point mutations in the DNA sequences. The conformational effects of methylation may be relevant for epigenetic regulatory events in a chromatin context, including DNA-protein or DNA-DNA recognition in the course of gene transcription, and DNA replication and recombination when double-stranded DNA is unwinded to ssDNA.

  19. Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Krzysztof Lepek

    2015-01-01

    Full Text Available Monitoring and control of infections are key parts of surveillance systems and epidemiological risk prevention. In the case of influenza A viruses (IAVs, which show high variability, a wide range of hosts, and a potential of reassortment between different strains, it is essential to study not only people, but also animals living in the immediate surroundings. If understated, the animals might become a source of newly formed infectious strains with a pandemic potential. Special attention should be focused on pigs, because of the receptors specific for virus strains originating from different species, localized in their respiratory tract. Pigs are prone to mixed infections and may constitute a reservoir of potentially dangerous IAV strains resulting from genetic reassortment. It has been reported that a quadruple reassortant, A(H1N1pdm09, can be easily transmitted from humans to pigs and serve as a donor of genetic segments for new strains capable of infecting humans. Therefore, it is highly desirable to develop a simple, cost-effective, and rapid method for evaluation of IAV genetic variability. We describe a method based on multitemperature single-strand conformational polymorphism (MSSCP, using a fragment of the hemagglutinin (HA gene, for detection of coinfections and differentiation of genetic variants of the virus, difficult to identify by conventional diagnostic.

  20. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS.

    Science.gov (United States)

    Pachkowski, Brian F; Tano, Keizo; Afonin, Valeriy; Elder, Rhoderick H; Takeda, Shunichi; Watanabe, Masami; Swenberg, James A; Nakamura, Jun

    2009-12-01

    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase beta.

  1. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against the Pesticide Fipronil and Sensitive Detection in River Water

    Directory of Open Access Journals (Sweden)

    Ka L. Hong

    2017-12-01

    Full Text Available Fipronil is a commonly used insecticide that has been shown to have environmental and human health risks. The current standard methods of detection for fipronil and its metabolites, such as GC-MS, are time consuming and labor intensive. In this study, a variant of systematic evolution of ligands by exponential enrichment (SELEX, was utilized to identify the first single-stranded DNA (ssDNA molecular recognition element (MRE that binds to fipronil with high affinity (Kd = 48 ± 8 nM. The selected MRE displayed low cross binding activity on various environmentally relevant, structurally unrelated herbicides and pesticides, in addition to broad-spectrum binding activity on major metabolites of fipronil and a structurally similar pesticide in prepared river samples. Additionally, a proof-of-principle fluorescent detection assay was developed by using the selected ssDNA MRE as a signal-reporting element, with a limit of detection of 105 nM in a prepared river water sample.

  2. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Boye, E.; Johansen, I.; Brustad, T.

    1976-01-01

    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 2 0 C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 2 0 C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  3. Clonal origin of multiple lung cancers: K-ras and p53 mutations determined by nonradioisotopic single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Lau, D H; Yang, B; Hu, R; Benfield, J R

    1997-08-01

    Disease stage is the most important factor in determining prognosis and treatment of lung cancer. Staging of lung cancer is complicated by presentation of multiple pulmonary malignant lesions with a similar histology. It is a dilemma to decide if these lesions are synchronous primaries arising from different malignant clones or metastases from a single clone. Lung cancer is associated with multiple genetic abnormalities including mutations of K-ras and p53, which are believed to occur prior to onset of metastasis. To determine the clonal origin of multiple pulmonary malginant nodules, we analyzed point-mutations of K-ras and p53 by microdissection, polymerase chain reactions (PCR), nonradioisotopic single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. Each pulmonary lesion was microdissected from paraffin slides. Genomic DNA was amplified by two sequential PCRs followed by electrophoresis in a minigel and silver staining. Deoxyribonucleic acid sequencing was performed if necessary to confirm a mutation found upon SSCP analysis. Applying this molecular approach, we were able to differentiate the clonal origins of multiple malignant nodules of the lung as exemplified by the two cases presented.

  4. Simultaneous identification of seven foodborne pathogens and Escherichia coli (pathogenic and nonpathogenic) using capillary electrophoresis-based single-strand conformation polymorphism coupled with multiplex PCR.

    Science.gov (United States)

    Oh, Mi-Hwa; Paek, Se-Hee; Shin, Gi Won; Kim, Hae-Yeong; Jung, Gyoo Yeol; Oh, Sangsuk

    2009-06-01

    The objective of this study was to develop a novel technique for parallel analysis of eight important foodborne microbes using capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) coupled with multiplex PCR. Specific primers for multiplex PCR amplification of the 16S rRNA gene were designed, corresponding to eight species of bacteria, including Escherichia coli, Clostridium perfringens, Campylobacter jejuni, Salmonella enterica, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Bacillus cereus, for the species-specific identification and optimal separation of their PCR products in subsequent analysis by CE-SSCP. Multiplex PCR conditions including annealing temperature, extension time, the number of PCR cycles, and primer concentrations were then optimized for simultaneous detection of all target foodborne bacteria. The diagnostic system using CE-SSCP combined with multiplex PCR developed here can be used for rapid investigation of causative agents of foodborne illness. The simplicity and high sensitivity of the method may lead to improved management of safety and illness related to food.

  5. Selection and Characterization of Single-Stranded DNA Aptamers Binding Human B-Cell Surface Protein CD20 by Cell-SELEX

    Directory of Open Access Journals (Sweden)

    Mansoureh Haghighi

    2018-03-01

    Full Text Available The B-lymphocyte antigen (CD20 is a suitable target for single-stranded (ss nucleic acid oligomer (aptamers. The aim of study was selection and characterization of a ssDNA aptamer against CD20 using Cell-Systematic Evolution of Ligands by Exponential Enrichment (Cell-SELEX. The cDNA clone of CD20 (pcDNA-CD20 was transfected to human embryonic kidney (HEK293T cells. Ten rounds of Cell-SELEX was performed on recombinant HEK-CD20 cells. The final eluted ssDNA pool was amplified and ligated in T/A vector for cloning. The plasmids of positive clones were extracted, sequenced and the secondary structures of the aptamers predicted using DNAMAN® software. The sequencing results revealed 10 different types; three of them had the highest thermodynamic stability, named AP-1, AP-2 and AP-3. The AP-1 aptamer was the most thermodynamically stable one (ΔGAP-1 = −10.87 kcal/mol with the highest binding affinity to CD20 (96.91 ± 4.5 nM. Since, the CD20 is a suitable target for recognition of B-Cell. The selected aptamers could be comparable to antibodies with many advantages. The AP-1, AP-2 and AP-3 could be candidate instead of antibodies for diagnostic and therapeutic applications in immune deficiency, autoimmune diseases, leukemia and lymphoma.

  6. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    Science.gov (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Integrative modelling coupled with ion mobility mass spectrometry reveals structural features of the clamp loader in complex with single-stranded DNA binding protein.

    Science.gov (United States)

    Politis, Argyris; Park, Ah Young; Hall, Zoe; Ruotolo, Brandon T; Robinson, Carol V

    2013-11-29

    DNA polymerase III, a decameric 420-kDa assembly, simultaneously replicates both strands of the chromosome in Escherichia coli. A subassembly of this holoenzyme, the seven-subunit clamp loader complex, is responsible for loading the sliding clamp (β2) onto DNA. Here, we use structural information derived from ion mobility mass spectrometry (IM-MS) to build three-dimensional models of one form of the full clamp loader complex, γ3δδ'ψχ (254 kDa). By probing the interaction between the clamp loader and a single-stranded DNA (ssDNA) binding protein (SSB4) and by identifying two distinct conformational states, with and without ssDNA, we assemble models of ψχ-SSB4 (108 kDa) and the clamp loader-SSB4 (340 kDa) consistent with IM data. A significant increase in measured collision cross-section (~10%) of the clamp loader-SSB4 complex upon DNA binding suggests large conformational rearrangements. This DNA bound conformation represents the active state and, along with the presence of ψχ, stabilises the clamp loader-SSB4 complex. Overall, this study of a large heteromeric complex analysed by IM-MS, coupled with integrative modelling, highlights the potential of such an approach to reveal structural features of previously unknown complexes of high biological importance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. porphyrin with single strand DNAs

    Indian Academy of Sciences (India)

    for organization of porphyrin molecules into extended assemblies, providing opportunities for construction of supramolecular structures.6–8 Among the porphyrin .... and consequently the mono- and bi-exponential nature of the decays were judged by the reduced chi-square. (χ2) values and distribution of the weighted ...

  9. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA.

    Science.gov (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S

    2000-09-20

    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  10. Flow cytometry analysis of single-strand DNA damage in neuroblastoma cell lines using the F7-26 monoclonal antibody.

    Science.gov (United States)

    Grigoryan, Rita S; Yang, Bo; Keshelava, Nino; Barnhart, Jerry R; Reynolds, C Patrick

    2007-11-01

    The F7-26 monoclonal antibody (Mab) has been reported to be specific for single-strand DNA damage (ssDNA) and to also identify cells in apoptosis. We carriedout studies to determine if F7-26 binding measured by flow cytometry was able to specifically identify exogenous ssDNA as opposed to DNA damage from apoptosis. Neuroblastoma cells were treated with melphalan (L-PAM), fenretinide, 4-hydroperoxycyclophosphamide (4-HC)+/-pan-caspase inhibitor BOC-d-fmk, topotecan or with 10Gy gamma radiation+/-hydrogen peroxide (H2O2) and fixed immediately postradiation. Cytotoxicity was measured by DIMSCAN digital imaging fluorescence assay. The degree of ssDNA damage was analyzed by flow cytometry using Mab F7-26, with DNA visualized by propidium iodide counterstaining. Flow cytometry was used to measure apoptosis detected by terminal deoxynucleotidyltransferase (TUNEL) assay and reactive oxygen species (ROS) by carboxy-dichlorofluorescein diacetate. Irradiated and immediately fixed neuroblastoma cells showed increased ssDNA, but not apoptosis by TUNEL (TUNEL-negative). 4-HC or L-PAM+/-BOC-d-fmk increased ssDNA (F7-26-positive), but BOC-d-fmk prevented TUNEL staining. Fenretinide increased apoptosis by TUNEL but not ssDNA damage detected with F7-26. Enhanced ssDNA in neuroblastoma cells treated with radiation+H2O2 was associated with increased ROS. Topotecan increased both ssDNA and cytotoxicity in 4-HC-treated cells. These data demonstrate that Mab F7-26 recognized ssDNA due to exogenous DNA damage, rather than apoptosis. This assay should be useful to characterize the mechanism of action of antineoplastic drugs. Copyright (c) 2007 International Society for Analytical Cytology.

  11. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani

    2006-09-01

    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  12. Detection of p53 mutations by single-strand conformation polymorphisms (SSCP) gel electrophoresis. A comparative study of radioactive and nonradioactive silver-stained SSCP analysis.

    Science.gov (United States)

    Bosari, S; Marchetti, A; Buttitta, F; Graziani, D; Borsani, G; Loda, M; Bevilacqua, G; Coggi, G

    1995-12-01

    p53 mutations are the most common genetic abnormality in humans tumors, but their clinical significance remains to be precisely elucidated. Conventional single-strand conformation polymorphism (SSCP) analysis, a well-established technique for detecting p53 mutations, uses radioactively labeled polymerase chain reaction (PCR) products, which migrate abnormally in the presence of mutations. We performed radioactive PCR-SSCP analysis in a series of 30 formalin-fixed, paraffin-embedded ovarian carcinomas and two cell lines (SW480 and Caov4) harboring known homozygous p53 mutations and compared the results with nonradioactive silver-stained SSCP. The purpose was to assess whether nonradioactive SSCP is suitable for detecting p53 mutations in a rapid, sensitive, cost-effective fashion, without the need of radioactive isotopes. We accomplished PCR amplification of p53 exons 5 through 8 in 26 carcinomas, and radioactive SSCP detected p53 mutations in 13 tumors; three mutations were localized in exon 5, six in exon 6, two in exon 7, and two in exon 8. All mutations were correctly identified with nonradioactive SSCP, except for one exon 8 mutation. To establish the sensitivity of nonradioactive SSCP, DNA samples of SW480 and Caov4 were mixed with increasing amounts (0-90%) of normal DNA and subjected to PCR-SSCP analysis. Mutations were detected until the concentration of SW480 and Caov4 was 15% and 10%, respectively, of the total sample. The results of our investigation demonstrate that nonradioactive silver-stained SSCP is a sensitive, rapid, and simple technique to detect p53 mutations, even in formalin-fixed tissues, and could be easily used to investigate large series of patients to assess the clinical significance of p53 mutations in human tumors.

  13. Ampelomyces mycoparasites from apple powdery mildew identified as a distinct group based on single-stranded conformation polymorphism analysis of the rDNA ITS region.

    Science.gov (United States)

    Szentiványi, Orsolya; Kiss, Levente; Russell, John C; Kovács, Gábor M; Varga, Krisztina; Jankovics, Tünde; Lesemann, Silke; Xu, Xiang-Ming; Jeffries, Peter

    2005-04-01

    Pycnidial fungi belonging to the genus Ampelomyces are the most common natural antagonists of powdery mildews worldwide. During a study of the interactions between apple powdery mildew (Podosphaera leucotricha) and Ampelomyces mycoparasites, 52 new Ampelomyces isolates were obtained from P. leucotricha and, in addition, 13 new isolates from other species of the Erysiphaceae in four European countries. Their genetic diversity was screened using single-stranded conformation polymorphism (SSCP) analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). For comparison, 24 isolates obtained from genetic resource collections or other sources were included in this study. Based on the ITS-SSCP patterns, the isolates were placed in eight groups. The isolates belonged to two types based on their growth in culture. The faster-growing and the slower-growing isolates were included in different SSCP groups. A phylogenetic analysis of the ITS sequences of representatives of these groups confirmed the results obtained with the SSCP method, and showed that the faster-growing isolates do not belong to Ampelomyces as suggested by earlier studies. All the isolates from P. leucotricha fell into a distinct SSCP group of genetically homogeneous isolates. This suggests that Ampelomyces mycoparasites which occur in apple powdery mildew are slightly different from the other Ampelomyces groups which contain mycoparasites from various powdery mildew species. This may be because the main growth period of Ampelomyces mycoparasites in apple powdery mildew is isolated in time from that of Ampelomyces isolates that occur in other species of the Erysiphaceae. P. leucotricha starts its life-cycle early in the season, usually in March-April, while most powdery mildews are active in the same environments only late in the year.

  14. Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody: a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody.

    Science.gov (United States)

    Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua

    2018-02-01

    Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.

  15. Variabilidad genética de Aedes aegypti en algunas áreas del Perú usando Single Stranded Conformational Polymorphism (SSCP

    Directory of Open Access Journals (Sweden)

    Nélida Leiva G

    2004-07-01

    Full Text Available Aedes aegypti es el vector responsable de la transmisión del virus del dengue, su distribución geográfica se ha ampliado rápidamente debido principalmente a la intervención de los seres humanos. Objetivo: Analizar la variabilidad genética de este mosquito mediante la comparación del Segundo Espaciador Transcrito Interno (ITS 2 perteneciente al ADN ribosomal (rADN. Materiales y Métodos: Se analizaron muestras de ocho localidades (Jaén, Tingo María, Iquitos, Lambayeque, el distrito de El Rimac, Sullana y Zarumilla y uno de la provincia de Huaquillas (Ecuador. El análisis de la variabilidad se determinó usando la técnica conocida como SSCP (Single Stranded Conformation Polymorphism. Resultados: El estudio muestra que existe variabilidad genética entre las poblaciones analizadas, principalmente entre las muestras localizadas en la costa del Perú (Zarumilla, El Rímac, Sullana y Huaquillas y las muestras del nororiente (Tingo María, Iquitos, Jaén y Lambayeque Conclusión: Se determinaron dos variantes genéticas entre las poblaciones de Aedes aegypti: Costeña y Nororiental, que probablemente provienen de dos ancestros diferentes y cuyo ancestro común sufrió de aislamiento por distancia. Se observó que no existe relación entre las distancias genéticas y las distancias geográficas indicando que la migración de estas poblaciones es el resultado de la intervención de los seres humanos que diseminan al vector y no por la migración activa del mosquito. Se plantea el papel de la Cordillera de los Andes en la migración y separación de las poblaciones de Aedes.

  16. Detection of hybridization of single-strand DNA PCR products in temperature change process by a novel metal-clamping piezoelectric sensor.

    Science.gov (United States)

    Chen, Qinghai; Bian, Zhiheng; Hua, Xing; Yao, Chunyan; Wu, Wei; Zhang, Xue; Zhang, Bo; Huang, Junfu; Tang, Wanli; Fu, Weiling

    2010-05-15

    Oligonucleotide probes on the sensor surface can be hybridized with single-strand DNA (ssDNA) that is formed from PCR products in ice bath after degeneration. Thus, detection of PCR products by piezoelectric sensors requires the participation of ssDNA PCR products in ice bath. When PCR products in ice bath are added into the buffer of the sensor well at room temperature, there will be a temperature change process during mixing. However, it still remains unclear whether the temperature change affects the frequency baseline stability of the sensor and the result judgment, which is the basic condition for detecting hybridization of nucleic acid. In this study, we detected the hybridization of HPV PCR products during temperature change process by a self-designed adjustable metal-clamping piezoelectric sensor. The study mainly involves sensor adjustment, probe immobilization and ice bath sample addition (at different concentrations and different volumes). The response curve of basic frequency in temperature change process showed three stages, i.e., increase, decrease to baseline, and continuous decrease to stability. The early increase of frequency and duration of the time can reach 55+/-7.4 Hz and 39 min when 40 microL sample (0-1 degrees C) was added into 110 microL buffer (25 degrees C). The frequency increase effect caused by temperature difference at early stage depends on the volume ratio of two liquids and on the temperature difference. The results indicate that we should pay more attention to possibly small volume of PCR products in ice bath and minor temperature difference of two liquids in operation. 2010 Elsevier B.V. All rights reserved.

  17. Gauging the Nanotoxicity of h2D-C2N toward Single-Stranded DNA: An in Silico Molecular Simulation Approach.

    Science.gov (United States)

    Mukhopadhyay, Titas Kumar; Bhattacharyya, Kalishankar; Datta, Ayan

    2018-04-12

    Recent toxicological assessments of graphene, graphene oxides, and some other two-dimensional (2D) materials have shown them to be substantially toxic at the nanoscale, where they inhibit and eventually disrupt biological processes. These shortfalls of graphene and analogs have resulted in a quest for novel biocompatible 2D materials with minimum cytotoxicity. In this article, we demonstrate C 2 N (h2D-C 2 N), a newly synthesized 2D porous graphene analog, to be non-nanotoxic toward genetic materials from an "in-silico" point of view through sequence-dependent binding of different polynucleotide single-stranded DNA (ssDNA) onto it. The calculated binding energy of nucleobases and the free energy of binding of polynucleotides follow the common trait, cytosine > guanine > adenine > thymine, and are well within the limits of physisorption. Ab-initio simulations completely exclude the possibility of any chemical reaction, demonstrating purely noncovalent binding of nucleobases with C 2 N through a crucial interplay between hydrogen bonding and π-stacking interactions with the surface. Further, we show that the extent of distortion inflicted upon ssDNA by C 2 N is negligible. Analysis of the density of states of the nucleobase-C 2 N hybrids confirms minimum electronic perturbation of the bases after adsorption. Most importantly, we demonstrate the potency of C 2 N in nucleic acid transportation via reversible binding of ssDNA. The plausible use of C 2 N as a template for DNA repair is illustrated through an example of C 2 N-assisted complementary ssDNA winding.

  18. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms.

    Science.gov (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A

    2012-05-01

    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    Science.gov (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. The role of DNA dependent protein kinase in synapsis of DNA ends

    NARCIS (Netherlands)

    E.P.W.C. Weterings (Eric); N.S. Verkaik (Nicole); H.T. Brüggenwirth (Hennie); D.C. van Gent (Dik); J.H.J. Hoeijmakers (Jan)

    2003-01-01

    textabstractDNA dependent protein kinase (DNA-PK) plays a central role in the non-homologous end-joining pathway of DNA double strand break repair. Its catalytic subunit (DNA-PK(CS)) functions as a serine/threonine protein kinase. We show that DNA-PK forms a stable complex at DNA termini that blocks

  2. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W

    2009-12-23

    Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation

  3. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  4. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  5. Contribution of single-strand breaks and alkali-labile bonds to the loss of infectivity of γ-irradiated phiX174 RF-DNA in E. coli cells mutant in various repair functions

    International Nuclear Information System (INIS)

    McKee, R.H.

    1975-01-01

    Twenty-one radiation sensitive mutants have been examined for their capacity to support gamma-irradiated phiX174 RF-DNA. The survival of phiX174 RF-DNA was reduced in essentially all of the sensitive mutants. The irradiated phiX174 RF-DNA was then separated into populations containing either single-strand breaks or alkali-labile bonds to examine the capacity of the mutants to repair each of the classes of lesions. It was found that all E. coli strains are unable to repair 22 percent of the single-strand breaks and all sensitive mutants are unable to repair an additional 10 percent of the breaks. All the repair functions examined are involved in single-strand break repair and none are more or less necessary than any of the others. PhiX174 RF-DNA is also inactivated by alkali-labile bonds. In the normal strains the inactivation efficiency is 0.16 lethal events per lesion with a threshold dose of 15 to 20 krads. The mutants are divided into two classes by their sensitivity to alkali-labile bonds. Both classes of mutants are also inactivated by alkali-labile bonds with efficiencies of about 0.17 and 0.29 lethal events per lesion, respectively. It is proposed that the differences seen in survival curves of phiX174 measured in the sensitive mutants is due to this difference. Although in normal cells the efficiency of inactivation of phiX174 by single-strand breaks is 50 percent greater than by alkali-labile bonds, alkali-labile bonds are produced at approximately twice the rate of single-strand breaks so alkali-labile bonds account for about 61 percent of the overall inactivation. In the mutants of least sensitivity alkali-labile bonds account for about 54 percent of the inactivating events and in the most sensitive about 67 percent

  6. DNA-dependent protein kinase in nonhomologous end joining: a lock with multiple keys?

    Science.gov (United States)

    Weterings, Eric; Chen, David J

    2007-10-22

    The DNA-dependent protein kinase (DNA-PK) is one of the central enzymes involved in DNA double-strand break (DSB) repair. It facilitates proper alignment of the two ends of the broken DNA molecule and coordinates access of other factors to the repair complex. We discuss the latest findings on DNA-PK phosphorylation and offer a working model for the regulation of DNA-PK during DSB repair.

  7. Characterization of a Novel Megabirnavirus from Sclerotinia sclerotiorum Reveals Horizontal Gene Transfer from Single-Stranded RNA Virus to Double-Stranded RNA Virus.

    Science.gov (United States)

    Wang, Minghong; Wang, Yong; Sun, Xiangzhong; Cheng, Jiasen; Fu, Yanping; Liu, Huiquan; Jiang, Daohong; Ghabrial, Said A; Xie, Jiatao

    2015-08-01

    Mycoviruses have been detected in all major groups of filamentous fungi, and their study represents an important branch of virology. Here, we characterized a novel double-stranded RNA (dsRNA) mycovirus, Sclerotinia sclerotiorum megabirnavirus 1 (SsMBV1), in an apparently hypovirulent strain (SX466) of Sclerotinia sclerotiorum. Two similarly sized dsRNA segments (L1- and L2-dsRNA), the genome of SsMBV1, are packaged in rigid spherical particles purified from strain SX466. The full-length cDNA sequence of L1-dsRNA/SsMBV1 comprises two large open reading frames (ORF1 and ORF2), which encode a putative coat protein and an RNA-dependent RNA polymerase (RdRp), respectively. Phylogenetic analysis of the RdRp domain clearly indicates that SsMBV1 is related to Rosellinia necatrix megabirnavirus 1 (RnMBV1). L2-dsRNA/SsMBV1 comprises two nonoverlapping ORFs (ORFA and ORFB) encoding two hypothetical proteins with unknown functions. The 5'-terminal regions of L1- and L2-dsRNA/SsMBV1 share strictly conserved sequences and form stable stem-loop structures. Although L2-dsRNA/SsMBV1 is dispensable for replication, genome packaging, and pathogenicity of SsMBV1, it enhances transcript accumulation of L1-dsRNA/SsMBV1 and stability of virus-like particles (VLPs). Interestingly, a conserved papain-like protease domain similar to a multifunctional protein (p29) of Cryphonectria hypovirus 1 was detected in the ORFA-encoded protein of L2-dsRNA/SsMBV1. Phylogenetic analysis based on the protease domain suggests that horizontal gene transfer may have occurred from a single-stranded RNA (ssRNA) virus (hypovirus) to a dsRNA virus, SsMBV1. Our results reveal that SsMBV1 has a slight impact on the fundamental biological characteristics of its host regardless of the presence or absence of L2-dsRNA/SsMBV1. Mycoviruses are widespread in all major fungal groups, and they possess diverse genomes of mostly ssRNA and dsRNA and, recently, circular ssDNA. Here, we have characterized a novel dsRNA virus

  8. Essential role of the N-terminal domain in the regulation of RIG-I ATPase activity.

    Science.gov (United States)

    Gee, Peter; Chua, Pong Kian; Gevorkyan, Jirair; Klumpp, Klaus; Najera, Isabel; Swinney, David C; Deval, Jerome

    2008-04-04

    Retinoic acid-inducible gene I (RIG-I) is a cytosolic receptor that recognizes viral RNA and activates the interferon-mediated innate antiviral response. To understand the mechanism of signal activation at the receptor level, we cloned, expressed, and purified human RIG-I containing the two caspase activation and recruitment domains (CARDs) followed by the C-terminal helicase domain. We found that recombinant RIG-I is a functional protein that interacts with double-stranded RNA with substantially higher affinity as compared with single-stranded RNA structures unless they contain a 5'-triphosphate group. Viral RNA binding to RIG-I stimulates the velocity of ATP hydrolysis by 33-fold, which at the cellular level translates into a 43-fold increase of interferon-beta expression. In contrast, the isolated ATPase/helicase domain is constitutively activated while also retaining its RNA ligand binding properties. These results support the recent model by which RIG-I signaling is autoinhibited in the absence of RNA by intra-molecular interactions between the CARDs and the C terminus. Based on pH profile and metal ion dependence experiments, we propose that the active site of RIG-I cannot efficiently accommodate divalent cations under the RNA-free repressed conformation. Overall, these results show a direct correlation between RNA binding and ATPase enzymatic function leading to signal transduction and suggest that a tight control of ATPase activity by the CARDs prevents RIG-I signaling in the absence of viral RNA.

  9. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family.

    Science.gov (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław

    2017-05-01

    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  10. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D

    2010-01-01

    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  11. Increased type I collagen content and DNA binding activity of a single-stranded, cytosine-rich sequence in the high-salt buffer protein extract of the copper-deficient rat heart.

    Science.gov (United States)

    Zeng, Huawei; Saari, Jack T

    2004-11-01

    Dietary copper (Cu) deficiency not only causes a hypertrophic cardiomyopathy but also increases cancer risk in rodent models. However, a possible alteration in gene expression has not been fully examined. The present study was undertaken to determine the effect of Cu deficiency on protein profiles in rat heart tissue. Male Sprague-Dawley rats were fed diets that were either a Cu-adequate diet (6.0 microg Cu/g diet, n = 6) or a Cu-deficient diet (0.3 microg Cu/g diet, n = 6) for 5 weeks. The high-salt buffer (HSB) protein extract from heart tissue of Cu-deficient, but not Cu-adequate rats showed a 132 kDa protein band by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. This protein band stained pink with Coomassie Blue, suggesting the presence of collagens or other proline-rich proteins. Dot immunoblotting demonstrated that total type I collagen was increased by 110% in HSB protein extract from Cu-deficient, relative to Cu-adequate, rats. Liquid chromatography with mass spectrometry analysis indicated that the 132 kDa protein band contained a collagen alpha (I) chain precursor as well as a leucine-rich protein 130 (LRP130) in HSB protein extract from Cu-deficient but not Cu-adequate rats. A gel shift assay showed that HSB protein extract from Cu-deficient rats bound to a single-stranded cytosine-rich DNA with higher affinity than the extract of Cu-adequate rats, similar to reports of an increase in LRP130 single-stranded DNA binding activity in several types of tumor cells. Collectively, these results not only suggest an additional feature of altered collagen metabolism with Cu deficiency but also demonstrate for the first time an increase in single-stranded cytosine-rich DNA binding in Cu-deficient rat heart.

  12. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: tcheng@ntu.edu.tw [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)

    2013-02-01

    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ► To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ► ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ► PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ► The findings

  13. DNA-dependent protein kinase inhibits AID-induced antibody gene conversion.

    Directory of Open Access Journals (Sweden)

    Adam J L Cook

    2007-04-01

    Full Text Available Affinity maturation and class switching of antibodies requires activation-induced cytidine deaminase (AID-dependent hypermutation of Ig V(DJ rearrangements and Ig S regions, respectively, in activated B cells. AID deaminates deoxycytidine bases in Ig genes, converting them into deoxyuridines. In V(DJ regions, subsequent excision of the deaminated bases by uracil-DNA glycosylase, or by mismatch repair, leads to further point mutation or gene conversion, depending on the species. In Ig S regions, nicking at the abasic sites produced by AID and uracil-DNA glycosylases results in staggered double-strand breaks, whose repair by nonhomologous end joining mediates Ig class switching. We have tested whether nonhomologous end joining also plays a role in V(DJ hypermutation using chicken DT40 cells deficient for Ku70 or the DNA-dependent protein kinase catalytic subunit (DNA-PKcs. Inactivation of the Ku70 or DNA-PKcs genes in DT40 cells elevated the rate of AID-induced gene conversion as much as 5-fold. Furthermore, DNA-PKcs-deficiency appeared to reduce point mutation. The data provide strong evidence that double-strand DNA ends capable of recruiting the DNA-dependent protein kinase complex are important intermediates in Ig V gene conversion.

  14. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: skim1@lsuhsc.edu [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  15. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  16. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee

    2012-01-01

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  17. Effect of ionizing radiation on Ca2+-ATPase and Mg2+-ATPase: the role of ligands

    International Nuclear Information System (INIS)

    Dreval', V.I.

    1994-01-01

    The change of Ca 2+ -ATPase and Mg 2+ -ATPase activity in plasma membranes of thymocytes irradiated with doses of 10 2 , 10 3 and 10 4 Gy in the presence of Ca 2+ , Mg 2+ and ATP was studied. Stabilizing effect of Ca 2+ and Mg 2+ on Ca 2+ -ATPase and ATP on Mg 2+ -ATPase under irradiation was established

  18. Mycobacterium smegmatis SftH exemplifies a distinctive clade of superfamily II DNA-dependent ATPases with 3′ to 5′ translocase and helicase activities

    OpenAIRE

    Yakovleva, Lyudmila; Shuman, Stewart

    2012-01-01

    Bacterial DNA helicases are nucleic acid-dependent NTPases that play important roles in DNA replication, recombination and repair. We are interested in the DNA helicases of Mycobacteria, a genus of the phylum Actinobacteria, which includes the human pathogen Mycobacterium tuberculosis and its avirulent relative Mycobacterium smegmatis. Here, we identify and characterize M. smegmatis SftH, a superfamily II helicase with a distinctive domain structure, comprising an N-terminal NTPase domain and...

  19. On archaebacterial ATPase from Halobacterium saccharovorum

    Science.gov (United States)

    Kristjansson, H.; Ponnamperuma, C.; Hochstein, L.; Altekar, W.

    1984-01-01

    The energy transducing ATPase from Halobacterium saccharovorum was studied in order to define the origin of energy transducing systems. The ATPase required high salt concentration (4M NaCl) for activity; activity was rapidly lost when NaCl was below 1 Molar. At low salt concentration, the membrane bound ATPase activity could be stabilized in presence of spermine. However, following solubilization spermine was ineffective. Furthermore, F1 ATPase activity was stabilized by ammonium sulfate even when the NaCl concentration was less than 1 Molar. These studies suggest that stabilization by hydrophobic interactions preceded ionic ones in the evolution of the energy transducing ATPases.

  20. Myocardial Na,K-ATPase: Clinical aspects

    OpenAIRE

    Kjeldsen, Keld

    2003-01-01

    The specific binding of digitalis glycosides to Na,K-ATPase is used as a tool for Na,K-ATPase quantification with high accuracy and precision. In myocardial biopsies from patients with heart failure, total Na,K-ATPase concentration is decreased by around 40%; a correlation exists between a decrease in heart function and a decrease in Na,K-ATPase concentration. During digitalization, around 30% of remaining pumps are occupied by digoxin. Myocardial Na,K-ATPase is also influenced by other drugs...

  1. Evolution of plant P-type ATPases

    Directory of Open Access Journals (Sweden)

    Christian N.S. Pedersen

    2012-02-01

    Full Text Available Five organisms having completely sequenced genomes and belonging to all major branches of green plants (Viridiplantae were analyzed with respect to their content of P-type ATPases encoding genes. These were the chlorophytes Ostreococcus tauria and Chlamydomonas reinhardtii, and the streptophytes Physcomitrella patens (a moss, Selaginella moellendorffii (a primitive vascular plant, and Arabidopsis thaliana (a model flowering plant. Each organism contained sequences for all five subfamilies of P-type ATPases. Our analysis demonstrates when specific subgroups of P-type ATPases disappeared in the evolution of Angiosperms. Na/K-pump related P2C ATPases were lost with the evolution of streptophytes whereas Na+ or K+ pumping P2D ATPases and secretory pathway Ca2+-ATPases remained until mosses. An N-terminally located calmodulin binding domain in P2B ATPases can only be detected in pumps from Streptophytae, whereas, like in animals, a C-terminally localized calmodulin binding domain might be present in chlorophyte P2B Ca2+-ATPases. Chlorophyte genomes encode P3A ATPases resembling protist plasma membrane H+-ATPases and a C-terminal regulatory domain is missing. The complete inventory of P-type ATPases in the major branches of Viridiplantae is an important starting point for elucidating the evolution in plants of these important pumps.

  2. Regulation of the pancreatic duodenal homeobox-1 protein by DNA-dependent protein kinase.

    Science.gov (United States)

    Lebrun, Patricia; Montminy, Marc R; Van Obberghen, Emmanuel

    2005-11-18

    The transcription factor PDX-1 plays a crucial role during pancreatic development and in the function of insulin-producing beta cells. Disruption of the pdx-1 gene in these cells induces overt diabetes in mice, and this gene is modified in several type 2 diabetic families. It is thus crucial to determine the molecular mechanisms involved in the regulation of PDX-1 expression and/or activation. We identified new proteins associated with PDX-1 by mass spectrometry. These proteins, Ku70 and Ku80, are regulatory subunits of DNA-dependent protein kinase (DNA-PK). We determined that the interaction between PDX-1 and Ku70 or Ku80 is dependent on the homeodomain of PDX-1. Most interestingly, we demonstrated in vitro that the DNA-PK phosphorylates PDX-1 on threonine 11. Although this residue is located in the transactivation domain, this phosphorylation does not seem to be implicated in the transcriptional activation of PDX-1. However, in response to radiation, which activates DNA-PK, a second form of the PDX-1 protein appears rapidly. This form is phosphorylated on threonine and seems to drive PDX-1 degradation by the proteosome. In correlation with this degradation, we observed a subsequent reduction in the activation of the insulin promoter and a decrease in PDX-1-mediated gene expression, i.e. glut2 and glucokinase. Our study demonstrates that radiation, through the activation of DNA-PK, may regulate PDX-1 protein expression.

  3. The role of DNA dependent protein kinase in synapsis of DNA ends.

    Science.gov (United States)

    Weterings, Eric; Verkaik, Nicole S; Brüggenwirth, Hennie T; Hoeijmakers, Jan H J; van Gent, Dik C

    2003-12-15

    DNA dependent protein kinase (DNA-PK) plays a central role in the non-homologous end-joining pathway of DNA double strand break repair. Its catalytic subunit (DNA-PK(CS)) functions as a serine/threonine protein kinase. We show that DNA-PK forms a stable complex at DNA termini that blocks the action of exonucleases and ligases. The DNA termini become accessible after autophosphorylation of DNA-PK(CS), which we demonstrate to require synapsis of DNA ends. Interestingly, the presence of DNA-PK prevents ligation of the two synapsed termini, but allows ligation to another DNA molecule. This alteration of the ligation route is independent of the type of ligase that we used, indicating that the intrinsic architecture of the DNA-PK complex itself is not able to support ligation of the synapsed DNA termini. We present a working model in which DNA-PK creates a stable molecular bridge between two DNA ends that is remodeled after DNA-PK autophosphorylation in such a way that the extreme termini become accessible without disrupting synapsis. We infer that joining of synapsed DNA termini would require an additional protein factor.

  4. [The chromatographic properties of the DNA-dependent DNA polymerases from Acholeplasma laidlawii PG-8].

    Science.gov (United States)

    Bezuglyĭ, S V; Skripal', I G; Babichev, V V

    1992-01-01

    The DNA-dependent DNA-polymerase (DNA polymerase I which is not sorbed on the column with DEAE-cellulose, and DNA-polymerase II, which is absorbed by this column and is eluted from it by 0.3 M of NaCl), have been isolated from Acholeplasma laidlawii PG-8. DNA-polymerase I in homogeneous state was obtained as a result of the stepwise treatment by heparin-sepharose (elution at 0.35 M of NaCl) and poly-U-sepharose (elution at 0.3 M of NaCl). It was presented on the electrophoregram by one polypeptide with molecular weight of 72 kDalton. The second form of DNA polymerase was also obtained in homogeneous state as a result of sequential treatment on heparin-sepharose (elution at 0.3 M of NaCl) and on poly-A-sepharose (elution at 0.25 M of NaCl): the protein which had manifested polymerase activity was a polypeptide with molecular weight of 45 kDalton.

  5. Mycobacterium tuberculosis UvrB Is a Robust DNA-Stimulated ATPase That Also Possesses Structure-Specific ATP-Dependent DNA Helicase Activity.

    Science.gov (United States)

    Thakur, Manoj; Kumar, Mohan B J; Muniyappa, K

    2016-10-18

    Much is known about the Escherichia coli nucleotide excision repair (NER) pathway; however, very little is understood about the proteins involved and the molecular mechanism of NER in mycobacteria. In this study, we show that Mycobacterium tuberculosis UvrB (MtUvrB), which exists in solution as a monomer, binds to DNA in a structure-dependent manner. A systematic examination of MtUvrB substrate specificity reveals that it associates preferentially with single-stranded DNA, duplexes with 3' or 5' overhangs, and linear duplex DNA with splayed arms. Whereas E. coli UvrB (EcUvrB) binds weakly to undamaged DNA and has no ATPase activity, MtUvrB possesses intrinsic ATPase activity that is greatly stimulated by both single- and double-stranded DNA. Strikingly, we found that MtUvrB, but not EcUvrB, possesses the DNA unwinding activity characteristic of an ATP-dependent DNA helicase. The helicase activity of MtUvrB proceeds in the 3' to 5' direction and is strongly modulated by a nontranslocating 5' single-stranded tail, indicating that in addition to the translocating strand it also interacts with the 5' end of the substrate. The fraction of DNA unwound by MtUvrB decreases significantly as the length of the duplex increases: it fails to unwind duplexes longer than 70 bp. These results, on one hand, reveal significant mechanistic differences between MtUvrB and EcUvrB and, on the other, support an alternative role for UvrB in the processing of key DNA replication intermediates. Altogether, our findings provide insights into the catalytic functions of UvrB and lay the foundation for further understanding of the NER pathway in M. tuberculosis.

  6. Binding of a second magnesium is required for ATPase activity of RadA from Methanococcus voltae.

    Science.gov (United States)

    Qian, Xinguo; He, Yujiong; Luo, Yu

    2007-05-22

    RecA-like strand exchange proteins, which include closely related archaeal Rad51/RadA and eukaryal Rad51 and DMC1, play a key role in DNA repair by forming helical nucleoprotein filaments which promote a hallmark strand exchange reaction between homologous DNA substrates. Our recent crystallographic studies on a RadA recombinase from Methanococcus voltae (MvRadA) have unexpectedly revealed a secondary magnesium at the subunit interface approximately 11 A from the primary one coordinated by ATP and the canonical P-loop. The DNA-dependent ATPase activity of MvRadA appears to be dependent on the concentration of free Mg2+, while the strand exchange activity does not. We also made site-directed mutagenesis at the Mg2+-liganding residue Asp-246. The mutant proteins exhibited approximately 20-fold reduced ATPase activity but normal strand exchange activity. Structurally, the main chain carbonyl of the conserved catalytic residue Glu-151 is hydrogen bonded with one of the magnesium-liganding water molecules. Changes in the secondary magnesium site may therefore induce conformational changes around this catalytic glutamate and affect the ATPase activity without significantly altering the stability of the extended recombinase filament. Asp-246 is somewhat conserved among archaeal and eukaryal homologues, implying some homologues may share this allosteric site for ATPase function.

  7. Functional Analysis of P4-ATPases

    DEFF Research Database (Denmark)

    Theorin, Lisa

    Across membranes of the late secretory pathway in eukaryotic cells an asymmetric lipid distribution is maintained, with the lipids phosphatidylserine and phosphatidylethanolamine restricted to the cytoplasmic leaflet of the membrane. In recent years a subgroup of P-type ATPases, P4-ATPases, has...... and mammalian P4-ATPases have been studied extensively and the physiological function is mostly known, while the exact biochemistry and specific activity is mostly unknown. Even though the plant Arabidopsis thaliana has 12 P4-ATPases, not much is known about their function. In this study, the biochemical...... properties, with a focus on the lipid requirements, of the Aminophospholipid ATPase 2 (ALA2), a P4-ATPase from A. thaliana, were characterized. Heterologous expression of ALA2 together with its subunit, the Cdc50 homolog ALA Interacting Subunit 5 (ALIS5), in the yeast Saccharomyces cerevisiae allowed...

  8. DNA-Dependent Protein Kinase As Molecular Target for Radiosensitization of Neuroblastoma Cells.

    Directory of Open Access Journals (Sweden)

    M Emmy M Dolman

    Full Text Available Tumor cells might resist therapy with ionizing radiation (IR by non-homologous end-joining (NHEJ of IR-induced double-strand breaks. One of the key players in NHEJ is DNA-dependent protein kinase (DNA-PK. The catalytic subunit of DNA-PK, i.e. DNA-PKcs, can be inhibited with the small-molecule inhibitor NU7026. In the current study, the in vitro potential of NU7026 to radiosensitize neuroblastoma cells was investigated. DNA-PKcs is encoded by the PRKDC (protein kinase, DNA-activated, catalytic polypeptide gene. We showed that PRKDC levels were enhanced in neuroblastoma patients and correlated with a more advanced tumor stage and poor prognosis, making DNA-PKcs an interesting target for radiosensitization of neuroblastoma tumors. Optimal dose finding for combination treatment with NU7026 and IR was performed using NGP cells. One hour pre-treatment with 10 μM NU7026 synergistically sensitized NGP cells to 0.63 Gy IR. Radiosensitizing effects of NU7026 increased in time, with maximum effects observed from 96 h after IR-exposure on. Combined treatment of NGP cells with 10 μM NU7026 and 0.63 Gy IR resulted in apoptosis, while no apoptotic response was observed for either of the therapies alone. Inhibition of IR-induced DNA-PK activation by NU7026 confirmed the capability of NGP cells to, at least partially, resist IR by NHEJ. NU7026 also synergistically radiosensitized other neuroblastoma cell lines, while no synergistic effect was observed for low DNA-PKcs-expressing non-cancerous fibroblasts. Results obtained for NU7026 were confirmed by PRKDC knockdown in NGP cells. Taken together, the current study shows that DNA-PKcs is a promising target for neuroblastoma radiosensitization.

  9. Novel aspects of Na+,K+-ATPase

    OpenAIRE

    Aizman, Oleg

    2002-01-01

    Na,K-ATPase, an integral membrane protein expressed in each eukaryotic cell, serves as the major determinant of intracellular ion composition. In the current study we investigated novel aspects of Na,K-ATPase function and regulation. It is well established that Na,K-ATPase activity is regulated by reversible phosphorylation. New findings in this study are: 1) the level of intracellular Ca 2. concentration determines the functional effects of PKA and PKC-mediated Na,K-ATP...

  10. AAA-ATPases in Protein Degradation

    Directory of Open Access Journals (Sweden)

    Ravikiran S. Yedidi

    2017-06-01

    Full Text Available Proteolytic machineries containing multisubunit protease complexes and AAA-ATPases play a key role in protein quality control and the regulation of protein homeostasis. In these protein degradation machineries, the proteolytically active sites are formed by either threonines or serines which are buried inside interior cavities of cylinder-shaped complexes. In eukaryotic cells, the proteasome is the most prominent protease complex harboring AAA-ATPases. To degrade protein substrates, the gates of the axial entry ports of the protease need to be open. Gate opening is accomplished by AAA-ATPases, which form a hexameric ring flanking the entry ports of the protease. Protein substrates with unstructured domains can loop into the entry ports without the assistance of AAA-ATPases. However, folded proteins require the action of AAA-ATPases to unveil an unstructured terminus or domain. Cycles of ATP binding/hydrolysis fuel the unfolding of protein substrates which are gripped by loops lining up the central pore of the AAA-ATPase ring. The AAA-ATPases pull on the unfolded polypeptide chain for translocation into the proteolytic cavity of the protease. Conformational changes within the AAA-ATPase ring and the adjacent protease chamber create a peristaltic movement for substrate degradation. The review focuses on new technologies toward the understanding of the function and structure of AAA-ATPases to achieve substrate recognition, unfolding and translocation into proteasomes in yeast and mammalian cells and into proteasome-equivalent proteases in bacteria and archaea.

  11. The Rev1 interacting region (RIR) motif in the scaffold protein XRCC1 mediates a low-affinity interaction with polynucleotide kinase/phosphatase (PNKP) during DNA single-strand break repair.

    Science.gov (United States)

    Breslin, Claire; Mani, Rajam S; Fanta, Mesfin; Hoch, Nicolas; Weinfeld, Michael; Caldecott, Keith W

    2017-09-29

    The scaffold protein X-ray repair cross-complementing 1 (XRCC1) interacts with multiple enzymes involved in DNA base excision repair and single-strand break repair (SSBR) and is important for genetic integrity and normal neurological function. One of the most important interactions of XRCC1 is that with polynucleotide kinase/phosphatase (PNKP), a dual-function DNA kinase/phosphatase that processes damaged DNA termini and that, if mutated, results in ataxia with oculomotor apraxia 4 (AOA4) and microcephaly with early-onset seizures and developmental delay (MCSZ). XRCC1 and PNKP interact via a high-affinity phosphorylation-dependent interaction site in XRCC1 and a forkhead-associated domain in PNKP. Here, we identified using biochemical and biophysical approaches a second PNKP interaction site in XRCC1 that binds PNKP with lower affinity and independently of XRCC1 phosphorylation. However, this interaction nevertheless stimulated PNKP activity and promoted SSBR and cell survival. The low-affinity interaction site required the highly conserved Rev1-interacting region (RIR) motif in XRCC1 and included three critical and evolutionarily invariant phenylalanine residues. We propose a bipartite interaction model in which the previously identified high-affinity interaction acts as a molecular tether, holding XRCC1 and PNKP together and thereby promoting the low-affinity interaction identified here, which then stimulates PNKP directly. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  13. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  14. OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

    Directory of Open Access Journals (Sweden)

    Kevin M. Bradley

    2014-08-01

    Full Text Available Synthetic biologists wishing to self-assemble large DNA (L-DNA constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson–Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS, and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting" software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

  15. The interaction of hyperthermophilic TATA-box binding protein with single-stranded DNA is entropically favorable and exhibits a large negative heat capacity change at high salt concentration.

    Science.gov (United States)

    Nagatoishi, Satoru; Tanaka, Yoshikazu; Kudou, Motonori; Tsumoto, Kouhei

    2009-09-01

    We have investigated the thermodynamics of the interaction between the TATA-box-binding protein from Pyrococcus horikoshii (PhoTBP) and its target DNA (TATA-1). The interaction between PhoTBP and double-stranded DNA (dsDNA) is entropically favorable and enthalpically unfavorable. The thermodynamic parameters for TATA-1 duplex formation in the presence of PhoTBP, that is, ternary PhoTBP-dsDNA complexation, are similar to those for TATA-1 duplex formation, which is enthalpically favorable. Surface plasmon resonance analysis indicates that the interaction between PhoTBP and single-stranded DNA (ssDNA) of TATA-1 is entropy driven and has a large negative heat capacity change (-1.19 kcal mol(-1) K(-1)) at high salt concentration (800 mM NaCl). These results suggest that the favorable entropic effect corresponding to the interaction between PhoTBP and dsDNA is due not to ternary complexation but to the interaction between PhoTBP and ssDNA. This report is the first to describe the thermodynamics of the interaction between TBP and ssDNA.

  16. Suppression of DNA-dependent protein kinase sensitize cells to radiation without affecting DSB repair

    International Nuclear Information System (INIS)

    Gustafsson, Ann-Sofie; Abramenkovs, Andris; Stenerlöw, Bo

    2014-01-01

    Highlights: • We reduced the level of DNA-PKcs with siRNA and examined cells after γ-irradiation. • Low DNA-PKcs levels lead to radiosensitivity but did not affect repair of DSB. • Low DNA-PKcs levels may block progression of mitosis. • DNA-PKcs role in mitotic progression is independent of its role in DSB repair. • We suggest different mechanisms by which loss of DNA-PKcs function sensitize cells. - Abstract: Efficient and correct repair of DNA double-strand break (DSB) is critical for cell survival. Defects in the DNA repair may lead to cell death, genomic instability and development of cancer. The catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) is an essential component of the non-homologous end joining (NHEJ) which is the major DSB repair pathway in mammalian cells. In the present study, by using siRNA against DNA-PKcs in four human cell lines, we examined how low levels of DNA-PKcs affected cellular response to ionizing radiation. Decrease of DNA-PKcs levels by 80–95%, induced by siRNA treatment, lead to extreme radiosensitivity, similar to that seen in cells completely lacking DNA-PKcs and low levels of DNA-PKcs promoted cell accumulation in G2/M phase after irradiation and blocked progression of mitosis. Surprisingly, low levels of DNA-PKcs did not affect the repair capacity and the removal of 53BP1 or γ-H2AX foci and rejoining of DSB appeared normal. This was in strong contrast to cells completely lacking DNA-PKcs and cells treated with the DNA-PKcs inhibitor NU7441, in which DSB repair were severely compromised. This suggests that there are different mechanisms by which loss of DNA-PKcs functions can sensitize cells to ionizing radiation. Further, foci of phosphorylated DNA-PKcs (T2609 and S2056) co-localized with DSB and this was independent of the amount of DNA-PKcs but foci of DNA-PKcs was only seen in siRNA-treated cells. Our study emphasizes on the critical role of DNA-PKcs for maintaining survival after radiation exposure

  17. Suppression of DNA-dependent protein kinase sensitize cells to radiation without affecting DSB repair

    Energy Technology Data Exchange (ETDEWEB)

    Gustafsson, Ann-Sofie, E-mail: ann-sofie.gustafsson@bms.uu.se; Abramenkovs, Andris; Stenerlöw, Bo

    2014-11-15

    Highlights: • We reduced the level of DNA-PKcs with siRNA and examined cells after γ-irradiation. • Low DNA-PKcs levels lead to radiosensitivity but did not affect repair of DSB. • Low DNA-PKcs levels may block progression of mitosis. • DNA-PKcs role in mitotic progression is independent of its role in DSB repair. • We suggest different mechanisms by which loss of DNA-PKcs function sensitize cells. - Abstract: Efficient and correct repair of DNA double-strand break (DSB) is critical for cell survival. Defects in the DNA repair may lead to cell death, genomic instability and development of cancer. The catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) is an essential component of the non-homologous end joining (NHEJ) which is the major DSB repair pathway in mammalian cells. In the present study, by using siRNA against DNA-PKcs in four human cell lines, we examined how low levels of DNA-PKcs affected cellular response to ionizing radiation. Decrease of DNA-PKcs levels by 80–95%, induced by siRNA treatment, lead to extreme radiosensitivity, similar to that seen in cells completely lacking DNA-PKcs and low levels of DNA-PKcs promoted cell accumulation in G2/M phase after irradiation and blocked progression of mitosis. Surprisingly, low levels of DNA-PKcs did not affect the repair capacity and the removal of 53BP1 or γ-H2AX foci and rejoining of DSB appeared normal. This was in strong contrast to cells completely lacking DNA-PKcs and cells treated with the DNA-PKcs inhibitor NU7441, in which DSB repair were severely compromised. This suggests that there are different mechanisms by which loss of DNA-PKcs functions can sensitize cells to ionizing radiation. Further, foci of phosphorylated DNA-PKcs (T2609 and S2056) co-localized with DSB and this was independent of the amount of DNA-PKcs but foci of DNA-PKcs was only seen in siRNA-treated cells. Our study emphasizes on the critical role of DNA-PKcs for maintaining survival after radiation exposure

  18. Crystal structure and DNA-binding property of the ATPase domain of bacterial mismatch repair endonuclease MutL from Aquifex aeolicus.

    Science.gov (United States)

    Fukui, Kenji; Iino, Hitoshi; Baba, Seiki; Kumasaka, Takashi; Kuramitsu, Seiki; Yano, Takato

    2017-09-01

    DNA mismatch repair (MMR) system corrects mismatched bases that are generated mainly by DNA replication errors. The repair system excises the error-containing single-stranded region and enables the re-synthesis of the strand. In the early reactions of MMR, MutL endonuclease incises the newly-synthesized/error-containing strand of the duplex to initiate the downstream excision reaction. MutL endonuclease consists of the N-terminal ATPase and C-terminal endonuclease domains. In this study, we report the crystal structure of the ATPase domain of MutL endonuclease from Aquifex aeolicus. The overall structure of the domain was similar to those of human MutL homologs and Escherichia coli MutL, although E. coli MutL has no endonuclease activity. The ATPase domain was comprised of two subdomains: the N-terminal ATP-binding subdomain and the C-terminal α-β sandwich subdomain. Site-directed mutagenesis experiment identified DNA-interacting eight basic amino acid residues, which were distributed across both the two subdomains and formed a DNA-binding cleft. Docking simulation between the structures of the ATPase and endonuclease domains generated a reliable model structure for the full-length A. aeolicus MutL, which satisfies our previous result of small-angle X-ray scattering analysis. On the basis of the model structure and further experimental results, we concluded that the two separate DNA-binding sites in the full-length A. aeolicus MutL simultaneously bind a dsDNA molecule. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

    2003-01-01

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  20. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  1. A G-C-rich palindromic structural motif and a stretch of single-stranded purines are required for optimal packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA.

    Science.gov (United States)

    Jaballah, Soumeya Ali; Aktar, Suriya J; Ali, Jahabar; Phillip, Pretty Susan; Al Dhaheri, Noura Salem; Jabeen, Aayesha; Rizvi, Tahir A

    2010-09-03

    During retroviral RNA packaging, two copies of genomic RNA are preferentially packaged into the budding virus particles whereas the spliced viral RNAs and the cellular RNAs are excluded during this process. Specificity towards retroviral RNA packaging is dependent upon sequences at the 5' end of the viral genome, which at times extend into Gag sequences. It has earlier been suggested that the Mason-Pfizer monkey virus (MPMV) contains packaging sequences within the 5' untranslated region (UTR) and Gag. These studies have also suggested that the packaging determinants of MPMV that lie in the UTR are bipartite and are divided into two regions both upstream and downstream of the major splice donor. However, the precise boundaries of these discontinuous regions within the UTR and the role of the intervening sequences between these dipartite sequences towards MPMV packaging have not been investigated. Employing a combination of genetic and structural prediction analyses, we have shown that region "A", immediately downstream of the primer binding site, is composed of 50 nt, whereas region "B" is composed of the last 23 nt of UTR, and the intervening 55 nt between these two discontinuous regions do not contribute towards MPMV RNA packaging. In addition, we have identified a 14-nt G-C-rich palindromic sequence (with 100% autocomplementarity) within region A that has been predicted to fold into a structural motif and is essential for optimal MPMV RNA packaging. Furthermore, we have also identified a stretch of single-stranded purines (ssPurines) within the UTR and 8 nt of these ssPurines are duplicated in region B. The native ssPurines or its repeat in region B when predicted to refold as ssPurines has been shown to be essential for RNA packaging, possibly functioning as a potential nucleocapsid binding site. Findings from this study should enhance our understanding of the steps involved in MPMV replication including RNA encapsidation process. Copyright (c) 2010 Elsevier Ltd

  2. A single-stranded conformational polymorphism (SSCP)-derived quantitative variable to monitor the virulence of a Barley yellow dwarf virus-PAV (BYDV-PAV) isolate during adaptation to the TC14 resistant wheat line.

    Science.gov (United States)

    Delaunay, Agnes; Lacroix, Christelle; Morliere, Stephanie; Riault, Gerard; Chain, Florian; Trottet, Maxime; Jacquot, Emmanuel

    2010-09-01

    A standardized single-stranded conformational polymorphism (SSCP) procedure is proposed as an alternative to the time-consuming biological characterization of Barley yellow dwarf virus-PAV (BYDV-PAV) isolates. Using this procedure, six of 21 overlapping regions used to scan the viral genome gave patterns specific to '4E' (avirulent) or '4T' ('4E'-derived virulent) isolates. The calibration of samples and integration of SSCP patterns corresponding to the nucleotide region 1482-2023 allowed the estimation of P(T) values that reflect the proportions of a '4T'-specific band. Analysis of the biological (area under the pathogen progress curve) and molecular (P(T)) data suggested a positive linear relation between these variables. Moreover, sequence analysis of the nucleotide region 1482-2023 highlighted the presence of a nucleotide polymorphism (C/A(1835)) which can be considered as a candidate for virus-host interactions linked to the monitored virulence. According to these parameters, P(T) values associated with '4E'- and '4T'-derived populations show that: (i) long-term infection of a BYDV-PAV isolate on the 'TC14' resistant host leads to the fixation of virulent individuals in viral populations; and (ii) the introduction of susceptible hosts in successive 'TC14' infections results in the maintenance of low virulence of the populations. Thus, the presented study demonstrates that SSCP is a useful tool for monitoring viral populations during the host adaptation process. The described impact of host alternation provides new opportunities for the use of the 'TC14' resistance source in BYDV-resistant breeding programmes. This study is part of the global effort made by the scientific community to propose sustainable alternatives to the chemical control of this viral disease.

  3. Ex vivo gene editing of the dystrophin gene in muscle stem cells mediated by peptide nucleic acid single stranded oligodeoxynucleotides induces stable expression of dystrophin in a mouse model for Duchenne muscular dystrophy.

    Science.gov (United States)

    Nik-Ahd, Farnoosh; Bertoni, Carmen

    2014-07-01

    Duchenne muscular dystrophy (DMD) is a fatal disease caused by mutations in the dystrophin gene, which result in the complete absence of dystrophin protein throughout the body. Gene correction strategies hold promise to treating DMD. Our laboratory has previously demonstrated the ability of peptide nucleic acid single-stranded oligodeoxynucleotides (PNA-ssODNs) to permanently correct single-point mutations at the genomic level. In this study, we show that PNA-ssODNs can target and correct muscle satellite cells (SCs), a population of stem cells capable of self-renewing and differentiating into muscle fibers. When transplanted into skeletal muscles, SCs transfected with correcting PNA-ssODNs were able to engraft and to restore dystrophin expression. The number of dystrophin-positive fibers was shown to significantly increase over time. Expression was confirmed to be the result of the activation of a subpopulation of SCs that had undergone repair as demonstrated by immunofluorescence analyses of engrafted muscles using antibodies specific to full-length dystrophin transcripts and by genomic DNA analysis of dystrophin-positive fibers. Furthermore, the increase in dystrophin expression detected over time resulted in a significant improvement in muscle morphology. The ability of transplanted cells to return into quiescence and to activate upon demand was confirmed in all engrafted muscles following injury. These results demonstrate the feasibility of using gene editing strategies to target and correct SCs and further establish the therapeutic potential of this approach to permanently restore dystrophin expression into muscle of DMD patients. © 2014 AlphaMed Press.

  4. Decoding P4-ATPase substrate interactions.

    Science.gov (United States)

    Roland, Bartholomew P; Graham, Todd R

    Cellular membranes display a diversity of functions that are conferred by the unique composition and organization of their proteins and lipids. One important aspect of lipid organization is the asymmetric distribution of phospholipids (PLs) across the plasma membrane. The unequal distribution of key PLs between the cytofacial and exofacial leaflets of the bilayer creates physical surface tension that can be used to bend the membrane; and like Ca 2+ , a chemical gradient that can be used to transduce biochemical signals. PL flippases in the type IV P-type ATPase (P4-ATPase) family are the principle transporters used to set and repair this PL gradient and the asymmetric organization of these membranes are encoded by the substrate specificity of these enzymes. Thus, understanding the mechanisms of P4-ATPase substrate specificity will help reveal their role in membrane organization and cell biology. Further, decoding the structural determinants of substrate specificity provides investigators the opportunity to mutationally tune this specificity to explore the role of particular PL substrates in P4-ATPase cellular functions. This work reviews the role of P4-ATPases in membrane biology, presents our current understanding of P4-ATPase substrate specificity, and discusses how these fundamental aspects of P4-ATPase enzymology may be used to enhance our knowledge of cellular membrane biology.

  5. Sodium, potassium-atpases in algae and oomycetes.

    Science.gov (United States)

    Barrero-Gil, Javier; Garciadeblás, Blanca; Benito, Begoña

    2005-08-01

    We have investigated the presence of K(+)-transporting ATPases that belong to the phylogenetic group of animal Na(+),K(+)-ATPases in the Pythium aphanidermatum Stramenopile oomycete, the Porphyra yezoensis red alga, and the Udotea petiolata green alga, by molecular cloning and expression in heterologous systems. PCR amplification and search in EST databases allowed one gene to be identified in each species that could encode ATPases of this type. Phylogenetic analysis of the sequences of these ATPases revealed that they cluster with ATPases of animal origin, and that the algal ATPases are closer to animal ATPases than the oomycete ATPase is. The P. yezoensis and P. aphanidermatum ATPases were functionally expressed in Saccharomyces cerevisiae and Escherichia coli alkali cation transport mutants. The aforementioned cloning and complementary searches in silicio for H(+)- and Na(+),K(+)-ATPases revealed a great diversity of strategies for plasma membrane energization in eukaryotic cells different from typical animal, plant, and fungal cells.

  6. Formation of a Trimeric Xpo1-Ran[GTP]-Ded1 Exportin Complex Modulates ATPase and Helicase Activities of Ded1.

    Directory of Open Access Journals (Sweden)

    Glenn Hauk

    Full Text Available The DEAD-box RNA helicase Ded1, which is essential in yeast and known as DDX3 in humans, shuttles between the nucleus and cytoplasm and takes part in several basic processes including RNA processing and translation. A key interacting partner of Ded1 is the exportin Xpo1, which together with the GTP-bound state of the small GTPase Ran, facilitates unidirectional transport of Ded1 out of the nucleus. Here we demonstrate that Xpo1 and Ran[GTP] together reduce the RNA-stimulated ATPase and helicase activities of Ded1. Binding and inhibition of Ded1 by Xpo1 depend on the affinity of the Ded1 nuclear export sequence (NES for Xpo1 and the presence of Ran[GTP]. Association with Xpo1/Ran[GTP] reduces RNA-stimulated ATPase activity of Ded1 by increasing the apparent KM for the RNA substrate. Despite the increased KM, the Ded1:Xpo1:Ran[GTP] ternary complex retains the ability to bind single stranded RNA, suggesting that Xpo1/Ran[GTP] may modulate the substrate specificity of Ded1. These results demonstrate that, in addition to transport, exportins such as Xpo1 also have the capability to alter enzymatic activities of their cargo.

  7. Structural divergence between the two subgroups of P5 ATPases

    DEFF Research Database (Denmark)

    Sørensen, Danny Mollerup; Buch-Pedersen, Morten Jeppe; Palmgren, Michael Broberg

    2010-01-01

    Evolution of P5 type ATPases marks the origin of eukaryotes but still they remain the least characterized pumps in the superfamily of P-type ATPases. Phylogenetic analysis of available sequences suggests that P5 ATPases should be divided into at least two subgroups, P5A and P5B. P5A ATPases have....... Together these findings indicate that P5A and P5B ATPases are structurally and functionally different....

  8. Identification of DNA-Dependent Protein Kinase Catalytic Subunit (DNA-PKcs) as a Novel Target of Bisphenol A

    OpenAIRE

    Ito, Yuki; Ito, Takumi; Karasawa, Satoki; Enomoto, Teruya; Nashimoto, Akihiro; Hase, Yasuyoshi; Sakamoto, Satoshi; Mimori, Tsuneyo; Matsumoto, Yoshihisa; Yamaguchi, Yuki; Handa, Hiroshi

    2012-01-01

    Bisphenol A (BPA) forms the backbone of plastics and epoxy resins used to produce packaging for various foods and beverages. BPA is also an estrogenic disruptor, interacting with human estrogen receptors (ER) and other related nuclear receptors. Nevertheless, the effects of BPA on human health remain unclear. The present study identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs) as a novel BPA-binding protein. DNA-PKcs, in association with the Ku heterodimer (Ku70/80), is a cr...

  9. The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis

    OpenAIRE

    Jette, Nicholas; Lees-Miller, Susan P.

    2014-01-01

    The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemi...

  10. Inactivation of mitochondrial ATPase by ultraviolet light

    International Nuclear Information System (INIS)

    Chavez, E.; Cuellar, A.

    1984-01-01

    The present work describes experiments that show that far-ultraviolet irradiation induce the inhibition of ATPase activity in both membrane-bound and soluble F1. It was also found that ultraviolet light promotes the release of tightly bound adenine nucleotides from F1-ATPase. Experiments carried out with submitochondrial particles indicate that succinate partially protects against these effects of ultraviolet light. Titration of sulfhydryl groups in both irradiated submitochondrial particles and soluble F1-ATPase indicates that a conformational change induced by photochemical modifications of amino acid residues appears involved in the inactivation of the enzyme. Finally, experiments are described which show that the tyrosine residue located in the active site of F1-ATPase is modified by ultraviolet irradiation

  11. Mg,Ca-ATPase activity under irradiation

    International Nuclear Information System (INIS)

    Ladutin, V.V.; Orlova, V.V.; Lob, P.A.; Gerasiminko, I.V.; Mack, E.I.

    2003-01-01

    Full text: The influence of different doses irradiation at the Mg,Ca-ATPase activity at the rat brain has been investigated. The analyses were made at the apparatus of LKB and Carl-Ceis-Jena firm with help of reagents of Sigma and Boehringer firm. Rats decapitated after 1, 3, 6, 24 and 48 h after action of irradiation. Dose 0.206 C/kg. Erythrocytes. 1 and 3h after irradiation influence- decrease of Mg,Ca-ATPase activity to 86-87% relatively control level, 24 and 48 h - increase of activity to the control level. Dose 0.312 C/kg. Large hemispheres. 1h - decrease of ATPase activity to 90% relatively control, 3h - increase to control level, 24h - fall to 86%, after 48h small increase to 93% relatively control. Dose 9.287 C/kg. Large hemispheres. 1h - sharp fall of Mg, Ca-ATPase activity to 67 % relatively control, increase of activity to 96% after 3h and sharp fall of activity to 64% 6h after action of irradiation. Dose 9.287 C/kg. Cerebellum. 1h - sharp decrease of ATPase activity to 80%. After 3h -sharp increase to 160% relatively control level and sharp fall of ATPase activity to 47% relatively control after 6h. The mechanism of radiation pathology of active ion transport has been discussed

  12. Mutagenesis of the Agrobacterium VirE2 single-stranded DNA-binding protein identifies regions required for self-association and interaction with VirE1 and a permissive site for hybrid protein construction.

    Science.gov (United States)

    Zhou, X R; Christie, P J

    1999-07-01

    The VirE2 single-stranded DNA-binding protein (SSB) of Agrobacterium tumefaciens is required for delivery of T-DNA to the nuclei of susceptible plant cells. By yeast two-hybrid and immunoprecipitation analyses, VirE2 was shown to self-associate and to interact with VirE1. VirE2 mutants with small deletions or insertions of a 31-residue oligopeptide (i31) at the N or C terminus or with an i31 peptide insertion at Leu236 retained the capacity to form homomultimers. By contrast, VirE2 mutants with modifications outside a central region located between residues 320 and 390 retained the capacity to interact with VirE1. These findings suggest the tertiary structure of VirE2 is important for homomultimer formation whereas a central domain mediates formation of a complex with VirE1. The capacity of VirE2 mutants to interact with full-length VirE2 in the yeast Saccharomyces cerevisiae correlated with the abundance of the mutant proteins in A. tumefaciens, suggesting that VirE2 is stabilized by homomultimerization in the bacterium. We further characterized the promoter and N- and C-terminal sequence requirements for synthesis of functional VirE2. A PvirB::virE2 construct yielded functional VirE2 protein as defined by complementation of a virE2 null mutation. By contrast, PvirE or Plac promoter constructs yielded functional VirE2 only if virE1 was coexpressed with virE2. Deletion of 10 or 9 residues from the N or C terminus of VirE2, respectively, or addition of heterologous peptides or proteins to either terminus resulted in a loss of protein function. However, an i31 peptide insertion at Tyr39 had no effect on protein function as defined by the capacity of the mutant protein to (i) interact with native VirE2, (ii) interact with VirE1, (iii) accumulate at abundant levels in A. tumefaciens, and (iv) restore wild-type virulence to a virE2 null mutant. We propose that Tyr39 of VirE2 corresponds to a permissive site for insertion of heterologous peptides or proteins of interest

  13. The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis

    Science.gov (United States)

    Jette, Nicholas; Lees-Miller, Susan P.

    2015-01-01

    The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemistry, structure and function of DNA-PK, its roles in DNA double strand break repair and its newly described roles in mitosis and other cellular processes. PMID:25550082

  14. [The isolation and partial purification of 2 DNA-dependent DNA polymerases from Acholeplasma laidlawii PG-8].

    Science.gov (United States)

    Bezuglyĭ, S V; Babichev, V V; Skripal', I G; Malinovskaia, L P

    1991-01-01

    Two forms of DNA-dependent DNA-polymerase have been isolated and partially purified from the limited amount of biomass of cells Acholeplasma laidlawii PG-8, a typical representative of genus Acholeplasmataceae, as a result of successive chromatography on the columns with DEAE-cellulose DE-52 and Green A-sepharose. The first form of DNA-polymerase is eluted from the ion-exchange column with NaCl concentration of 0.1 M from the column with Green A-sepharose of 0.27 M, while the second form-with NaCl concentrations of 0.6 and 0.4 M, respectively. The both enzymatic activities are able to implement DNA synthesis. The conditions of DNA-polymerase production proved to be rather convenient for isolation of the concentrated and highly active enzymes.

  15. [The kinetic and functional characteristics of DNA-dependent DNA-polymerases in Acholeplasma laidlawii PG-8].

    Science.gov (United States)

    Bezuglyĭ, S V; Skripal', I G; Babichev, V V

    1993-01-01

    The kinetic and functional characteristics of I and II forms of DNA-dependent DNA-polymerases of Acholeplasma laidlawii PG-8 have been studied. It is stated that I form of DNA polymerase possesses 5'-3'-exonuclease activity and is a typical replicase; II form of DNA-polymerase possesses both 5'-3'-polymerase and 3'-5'-exonuclease activity and is, evidently, a reparase. Both forms of enzyme give preference to poly(U)- and poly(A)-matrices having extremely high activity on these polymers. The enzymatic reactions realized by both forms of DNA-polymerases are described by the first-order equation. The calculated Michaelis-Menten constants equaled 180 and 250 microM for I and II forms of polymerases, respectively. It indicates that affinity to substrate in II form of polymerase is one-third higher than in I form of enzyme.

  16. Mycobacterium smegmatis HelY Is an RNA-Activated ATPase/dATPase and 3'-to-5' Helicase That Unwinds 3'-Tailed RNA Duplexes and RNA:DNA Hybrids.

    Science.gov (United States)

    Uson, Maria Loressa; Ordonez, Heather; Shuman, Stewart

    2015-10-01

    Mycobacteria have a large and distinctive ensemble of DNA helicases that function in DNA replication, repair, and recombination. Little is known about the roster of RNA helicases in mycobacteria or their roles in RNA transactions. The 912-amino-acid Mycobacterium smegmatis HelY (MSMEG_3885) protein is a bacterial homolog of the Mtr4 and Ski2 helicases that regulate RNA 3' processing and turnover by the eukaryal exosome. Here we characterize HelY as an RNA-stimulated ATPase/dATPase and an ATP/dATP-dependent 3'-to-5' helicase. HelY requires a 3' single-strand RNA tail (a loading RNA strand) to displace the complementary strand of a tailed RNA:RNA or RNA:DNA duplex. The findings that HelY ATPase is unresponsive to a DNA polynucleotide cofactor and that HelY is unable to unwind a 3'-tailed duplex in which the loading strand is DNA distinguish HelY from other mycobacterial nucleoside triphosphatases/helicases characterized previously. The biochemical properties of HelY, which resemble those of Mtr4/Ski2, hint at a role for HelY in mycobacterial RNA catabolism. RNA helicases play crucial roles in transcription, RNA processing, and translation by virtue of their ability to alter RNA secondary structure or remodel RNA-protein interactions. In eukarya, the RNA helicases Mtr4 and Ski2 regulate RNA 3' resection by the exosome. Mycobacterium smegmatis HelY, a bacterial homolog of Mtr4/Ski2, is characterized here as a unidirectional helicase, powered by RNA-dependent ATP/dATP hydrolysis, that tracks 3' to 5' along a loading RNA strand to displace the complementary strand of a tailed RNA:RNA or RNA:DNA duplex. The biochemical properties of HelY suggest a role in bacterial RNA transactions. HelY homologs are present in pathogenic mycobacteria (e.g., M. tuberculosis and M. leprae) and are widely prevalent in Actinobacteria and Cyanobacteria but occur sporadically elsewhere in the bacterial domain. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  17. The plant plasma membrane H+-ATPase

    DEFF Research Database (Denmark)

    Ekberg, Kira

      The very high mobility of protons in aqueous solutions demands special features of membrane proton transporters to sustain efficient yet regulated proton transport across biological membranes. By the use of the chemical energy of ATP, plasma-membrane-embedded H+-ATPases extrude protons from cells...... of plants and fungi to generate electrochemical proton gradients. A recently published crystal structure of a plasma membrane H(+)-ATPase contributes to our knowledge about the mechanism of these essential enzymes. Together with biochemical and structural data presented in this thesis we are now able...... to describe the basic molecular components that allow the plasma membrane proton H+-ATPase to carry out proton transport against large membrane potentials. Moreover, a completely new paradigm for post-translational activation of these proteins is presented. The talk will focus on the following themes...

  18. Roles of transmembrane segment M1 of Na(+),K (+)-ATPase and Ca (2+)-ATPase, the gatekeeper and the pivot

    DEFF Research Database (Denmark)

    Einholm, Anja P.; Andersen, Jens Peter; Vilsen, Bente

    2007-01-01

    In this review we summarize mutagenesis work on the structure-function relationship of transmembrane segment M1 in the Na(+),K(+)-ATPase and the sarco(endo)plasmic reticulum Ca(2+)-ATPase. The original hypothesis that charged residues in the N-terminal part of M1 interact with the transported...... cations can be rejected. On the other hand hydrophobic residues in the middle part of M1 turned out to play crucial roles in Ca(2+) interaction/occlusion in Ca(2+)-ATPase and K(+) interaction/occlusion in Na(+),K(+)-ATPase. Leu(65) of the Ca(2+)-ATPase and Leu(99) of the Na(+),K(+)-ATPase, located...... of the extracytoplasmic gate in both the Ca(2+)-ATPase and the Na(+),K(+)-ATPase. Udgivelsesdato: 2007-Dec...

  19. P4 ATPases - lipid flippases and their role in disease

    NARCIS (Netherlands)

    Folmer, Dineke E.; Elferink, Ronald P. J. Oude; Paulusma, Coen C.

    2009-01-01

    P4 ATPases (type 4 P-type ATPases) are multispan transmembrane proteins that have been implicated in phospholipid translocation from the exoplasmic to the cytoplasmic leaflet of biological membranes. Studies in Saccharomyces cerevisiae have indicated that P4 ATPases are important in vesicle

  20. Na+/K+-ATPase: Activity and inhibition

    Science.gov (United States)

    Čolović, M.; Krstić, D.; Krinulović, K.; Momić, T.; Savić, J.; Vujačić, A.; Vasić, V.

    2009-09-01

    The aim of the study was to give an overview of the mechanism of inhibition of Na+/K+-ATPase activity induced by some specific and non specific inhibitors. For this purpose, the effects of some ouabain like compounds (digoxin, gitoxin), noble metals complexes ([PtCl2DMSO2], [AuCl4]-, [PdCl4]2-, [PdCl(dien)]+, [PdCl(Me4dien)]+), transition metal ions (Cu2+, Zn2+, Fe2+, Co2+), and heavy metal ions (Hg2+, Pb2+, Cd2+) on the activity of Na+/K+-ATPase from rat synaptic plasma membranes (SPM), porcine cerebral cortex and human erythrocytes were discussed.

  1. Myocardial Na,K-ATPase: Clinical aspects

    Science.gov (United States)

    Kjeldsen, Keld

    2003-01-01

    The specific binding of digitalis glycosides to Na,K-ATPase is used as a tool for Na,K-ATPase quantification with high accuracy and precision. In myocardial biopsies from patients with heart failure, total Na,K-ATPase concentration is decreased by around 40%; a correlation exists between a decrease in heart function and a decrease in Na,K-ATPase concentration. During digitalization, around 30% of remaining pumps are occupied by digoxin. Myocardial Na,K-ATPase is also influenced by other drugs used for the treatment of heart failure. Thus, potassium loss during diuretic therapy has been found to reduce myocardial Na,K-ATPase, whereas angiotensin-converting enzyme inhibitors may stimulate Na,K pump activity. Furthermore, hyperaldosteronism induced by heart failure has been found to decrease Na,K-ATPase activity. Accordingly, treatment with the aldosterone antagonist, spironolactone, may also influence Na,K-ATPase activity. The importance of Na,K pump modulation with heart disease, inhibition in digitalization and other effects of medication should be considered in the context of sodium, potassium and calcium regulation. It is recommended that digoxin be administered to heart failure patients who, after institution of mortality-reducing therapy, still have heart failure symptoms, and that the therapy be continued if symptoms are revealed or reduced. Digitalis glycosides are the only safe inotropic drugs for oral use that improve hemodynamics in heart failure. An important aspect of myocardial Na,K pump affection in heart disease is its influence on extracellular potassium (Ke) homeostasis. Two important aspects should be considered: potassium handling among myocytes, and effects of potassium entering the extracellular space of the heart via the bloodstream. It should be noted that both of these aspects of Ke homeostasis are affected by regulatory aspects, eg, regulation of the Na,K pump by physiological and pathophysiological conditions, as well as by medical

  2. The mechanism of Torsin ATPase activation.

    Science.gov (United States)

    Brown, Rebecca S H; Zhao, Chenguang; Chase, Anna R; Wang, Jimin; Schlieker, Christian

    2014-11-11

    Torsins are membrane-associated ATPases whose activity is dependent on two activating cofactors, lamina-associated polypeptide 1 (LAP1) and luminal domain-like LAP1 (LULL1). The mechanism by which these cofactors regulate Torsin activity has so far remained elusive. In this study, we identify a conserved domain in these activators that is predicted to adopt a fold resembling an AAA+ (ATPase associated with a variety of cellular activities) domain. Within these domains, a strictly conserved Arg residue present in both activating cofactors, but notably missing in Torsins, aligns with a key catalytic Arg found in AAA+ proteins. We demonstrate that cofactors and Torsins associate to form heterooligomeric assemblies with a defined Torsin-activator interface. In this arrangement, the highly conserved Arg residue present in either cofactor comes into close proximity with the nucleotide bound in the neighboring Torsin subunit. Because this invariant Arg is strictly required to stimulate Torsin ATPase activity but is dispensable for Torsin binding, we propose that LAP1 and LULL1 regulate Torsin ATPase activity through an active site complementation mechanism.

  3. Sodium-stimulated ATPase in Streptococcus faecalis.

    Science.gov (United States)

    Kinoshita, N; Unemoto, T; Kobayashi, H

    1984-06-01

    We measured Na+-stimulated ATPase activity in a mutant of Streptococcus faecalis defective in the generation of proton motive force. The activity in membrane vesicles was 62.1 +/- 5.9 nmol of phosphate produced per min per mg of protein when cells were grown on medium containing 0.12 M Na+. Activity decreased as the concentration of Na+ in the growth medium decreased. The decrease in enzyme activity corresponded to the decrease in transport activity for Na+ in both whole cells and membrane vesicles. The effects of pH on both activities were identical. Thus, it is suggested that Na+ movement is mediated by this enzyme. Sodium extrusion and ATPase activity in the wild-type strain were markedly lower than those observed in the mutant strain. Elevated activities of both Na+ extrusion and Na+-stimulated ATPase could be detected in the wild-type strain when cells were grown in the absence of proton motive force. Thus, we propose that the level of ATPase is increased by dissipation of the proton motive force.

  4. Dicyclohexylcarbodiimide-sensitive ATPase in Halobacterium saccharovorum

    Science.gov (United States)

    Kristjansson, H.; Hochstein, L. I.

    1985-01-01

    Membranes from Halobacterium saccharovorum contained a cryptic ATPase which required Mg(2+) or Mn(2+) and was activated by Triton X-100. The optimal pH for ATP hydrolysis was 9-10. ATP or GTP were hydrolyzed at the same rate while ITP, CTP, and UTP were hydrolyzed at about half that rate. The products of ATP hydrolysis were ADP and phosphate. The ATPase required high concentrations (3.5 M) of NaCl for maximum activity. ADP was a competitive inhibitor of the activity, with an apparent Ki of 50 micro-M. Dicyclohexylcarbodiimide (DCCD) inhibited ATP hydrolysis. The inhibition was marginal at the optimum pH of the enzyme. When the ATPase was preincubated with DCCD at varying pH values, but assayed at the optimal pH for activity, DCCD inhibition was observed to increase with increasing acidity of the preincubation medium. DCCD inhibition was also dependent on time of preincubation, and protein and DCCD concentrations. When preincubated at pH 6.0 for 4 h at a protein:DCCD ratio of 40 (w/w), ATPase activity was inhibited 90 percent.

  5. Nucleotide binding to Na+/K+-ATPase

    Czech Academy of Sciences Publication Activity Database

    Kubala, Martin; Lánský, Zdeněk; Ettrich, R.; Plášek, J.; Teisinger, Jan; Amler, Evžen

    2005-01-01

    Roč. 272, č. S1 (2005), s. 191-191 E-ISSN 1742-4658. [FEBS Congress /30./ and IUBMB Conference /9./. 02.07.2005-07.07.2005, Budapest] Keywords : Na+/K+- ATPase * ATP binding * TNP-ATP Subject RIV: BO - Biophysics

  6. Putative DNA-dependent RNA polymerase in Mitochondrial Plasmid of Paramecium caudatum Stock GT704

    Directory of Open Access Journals (Sweden)

    Trina Ekawati Tallei

    2015-10-01

    Full Text Available Mitochondria of Paramecium caudatum stock GT704 has a set of four kinds of linear plasmids with sizes of 8.2, 4.1, 2.8 and 1.4 kb. The plasmids of 8.2 and 2.8 kb exist as dimers consisting of 4.1- and 1.4-kb monomers, respectively. The plasmid 2.8 kb, designated as pGT704-2.8, contains an open reading frame encodes for putative DNA-dependent RNA polymerase (RNAP. This study reveals that this RNAP belongs to superfamily of DNA/RNA polymerase and family of T7/T3 single chain RNA polymerase and those of mitochondrial plasmid of fungi belonging to Basidiomycota and Ascomycota. It is suggested that RNAP of pGT704-2.8 can perform transcription without transcription factor as promoter recognition. Given that only two motifs were found, it could not be ascertained whether this RNAP has a full function independently or integrated with mtDNA in carrying out its function.

  7. [The effect of physicochemical factors on the activity of DNA-dependent DNA polymerases in Acholeplasma laidlawii PG-8].

    Science.gov (United States)

    Bezuglyĭ, S V; Skripal', I G; Babichev, V V; Malinovskaia, L P

    1992-01-01

    The biological and physico-chemical properties of DNA-dependent DNA-polymerases of Acholeplasma laidlawii PG-8 have been studied. The optimal parameters of maximal enzymatic activity are determined. It is stated that N-ethylmaleimide in concentration of 1 mM activated DNA-polymerase I by 52%, whereas DNA-polymerase II with reagent concentration of 0.5 mM demonstrated the peak of activity exceeding the control only by 10%. Spermidine in concentration of 1.5 mM for the first form of DNA-polymerase and 0.15 mM-for the second one increased the ability of both forms of polymerases to synthesize DNA by 10%. Aphidicolin added to the reaction medium up to concentration of 10 mg/ml decreased activity of forms I and II of enzymes by 83 and 68%, respectively. The presence of 0.6 mM of EDTA in the medium also negatively affected the activity of polymerases inhibiting it by 83% in form I and by 77%-in form II.

  8. Heterogeneous nuclear ribonucleoprotein B1 protein impairs DNA repair mediated through the inhibition of DNA-dependent protein kinase activity

    International Nuclear Information System (INIS)

    Iwanaga, Kentaro; Sueoka, Naoko; Sato, Akemi; Hayashi, Shinichiro; Sueoka, Eisaburo

    2005-01-01

    Heterogeneous nuclear ribonucleoprotein B1, an RNA binding protein, is overexpressed from the early stage of lung cancers; it is evident even in bronchial dysplasia, a premalignant lesion. We evaluated the proteins bound with hnRNP B1 and found that hnRNP B1 interacted with DNA-dependent protein kinase (DNA-PK) complex, and recombinant hnRNP B1 protein dose-dependently inhibited DNA-PK activity in vitro. To test the effect of hnRNP B1 on DNA repair, we performed comet assay after irradiation, using normal human bronchial epithelial (HBE) cells treated with siRNA for hnRNP A2/B1: reduction of hnRNP B1 treated with siRNA for hnRNP A2/B1 induced faster DNA repair in normal HBE cells. Considering these results, we assume that overexpression of hnRNP B1 occurring in the early stage of carcinogenesis inhibits DNA-PK activity, resulting in subsequent accumulation of erroneous rejoining of DNA double-strand breaks, causing tumor progression

  9. The parietal cell gastric H, K-ATPase also functions as the Na, K-ATPase and Ca-ATPase in altered states.

    Science.gov (United States)

    Ray, Tushar

    2013-01-01

    This article offers an explanation for the apparent lack of Na, K-ATPase activity in parietal cells although ouabain has been known to inhibit gastric acid secretion since 1962. The gastric H, K-ATPase (proton-pump) seems to be acting in altered states, thus behaving like a Na, K-ATPase (Na-pump) and/or Ca-ATPase (Ca-pump) depending on cellular needs.  This conclusion is based on the following findings. First, parietal cell fractions do not exhibit Na, K-ATPase activity at pH 7.0 but do at pH 8.5. Second, the apical plasma membrane (APM) fraction exhibits a (Ca or Mg)-ATPase activity with negligible H, K-ATPase activity. However, when assayed with Mg alone in presence of the 80 k Da cytosolic proton-pump activator (HAF), the APM fraction reveals remarkably high H, K-ATPase activity, suggesting the observed low affinity of Ca (or Mg)-ATPase is an altered state of the latter. Third, calcium (between 1 and 4 µM) shows both stimulation and inhibition of the HAF-stimulated H, K-ATPase depending on its concentration, revealing a close interaction between the  proton-pump activator and local Ca concentration in gastric H, K-ATPase function. Such interactions suggest that Ca is acting as a terminal member of the intracellular signaling system for the HAF-regulated proton-pump. It appears that during resting state, the HAF-associated H, K-ATPase remains inhibited by Ca (>1 µM) and, prior to resumption of acid secretion the gastric H, K-ATPase acts temporarily as a Ca-pump for removing excess Ca from its immediate environment. This conclusion is consistent with the recent reports of immunochemical co-localization of the gastric H, K-ATPase and Ca-ATPase by superimposition in parietal cells, and a transitory efflux of Ca immediately preceding the onset of acid secretion. These new perspectives on proton-pump function would open new avenues for a fuller understanding of the intracellular regulation of the ubiquitous Na-pump.

  10. The DNA translocase RAD5A acts independently of the other main DNA repair pathways, and requires both its ATPase and RING domain for activity in Arabidopsis thaliana.

    Science.gov (United States)

    Klemm, Tobias; Mannuß, Anja; Kobbe, Daniela; Knoll, Alexander; Trapp, Oliver; Dorn, Annika; Puchta, Holger

    2017-08-01

    Multiple pathways exist to repair DNA damage induced by methylating and crosslinking agents in Arabidopsis thaliana. The SWI2/SNF2 translocase RAD5A, the functional homolog of budding yeast Rad5 that is required for the error-free branch of post-replicative repair, plays a surprisingly prominent role in the repair of both kinds of lesions in Arabidopsis. Here we show that both the ATPase domain and the ubiquitination function of the RING domain of the Arabidopsis protein are essential for the cellular response to different forms of DNA damage. To define the exact role of RAD5A within the complex network of DNA repair pathways, we crossed the rad5a mutant line with mutants of different known repair factors of Arabidopsis. We had previously shown that RAD5A acts independently of two main pathways of replication-associated DNA repair defined by the helicase RECQ4A and the endonuclease MUS81. The enhanced sensitivity of all double mutants tested in this study indicates that the repair of damaged DNA by RAD5A also occurs independently of nucleotide excision repair (AtRAD1), single-strand break repair (AtPARP1), as well as microhomology-mediated double-strand break repair (AtTEB). Moreover, RAD5A can partially complement for a deficient AtATM-mediated DNA damage response in plants, as the double mutant shows phenotypic growth defects. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  11. Structural relationships among the multiple forms of DNA-dependent RNA polymerase II from cultured parsley cells

    International Nuclear Information System (INIS)

    Link, G.; Bogorad, L.; Kidd, G.H.; Richter, G.

    1978-01-01

    DNA-dependent RNA polymerase II (or B) was purified from cultured parsley cells, and its molecular structure was examined in detail. Upon centrifugation through glycerol gradients, RNA polymerase II sediments as a single band with an apparent sedimentation constant of 15S. No contamination with RNA polymerases I or III could be detected when the activity of purified RNA polymerase II was assayed in the presence of high concentrations of α-amanitin. Analysis of purified RNA polymerase II be nondenaturing and denaturing polyacrylamide gel electrophoresis revealed that this enzyme exists in multiple forms. They were designated II(O), II(A), and II(B). It is suggested that each form has a subunit of Mr = 140000 as well as smaller polypeptides in common. They differ, however, in the molecular weights of their largest subunits which is 220000 in form II(O), 200000 in form II(A), and 180000 in form II(B). These large subunits were labelled with 125 I, digested with trypsin, and tryptic digests were compared by two-dimensional analysis on thin-layer plates (Elder et al. (1977) J. Biol. Chem. 252, 6510-6515). Fingerprints of tryptic digests from the polypeptides with Mr = 220000, Mr = 200000, and Mr = 180000 were similar. It is, therefore, suggested that these subunits are stucturally related. A tryptic digest was also produced from the subunit with Mr = 140000. Its fingerprint was found to yield a considerably different distribution of peptides as compared to those from the three large subunits. (orig.) [de

  12. Identification of DNA-dependent protein kinase catalytic subunit (DNA-PKcs as a novel target of bisphenol A.

    Directory of Open Access Journals (Sweden)

    Yuki Ito

    Full Text Available Bisphenol A (BPA forms the backbone of plastics and epoxy resins used to produce packaging for various foods and beverages. BPA is also an estrogenic disruptor, interacting with human estrogen receptors (ER and other related nuclear receptors. Nevertheless, the effects of BPA on human health remain unclear. The present study identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs as a novel BPA-binding protein. DNA-PKcs, in association with the Ku heterodimer (Ku70/80, is a critical enzyme involved in the repair of DNA double-strand breaks. Low levels of DNA-PK activity are previously reported to be associated with an increased risk of certain types of cancer. Although the Kd for the interaction between BPA and a drug-binding mutant of DNA-PKcs was comparatively low (137 nM, high doses of BPA were required before cellular effects were observed (100-300 μM. The results of an in vitro kinase assay showed that BPA inhibited DNA-PK kinase activity in a concentration-dependent manner. In M059K cells, BPA inhibited the phosphorylation of DNA-PKcs at Ser2056 and H2AX at Ser139 in response to ionizing radiation (IR-irradiation. BPA also disrupted DNA-PKcs binding to Ku70/80 and increased the radiosensitivity of M059K cells, but not M059J cells (which are DNA-PKcs-deficient. Taken together, these results provide new evidence of the effects of BPA on DNA repair in mammalian cells, which are mediated via inhibition of DNA-PK activity. This study may warrant the consideration of the possible carcinogenic effects of high doses of BPA, which are mediated through its action on DNA-PK.

  13. Sperm Na+, K+-ATPase α4 and plasma membrane Ca2+-ATPase (PMCA) 4 regulation in asthenozoospermia.

    Science.gov (United States)

    Lestari, Silvia W; Miati, Dessy Noor; Seoharso, P; Sugiyanto, R; Pujianto, Dwi A

    2017-10-01

    Asthenozoospermia, which is characterized by reduced motility, is one of the etiologies of male infertility. Its biochemical and functional consequences include altered ATPase activity. This study investigated the activities of Na + , K + -ATPase and Ca 2+ -ATPase and the expression of Na + , K + -ATPase α4 and PMCA4 isoforms in human sperm of asthenozoospermic infertile men. Nineteen samples from asthenozoospermic infertile couples were examined in this study. Computerized-assisted semen analysis (CASA) was performed, and the enzyme activity was measured based on the ability of ATPase to release organic phosphate from ATP as a substrate. The Na + , K + -ATPase α4 and PMCA4 isoform expression levels were measured by western immunoblotting, whereas the protein distribution was examined by immunocytochemistry. This showed that the Na + , K + -ATPase activity and the Na + , K + -ATPase α4 isoform expression were lower in the asthenozoospermia group than in the normozoospermia group (8.688±1.161 versus 13.851±1.884 µmol Pi/mg protein/h, respectively; p>0.05). In contrast, the Ca 2+ -ATPase activity was significantly higher in the asthenozoospermia group than in the normozoospermia group (11.154±1.186 versus 2.725±0.545 µmol Pi/mg protein/h, respectively; p0.05). The altered ATPase activity and isoform expression in asthenozoospermia may impair sperm structure and function.

  14. Lithium-induced inhibition of Na-K ATPase and Ca ATPase activities in rat brain synaptosome.

    Science.gov (United States)

    Cho, Y. W.

    1995-01-01

    To explore the action mechanism of lithium in the brain, the author investigated the effects of lithium on Na-K ATPase and Ca ATPase in rat brain synaptosomes prepared from forebrains by the method of Booth and Clark. The activities of Na-K ATPase and Ca ATPase were assayed by the level of inorganic phosphate liberated from the hydrolysis of ATP. Lithium at the optimum therapeutic concentration of 1 mM decreased the activity of Na-K ATPase from the control value of 19.08 +/- 0.29 to 18.27 +/- 0.10 micromoles Pi/mg protein/h and also reduced the activity of Ca ATPase from 6.38 +/- 0.12 to 5.64 +/- 0.12 micromoles Pi/mg protein/h. The decreased activity of Na-K ATPase will decrease the rate of Ca2+ efflux, probably via an Na-Ca exchange mechanism and will increase the rate of Ca2+ entry by the depolarization of nerve terminals. The reduced activity of Ca ATPase will result in the decreased efflux of Ca2+. As a Conclusion, it can be speculated that lithium elevates the intrasynaptosomal Ca2+ concentration via inhibition of the activities of Na-K ATPase and Ca ATPase, and this increased [Ca2+]i will cause the release of neurotransmitters and neurological effects of lithium. PMID:7598829

  15. Overproduction of PIB-Type ATPases

    DEFF Research Database (Denmark)

    Liu, Xiangyu; Sitsel, Oleg; Wang, Kaituo

    2016-01-01

    Understanding of the functions and mechanisms of fundamental processes in the cell requires structural information. Structural studies of membrane proteins typically necessitate large amounts of purified and preferably homogenous target protein. Here, we describe a rapid overproduction and purifi...... and purification strategy of a bacterial PIB-type ATPase for isolation of milligrams of target protein per liter Escherichia coli cell culture, with a final quality of the sample which is sufficient for generating high-resolution crystals....

  16. Mutational analysis of yeast vacuolar H+ -ATPase

    International Nuclear Information System (INIS)

    Noumi, Takato; Beltran, C.; Nelson, H.; Nelson, N.

    1991-01-01

    Yeast mutants in which genes encoding subunits of the vacuolar H + -ATPase were interrupted were assayed for their vacuolar ATPase and proton-uptake activities. The vacuoles from the mutants lacking subunits A (72 kDa), B (57 kDa), or c (proteolipid, 16 kDa) were completely inactive in these reactions. Immunological studies revealed that in the absence of each one of those subunits the catalytic sector was not assembled. Labeling with N,N' -[ 14 C]dicyclohexylcarbodiimide showed the presence of the proteolipid in vacuoles of mutants in which genes encoding subunits of the catalytic sectors were interrupted. No labeling was detected in the mutant in which the gene encoding the proteolipid was interrupted. The authors conclude that of all the ATPase subunits only the proteolipid is assembled independently and it serves as a template for the assembly of the other subunits. Site-specific mutations were generated in the gene encoding the proteolipid. All of the drastic changes and replacements gave inactive proteins. About half of the single amino acid replacements gave active proteins. Replacing glutamic acid-137 by any of several amino acids, except for aspartic acid, abolished the activity of the enzyme. Other amino acids that may function in proton conductance were changed. It was found that glycine residues may replace amino acids with exchangeable protons

  17. Transcriptional regulators of Na, K-ATPase subunits

    OpenAIRE

    Zhiqin eLi; Sigrid A Langhans

    2015-01-01

    The Na,K-ATPase classically serves as an ion pump creating an electrochemical gradient across the plasma membrane that is essential for transepithelial transport, nutrient uptake and membrane potential. In addition, Na,K-ATPase also functions as a receptor, a signal transducer and a cell adhesion molecule. With such diverse roles, it is understandable that the Na,K-ATPase subunits, the catalytic alpha-subunit, the beta-subunit and the FXYD proteins, are controlled extensively during developme...

  18. Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls.

    Science.gov (United States)

    Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B

    2015-12-01

    Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.

  19. Transcriptional regulators of Na, K-ATPase subunits

    Directory of Open Access Journals (Sweden)

    Zhiqin eLi

    2015-10-01

    Full Text Available The Na,K-ATPase classically serves as an ion pump creating an electrochemical gradient across the plasma membrane that is essential for transepithelial transport, nutrient uptake and membrane potential. In addition, Na,K-ATPase also functions as a receptor, a signal transducer and a cell adhesion molecule. With such diverse roles, it is understandable that the Na,K-ATPase subunits, the catalytic alpha-subunit, the beta-subunit and the FXYD proteins, are controlled extensively during development and to accommodate physiological needs. The spatial and temporal expression of Na,K-ATPase is partially regulated at the transcriptional level. Numerous transcription factors, hormones, growth factors, lipids and extracellular stimuli modulate the transcription of the Na,K-ATPase subunits. Moreover, epigenetic mechanisms also contribute to the regulation of Na,K-ATPase expression. With the ever growing knowledge about diseases associated with the malfunction of Na,K-ATPase, this review aims at summarizing the best-characterized transcription regulators that modulate Na,K-ATPase subunit levels. As abnormal expression of Na,K-ATPase subunits have been observed in many carcinoma, we will also discuss transcription factors that are associated with epithelial-to-mesenchymal transition, a crucial step in the progression of many tumors to malignant disease.

  20. Na(+),K (+)-ATPase as a docking station: protein-protein complexes of the Na(+),K (+)-ATPase.

    Science.gov (United States)

    Reinhard, Linda; Tidow, Henning; Clausen, Michael J; Nissen, Poul

    2013-01-01

    The Na(+),K(+)-ATPase, or sodium pump, is well known for its role in ion transport across the plasma membrane of animal cells. It carries out the transport of Na(+) ions out of the cell and of K(+) ions into the cell and thus maintains electrolyte and fluid balance. In addition to the fundamental ion-pumping function of the Na(+),K(+)-ATPase, recent work has suggested additional roles for Na(+),K(+)-ATPase in signal transduction and biomembrane structure. Several signaling pathways have been found to involve Na(+),K(+)-ATPase, which serves as a docking station for a fast-growing number of protein interaction partners. In this review, we focus on Na(+),K(+)-ATPase as a signal transducer, but also briefly discuss other Na(+),K(+)-ATPase protein-protein interactions, providing a comprehensive overview of the diverse signaling functions ascribed to this well-known enzyme.

  1. Structural studies of the vacuolar membrane ATPase from Neurospora crassa and comparison with the tonoplast membrane ATPase and Zea mays

    International Nuclear Information System (INIS)

    Bowman, E.J.; Mandala, S.; Taiz, L.; Bowman, B.J.

    1986-01-01

    The H + translocating ATPase located on vacuolar membranes of Neurospora crassa was partially purified by solubilization in two detergents, Triton X-100 and N-hexadecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate, followed by centrifugation on sucrose density gradients. Two polypeptides of M/sub r/ ≅ 70,000 and ≅ 62,000 consistently migrated with activity, along with several minor bands of lower molecular weight. Radioactively labeled inhibitors of ATPase activity, N-[ 14 C]ethylmaleimide and 7-chloro-4-nitro[ 14 C]benzo-2-oxa-1,3-diazole, labeled the M/sub r/ ≅ 70,000 polypeptide; this labeling was reduced in the presence of ATP. N,N'-[ 14 C]dicyclohexylcarbodiimide labeled a polypeptide of M/sub r/ ≅ 15,000. Estimation of the functional size of the vacuolar membrane ATPase by radiation inactivation gave a value of M/sub r/ 5.2 x 10 5 , 10-15% larger than the mitochondrial ATPase. The Neurospora vacuolar ATPase showed no crossreactivity with antiserum to plasma membrane or mitochrondrial ATPase but stongly crossreacted with antiserum against a polypeptide of M/sub r/ ≅ 70,000 associated with the tonoplast ATPase of corn coleoptiles. These results suggest that fungal and plant vacuolar ATPases may be large multisubunit complexes, somewhat similar to, but immunologically distinct from, known F 0 F 1 ATPases

  2. Ecto-ATPase activity of vertebrate blood cells.

    Science.gov (United States)

    Bencic, D C; Yates, T J; Ingermann, R L

    1997-01-01

    Ecto-ATPase activity was measured for red blood cells, white blood cells, and whole blood from a variety of vertebrates. A large range of red blood cell ecto-ATPase activity was observed; for example, at 10 degrees C, red blood cells from a catastomid fish (Catostomus macrocheilus) and a newt (Taricha rivularis) had activities of 56 +/- 9 and 25,000,000 +/- 14,000,000 pmol ATP per 10(6) red blood cells per hour, respectively (mean +/- SD). Several control experiments verified that the measured ATPase activity was not the result of intracellular ATPases released due to cell damage or lysis nor due to the release of intracellular nucleoside triphosphate or uptake of extracellular ATP. Red blood cell ecto-ATPase activity was relatively low within the teleosts, was high within the reptiles, and had the greatest range and single highest value within the amphibians. Within the endotherms, avian red blood cell ecto-ATPase activities were greater than mammalian red blood cell ecto-ATPase activities, which were the lowest for all vertebrates examined. The lowest ecto-ATPase activities measured were for human and skunk red blood cells, which had activities of 13 +/- 1 and 11 +/- 2 pmol ATP per 10(6) red blood cells per hour, respectively, at 35 degrees C. Ecto-ATPase activity was measured in white blood cells of several vertebrate species and appeared generally high and less variable than red blood cell ecto-ATPase activity. Measured whole blood ecto-ATPase activity showed a range of three orders of magnitude and correlated positively with red blood cell ecto-ATPase activities. Ecto-ATPase activity was also determined for red blood cells from fetal, 1-3 d old neonatal, and pregnant garter snakes (Thamnophis elegans); these activities were not significantly different from the activity of red blood cells from nonpregnant adult females. Overall, the data from the present study demonstrate a wide range of red blood cell and whole blood ecto-ATPase activities among vertebrates

  3. Phosphorylation of the Na+,K+-ATPase and the H+,K+-ATPase

    DEFF Research Database (Denmark)

    Poulsen, Hanne; Morth, Jens Preben; Jensen, Jan Egebjerg

    2010-01-01

    pumps are very homologous, and at least one of the phosphorylation sites is conserved, namely a cAMP activated protein kinase (PKA) site, which is important for regulating pumping activity, either by changing the cellular distribution of the ATPases or by directly altering the kinetic properties...

  4. Trypsin-induced ATPase activity in potato mitochondria

    Energy Technology Data Exchange (ETDEWEB)

    Jung, D.W.; Laties, G.G.

    1976-04-01

    Potato mitochondria (Solanum tuberosum var. Russet Burbank), which readily phosphorylate ADP in oxidative phosphorylation, show low levels of ATPase activity which is stimulated neither by Mg/sup 2 +/, 2,4-dinitrophenol, incubation with respiratory substrates, nor disruption by sonication or treatment with Triton X-100, individually or in concert. Treatment of disrupted potato mitochondria with trypsin stimulates Mg/sup 2 +/-dependent, oligomycin-sensitive ATPase activity 10- to 15-fold, suggesting the presence of an ATPase inhibitor protein. Trypsin-induced ATPase activity was unaffected by uncoupler. Oligomycin-sensitive ATPase activity decreases as exposure to trypsin is increased. Incubation at alkaline pH or heating at 60/sup 0/C for 2 minutes also activates ATPase of sonicated potato mitochondria. Disruption of cauliflower (Brassica oleracea), red sweet potato (Ipomoea batatas), and carrot (Daucus carota) mitochondria increases ATPase activity, which is further enhanced by treatment with trypsin. The significance of the tight association of the inhibitor protein and ATPase in potato mitochondria is not clear.

  5. Substrate Specificity of Na+,Cl-(HCO3-)-ATPase.

    Science.gov (United States)

    Yurkiv, V A; Melikhov, V I; Shubin, V S

    2016-09-01

    We studied substrate specificity of Na + ,Cl - (HCO 3 - )-ATPase. In most cases, replacement of ATP for other phosphate-containing substances resulted in not only pronounced suppression of phosphohydrolase reactions, but also dramatic changes of their responsiveness to the stimulating effect of monovalent ions. The data showed that Na + ,Cl - (HCO 3 - )-ATPase is a highly specific enzyme for ATP.

  6. On Allosteric Modulation of P-Type Cu+-ATPases

    DEFF Research Database (Denmark)

    Mattle, Daniel; Sitsel, Oleg; Autzen, Henriette E.

    2013-01-01

    -specific sequence motifs and structural elements that are linked to transport specificity and mechanistic modulation. Here we provide an overview of the Cu+-transporting ATPases (of subclass PIB) and compare them to the well-studied sarco(endo)plasmic reticulum Ca2 +-ATPase (of subclass PIIA). Cu+ ions in the cell...

  7. A plasma membrane H + ATPase gene is germinationinduced in ...

    African Journals Online (AJOL)

    The expression pattern of a germination specific plasma membrane H+-ATPase was analyzed by RTPCR and in situ RNA hybridization methods. RT-PCR results revealed that germination specific plasma membrane H+-ATPase accumulation was detectable in all organs and tissues of germinating wheat embryos.

  8. A plasma membrane H ATPase gene is germination- induced in ...

    African Journals Online (AJOL)

    ONOS

    2010-01-18

    Jan 18, 2010 ... The expression pattern of a germination specific plasma membrane H+-ATPase was analyzed by RT-. PCR and in situ RNA hybridization methods. RT-PCR results revealed that germination specific plasma membrane H+-ATPase accumulation was detectable in all organs and tissues of germinating wheat.

  9. Regulation of the Plasma Membrane H+-ATPase

    DEFF Research Database (Denmark)

    Falhof, Janus

    The plasma membrane (PM) H+-ATPase is responsible for generating the electrochemical gradientthat drives the secondary transport of nutrients across the cellular membrane. It belongs to a familyof cation and lipid transporters that are vital to many organisms. PM H+-ATPases are Type P3AATPases...

  10. Sodium-stimulated ATPase in Streptococcus faecalis.

    OpenAIRE

    Kinoshita, N; Unemoto, T; Kobayashi, H

    1984-01-01

    We measured Na+-stimulated ATPase activity in a mutant of Streptococcus faecalis defective in the generation of proton motive force. The activity in membrane vesicles was 62.1 +/- 5.9 nmol of phosphate produced per min per mg of protein when cells were grown on medium containing 0.12 M Na+. Activity decreased as the concentration of Na+ in the growth medium decreased. The decrease in enzyme activity corresponded to the decrease in transport activity for Na+ in both whole cells and membrane ve...

  11. Na, K-ATPase as signaling transducer

    OpenAIRE

    Li, Juan

    2007-01-01

    It is now generally agreed that Na,K-ATPase (NKA), in addition to its role in the maintenance of Na+ and K+ gradients across the cell membrane, is a signal transducer. Our group has identified a novel signaling pathway where NKA interact with IP3R to form a signaling microdomain. Ouabain, a specific ligand of NKA, activates this pathway, triggers slow Ca2+ oscillations and activates NF-κB. In current study, the molecular mechanisms and some important downstream effects of NK...

  12. Elucidating Functional Aspects of P-type ATPases

    DEFF Research Database (Denmark)

    Autzen, Henriette Elisabeth

    2015-01-01

    P-type ATPases are proteins that act to maintain ion homeostasis and electrochemical gradients through the translocation of cations across cell membranes. Underscoring their significance in humans, dysfunction of the ATPases can lead to crucial diseases. Dysfunction of the sarco(endo)plasmic reti......P-type ATPases are proteins that act to maintain ion homeostasis and electrochemical gradients through the translocation of cations across cell membranes. Underscoring their significance in humans, dysfunction of the ATPases can lead to crucial diseases. Dysfunction of the sarco...... and parasites makes it an attractive target for novel drugs, battling the near-future threat of antimicrobial resistance. Consequently, unveiling how these two ATPases function at the atomistic level will not only advance basic bioscience, but provide a framework for designing a new generation of drugs against...

  13. Thermophilic P-loop transport ATPases : Enzyme function and energetics at high temperature

    NARCIS (Netherlands)

    Pretz, Monika Gyöngyi

    2007-01-01

    Primary transport ATPases are divided into several superfamilies; amongst others including ATPases of the ABC transporter superfamily, the F-ATPase superfamily or the motor ATPases of the General Secretory (Sec) pathway. Motor proteins from these superfamilies show a low sequence similarity, except

  14. The amino-terminal 200 amino acids of the plasma membrane Na+,K+-ATPase alpha subunit confer ouabain sensitivity on the sarcoplasmic reticulum Ca(2+)-ATPase.

    OpenAIRE

    Ishii, T; Takeyasu, K

    1993-01-01

    Cardiac glycosides such as G-strophanthin (ouabain) bind to and inhibit the plasma membrane Na+,K(+)-ATPase but not the sarcoplasmic reticulum (SR) Ca(2+)-ATPase, whereas thapsigargin specifically blocks the SR Ca(2+)-ATPase. The chimera [n/c]CC, in which the amino-terminal amino acids Met1 to Asp162 of the SR Ca(2+)-ATPase (SERCA1) were replaced with the corresponding portion of the Na+,K(+)-ATPase alpha 1 subunit (Met1 to Asp200), retained thapsigargin- and Ca(2+)-sensitive ATPase activity,...

  15. Regulation of vacuolar H+-ATPase in microglia by RANKL

    International Nuclear Information System (INIS)

    Serrano, Eric M.; Ricofort, Ryan D.; Zuo, Jian; Ochotny, Noelle; Manolson, Morris F.; Holliday, L. Shannon

    2009-01-01

    Vacuolar H + -ATPases (V-ATPases) are large electrogenic proton pumps composed of numerous subunits that play vital housekeeping roles in the acidification of compartments of the endocytic pathway. Additionally, V-ATPases play specialized roles in certain cell types, a capacity that is linked to cell type selective expression of isoforms of some of the subunits. We detected low levels of the a3 isoform of the a-subunit in mouse brain extracts. Examination of various brain-derived cell types by immunoblotting showed a3 was expressed in the N9 microglia cell line and in primary microglia, but not in other cell types. The expression of a3 in osteoclasts requires stimulation by Receptor Activator of Nuclear Factor κB-ligand (RANKL). We found that Receptor Activator of Nuclear Factor κB (RANK) was expressed by microglia. Stimulation of microglia with RANKL triggered increased expression of a3. V-ATPases in microglia were shown to bind microfilaments, and stimulation with RANKL increased the proportion of V-ATPase associated with the detergent-insoluble cytoskeletal fraction and with actin. In summary, microglia express the a3-subunit of V-ATPase. The expression of a3 and the interaction between V-ATPases and microfilaments was modulated by RANKL. These data suggest a novel molecular pathway for regulating microglia.

  16. Functional intersection of ATM and DNA-dependent protein kinase catalytic subunit in coding end joining during V(D)J recombination

    DEFF Research Database (Denmark)

    Lee, Baeck-Seung; Gapud, Eric J; Zhang, Shichuan

    2013-01-01

    V(D)J recombination is initiated by the RAG endonuclease, which introduces DNA double-strand breaks (DSBs) at the border between two recombining gene segments, generating two hairpin-sealed coding ends and two blunt signal ends. ATM and DNA-dependent protein kinase catalytic subunit (DNA......-PKcs. Mutation of these threonine residues to alanine (DNA-PKcs(3A)) renders DNA-PKcs dependent on its intrinsic kinase activity during coding end joining, at a step downstream of opening hairpin-sealed coding ends. Thus, DNA-PKcs has critical functions in coding end joining beyond promoting Artemis endonuclease...

  17. Photosynthesis Activates Plasma Membrane H+-ATPase via Sugar Accumulation.

    Science.gov (United States)

    Okumura, Masaki; Inoue, Shin-Ichiro; Kuwata, Keiko; Kinoshita, Toshinori

    2016-05-01

    Plant plasma membrane H(+)-ATPase acts as a primary transporter via proton pumping and regulates diverse physiological responses by controlling secondary solute transport, pH homeostasis, and membrane potential. Phosphorylation of the penultimate threonine and the subsequent binding of 14-3-3 proteins in the carboxyl terminus of the enzyme are required for H(+)-ATPase activation. We showed previously that photosynthesis induces phosphorylation of the penultimate threonine in the nonvascular bryophyte Marchantia polymorpha However, (1) whether this response is conserved in vascular plants and (2) the process by which photosynthesis regulates H(+)-ATPase phosphorylation at the plasma membrane remain unresolved issues. Here, we report that photosynthesis induced the phosphorylation and activation of H(+)-ATPase in Arabidopsis (Arabidopsis thaliana) leaves via sugar accumulation. Light reversibly phosphorylated leaf H(+)-ATPase, and this process was inhibited by pharmacological and genetic suppression of photosynthesis. Immunohistochemical and biochemical analyses indicated that light-induced phosphorylation of H(+)-ATPase occurred autonomously in mesophyll cells. We also show that the phosphorylation status of H(+)-ATPase and photosynthetic sugar accumulation in leaves were positively correlated and that sugar treatment promoted phosphorylation. Furthermore, light-induced phosphorylation of H(+)-ATPase was strongly suppressed in a double mutant defective in ADP-glucose pyrophosphorylase and triose phosphate/phosphate translocator (adg1-1 tpt-2); these mutations strongly inhibited endogenous sugar accumulation. Overall, we show that photosynthesis activated H(+)-ATPase via sugar production in the mesophyll cells of vascular plants. Our work provides new insight into signaling from chloroplasts to the plasma membrane ion transport mechanism. © 2016 American Society of Plant Biologists. All Rights Reserved.

  18. Metal Fluoride Complexes of Na,K-ATPase

    Science.gov (United States)

    Cornelius, Flemming; Mahmmoud, Yasser A.; Toyoshima, Chikashi

    2011-01-01

    The Na,K-ATPase belongs to the P-type ATPase family of primary active cation pumps. Metal fluorides like magnesium-, beryllium-, and aluminum fluoride act as phosphate analogues and inhibit P-type ATPases by interacting with the phosphorylation site, stabilizing conformations that are analogous to specific phosphoenzyme intermediates. Cardiotonic steroids like ouabain used in the treatment of congestive heart failure and arrhythmias specifically inhibit the Na,K-ATPase, and the detailed structure of the highly conserved binding site has recently been described by the crystal structure of the shark Na,K-ATPase in a state analogous to E2·2K+·Pi with ouabain bound with apparently low affinity (1). In the present work inhibition, and subsequent reactivation by high Na+, after treatment of shark Na,K-ATPase with various metal fluorides are characterized. Half-maximal inhibition of Na,K-ATPase activity by metal fluorides is in the micromolar range. The binding of cardiotonic steroids to the metal fluoride-stabilized enzyme forms was investigated using the fluorescent ouabain derivative 9-anthroyl ouabain and compared with binding to phosphorylated enzyme. The fastest binding was to the Be-fluoride stabilized enzyme suggesting a preformed ouabain binding cavity, in accord with results for Ca-ATPase where Be-fluoride stabilizes the E2-P ground state with an open luminal ion access pathway, which in Na,K-ATPase could be a passage for ouabain. The Be-fluoride stabilized enzyme conformation closely resembles the E2-P ground state according to proteinase K cleavage. Ouabain, but not its aglycone ouabagenin, prevented reactivation of this metal fluoride form by high Na+ demonstrating the pivotal role of the sugar moiety in closing the extracellular cation pathway. PMID:21708939

  19. Radioprotector modifying influence upon the ion transport ATPase activities

    International Nuclear Information System (INIS)

    Dvoretsky, A.I.; Egorova, E.G.; Ananieva, T.V.; Kulikova, I.A.

    1993-01-01

    The effects of aminothiol and biogenic amine radioprotectors (β-mercaptoethylamine, AET, serotonin, dopamine, histamine) on the basic ion transport enzymes, such as Na, K-ATP ase and Mg, Ca-ATPase activities were investigated in the tissues of numerous organs, with different radiosensitivity in the wistar rats. Experimental results showed that intraperitoneal injection of the used radioprotectors caused preliminary inhibition of the Na, K-ATPase activity in tissues from organs with different radioresistance, but had no influence on the Mg, Ca-ATPase activity in membranes of erythrocytes and rat brain cells. (2 tabs.)

  20. Calcium Modulation of Plant Plasma Membrane-Bound Atpase Activities

    Science.gov (United States)

    Caldwell, C.

    1983-01-01

    The kinetic properties of barley enzyme are discussed and compared with those of other plants. Possibilities for calcium transport in the plasma membrane by proton pump and ATPase-dependent calcium pumps are explored. Topics covered include the ph phase of the enzyme; high affinity of barley for calcium; temperature dependence, activation enthalpy, and the types of ATPase catalytic sites. Attention is given to lipids which are both screened and bound by calcium. Studies show that barley has a calmodulin activated ATPase that is found in the presence of magnesium and calcium.

  1. Insulin regulation of (Na+, K+)-ATPase

    International Nuclear Information System (INIS)

    Lytton, J.

    1985-01-01

    This thesis describes an investigation into the mechanism of insulin stimulation of (Na + ,K + )=ATPase in rat adipocytes. Two molecular forms of the catalytic subunit of the enzyme were identified and denoted α and α(+), due to their similarity to those isozymes previously described from rat brain. Insulin specifically stimulated the α(+) form of the enzyme. The two forms of the enzyme had quite different affinities for intracellular sodium ion; insulin affected only the lower affinity of α(+), shifting it toward a higher value. However, the sodium affinity of (Na + ,K + )-ATPase activity in isolated membranes was equally high for both forms of the enzyme. This suggests that the difference in sodium affinity between the two forms observed in the cell is not inherent within the structure of the sodium pump, but must depend upon a selective interaction with another molecule which has been lost upon membrane isolation. Immunoprecipitation of both the catalytic subunits either from extracts of whole cells which had been labelled with [ 32 P] orthophosphate, or from membranes which had been labelled with γ-[ 32 P]ATP demonstrated that less than 1 in 100 molecules had a covalently bound phosphate insulin had no influence on this value. The amino terminal sequences of the first 4 amino acids of the catalytic subunits of both α (isolated from rat kidney) and α(+) (from rat brainstem axolemma) were determined. The result shows two highly homologous but clearly different molecules. It can thus be concluded that the insulin sensitive version of the enzyme is not derived from the common α form by a post-translational modification

  2. OSMOTIC FRAGILITY AND Na + -K + + ATPase ACTIVITY OF ...

    African Journals Online (AJOL)

    + -K+ ATPase activity of the erythrocytes of HIV/AIDS patients. Whole blood was taken from subjects at the Human Virology Laboratory of the Nigerian Institute of Medical Research. Subjects were judged suitable for the various investigations by ...

  3. Stochastic Four-State Mechanochemical Model of F1-ATPase

    International Nuclear Information System (INIS)

    Wu Weixia; Zhan Yong; Zhao Tongjun; Han Yingrong; Chen Yafei

    2010-01-01

    F 1 -ATPase, a part of ATP synthase, can synthesize and hydrolyze ATP moleculars in which the central γ-subunit rotates inside the α 3 β 3 cylinder. A stochastic four-state mechanochemical coupling model of F 1 -ATPase is studied with the aid of the master equation. In this model, the ATP hydrolysis and synthesis are dependent on ATP, ADP, and Pi concentrations. The effects of ATP concentration, ADP concentration, and the external torque on the occupation probability of binding-state, the rotation rate and the diffusion coefficient of F 1 -ATPase are investigated. Moreover, the results from this model are compared with experiments. The mechanochemical mechanism F 1 -ATPase is qualitatively explained by the model. (general)

  4. Whole-transcriptome brain expression and exon-usage profiling in major depression and suicide: evidence for altered glial, endothelial and ATPase activity.

    Science.gov (United States)

    Pantazatos, S P; Huang, Y-Y; Rosoklija, G B; Dwork, A J; Arango, V; Mann, J J

    2017-05-01

    Brain gene expression profiling studies of suicide and depression using oligonucleotide microarrays have often failed to distinguish these two phenotypes. Moreover, next generation sequencing approaches are more accurate in quantifying gene expression and can detect alternative splicing. Using RNA-seq, we examined whole-exome gene and exon expression in non-psychiatric controls (CON, N=29), DSM-IV major depressive disorder suicides (MDD-S, N=21) and MDD non-suicides (MDD, N=9) in the dorsal lateral prefrontal cortex (Brodmann Area 9) of sudden death medication-free individuals post mortem. Using small RNA-seq, we also examined miRNA expression (nine samples per group). DeSeq2 identified 35 genes differentially expressed between groups and surviving adjustment for false discovery rate (adjusted Pdepression, altered genes include humanin-like-8 (MTRNRL8), interleukin-8 (IL8), and serpin peptidase inhibitor, clade H (SERPINH1) and chemokine ligand 4 (CCL4), while exploratory gene ontology (GO) analyses revealed lower expression of immune-related pathways such as chemokine receptor activity, chemotaxis and cytokine biosynthesis, and angiogenesis and vascular development in (adjusted Psuicide and depression, and provisional evidence for altered DNA-dependent ATPase expression in suicide only. DEXSEq analysis identified differential exon usage in ATPase, class II, type 9B (adjusted Pdepression. Differences in miRNA expression or structural gene variants were not detected. Results lend further support for models in which deficits in microglial, endothelial (blood-brain barrier), ATPase activity and astrocytic cell functions contribute to MDD and suicide, and identify putative pathways and mechanisms for further study in these disorders.

  5. V-ATPase-mediated granular acidification is regulated by the V-ATPase accessory subunit Ac45 in POMC-producing cells.

    NARCIS (Netherlands)

    Jansen, E.J.S.; Hafmans, T.G.M.; Martens, G.J.

    2010-01-01

    The vacuolar (H(+))-ATPase (V-ATPase) is an important proton pump, and multiple critical cell-biological processes depend on the proton gradient provided by the pump. Yet, the mechanism underlying the control of the V-ATPase is still elusive but has been hypothesized to involve an accessory subunit

  6. The non-gastric H,K-ATPase as a tool to study the ouabain-binding site in Na,K-ATPase.

    NARCIS (Netherlands)

    Pont, J.J.H.H.M. de; Swarts, H.G.P.; Karawajczyk, A.; Schaftenaar, G.; Willems, P.H.G.M.; Koenderink, J.B.

    2009-01-01

    Based on studies with chimeras between (non-)gastric H,K-ATPase and Na,K-ATPase, a model for the ouabain binding site has recently been presented (Qiu et al. J.Biol.Chem. 280 (2005) 32349). In this model, hydrogen bonds between specific amino acid residues of Na,K-ATPase and hydroxyl groups of

  7. Biochemical characterization of P-type copper ATPases

    Science.gov (United States)

    Inesi, Giuseppe; Pilankatta, Rajendra; Tadini-Buoninsegni, Francesco

    2014-01-01

    Copper ATPases, in analogy with other members of the P-ATPase superfamily, contain a catalytic headpiece including an aspartate residue reacting with ATP to form a phosphoenzyme intermediate, and transmembrane helices containing cation-binding sites [TMBS (transmembrane metal-binding sites)] for catalytic activation and cation translocation. Following phosphoenzyme formation by utilization of ATP, bound copper undergoes displacement from the TMBS to the lumenal membrane surface, with no H+ exchange. Although PII-type ATPases sustain active transport of alkali/alkali-earth ions (i.e. Na+, Ca2+) against electrochemical gradients across defined membranes, PIB-type ATPases transfer transition metal ions (i.e. Cu+) from delivery to acceptor proteins and, prominently in mammalian cells, undergo trafficking from/to various membrane compartments. A specific component of copper ATPases is the NMBD (N-terminal metal-binding domain), containing up to six copper-binding sites in mammalian (ATP7A and ATP7B) enzymes. Copper occupancy of NMBD sites and interaction with the ATPase headpiece are required for catalytic activation. Furthermore, in the presence of copper, the NMBD allows interaction with protein kinase D, yielding phosphorylation of serine residues, ATP7B trafficking and protection from proteasome degradation. A specific feature of ATP7A is glycosylation and stabilization on plasma membranes. Cisplatin, a platinum-containing anti-cancer drug, binds to copper sites of ATP7A and ATP7B, and undergoes vectorial displacement in analogy with copper. PMID:25242165

  8. Effect Of DNA-dependent protein kinase on the molecular fate of the rAAV2 genome in skeletal muscle

    Science.gov (United States)

    Song, Sihong; Laipis, Philip J.; Berns, Kenneth I.; Flotte, Terence R.

    2001-01-01

    We report here that the DNA-dependent protein kinase (DNA-PK) affects the molecular fate of the recombinant adeno-associated virus (rAAV) genome in skeletal muscle. rAAV-human α1-antitrypsin (rAAV-hAAT) vectors were delivered by intramuscular injection to either C57BL/6 (DNA-PKcs+) or C57BL/6-SCID [severe combined immunodeficient (SCID), DNA-PKcs−] mice. In both strains, high levels of transgene expression were sustained for up to 1 year after a single injection. Southern blot analysis showed that rAAV genomes persisted as linear episomes for more than 1 year in SCID mice, whereas only circular episomal forms were observed in the C57BL/6 strain. These results indicate that DNA-PK is involved in the formation of circular rAAV episomes. PMID:11274433

  9. Leptin gene polymorphism in Indian Sahiwal cattle by single strand ...

    African Journals Online (AJOL)

    These leptin gene variants can be sequenced and screened in the entire population to develop single nucleotide polymorphisms (SNPs) for association studies with different productive and reproductive performances and marker assisted selection. Keywords: Leptin gene, PCR-SSCP, genetic variability, dairy cattle

  10. Electrostatic interactions in catalytic centers of F1-ATPase

    Science.gov (United States)

    Pogrebnaya, Alexandra F.; Romanovsky, Yury M.; Tikhonov, Alexander N.

    2003-10-01

    F1-ATPase is one of the most important enzymes of membrane bioenergetics. F1-ATPase is the constituent complex that provides the ATP formation from ADP and inorganic phosphate (Pi) at the expense of energy of electrochemical gradient of hydrogen ions generated across the energy transducing mitochondrial, chloroplast or bacterial membrane. F1-ATPase is a reversible molecular machine that can work as a proton pump due to energy released in the course of ATP hydrolysis (ATPase reaction). The unusual feature of this enzyme is that it operates as a rotary molecular motor. Recently, using the fluorescence microscopy method for the real time visualization of molecular mobility of individual molecules, it was demonstrated directly that the ATP hydrolysis by F1-ATPase is accompanied by unidirectional rotations of mobile subunits (rotor) of F1F0-ATP synthase. In this work, we calculated the contribution of electrostatic interactions between charged groups of a substrate (MgATP), products molecules (MgADP and Pi), and charged amino acid residuals of ATPase molecule to the energy changes associated with the substrate binding and their chemical transformations in the catalytic centers located at the interface of α and β subunits of the enzyme (oligomer complex α3β3γ of bovine mitochondria ATPase). A catalytic cycle of ATP hydrolysis considered in our work includes conformational changes of α and β subunits caused by unidirectional rotations of an eccentric γ subunit. The knowledge of energy characteristics and force field in catalytic center of an enzyme in different conformational states may be important for further simulation dynamic properties of ATP synthase complex.

  11. Archazolid and apicularen: Novel specific V-ATPase inhibitors

    Directory of Open Access Journals (Sweden)

    Zeeck Axel

    2005-08-01

    Full Text Available Abstract Background V-ATPases constitute a ubiquitous family of heteromultimeric, proton translocating proteins. According to their localization in a multitude of eukaryotic membranes, they energize many different transport processes. Since their malfunction is correlated with various diseases in humans, the elucidation of the properties of this enzyme for the development of selective inhibitors and drugs is one of the challenges in V-ATPase research. Results Archazolid A and B, two recently discovered cytotoxic macrolactones produced by the myxobacterium Archangium gephyra, and apicularen A and B, two novel benzolactone enamides produced by different species of the myxobacterium Chondromyces, exerted a similar inhibitory efficacy on a wide range of mammalian cell lines as the well established plecomacrolidic type V-ATPase inhibitors concanamycin and bafilomycin. Like the plecomacrolides both new macrolides also prevented the lysosomal acidification in cells and inhibited the V-ATPase purified from the midgut of the tobacco hornworm, Manduca sexta, with IC50 values of 20–60 nM. However, they did not influence the activity of mitochondrial F-ATPase or that of the Na+/K+-ATPase. To define the binding sites of these new inhibitors we used a semi-synthetic radioactively labelled derivative of concanamycin which exclusively binds to the membrane Vo subunit c. Whereas archazolid A prevented, like the plecomacrolides concanamycin A, bafilomycin A1 and B1, labelling of subunit c by the radioactive I-concanolide A, the benzolactone enamide apicularen A did not compete with the plecomacrolide derivative. Conclusion The myxobacterial antibiotics archazolid and apicularen are highly efficient and specific novel inhibitors of V-ATPases. While archazolid at least partly shares a common binding site with the plecomacrolides bafilomycin and concanamycin, apicularen adheres to an independent binding site.

  12. Influence of hexavanadates on Na+/K+- ATPase activity

    Directory of Open Access Journals (Sweden)

    Zdravković Aleksandra

    2016-01-01

    Full Text Available Introduction: There is a great interest in use of polioximetalates in clinical medicine, primary as antibacterial, antiviral and antitumoral agents. Considering the key role of Na+/ K+- ATPase in normal functioning of most animal cells, as well as pivotal roles in cancer cell migration, the aim of this paper was to examine the influence of new synthesized hexavandates [V6-CH3][Na]2, [V6-NO2][TBA]2, [V6-C3][H]2, [V6-C5d][TBA]2 on Na+/K+- ATPase activity. Material and methods: The enzymatic activity of porcine cerebral cortex Na+/K+- ATPase was followed in both the absence and presence of increasing concentration of [V6-CH3] [Na]2, [V6-NO2][TBA]2, [V6-C3][H]2, [V6-C5d][TBA]2 (within the range 10-8 - 10-3 mol/L. The released Pi, liberated from the enzymatic hydrolysis of ATP, was determined by spectrophotometric method, using Perkin Elmer Lambda 35 UV-VIS spectrophotometer. Results: Investigated compounds inhibit the activity of Na+/K+ ATPase in dose-dependent manner within the investigated range. Obtained results indicate that all investigated compounds inhibit the Na+/K+ ATPase activity, but with different inhibiting power. [V6-NO2] [TBA]2 (IC50 = 1,87 × 10-5 mol/L was the most potent inhibitor of Na+/K+ ATPase, while [V6-C5d][TBA]2 showed the least potent inhibiting power (IC50 = 1,31 × 10-4 mol/L . The results are consistent with previously published concentration-dependent inhibitory effect of polyoxometalates (including polioxovandates on ATPase activity from different model syistems. Conclusion: Based on the results, we can conclude that the examined compounds inhibit Na+/K+- ATPase activity in a dose-dependent manner. Inhibiting power of tested hexavanadates are different, and weaker than inhibiting power of decavanadates (tested earlier on Na+/K+- ATPase activity, which is probably due to differences in charge, size and shape of these polioxometalates. Considering the role of this enzymes in the functioning of healthy cells and the

  13. The role of the N-domain in the ATPase activity of the mammalian AAA ATPase p97/VCP.

    Science.gov (United States)

    Niwa, Hajime; Ewens, Caroline A; Tsang, Chun; Yeung, Heidi O; Zhang, Xiaodong; Freemont, Paul S

    2012-03-09

    p97/valosin-containing protein (VCP) is a type II ATPase associated with various cellular activities that forms a homohexamer with each protomer containing an N-terminal domain (N-domain); two ATPase domains, D1 and D2; and a disordered C-terminal region. Little is known about the role of the N-domain or the C-terminal region in the p97 ATPase cycle. In the p97-associated human disease inclusion body myopathy associated with Paget disease of bone and frontotemporal dementia, the majority of missense mutations are located at the N-domain D1 interface. Structure-based predictions suggest that such mutations affect the interaction of the N-domain with D1. Here we have tested ten major inclusion body myopathy associated with Paget disease of bone and frontotemporal dementia-linked mutants for ATPase activity and found that all have increased activity over the wild type, with one mutant, p97(A232E), having three times higher activity. Further mutagenesis of p97(A232E) shows that the increase in ATPase activity is mediated through D2 and requires both the N-domain and a flexible ND1 linker. A disulfide mutation that locks the N-domain to D1 in a coplanar position reversibly abrogates ATPase activity. A cryo-EM reconstruction of p97(A232E) suggests that the N-domains are flexible. Removal of the C-terminal region also reduces ATPase activity. Taken together, our data suggest that the conformation of the N-domain in relation to the D1-D2 hexamer is directly linked to ATP hydrolysis and that the C-terminal region is required for hexamer stability. This leads us to propose a model where the N-domain adopts either of two conformations: a flexible conformation compatible with ATP hydrolysis or a coplanar conformation that is inactive.

  14. A method to measure hydrolytic activity of adenosinetriphosphatases (ATPases.

    Directory of Open Access Journals (Sweden)

    Gianluca Bartolommei

    Full Text Available The detection of small amounts (nanomoles of inorganic phosphate has a great interest in biochemistry. In particular, phosphate detection is useful to evaluate the rate of hydrolysis of phosphatases, that are enzymes able to remove phosphate from their substrate by hydrolytic cleavage. The hydrolysis rate is correlated to enzyme activity, an extremely important functional parameter. Among phosphatases there are the cation transporting adenosinetriphosphatases (ATPases, that produce inorganic phosphate by cleavage of the γ-phosphate of ATP. These membrane transporters have many fundamental physiological roles and are emerging as potential drug targets. ATPase hydrolytic activity is measured to test enzyme functionality, but it also provides useful information on possible inhibitory effects of molecules that interfere with the hydrolytic process. We have optimized a molybdenum-based protocol that makes use of potassium antimony (III oxide tartrate (originally employed for phosphate detection in environmental analysis to allow its use with phosphatase enzymes. In particular, the method was successfully applied to native and recombinant ATPases to demonstrate its reliability, validity, sensitivity and versatility. Our method introduces significant improvements to well-established experimental assays, which are currently employed for ATPase activity measurements. Therefore, it may be valuable in biochemical and biomedical investigations of ATPase enzymes, in combination with more specific tests, as well as in high throughput drug screening.

  15. Hormonal regulation of Na -K -ATPase in cultured epithelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, J.P.; Jones, D.; Wiesmann, W.P.

    1986-08-01

    Aldosterone and insulin stimulate Na transport through mechanisms involving protein synthesis. Na -K -ATPase has been implicated in the action of both hormones. The authors examined the effect of aldosterone and insulin on Na -K -ATPase in epithelial cells in culture derived from toad urinary bladder (TB6C) and toad kidney (A6). Aldosterone, but not insulin, increases short-circuit current (I/sub sc/) in TB6C cells. Aldosterone increases Na -K -(TSP)ATPase activity after 18 h of incubation, but no effect can be seen at 3 and 6 h. Amiloride, which inhibits aldosterone-induced increases in I/sub sc/, has no effect on either basal or aldosterone stimulated enzyme activity. Both aldosterone and insulin increase I/sub sc/ in A6 cells and when added together are synergistic. Aldosterone stimulates enzyme activity in A6 cells, but insulin alone has no effect. However, aldosterone and insulin together stimulate enzyme activity more than aldosterone alone. It appears that stimulation of Na -K -ATPase activity is involved in aldosterone action in both cell lines but does not appear to be due to increased Na entry, since enhanced enzyme activity is not inhibited by amiloride. In contrast, insulin alone has no direct effect on Na -K -ATPase, although the increased enzyme activity following both agents in combination may explain their synergism on I/sub sc/.

  16. Review: The HSP90 molecular chaperone-an enigmatic ATPase.

    Science.gov (United States)

    Pearl, Laurence H

    2016-08-01

    The HSP90 molecular chaperone is involved in the activation and cellular stabilization of a range of 'client' proteins, of which oncogenic protein kinases and nuclear steroid hormone receptors are of particular biomedical significance. Work over the last two decades has revealed a conformational cycle critical to the biological function of HSP90, coupled to an inherent ATPase activity that is regulated and manipulated by many of the co-chaperones proteins with which it collaborates. Pharmacological inhibition of HSP90 ATPase activity results in degradation of client proteins in vivo, and is a promising target for development of new cancer therapeutics. Despite this, the actual function that HSP90s conformationally-coupled ATPase activity provides in its biological role as a molecular chaperone remains obscure. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 594-607, 2016. © 2016 The Authors. Biopolymers Published by Wiley Periodicals, Inc.

  17. Crystal Structure of the Vanadate-Inhibited Ca2+-ATPase

    DEFF Research Database (Denmark)

    Clausen, Johannes D.; Bublitz, Maike; Arnou, Bertrand Jean-Paul

    2016-01-01

    Vanadate is the hallmark inhibitor of the P-type ATPase family; however, structural details of its inhibitory mechanism have remained unresolved. We have determined the crystal structure of sarcoplasmic reticulum Ca2+-ATPase with bound vanadate in the absence of Ca2+. Vanadate is bound...... at the catalytic site as a planar VO3− in complex with water and Mg2+ in a dephosphorylation transition-state-like conformation. Validating bound VO3− by anomalous difference Fourier maps using long-wavelength data we also identify a hitherto undescribed Cl− site near the dephosphorylation site. Crystallization...... nucleotide analogs in the E2·VO3− structure with that in E2·BeF3− (E2P ground state analog) reveals multiple binding modes to the Ca2+-ATPase....

  18. Autoinhibitory Regulation of Plasma Membrane H+-ATPases

    DEFF Research Database (Denmark)

    Pedersen, Jesper Torbøl

    Electrochemical gradients across cell membranes are essential for nutrient uptake. In plant and fungal cells the electrochemical gradient across the plasma membrane (PM) can build much higher than in mammalian cells. The protein responsible for this gradient is the essential PM H+-ATPase that uses...... a huge amount of energy in form of ATP, to pump out protons. To avoid complete energy depletion in the cells, tight regulation of the PM H+-ATPase is a necessity. The proteins two terminal domains have been identified as autoinhibitory domains that regulate the pumping activity, but due to lack of a high...... in mammalian cells and it has been speculated if they have a similar function in plants. In this thesis we show, that plant PM H+-ATPases are receptors for lysophospholipids and the autoinhibitory terminal inhibition is released upon lysophospholipid binding. Finally, we have used a group of stabilizing...

  19. Protein import into chloroplasts requires a chloroplast ATPase

    International Nuclear Information System (INIS)

    Pain, D.; Blobel, G.

    1987-01-01

    The authors have transcribed mRNA from a cDNA clone coding for pea ribulose-1,5-bisphosphate carboxylase, translated the mRNA in a wheat germ cell-free system, and studied the energy requirement for posttranslational import of the [ 35 S]methionine-labeled protein into the stroma of pea chloroplasts. They found that import depends on ATP hydrolysis within the stroma. Import is not inhibited when H + , K + , Na + , or divalent cation gradients across the chloroplast membranes are dissipated by ionophores, as long as exogenously added ATP is also present during the import reaction. The data suggest that protein import into the chloroplast stroma requires a chloroplast ATPase that does not function to generate a membrane potential for driving the import reaction but that exerts its effect in another, yet-to-be-determined, mode. They have carried out a preliminary characterization of this ATPase regarding its nucleotide specificity and the effects of various ATPase inhibitors

  20. Salt-stress alters proton transport by the tonoplast ATPase

    International Nuclear Information System (INIS)

    DuPont, F.; Morrissey, P.

    1990-01-01

    A tonoplast-enriched membrane fraction was obtained from roots of barley (Hordeum vulgare cv CM72) seedlings grown in half-strength nutrient solution with or without 100 mM NaCl. Proton transport by the tonoplast ATPase was measured using acridine orange, quinacrine or uptake of [ 14 C]-methylamine. The Vmax for proton transport was 2 to 4-fold higher for the ATPase from salt-grown compared to control roots. However, the rate of ATP hydrolysis was not significantly different for the two treatments. The percent inhibition of ATP hydrolysis by DCCD, DIDS and KNO 3 was similar for the two treatments, as was the percent stimulation by Cl. The pH optimum for proton transport was more alkaline for the ATPase from salt-grown roots. No difference was observed between membranes from control and salt-grown roots when oxonol fluorescence was used to measure formation of a membrane potential by the ATPase. Immunoblots of SDS gels were reacted with the antibody to the 68-kD subunit from red beet to assess the relative amount of the 68-kD subunit of the tonoplast ATPase from control or salt-grown roots. The relative amount of the 16-kD DCCD-binding subunit was compared by binding of [ 14 C]-DCCD. The amounts of the two subunits were not significantly different in membranes from control or salt-grown roots. The increase in rate of formation of the pH gradient was not accounted for by an increase in the amount of the ATPase

  1. Elucidating Functional Aspects of P-type ATPases

    DEFF Research Database (Denmark)

    Autzen, Henriette Elisabeth

    2015-01-01

    (endo)plasmic reticulum Ca2+-ATPase from fast-twitch skeletal muscle (SERCA1a) is associated with skin and muscle diseases, while mutations of the Cu+-ATPase (CopA) give rise to Cu+ deficiency or excess as seen in the devastating Menkes and Wilson’s diseases. Furthermore, the essential role that these proteins have...... similar to that of the wild type (WT) protein. The discrepancy between the newly determined crystal structure of LpCopA and the functional manifestations of the missense mutation in human CopA, could indicate that LpCopA is insufficient in structurally elucidating the effect of disease-causing mutations...

  2. A structural overview of the plasma membrane Na+,K+-ATPase and H+-ATPase ion pumps

    DEFF Research Database (Denmark)

    Morth, Jens Preben; Pedersen, Bjørn Panella; Buch-Pedersen, Morten Jeppe

    2011-01-01

    transport systems that are responsible for uptake and extrusion of metabolites and other ions. The ion gradients are also both directly and indirectly used to control pH homeostasis and to regulate cell volume. The plasma membrane H(+)-ATPase maintains a proton gradient in plants and fungi and the Na(+),K(+)-ATPase...... maintains a Na(+) and K(+) gradient in animal cells. Structural information provides insight into the function of these two distinct but related P-type pumps.......Plasma membrane ATPases are primary active transporters of cations that maintain steep concentration gradients. The ion gradients and membrane potentials derived from them form the basis for a range of essential cellular processes, in particular Na(+)-dependent and proton-dependent secondary...

  3. Hormonal regulation of Na+/K+-dependent ATPase activity and pump function in corneal endothelial cells.

    Science.gov (United States)

    Hatou, Shin

    2011-10-01

    Na- and K-dependent ATPase (Na,K-ATPase) in the basolateral membrane of corneal endothelial cells plays an important role in the pump function of the corneal endothelium. We investigated the role of dexamethasone in the regulation of Na,K-ATPase activity and pump function in these cells. Mouse corneal endothelial cells were exposed to dexamethasone or insulin. ATPase activity was evaluated by spectrophotometric measurement, and pump function was measured using an Ussing chamber. Western blotting and immunocytochemistry were performed to measure the expression of the Na,K-ATPase α1-subunit. Dexamethasone increased Na,K-ATPase activity and the pump function of endothelial cells. Western blot analysis indicated that dexamethasone increased the expression of the Na,K-ATPase α1-subunit but decreased the ratio of active to inactive Na,K-ATPase α1-subunit. Insulin increased Na,K-ATPase activity and pump function of cultured corneal endothelial cells. These effects were transient and blocked by protein kinase C inhibitors and inhibitors of protein phosphatases 1 (PP1) and 2A (PP2A). Western blot analysis indicated that insulin decreased the amount of inactive Na,K-ATPase α1-subunit, but the expression of total Na,K-ATPase α1-subunit was unchanged. Immunocytochemistry showed that insulin increased cell surface expression of the Na,K-ATPase α1-subunit. Our results suggest that dexamethasone and insulin stimulate Na,K-ATPase activity in mouse corneal endothelial cells. The effect of dexamethasone activation in these cells was mediated by Na,K-ATPase synthesis and an increased enzymatic activity because of dephosphorylation of Na,K-ATPase α1-subunits. The effect of insulin is mediated by the protein kinase C, PP1, and/or PP2A pathways.

  4. Effects of aqueous extract of Hibiscus sabdariffa on renal Na(+)-K(+)-ATPase and Ca(2+)-Mg(2+)-ATPase activities in Wistar rats.

    Science.gov (United States)

    Olatunji, Lawrence A; Usman, Taofeek O; Adebayo, Joseph O; Olatunji, Victoria A

    2012-09-01

    To investigate the effects of oral administration of aqueous extract of Hibiscus sabdariffa on renal Na(+)-K(+)-ATPase and Ca(2+)-Mg(2+)-ATPase activities in rats. The 25 and 50 mg/(kg·d) of aqueous extracts of H. sabdariffa were respectively given to rats in the experimental groups for 28 d, and rats in the control group received an appropriate volume of distilled water as vehicle. Na(+)-K(+)-ATPase and Ca(2+)-Mg(2+)-ATPase activities in the kidney were assayed by spectrophotometric method. Administrations of 25 and 50 mg/(kg·d) of aqueous extract of H. sabdariffa significantly decreased the Ca(2+)-Mg(2+)-ATPase activity in the kidney of rats (Psabdariffa may preserve the renal function despite a decreased renal Ca(2+)-Mg(2+)-ATPase activity.

  5. DNA-dependent protein kinase (DAN-PK), a key enzyme in the re-ligation of DNA double-strand breaks

    International Nuclear Information System (INIS)

    Hennequin, C.; Averbeck, D.

    1999-01-01

    Repair pathways of DNA are now defined and some important findings have been discovered in the last few years. DNA non-homologous end-joining (NEH) is a crucial process in the repair of radiation-induced double-strand breaks (DSBs). NHEj implies at least three steps: the DNA free-ends must get closer, preparation of the free-ends by exonucleases and then a transient hybridization in a region of DNA with weak homology. DNA-dependent protein kinase (DNA-PK) is the key enzyme in this process. DNA-PK is a nuclear serine/threonine kinase that comprises three components: a catalytic subunit (DNA-PK cs ) and two regulatory subunits, DNA-binding proteins, Ku80 and Ku70. The severe combined immuno-deficient (scid) mice are deficient in DNA-PK cs : this protein is involved both in DNA repair and in the V(D)J recombination of immunoglobulin and T-cell receptor genes. It is a protein-kinase of the P13-kinase family and which can phosphorylate Ku proteins, p53 and probably some other proteins still unknown. DNA-PK is an important actor of DSBs repair (induced by ionising radiations or by drugs like etoposide), but obviously it is not the only mechanism existing in the cell for this function. Some others, like homologous recombination, seem also to have a great importance for cell survival. (authors)

  6. Radiosensitivity profiles from a panel of ovarian cancer cell lines exhibiting genetic alterations in p53 and disparate DNA-dependent protein kinase activities

    Energy Technology Data Exchange (ETDEWEB)

    Langland, Gregory T.; Yannone, Steven M.; Langland, Rachel A.; Nakao, Aki; Guan, Yinghui; Long, Sydney B.T.; Vonguyen, Lien; Chen, David J.; Gray, Joe W; Chen, Fanqing

    2009-09-07

    The variability of radiation responses in ovarian tumors and tumor-derived cell lines is poorly understood. Since both DNA repair capacity and p53 status can significantly alter radiation sensitivity, we evaluated these factors along with radiation sensitivity in a panel of sporadic human ovarian carcinoma cell lines. We observed a gradation of radiation sensitivity among these sixteen lines, with a five-fold difference in the LD50 between the most radiosensitive and the most radioresistant cells. The DNA-dependent protein kinase (DNA-PK) is essential for the repair of radiation induced DNA double-strand breaks in human somatic cells. Therefore, we measured gene copy number, expression levels, protein abundance, genomic copy and kinase activity for DNA-PK in all of our cell lines. While there were detectable differences in DNA-PK between the cell lines, there was no clear correlation with any of these differences and radiation sensitivity. In contrast, p53 function as determined by two independent methods, correlated well with radiation sensitivity, indicating p53 mutant ovarian cancer cells are typically radioresistant relative to p53 wild-type lines. These data suggest that the activity of regulatory molecules such as p53 may be better indicators of radiation sensitivity than DNA repair enzymes such as DNAPK in ovarian cancer.

  7. Multisubunit DNA-Dependent RNA Polymerases from Vaccinia Virus and Other Nucleocytoplasmic Large-DNA Viruses: Impressions from the Age of Structure.

    Science.gov (United States)

    Mirzakhanyan, Yeva; Gershon, Paul D

    2017-09-01

    The past 17 years have been marked by a revolution in our understanding of cellular multisubunit DNA-dependent RNA polymerases (MSDDRPs) at the structural level. A parallel development over the past 15 years has been the emerging story of the giant viruses, which encode MSDDRPs. Here we link the two in an attempt to understand the specialization of multisubunit RNA polymerases in the domain of life encompassing the large nucleocytoplasmic DNA viruses (NCLDV), a superclade that includes the giant viruses and the biochemically well-characterized poxvirus vaccinia virus. The first half of this review surveys the recently determined structural biology of cellular RNA polymerases for a microbiology readership. The second half discusses a reannotation of MSDDRP subunits from NCLDV families and the apparent specialization of these enzymes by virus family and by subunit with regard to subunit or domain loss, subunit dissociability, endogenous control of polymerase arrest, and the elimination/customization of regulatory interactions that would confer higher-order cellular control. Some themes are apparent in linking subunit function to structure in the viral world: as with cellular RNA polymerases I and III and unlike cellular RNA polymerase II, the viral enzymes seem to opt for speed and processivity and seem to have eliminated domains associated with higher-order regulation. The adoption/loss of viral RNA polymerase proofreading functions may have played a part in matching intrinsic mutability to genome size. Copyright © 2017 American Society for Microbiology.

  8. Simple synthesis of carbon-11-labeled chromen-4-one derivatives as new potential PET agents for imaging of DNA-dependent protein kinase (DNA-PK) in cancer

    International Nuclear Information System (INIS)

    Gao, Mingzhang; Wang, Min; Miller, Kathy D.; Zheng, Qi-Huang

    2012-01-01

    Carbon-11-labeled chromen-4-one derivatives were synthesized as new potential PET agents for imaging of DNA repair enzyme DNA-dependent protein kinase (DNA-PK) in cancer. The target tracers, X-[ 11 C]methoxy-2-morpholino-4H-chromen-4-ones (X=8, 7, 6, 5; [ 11 C]4a–d), were prepared from their corresponding precursors, X-hydroxy-2-morpholino-4H-chromen-4-ones (X=8, 7, 6, 5; 5a–d), with [ 11 C]CH 3 OTf through O-[ 11 C]methylation and isolated by a simplified solid-phase extraction (SPE) method using a C-18 Sep-Pak Plus cartridge. The radiochemical yields decay corrected to end of bombardment (EOB), from [ 11 C]CO 2 , were 40–60%. The specific activity at end of synthesis (EOS) was 185–370 GBq/μmol. - Highlights: ► New chromen-4-one derivatives were synthesized. ► New carbon-11-labeled chromen-4-one derivatives were synthesized. ► Simple solid-phase extraction (SPE) method was employed in radiosynthesis.

  9. Rapid Diminution in the Level and Activity of DNA-Dependent Protein Kinase in Cancer Cells by a Reactive Nitro-Benzoxadiazole Compound

    Directory of Open Access Journals (Sweden)

    Viviane A. O. Silva

    2016-05-01

    Full Text Available The expression and activity of DNA-dependent protein kinase (DNA-PK is related to DNA repair status in the response of cells to exogenous and endogenous factors. Recent studies indicate that Epidermal Growth Factor Receptor (EGFR is involved in modulating DNA-PK. It has been shown that a compound 4-nitro-7-[(1-oxidopyridin-2-ylsulfanyl]-2,1,3-benzoxadiazole (NSC, bearing a nitro-benzoxadiazole (NBD scaffold, enhances tyrosine phosphorylation of EGFR and triggers downstream signaling pathways. Here, we studied the behavior of DNA-PK and other DNA repair proteins in prostate cancer cells exposed to compound NSC. We showed that both the expression and activity of DNA-PKcs (catalytic subunit of DNA-PK rapidly decreased upon exposure of cells to the compound. The decline in DNA-PKcs was associated with enhanced protein ubiquitination, indicating the activation of cellular proteasome. However, pretreatment of cells with thioglycerol abolished the action of compound NSC and restored the level of DNA-PKcs. Moreover, the decreased level of DNA-PKcs was associated with the production of intracellular hydrogen peroxide by stable dimeric forms of Cu/Zn SOD1 induced by NSC. Our findings indicate that reactive oxygen species and electrophilic intermediates, generated and accumulated during the redox transformation of NBD compounds, are primarily responsible for the rapid modulation of DNA-PKcs functions in cancer cells.

  10. Expression of Gill Vacuolar-Type H^+-ATPase B Subunit, and Na^+, K^+-ATPase α_1 and β_1 Subunit Messenger RNAs in Smolting Salmo salar(Physiology)

    OpenAIRE

    Michel, Seidelin; Steffen S., Madsen; Christopher P., Cutler; Gordon, Cramb; Institute of Biology, University of Southern Denmark-Main Campus : Odense University:(Present address)Department of Life Sciences and Chemistry, Roskilde University; Institute of Biology, University of Southern Denmark-Main Campus : Odense University; School of Biomedical Sciences, Bute Medical Buildings, University of St. Andrews; School of Biomedical Sciences, Bute Medical Buildings, University of St. Andrews

    2001-01-01

    Changes in gill vacuolar-type HT-ATPase B subunit, and Na^+,K^+-ATPase α and β subunit mRNA expression were examined during the course of smoltification in Salmo salar. We cloned and sequenced cDNA fragments of S. salar gill i) vacuolar-type H^+-ATPase (V-H^+-ATPase) B subunit, ii) Na^+,K^+-ATPase α_1 subunit, and iii) Na^+,K^+-ATPase β_1 subunit, and used these as Northern blotting probes. During smoltification, the salmon showed a typical increase in gill Na^+,K^+-ATPase activity and improv...

  11. In and out of the cation pumps: P-type ATPase structure revisited

    DEFF Research Database (Denmark)

    Bublitz, Maike; Poulsen, Hanne; Morth, Jens Preben

    2010-01-01

    Active transport across membranes is a crucial requirement for life. P-type ATPases build up electrochemical gradients at the expense of ATP by forming and splitting a covalent phosphoenzyme intermediate, coupled to conformational changes in the transmembrane section where the ions are translocated....... The marked increment during the last three years in the number of crystal structures of P-type ATPases has greatly improved our understanding of the similarities and differences of pumps with different ion specificities, since the structures of the Ca2+-ATPase, the Na+,K+-ATPase and the H+-ATPase can now...

  12. Regulation of Na+/K+-ATPase by Estradiol and IGF-1 in Cardio-Metabolic Diseases.

    Science.gov (United States)

    Obradovic, Milan; Stanimirovic, Julijana; Panic, Anastasija; Bogdanovic, Nikola; Sudar-Milovanovic, Emina; Cenic-Milosevic, Desanka; Isenovic, Esma R

    2017-01-01

    The sodium/potassium- adenosine- triphosphatase (Na+/K+-ATPase) is an important mediator in vasculature tone and contractility, and its abnormal regulation has been implicated in many diseases such as obesity, insulin resistance, diabetes, and hypertension. Decreased Na+/K+-ATPase abundance and its altered isoform expression induce cardiomyocytes death and cardiac dysfunction, possibly leading to the development of myocardial dilation and heart failure. Therefore, the regulation of Na+/K+-ATPase activity/expression could be important in treatment and possible prevention of cardio-metabolic diseases. A number of hormones and environmental factors regulate the function of Na+/K+-ATPase in response to changing cellular requirements. Estradiol and insulin like growth factor-1 (IGF-1) are among potent hormones that positively regulate Na+/K+- ATPase activity or de novo synthesis of α - and β - subunits. Both estradiol and IGF-1 have a huge therapeutic potential in treatment of vasculopathy in cardio-metabolic diseases. We searched the MEDLINE and PUBMED databases for all English and non-English articles with an English abstract from April 1978 to May 2016. The main data search terms were: Na+/K+-ATPase; estradiol and Na+/K+-ATPase; estradiol, Na+/K+-ATPase and CVS; estradiol, Na+/K+-ATPase and CVD; estradiol, Na+/K+- ATPase and obesity; estradiol, Na+/K+-ATPase and diabetes; estradiol, Na+/K+-ATPase and hypertension; IGF-1; IGF-1 and Na+/K+-ATPase; IGF-1, Na+/K+-ATPase and CVS; IGF-1, Na+/K+-ATPase and CVD; IGF-1, Na+/K+- ATPase and obesity; IGF-1, Na+/K+-ATPase and diabetes; IGF-1, Na+/K+-ATPase and hypertension. The present review discusses the latest data from animal and human studies which focus on the effects of estradiol and IGF-1 on Na+/K+-ATPase regulation in physiological and pathophysiological conditions in cardiovascular system. Understanding the molecular mechanisms of estradiol and IGF-1 action on Na+/K+-ATPase in humans, may help resolving outstanding

  13. ATPaseTb2, a unique membrane-bound FoF1-ATPase component, is essential in bloodstream and dyskinetoplastic trypanosomes.

    Directory of Open Access Journals (Sweden)

    Karolína Šubrtová

    2015-02-01

    Full Text Available In the infectious stage of Trypanosoma brucei, an important parasite of humans and livestock, the mitochondrial (mt membrane potential (Δψm is uniquely maintained by the ATP hydrolytic activity and subsequent proton pumping of the essential FoF1-ATPase. Intriguingly, this multiprotein complex contains several trypanosome-specific subunits of unknown function. Here, we demonstrate that one of the largest novel subunits, ATPaseTb2, is membrane-bound and localizes with monomeric and multimeric assemblies of the FoF1-ATPase. Moreover, RNAi silencing of ATPaseTb2 quickly leads to a significant decrease of the Δψm that manifests as a decreased growth phenotype, indicating that the FoF1-ATPase is impaired. To further explore the function of this protein, we employed a trypanosoma strain that lacks mtDNA (dyskinetoplastic, Dk and thus subunit a, an essential component of the proton pore in the membrane Fo-moiety. These Dk cells generate the Δψm by combining the hydrolytic activity of the matrix-facing F1-ATPase and the electrogenic exchange of ATP4- for ADP3- by the ATP/ADP carrier (AAC. Surprisingly, in addition to the expected presence of F1-ATPase, the monomeric and multimeric FoF1-ATPase complexes were identified. In fact, the immunoprecipitation of a F1-ATPase subunit demonstrated that ATPaseTb2 was a component of these complexes. Furthermore, RNAi studies established that the membrane-bound ATPaseTb2 subunit is essential for maintaining normal growth and the Δψm of Dk cells. Thus, even in the absence of subunit a, a portion of the FoF1-ATPase is assembled in Dk cells.

  14. The parietal cell gastric H, K-ATPase also functions as the Na, K-ATPase and Ca-ATPase in altered states [v2; ref status: indexed, http://f1000r.es/1tc

    Directory of Open Access Journals (Sweden)

    Tushar Ray

    2013-09-01

    Full Text Available This article offers an explanation for the apparent lack of Na, K-ATPase activity in parietal cells although ouabain has been known to inhibit gastric acid secretion since 1962. The gastric H, K-ATPase (proton-pump seems to be acting in altered states, thus behaving like a Na, K-ATPase (Na-pump and/or Ca-ATPase (Ca-pump depending on cellular needs.  This conclusion is based on the following findings. First, parietal cell fractions do not exhibit Na, K-ATPase activity at pH 7.0 but do at pH 8.5. Second, the apical plasma membrane (APM fraction exhibits a (Ca or Mg-ATPase activity with negligible H, K-ATPase activity. However, when assayed with Mg alone in presence of the 80 k Da cytosolic proton-pump activator (HAF, the APM fraction reveals remarkably high H, K-ATPase activity, suggesting the observed low affinity of Ca (or Mg-ATPase is an altered state of the latter. Third, calcium (between 1 and 4 µM shows both stimulation and inhibition of the HAF-stimulated H, K-ATPase depending on its concentration, revealing a close interaction between the  proton-pump activator and local Ca concentration in gastric H, K-ATPase function. Such interactions suggest that Ca is acting as a terminal member of the intracellular signaling system for the HAF-regulated proton-pump. It appears that during resting state, the HAF-associated H, K-ATPase remains inhibited by Ca (>1 µM and, prior to resumption of acid secretion the gastric H, K-ATPase acts temporarily as a Ca-pump for removing excess Ca from its immediate environment. This conclusion is consistent with the recent reports of immunochemical co-localization of the gastric H, K-ATPase and Ca-ATPase by superimposition in parietal cells, and a transitory efflux of Ca immediately preceding the onset of acid secretion. These new perspectives on proton-pump function would open new avenues for a fuller understanding of the intracellular regulation of the ubiquitous Na-pump.

  15. The gastric H, K-ATPase system also functions as the Na, K-ATPase and Ca-ATPase in altered states [v1; ref status: indexed, http://f1000r.es/1eo

    Directory of Open Access Journals (Sweden)

    Tushar Ray

    2013-07-01

    Full Text Available This article offers an explanation for the apparent lack of Na, K-ATPase activity in parietal cells although ouabain has been known to inhibit gastric acid secretion since 1962. The gastric H, K-ATPase (proton-pump seems to be acting in altered states, thus behaving like a Na, K-ATPase (Na-pump and/or Ca-ATPase (Ca-pump depending on cellular needs.  This conclusion is based on the following findings. First, parietal cell fractions do not exhibit Na, K-ATPase activity at pH 7.0 but do at pH 8.5. Second, the apical plasma membrane (APM fraction exhibits a (Ca or Mg-ATPase activity with negligible H, K-ATPase activity. However, when assayed with Mg alone in presence of the 80 k Da cytosolic proton-pump activator (HAF, the APM fraction reveals remarkably high H, K-ATPase activity, suggesting the observed low affinity of Ca (or Mg-ATPase is an altered state of the latter. Third, calcium (between 1 and 4 µM shows both stimulation and inhibition of the HAF-stimulated H, K-ATPase depending on its concentration, revealing a close interaction between the  proton-pump activator and local Ca concentration in gastric H, K-ATPase function. Such interactions suggest that Ca is acting as a terminal member of the intracellular signaling system for the HAF-regulated proton-pump. It appears that during resting state, the HAF-associated H, K-ATPase remains inhibited by Ca (>1 µM and, prior to resumption of acid secretion the gastric H, K-ATPase acts temporarily as a Ca-pump for removing excess Ca from its immediate environment. This conclusion is consistent with the recent reports of immunochemical co-localization of the gastric H, K-ATPase and Ca-ATPase by superimposition in parietal cells, and a transitory efflux of Ca immediately preceding the onset of acid secretion. These new perspectives on proton-pump function would open new avenues for a fuller understanding of the intracellular regulation of the ubiquitous Na-pump.

  16. New ATPase regulators-p97 goes to the PUB

    DEFF Research Database (Denmark)

    Madsen, Louise; Seeger, Michael; Semple, Colin A

    2009-01-01

    The conserved eukaryotic AAA-type ATPase complex, known as p97 or VCP in mammals and Cdc48 in yeast, is involved in a number of cellular pathways, including fusion of homotypic membranes, protein degradation, and activation of membrane-bound transcription factors. Most likely, p97 is directed...

  17. Probing the functional subunits of the tonoplast H+-ATPase

    International Nuclear Information System (INIS)

    Randall, S.K.; Lai, S.; Sze, H.

    1986-01-01

    The tonoplast ATPase of oat roots is composed of at least three polypeptides of 72, 60, and 16 kDa. The 16 kDA polypeptide covalently binds N,N'-dicyclohexylcarbodiimide and is postulated to be a component of the proton channel. Initial studies to identify other subunits indicate that both the 72 and 60 kDa subunits covalently bind 14 C]-7-chloro-4-nitrobenzo-2-oxa-1,3-diazole and [ 14 C]N-ethylamleimide, inhibitors of the tonoplast ATPase. ATP prevents binding of these inhibitors suggesting that both the 72 and 60 kDa subunits are involved in substrate binding. Polyclonal antibody has been made to the 72 kDa subunit. Western blot analysis of tonoplast vesicles reveals single reactive polypeptide (72 kDa). The antibody shows no cross-reactivity towards either the mitochondrial F 1 -ATPase or the plasma membrane ATPase. This antibody specifically inhibits ATP hydrolysis and ATP-dependent H + pumping in native tonoplast vesicles. The authors conclude that the 72 kDa subunit is intimately associated with the catalytic (or ATP-binding) site

  18. Towards the structure of yeast and mammalian P4-ATPases

    DEFF Research Database (Denmark)

    Lyons, Joseph; Laban, Milena; Mikkelsen, Stine

    2017-01-01

    and biochemical studies of yeast and mammalian P4-ATPases, in particular the phosphatidylserine (PS) transporting Drs2p/Cdc50p (Saccharomyces cerevisiae) and bATP8A2/CDC50A (Bos taurus). However, questions surrounding the mechanism of lipid translocation remain. To address this deficit in knowledge and to provide...

  19. A plasma membrane H ATPase gene is germination- induced in ...

    African Journals Online (AJOL)

    ONOS

    2010-01-18

    Jan 18, 2010 ... Ewing and Bennet (1994) identi- fied at least 7 genes in tomato and Harper et al. (1994) identified 10 genes in Arabidopsis thaliana, indicating the presence of large families of H+-ATPase genes. In this report, we determine and localize the expression pattern of germination specific plasma membrane ...

  20. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  1. Changes in erythrocyte ATPase activity under different pathological ...

    African Journals Online (AJOL)

    Endogenous a. strychnine, nicotine, and morphine—de- scription of hypo and hyper-strychninergic, nicotinergic and morphinergic state in relation to neuropsychiatric diseases. Indian J. Exp. Biol., 386: 559-66. 21. Rohn TT, Hinds TR and Vincenzi FF. 1996. Inhibi- tion of Ca-2+-pump a. ATPase and the Na+, K+ -pump.

  2. Changes in erythrocyte ATPase activity under different pathological ...

    African Journals Online (AJOL)

    Changes in erythrocyte ATPase activity under different pathological conditions. Ali A Kherd, Nawal Helmi, Khadijah Saeed Balamash, Taha A Kumosani, Shareefa A AL-Ghamdi, Qari M, Etimad A Huwait, Soonham S Yaghmoor, Alaama Nabil, Maryam A AL-Ghamdi, Said S Moselhy ...

  3. The Kdp-ATPase system and its regulation

    Indian Academy of Sciences (India)

    2007-03-15

    Mar 15, 2007 ... K+, the dominant intracellular cation, is required for various physiological processes like turgor homeostasis, pH regulation etc. Bacterial cells have evolved many diverse K+ transporters to maintain the desired concentration of internal K+. In E. coli, the KdpATPase (comprising of the KdpFABC complex), ...

  4. Asymmetric incorporation of Na+, K+-ATPase into phospholipid vesicles

    NARCIS (Netherlands)

    Jackson, R.L.; Verkleij, A.J.; Zoelen, E.J.J. van; Lane, L.K.; Schwartz, A.; Deenen, L.L.M. van

    Purified lamb kidney Na+, K+-ATPase, consisting solely of the Mτ = 95,000 catalytic subunit and the Mτ- 44,000 glycoprotein, was solubilized with Triton X-100 and incorporated into unilamellar phospholipid vesicles. Freeze-fracture electron microscopy of the vesicles showed intramembranous particles

  5. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  6. Models for the a subunits of the Thermus thermophilus V/A-ATPase and Saccharomyces cerevisiae V-ATPase enzymes by cryo-EM and evolutionary covariance

    Science.gov (United States)

    Schep, Daniel G.; Rubinstein, John L.

    2016-01-01

    Rotary ATPases couple ATP synthesis or hydrolysis to proton translocation across a membrane. However, understanding proton translocation has been hampered by a lack of structural information for the membrane-embedded a subunit. The V/A-ATPase from the eubacterium Thermus thermophilus is similar in structure to the eukaryotic V-ATPase but has a simpler subunit composition and functions in vivo to synthesize ATP rather than pump protons. We determined the T. thermophilus V/A-ATPase structure by cryo-EM at 6.4 Å resolution. Evolutionary covariance analysis allowed tracing of the a subunit sequence within the map, providing a complete model of the rotary ATPase. Comparing the membrane-embedded regions of the T. thermophilus V/A-ATPase and eukaryotic V-ATPase from Saccharomyces cerevisiae allowed identification of the α-helices that belong to the a subunit and revealed the existence of previously unknown subunits in the eukaryotic enzyme. Subsequent evolutionary covariance analysis enabled construction of a model of the a subunit in the S. cerevisae V-ATPase that explains numerous biochemical studies of that enzyme. Comparing the two a subunit structures determined here with a structure of the distantly related a subunit from the bovine F-type ATP synthase revealed a conserved pattern of residues, suggesting a common mechanism for proton transport in all rotary ATPases. PMID:26951669

  7. Vacuolar ATPases, like F1,F0-ATPases, show a strong dependence of the reaction velocity on the binding of more than one ATP per enzyme

    International Nuclear Information System (INIS)

    Kasho, V.N.; Boyer, P.D.

    1989-01-01

    Recent studies with vacuolar ATPases have shown that multiple copies catalytic subunits are present and that these have definite sequence homology with catalytic subunits of the F 1 , F 0 -ATPases. Experiments are reported that assess whether the vacuolar ATPases may have the unusual catalytic cooperativity with sequential catalytic site participation as in the binding change mechanism for the F 1 ,F 0 -ATPases. The extent of reversal of bound ATP hydrolysis to bound ADP and P i as medium ATP concentration was lowered was determined by 18 O-exchange measurements for yeast and neurospora vacuolar ATPases. The results show a pronounced increase in the extent of water oxygen incorporation into the P i formed as ATP concentration is decreased to the micromolar range. The F 1 ,F 0 -ATPase from neurospora mitochondria showed an event more pronounced modulation, similar to that of other F 1 -type ATPases. The vacuolar ATPases thus appear to have a catalytic mechanism quite analogous to that of the F 1 ,F 0 -ATPases

  8. Epigallocatechin-3-Gallate Protects Erythrocyte Ca2+-ATPase and Na+/K+-ATPase Against Oxidative Induced Damage During Aging in Humans

    Directory of Open Access Journals (Sweden)

    Prabhanshu Kumar

    2014-10-01

    Full Text Available Purpose: The main purpose of this study was to investigate the protective role of epigallocatechin-3-gallate on tertiary butyl hydroperoxide induced oxidative damage in erythrocyte during aging in humans. Methods: Human erythrocyte membrane bound Ca2+-ATPase and Na+/K+-ATPase activities were determined as a function of human age. Protective role of epigallocatechin-3-gallate was evaluated by in vitro experiments by adding epigallocatechin-3-gallate in concentration dependent manner (final concentration range 10-7M to 10-4M to the enzyme assay medium. Oxidative stress was induced in vitro by incubating washed erythrocyte ghosts with tertiary butyl hydroperoxide (10-5 M final concentration. Results: We have reported concentration dependent effect of epigallocatechin-3-gallate on tertiary butyl hydroperoxide induced damage on activities of Ca2+-ATPase and Na+/K+-ATPase during aging in humans. We have detected a significant (p < 0.001 decreased activity of Ca2+-ATPase and Na+/K+ -ATPase as a function of human age. Epigallocatechin-3-gallate protected ATPases against tertiary butyl hydroperoxide induced damage in concentration dependent manner during aging in humans. Conclusion: Epigallocatechin-3-gallate is a powerful antioxidant that is capable of protecting erythrocyte Ca2+-ATPase and Na+/K+ -ATPase against oxidative stress during aging in humans. We may propose hypothesis that a high intake of catechin rich diet may provide some protection against development of aging and age related diseases.

  9. Expression of gill vacuolar-type H+-ATPase B subunit, and Na+, K+-ATPase alpha- and beta- subunit messenger RNAs in smolting Salmo salar

    DEFF Research Database (Denmark)

    Seidelin, Michel; Madsen, Steffen; Cutler, Christopher P

    2001-01-01

    Changes in gill vacuolar-type H+-ATPase B subunit, and Na+,K+-ATPase alpha and beta subunit mRNA expression were examined during the course of smoltification in Salmo salar. We cloned and sequenced cDNA fragments of S. salar gill i) vacuolar-type H+-ATPase (V-H+-ATPase) B subunit, ii) Na+,K+-ATPase....... The peak smelt stage was, however, characterized by simultaneously elevated gill Na+,K+-ATPase expression and low V-H+-ATPase expression, and possibly ensures the complete transformation of the gill into a hypo-osmoregulatory organ and hence the development of optimal SW-tolerance of the smolt....... alpha (1) subunit, and iii) Na+,K+-ATPase beta (1) subunit, and used these as Northern blotting probes. During smoltification, the salmon showed a typical increase in gill Na+,K+-ATPase activity and improved hypo-osmoregulatory ability as judged by their ability to regulate plasma [Cl-] in a 24-hr...

  10. Sodium ions as substitutes for protons in the gastric H,K-ATPase

    International Nuclear Information System (INIS)

    Polvani, C.; Sachs, G.; Blostein, R.

    1989-01-01

    In view of the striking homology among various ion-translocating ATPases including Na,K-ATPase, Ca-ATPase, and H,K-ATPase, and the recent evidence that protons can replace cytoplasmic sodium as well as potassium in the reaction mechanism of the Na,K-ATPase (Polvani, C., and Blostein, R. (1988) J. Biol. Chem. 263, 16757-16763), we studied the role of sodium as a substitute for protons in the H,K-ATPase reaction. Using hog gastric H,K-ATPase-rich inside-out membrane vesicles we observed 22Na+ influx which was stimulated by intravesicular potassium ions (K+i) at pH 8.5 but not at pH 7.1. This sodium influx was observed in medium containing ATP and was inhibited by vanadate and SCH28080, a selective inhibitor of the gastric H,K-ATPase. At least 2-fold accumulation of sodium was observed at pH 8.5. Experiments aimed to determine the sidedness of the alkaline pH requirement for K+i-dependent sodium influx showed that K+i-activated sodium influx depends on pHout and is unaffected by changes in pHin. These results support the conclusion that sodium ions substitute for protons in the H,K-ATPase reaction mechanism and provide evidence for a similarity in ion selectivity and/or binding domains of the Na,K-ATPase and the gastric H,K-ATPase enzymes

  11. Vacuolar H+-ATPase: An Essential Multitasking Enzyme in Physiology and Pathophysiology

    Directory of Open Access Journals (Sweden)

    L. Shannon Holliday

    2014-01-01

    Full Text Available Vacuolar H+-ATPases (V-ATPases are large multisubunit proton pumps that are required for housekeeping acidification of membrane-bound compartments in eukaryotic cells. Mammalian V-ATPases are composed of 13 different subunits. Their housekeeping functions include acidifying endosomes, lysosomes, phagosomes, compartments for uncoupling receptors and ligands, autophagosomes, and elements of the Golgi apparatus. Specialized cells, including osteoclasts, intercalated cells in the kidney and pancreatic beta cells, contain both the housekeeping V-ATPases and an additional subset of V-ATPases, which plays a cell type specific role. The specialized V-ATPases are typically marked by the inclusion of cell type specific isoforms of one or more of the subunits. Three human diseases caused by mutations of isoforms of subunits have been identified. Cancer cells utilize V-ATPases in unusual ways; characterization of V-ATPases may lead to new therapeutic modalities for the treatment of cancer. Two accessory proteins to the V-ATPase have been identified that regulate the proton pump. One is the (prorenin receptor and data is emerging that indicates that V-ATPase may be intimately linked to renin/angiotensin signaling both systemically and locally. In summary, V-ATPases play vital housekeeping roles in eukaryotic cells. Specialized versions of the pump are required by specific organ systems and are involved in diseases.

  12. Review: P4-ATPases as Phospholipid Flippases-Structure, Function, and Enigmas

    DEFF Research Database (Denmark)

    Andersen, Jens P; Vestergaard, Anna L; Mikkelsen, Stine A

    2016-01-01

    -type ATPase signature sequence, and dephosphorylation is activated by the lipid substrate being flipped from the exoplasmic to the cytoplasmic leaflet similar to the activation of dephosphorylation of Na+/K+-ATPase by exoplasmic K+. How the phospholipid is translocated can be understood in terms...... group is propelled along against its concentration gradient with the hydrocarbon chains projecting out into the lipid phase by movement of an isoleucine located at the position corresponding to an ion binding glutamate in the Ca2+- and Na+/K+-ATPases. Hence, the P4-ATPase mechanism is quite similar...... on properties of mammalian and yeast P4-ATPases for which most mechanistic insight is available. However, the structure, function and enigmas associated with mammalian and yeast P4-ATPases most likely extend to P4-ATPases of plants and other organisms....

  13. Decreased ATPase activity in adriamycin nephrosis is independent of proteinuria

    Energy Technology Data Exchange (ETDEWEB)

    Bakker, W.W.; Kalicharan, D.; Donga, J.; Hulstaert, C.E.; Hardonk, M.J.

    1987-03-01

    In previous studies from this laboratory it has been shown that ATP-ase activity in situ in the glomerular basement membrane (GBM) is clearly reduced in rats rendered nephrotic after treatment with adriamycin (ADR). The question was raised whether this reduction of ATP-ase activity in the GBM is due to toxic activity of ADR or rather a result of the nephrotic condition per se. Therefore, we studied ATP-ase activity using the cerium-based method in kidneys from ADR-treated rats without proteinuria (48 hr after ADR injection), or with proteinuria (approximately 150 mg/24 hr) several weeks after ADR injection. Also kidneys from rats rendered nephrotic by surgical ablation and from non-nephrotic rats treated with local X-irradiation (2000 rads) as well as from normal control rats were studied. The results show that in the GBM of ADR-treated or irradiated rats, clear reduction of ATP-ase activity is observed irrespective of their proteinuria, whereas in the GBM of rats rendered nephrotic by renal ablation (approximately 156 mg/24 hr mean protein excretion) no reduction of enzyme activity is found. It is concluded that decreased ATP-ase activity of the glomerular filtration barrier in ADR-treated rats is due to an early toxic activity of this drug and not a result of the nephrotic state per se. In view of the identical results in X-irradiated rats, it is likely that ADR may act through production of toxic radicals leading to damage of this membrane-associated enzyme system.

  14. Characterization of Na+K+-ATPase in bovine sperm.

    Science.gov (United States)

    Hickey, Katie D; Buhr, Mary M

    2012-04-15

    Existing as a ubiquitous transmembrane protein, Na(+)K(+)-ATPase affects sperm fertility and capacitation through ion transport and a recently identified signaling function. Functional Na(+)K(+)-ATPase is a dimer of α and β subunits, each with isoforms (four and three, respectively). Since specific isoform pairings and locations may influence or indicate function, the objective of this study was to identify and localize subunits of Na(+)K(+)-ATPase in fresh bull sperm by immunoblotting and immunocytochemistry using antibodies against α1 and 3, and all β isoforms. Relative quantity of Na(+)K(+)-ATPase in head plasma membranes (HPM's) from sperm of different bulls was determined by densitometry of immunoblot bands, and compared to bovine kidney. Sperm and kidney specifically bound all antibodies at kDa equivalent to commercial controls, and to additional lower kDa bands in HPM. Immunofluorescence of intact sperm confirmed that all isoforms were present in the head region of sperm and that α3 was also uniformly distributed post-equatorially. Permeabilization exposing internal membranes typically resulted in an increase in fluorescence, indicating that some antibody binding sites were present on the inner surface of the HPM or the acrosomal membrane. Deglycosylation of β1 reduced the kDa of bands in sperm, rat brain and kidney, with the kDa of the deglycosylated bands differing among tissues. Two-dimensional blots of β1 revealed three distinct spots. Based on the unique quantity, location and structure Na(+)K(+)-ATPase subunits in sperm, we inferred that this protein has unique functions in sperm. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Regulation of proximal tubule vacuolar H+-ATPase by PKA and AMP-activated protein kinase

    Science.gov (United States)

    Al-bataineh, Mohammad M.; Gong, Fan; Marciszyn, Allison L.; Myerburg, Michael M.

    2014-01-01

    The vacuolar H+-ATPase (V-ATPase) mediates ATP-driven H+ transport across membranes. This pump is present at the apical membrane of kidney proximal tubule cells and intercalated cells. Defects in the V-ATPase and in proximal tubule function can cause renal tubular acidosis. We examined the role of protein kinase A (PKA) and AMP-activated protein kinase (AMPK) in the regulation of the V-ATPase in the proximal tubule as these two kinases coregulate the V-ATPase in the collecting duct. As the proximal tubule V-ATPases have different subunit compositions from other nephron segments, we postulated that V-ATPase regulation in the proximal tubule could differ from other kidney tubule segments. Immunofluorescence labeling of rat ex vivo kidney slices revealed that the V-ATPase was present in the proximal tubule both at the apical pole, colocalizing with the brush-border marker wheat germ agglutinin, and in the cytosol when slices were incubated in buffer alone. When slices were incubated with a cAMP analog and a phosphodiesterase inhibitor, the V-ATPase accumulated at the apical pole of S3 segment cells. These PKA activators also increased V-ATPase apical membrane expression as well as the rate of V-ATPase-dependent extracellular acidification in S3 cell monolayers relative to untreated cells. However, the AMPK activator AICAR decreased PKA-induced V-ATPase apical accumulation in proximal tubules of kidney slices and decreased V-ATPase activity in S3 cell monolayers. Our results suggest that in proximal tubule the V-ATPase subcellular localization and activity are acutely coregulated via PKA downstream of hormonal signals and via AMPK downstream of metabolic stress. PMID:24553431

  16. A structural overview of the plasma membrane Na+,K+-ATPase and H+-ATPase ion pumps

    DEFF Research Database (Denmark)

    Morth, Jens Preben; Pedersen, Bjørn Panella; Buch-Pedersen, Morten Jeppe

    2011-01-01

    Plasma membrane ATPases are primary active transporters of cations that maintain steep concentration gradients. The ion gradients and membrane potentials derived from them form the basis for a range of essential cellular processes, in particular Na(+)-dependent and proton-dependent secondary tran......(+)-ATPase maintains a Na(+) and K(+) gradient in animal cells. Structural information provides insight into the function of these two distinct but related P-type pumps....... transport systems that are responsible for uptake and extrusion of metabolites and other ions. The ion gradients are also both directly and indirectly used to control pH homeostasis and to regulate cell volume. The plasma membrane H(+)-ATPase maintains a proton gradient in plants and fungi and the Na(+),K......Plasma membrane ATPases are primary active transporters of cations that maintain steep concentration gradients. The ion gradients and membrane potentials derived from them form the basis for a range of essential cellular processes, in particular Na(+)-dependent and proton-dependent secondary...

  17. Expression of Na,K-ATPase and H,K-ATPase Isoforms with the Baculovirus Expression System

    NARCIS (Netherlands)

    Koenderink, J.B.; Swarts, H.G.

    2016-01-01

    P-type ATPases can be expressed in several cell systems. The baculovirus expressions system uses an insect virus to enter and express proteins in Sf9 insect cells. This expression system is a lytic system in which the cells will die a few days after viral infection. Subsequently, the expressed

  18. Polo-like kinase 1 (PLK1) and protein phosphatase 6 (PP6) regulate DNA-dependent protein kinase catalytic subunit (DNA-PKcs) phosphorylation in mitosis.

    Science.gov (United States)

    Douglas, Pauline; Ye, Ruiqiong; Trinkle-Mulcahy, Laura; Neal, Jessica A; De Wever, Veerle; Morrice, Nick A; Meek, Katheryn; Lees-Miller, Susan P

    2014-06-25

    The protein kinase activity of the DNA-PKcs (DNA-dependent protein kinase catalytic subunit) and its autophosphorylation are critical for DBS (DNA double-strand break) repair via NHEJ (non-homologous end-joining). Recent studies have shown that depletion or inactivation of DNA-PKcs kinase activity also results in mitotic defects. DNA-PKcs is autophosphorylated on Ser2056, Thr2647 and Thr2609 in mitosis and phosphorylated DNA-PKcs localize to centrosomes, mitotic spindles and the midbody. DNA-PKcs also interacts with PP6 (protein phosphatase 6), and PP6 has been shown to dephosphorylate Aurora A kinase in mitosis. Here we report that DNA-PKcs is phosphorylated on Ser3205 and Thr3950 in mitosis. Phosphorylation of Thr3950 is DNA-PK-dependent, whereas phosphorylation of Ser3205 requires PLK1 (polo-like kinase 1). Moreover, PLK1 phosphorylates DNA-PKcs on Ser3205 in vitro and interacts with DNA-PKcs in mitosis. In addition, PP6 dephosphorylates DNA-PKcs at Ser3205 in mitosis and after IR (ionizing radiation). DNA-PKcs also phosphorylates Chk2 on Thr68 in mitosis and both phosphorylation of Chk2 and autophosphorylation of DNA-PKcs in mitosis occur in the apparent absence of Ku and DNA damage. Our findings provide mechanistic insight into the roles of DNA-PKcs and PP6 in mitosis and suggest that DNA-PKcs' role in mitosis may be mechanistically distinct from its well-established role in NHEJ.

  19. Carbonyl J Acid Derivatives Block Protein Priming of Hepadnaviral P Protein and DNA-Dependent DNA Synthesis Activity of Hepadnaviral Nucleocapsids

    Science.gov (United States)

    Wang, Yong-Xiang; Wen, Yu-Mei

    2012-01-01

    Current treatments for chronic hepatitis B are effective in only a fraction of patients. All approved directly antiviral agents are nucleos(t)ide analogs (NAs) that target the DNA polymerase activity of the hepatitis B virus (HBV) P protein; resistance and cross-resistance may limit their long-term applicability. P protein is an unusual reverse transcriptase that initiates reverse transcription by protein priming, by which a Tyr residue in the unique terminal protein domain acts as an acceptor of the first DNA nucleotide. Priming requires P protein binding to the ε stem-loop on the pregenomic RNA (pgRNA) template. This interaction also mediates pgRNA encapsidation and thus provides a particularly attractive target for intervention. Exploiting in vitro priming systems available for duck HBV (DHBV) but not HBV, we demonstrate that naphthylureas of the carbonyl J acid family, in particular KM-1, potently suppress protein priming by targeting P protein and interfering with the formation of P-DHBV ε initiation complexes. Quantitative evaluation revealed a significant increase in complex stability during maturation, yet even primed complexes remained sensitive to KM-1 concentrations below 10 μM. Furthermore, KM-1 inhibited the DNA-dependent DNA polymerase activity of both DHBV and HBV nucleocapsids, including from a lamivudine-resistant variant, directly demonstrating the sensitivity of human HBV to the compound. Activity against viral replication in cells was low, likely due to low intracellular availability. KM-1 is thus not yet a drug candidate, but its distinct mechanism of action suggests that it is a highly useful lead for developing improved, therapeutically applicable derivatives. PMID:22787212

  20. A novel multigene cloning method for the production of a motile ATPase.

    Science.gov (United States)

    Jang, Min Su; Song, Woo Chul; Shin, Seung Won; Park, Kyung Soo; Kim, Jinseok; Kim, Dong-Ik; Kim, Byung Woo; Um, Soong Ho

    2015-08-10

    With the advent of nanotechnology, new functional modules (e.g., nanomotors, nanoprobes) have become essential in several medical fields. Generally, mechanical modulators systems are the principal components of most cutting-edge technologies in modern biomedical applications. However, the in vivo use of motile probes has raised many concerns due to their low sensitivity and non-biocompatibility. As an alternative, biological enzymatic engines have received increased attention. In particular, ATPases, which belong to a class of motile enzymes that catalyze chemical metabolic reactions, have emerged as a promising motor due to their improved biocompatibility and performance. However, ATPases usually suffer from lower functional activity and are difficult to express recombinantly in bacteria relative to their conventional and synthetic competitors. Here, we report a novel functional modified ATPase with both a simple purification protocol and enhanced motile activity. For this mutant ATPase, a new bacterial subcloning method was established. The ATPase-encoding sequence was redesigned so that the mutant ATPase could be easily produced in an Escherichia coli system. The modified thermophilic F1-ATPase (mTF1-ATPase) demonstrated 17.8unit/mg ATPase activity. We propose that derivatives of our ATPase may enable the development of novel in vitro and in vivo synthetic medical diagnostics, as well as therapeutics. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Regulation of cardiac remodeling by cardiac Na/K-ATPase isoforms

    Directory of Open Access Journals (Sweden)

    Lijun Catherine Liu

    2016-09-01

    Full Text Available Cardiac remodeling occurs after cardiac pressure/volume overload or myocardial injury during the development of heart failure and is a determinant of heart failure. Preventing or reversing remodeling is a goal of heart failure therapy. Human cardiomyocyte Na+/K+-ATPase has multiple α isoforms (1-3. The expression of the α subunit of the Na+/K+-ATPase is often altered in hypertrophic and failing hearts. The mechanisms are unclear. There are limited data from human cardiomyocytes. Abundant evidences from rodents show that Na+/K+-ATPase regulates cardiac contractility, cell signaling, hypertrophy and fibrosis. The α1 isoform of the Na+/K+-ATPase is the ubiquitous isoform and possesses both pumping and signaling functions. The α2 isoform of the Na+/K+-ATPase regulates intracellular Ca2+ signaling, contractility and pathological hypertrophy. The α3 isoform of the Na+/K+-ATPase may also be a target for cardiac hypertrophy. Restoration of cardiac Na+/K+-ATPase expression may be an effective approach for prevention of cardiac remodeling. In this article, we will overview: (1 the distribution and function of isoform specific Na+/K+-ATPase in the cardiomyocytes. (2 the role of cardiac Na+/K+-ATPase in the regulation of cell signaling, contractility, cardiac hypertrophy and fibrosis in vitro and in vivo. Selective targeting of cardiac Na+/K+-ATPase isoform may offer a new target for the prevention of cardiac remodeling.

  2. Differential effects of inhibitors and detergents on the Ca2+-ATPase and Mg2+-ATPase activities of the plasma membrane of a human oat cell carcinoma

    International Nuclear Information System (INIS)

    Knowles, A.F.; Lawrence, C.M.

    1986-01-01

    Plasma membranes of human oat cell carcinoma possess Mg 2+ - and Ca 2+ -dependent ATPase activities of similar magnitude. These activities exhibit the unusual characteristic of being inactiviated by prolonged incubation of the membrane with 1-2 mM dithiothreitol (DTT). Inactivation by DTT was prevented by lowering the incubation temperature, elevation of the membrane protein concentration, and addition of ATP. Fluorosulfonylbenzoyl adenosine (FSBA), an affinity ATP analog, also inactivates these activities. The Ca 2+ -ATPase activity appears to be more sensitive to both DTT and FSBA. The Ca 2+ -ATPase activity is more easily inactivated by Triton X-100, while the Mg 2+ -ATPase is preferentially activated by digitonin. These differential effects of inhibitors and detergents suggest that the Ca 2+ -ATPase and Mg 2+ -ATPase are separate enzymes. Incubation of oat cell carcinoma plasma membrane with [ 3 H]FSBA resulted in the labeling of several proteins. A labelled 35,000 dalton protein corresponds to the molecular weight of the oat cell carcinoma plasma membrane Ca 2+ -ATPase previously purified in this laboratory. The identity of one or more of the other labelled proteins with the Mg 2+ -ATPase has not been demonstrated, but is presently under investigation

  3. Activation of Na+-K+-ATPase with DRm217 attenuates oxidative stress-induced myocardial cell injury via closing Na+-K+-ATPase/Src/Ros amplifier.

    Science.gov (United States)

    Yan, Xiaofei; Xun, Meng; Dou, Xiaojuan; Wu, Litao; Zhang, Fujun; Zheng, Jin

    2017-04-01

    Reduced Na + -K + -ATPase activity has close relationship with cardiomyocyte death. Reactive oxygen species (ROS) also plays an important role in cardiac cell damage. It has been proved that Na + -K + -ATPase and ROS form a feed-forward amplifier. The aim of this study was to explore whether DRm217, a proved Na + /K + -ATPase's DR-region specific monoclonal antibody and direct activator, could disrupt Na + -K + -ATPase/ROS amplifier and protect cardiac cells from ROS-induced injury. We found that DRm217 protected myocardial cells against hydrogen peroxide (H 2 O 2 )-induced cardiac cell injury and mitochondrial dysfunction. DRm217 also alleviated the effect of H 2 O 2 on inhibition of Na + -K + -ATPase activity, Na + -K + -ATPase cell surface expression, and Src phosphorylation. H 2 O 2 -treatment increased intracellular ROS, mitochondrial ROS and induced intracellular Ca 2+ , mitochondrial Ca 2+ overload. DRm217 closed Na + -K + -ATPase/ROS amplifier, alleviated Ca 2+ accumulation and finally inhibited ROS and mitochondrial ROS generation. These novel results may help us to understand the important role of the Na + -K + -ATPase in oxidative stress and oxidative stress-related disease.

  4. Sperm Na+, K+-ATPase and Ca2+-ATPase activity: A preliminary study of comparison of swim up and density gradient centrifugation methods for sperm preparation

    Science.gov (United States)

    Lestari, Silvia W.; Larasati, Manggiasih D.; Asmarinah, Mansur, Indra G.

    2018-02-01

    As one of the treatment for infertility, the success rate of Intrauterine Insemination (IUI) is still relatively low. Several sperm preparation methods, swim-up (SU) and the density-gradient centrifugation (DGC) are frequently used to select for better sperm quality which also contribute to IUI failure. Sperm selection methods mainly separate the motile from the immotile sperm, eliminating the seminal plasma. The sperm motility involves the structure and function of sperm membrane in maintaining the balance of ion transport system which is regulated by the Na+, K+-ATPase, and Ca2+-ATPase enzymes. This study aims to re-evaluate the efficiency of these methods in selecting for sperm before being used for IUI and based the evaluation on sperm Na+,K+-ATPase and Ca2+-ATPase activities. Fourteen infertile men from couples who underwent IUI were involved in this study. The SU and DGC methods were used for the sperm preparation. Semen analysis was performed based on the reference value of World Health Organization (WHO) 2010. After isolating the membrane fraction of sperms, the Na+, K+-ATPase activity was defined as the difference in the released inorganic phosphate (Pi) with and without the existence of 10 mM ouabain in the reaction, while the Ca2+-ATPase was determined as the difference in Pi contents with and without the existence of 55 µm CaCl2. The prepared sperm demonstrated a higher percentage of motile sperm compared to sperm from the whole semen. Additionally, the percentage of motile sperm of post-DGC showed higher result than the sperm from post-SU. The velocity of sperm showed similar pattern with the percentage of motile sperm, in which the velocity of prepared sperm was higher than the sperm from whole semen. Furthermore, the sperm velocity of post-DGC was higher compared to the sperm from post-SU. The Na+, K+-ATPase activity of prepared sperm was higher compared to whole semen, whereas Na+, K+-ATPase activity in the post DGC was higher than post SU. The Ca2

  5. Arginine substitution of a cysteine in transmembrane helix M8 converts Na+,K+-ATPase to an electroneutral pump similar to H+,K+-ATPase.

    Science.gov (United States)

    Holm, Rikke; Khandelwal, Jaanki; Einholm, Anja P; Andersen, Jens P; Artigas, Pablo; Vilsen, Bente

    2017-01-10

    Na + ,K + -ATPase and H + ,K + -ATPase are electrogenic and nonelectrogenic ion pumps, respectively. The underlying structural basis for this difference has not been established, and it has not been revealed how the H + ,K + -ATPase avoids binding of Na + at the site corresponding to the Na + -specific site of the Na + ,K + -ATPase (site III). In this study, we addressed these questions by using site-directed mutagenesis in combination with enzymatic, transport, and electrophysiological functional measurements. Replacement of the cysteine C932 in transmembrane helix M8 of Na + ,K + -ATPase with arginine, present in the H + ,K + -ATPase at the corresponding position, converted the normal 3Na + :2K + :1ATP stoichiometry of the Na + ,K + -ATPase to electroneutral 2Na + :2K + :1ATP stoichiometry similar to the electroneutral transport mode of the H + ,K + -ATPase. The electroneutral C932R mutant of the Na + ,K + -ATPase retained a wild-type-like enzyme turnover rate for ATP hydrolysis and rate of cellular K + uptake. Only a relatively minor reduction of apparent Na + affinity for activation of phosphorylation from ATP was observed for C932R, whereas replacement of C932 with leucine or phenylalanine, the latter of a size comparable to arginine, led to spectacular reductions of apparent Na + affinity without changing the electrogenicity. From these results, in combination with structural considerations, it appears that the guanidine + group of the M8 arginine replaces Na + at the third site, thus preventing Na + binding there, although allowing Na + to bind at the two other sites and become transported. Hence, in the H + ,K + -ATPase, the ability of the M8 arginine to donate an internal cation binding at the third site is decisive for the electroneutral transport mode of this pump.

  6. Differential distribution of V-type H(+)-ATPase and Na (+)/K (+)-ATPase in the branchial chamber of the palaemonid shrimp Macrobrachium amazonicum.

    Science.gov (United States)

    Boudour-Boucheker, Nesrine; Boulo, Viviane; Charmantier-Daures, Mireille; Grousset, Evelyse; Anger, Klaus; Charmantier, Guy; Lorin-Nebel, Catherine

    2014-07-01

    V-H(+)-ATPase and Na(+)/K(+)-ATPase were localized in the gills and branchiostegites of M. amazonicum and the effects of salinity on the branchial chamber ultrastructure and on the localization of transporters were investigated. Gills present septal and pillar cells. In freshwater (FW), the apical surface of pillar cells is amplified by extensive evaginations associated with mitochondria. V-H(+)-ATPase immunofluorescence was localized in the membranes of the apical evaginations and in clustered subapical areas of pillar cells, suggesting labeling of intracellular vesicle membranes. Na(+)/K(+)-ATPase labeling was restricted to the septal cells. No difference in immunostaining was recorded for both proteins according to salinity (FW vs. 25 PSU). In the branchiostegite, both V-H(+)-ATPase and Na(+)/K(+)-ATPase immunofluorescence were localized in the same cells of the internal epithelium. Immunogold revealed that V-H(+)-ATPase was localized in apical evaginations and in electron-dense areas throughout the inner epithelium, while Na(+)/K(+)-ATPase occurred densely along the basal infoldings of the cytoplasmic membrane. Our results suggest that morphologically different cell types within the gill lamellae may also be functionally specialized. We propose that, in FW, pillar cells expressing V-H(+)-ATPase absorb ions (Cl(-), Na(+)) that are transported either directly to the hemolymph space or through a junctional complex to the septal cells, which may be responsible for active Na(+) delivery to the hemolymph through Na(+)/K(+)-ATPase. This suggests a functional link between septal and pillar cells in osmoregulation. When shrimps are transferred to FW, gill and branchiostegite epithelia undergo ultrastructural changes, most probably resulting from their involvement in osmoregulatory processes.

  7. Nonequilibrium Energetics of a Single F1-ATPase Molecule

    OpenAIRE

    Toyabe, Shoichi; Watanabe-Nakayama, Takahiro; Okamoto, Tetsuaki; Kudo, Seishi; Muneyuki, Eiro

    2010-01-01

    Molecular motors drive mechanical motions utilizing the free energy liberated from chemical reactions such as ATP hydrolysis. Although it is essential to know the efficiency of this free energy transduction, it has been a challenge due to the system's microscopic scale. Here, we evaluate the single-molecule energetics of a rotary molecular motor, F1-ATPase, by applying a recently derived nonequilibrium equality together with an electrorotation method. We show that the sum of the heat flow thr...

  8. Porphyromonas gingivalis is highly sensitive to inhibitors of a proton-pumping ATPase.

    Science.gov (United States)

    Sekiya, Mizuki; Shimoyama, Yu; Ishikawa, Taichi; Sasaki, Minoru; Futai, Masamitsu; Nakanishi-Matsui, Mayumi

    2018-04-15

    Porphyromonas gingivalis is a well-known Gram-negative bacterium that causes periodontal disease. The bacterium metabolizes amino acids and peptides to obtain energy. An ion gradient across its plasma membrane is thought to be essential for nutrient import. However, it is unclear whether an ion-pumping ATPase responsible for the gradient is required for bacterial growth. Here, we report the inhibitory effect of protonophores and inhibitors of a proton-pumping ATPase on the growth of P. gingivalis. Among the compounds examined, curcumin and citreoviridin appreciably reduced the bacterial growth. Furthermore, these compounds inhibited the ATPase activity in the bacterial membrane, where the A-type proton-pumping ATPase (A-ATPase) is located. This study suggests that curcumin and citreoviridin inhibit the bacterial growth by inhibiting the A-ATPase in the P. gingivalis membrane. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. Excess capacity of H+ ATPase and inverse respiratory control in Escherichia coli

    DEFF Research Database (Denmark)

    Jensen, Peter Ruhdal; Westerhoff, Hans V.; Michelsen, Ole

    1993-01-01

    With succinate as free-energy source, Escherichia coli generating virtually all ATP by oxidative phosphorylation might be expected heavily to tax its ATP generating capacity. To examine this the H+-ATPase (ATP synthase) was modulated over a 30-fold range. Decreasing the amount of H+-ATPase reduced...... the growth rate much less than proportionally; the H+-ATPase controlled growth rate by lt 10%. This lack of control reflected excess capacity: the rate of ATP synthesis per H+-ATPase (the turnover number) increased by 60% when the number of enzymes was decreased by 40%. At 15% H+-ATPase, the enzyme became...... limiting and its turnover was increased even further, due to an increased driving force caused by a reduction in the total flux through the enzymes. At smaller reductions of (H+-ATPase) the total flux was not reduced, revealing a second cause for increased turnover number through increased membrane...

  10. Nitric oxide and Na,K-ATPase activity in rat skeletal muscle

    DEFF Research Database (Denmark)

    Juel, Carsten

    2016-01-01

    Aim: It has been suggested that nitric oxide (NO) stimulates the Na,K-ATPase in cardiac myocytes. Therefore, the aims of this study were to investigate whether NO increases Na,K-ATPase activity in skeletal muscle and, if that is the case, to identify the underlying mechanism. Method: The study used...... isolated rat muscle, muscle homogenates and purified membranes as model systems. Na,K-ATPase activity was quantified from phosphate release due to ATP hydrolysis. Results: Exposure to the NO donor spermine NONOate (10 μm) increased the maximal Na,K-ATPase activity by 27% in isolated glycolytic muscles......, but had no effect in oxidative muscles. Spermine NONOate increased the maximal Na,K-ATPase activity by 58% (P Na,K-ATPase α-isoform. Incubation with c...

  11. Induction and Persistence of Large γH2AX Foci by High Linear Energy Transfer Radiation in DNA-Dependent protein kinase–Deficient Cells

    Energy Technology Data Exchange (ETDEWEB)

    Bracalente, Candelaria; Ibañez, Irene L. [Departamento de Micro y Nanotecnología, Comisión Nacional de Energía Atómica, San Martín, Buenos Aires (Argentina); Consejo Nacional de Investigaciones Científicas y Técnicas, Buenos Aires (Argentina); Molinari, Beatriz [Departamento de Radiobiología, Comisión Nacional de Energía Atómica, San Martín, Buenos Aires (Argentina); Consejo Nacional de Investigaciones Científicas y Técnicas, Buenos Aires (Argentina); Palmieri, Mónica [Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Buenos Aires (Argentina); Kreiner, Andrés [Consejo Nacional de Investigaciones Científicas y Técnicas, Buenos Aires (Argentina); Gerencia de Investigación y Aplicaciones, Comisión Nacional de Energía Atómica, San Martín, Buenos Aires (Argentina); Escuela de Ciencia y Tecnología, Universidad Nacional de San Martín, San Martín, Buenos Aires (Argentina); Valda, Alejandro [Escuela de Ciencia y Tecnología, Universidad Nacional de San Martín, San Martín, Buenos Aires (Argentina); and others

    2013-11-15

    Purpose: To evaluate the cell response to DNA double-strand breaks induced by low and high linear energy transfer (LET) radiations when the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), an essential protein of the nonhomologous end-joining repair pathway, lacks kinase activity. Methods and Materials: CHO10B2, a Chinese hamster ovary cell line, and its derived radiosensitive mutant cell line, irs-20, lacking DNA-PKcs activity, were evaluated after 0 to 3 Gy of γ-rays, plateau and Bragg peak protons, and lithium beams by clonogenic assay, and as a measurement of double-strand breaks, phosphorylated H2AX (γH2AX) foci number and size were quantified by immunocytofluorescence. Results: Irs-20 exhibited greater radiosensitivity and a higher amount of γH2AX foci than CHO10B2 at 6 hours after irradiation for all types of radiations. Remarkably, CHO10B2 and irs-20 maintained their difference in radiosensitivity after high-LET radiation. Six hours after low-LET radiations, irs-20 did not reach basal levels of γH2AX at high doses, whereas CHO10B2 recovered basal levels for all doses. After high-LET radiation, only CHO10B2 exhibited a reduction in γH2AX foci, but it never reached basal levels. Persistent foci in irs-20 confirmed a repair deficiency. Interestingly, after 30 minutes of high-LET radiation both cell lines exhibited large foci (size >0.9 μm{sup 2}) related to the damage nature, whereas at 6 hours irs-20 showed a higher amount of large foci than CHO10B2, with a 7-fold increase at 3 Gy, that could also be associated to radiosensitivity. Conclusions: We demonstrated, for the first time, an association between deficient DNA-PKcs activity and not only high levels of H2AX phosphorylation but also persistence and size increase of γH2AX foci after high-LET irradiation.

  12. A role for DNA-dependent activator of interferon regulatory factor in the recognition of herpes simplex virus type 1 by glial cells

    Directory of Open Access Journals (Sweden)

    Furr Samantha R

    2011-08-01

    Full Text Available Abstract Background The rapid onset of potentially lethal neuroinflammation is a defining feature of viral encephalitis. Microglia and astrocytes are likely to play a significant role in viral encephalitis pathophysiology as they are ideally positioned to respond to invading central nervous system (CNS pathogens by producing key inflammatory mediators. Recently, DNA-dependent activator of IFN regulatory factor (DAI has been reported to function as an intracellular sensor for DNA viruses. To date, the expression and functional role of DAI in the inflammatory responses of resident CNS cells to neurotropic DNA viruses has not been reported. Methods Expression of DAI and its downstream effector molecules was determined in C57BL/6-derived microglia and astrocytes, either at rest or following exposure to herpes simplex virus type 1 (HSV-1 and/or murine gammaherpesvirus-68 (MHV-68, by immunoblot analysis. In addition, such expression was studied in ex vivo microglia/macrophages and astrocytes from uninfected animals or mice infected with HSV-1. Inflammatory cytokine production by glial cultures following transfection with a DAI specific ligand (B-DNA, or following HSV-1 challenge in the absence or presence of siRNA directed against DAI, was assessed by specific capture ELISA. The production of soluble neurotoxic mediators by HSV-1 infected glia following DAI knockdown was assessed by analysis of the susceptibility of neuron-like cells to conditioned glial media. Results We show that isolated microglia and astrocytes constitutively express DAI and its effector molecules, and show that such expression is upregulated following DNA virus challenge. We demonstrate that these resident CNS cells express DAI in situ, and show that its expression is similarly elevated in a murine model of HSV-1 encephalitis. Importantly, we show B-DNA transfection can elicit inflammatory cytokine production by isolated glial cells and DAI knockdown can significantly reduce

  13. Formation of oriented membrane multilayers of Na/K-ATPase

    International Nuclear Information System (INIS)

    Pachence, J.M.; Knott, R.; Edelman, I.S.; Schoenborn, B.P.; Wallace, B.A.

    1982-01-01

    The isolated membrane-bound enzyme retains its ouabain-sensitive ATP hydrolysis activity, and produces ATP-dependent Na + and K + fluxes when incorporated into phospholipid vesicles. The ultimate goal of this work is to determine its low resolution structure using both X-ray and neutron diffraction. A number of methods were used to impart lamellar stacking order to highly purified pig Na/K-ATPase membranes. Upon partial dehydration, x-ray diffraction from Na/K-ATPase membrane multilayers at 98% relative humidity yielded discrete reflections of 118 A periodicity, diffracting to 1/14.8 A -1 , additionally, continuous diffraction to 1/10 A -1 was obtained. Subjecting the membrane multilayers to high magnetic fields improved the quality of the lamellar diffraction dramatically. Neutron diffraction studies of the partially dehydrated Na/K-ATPase membrane multilayers detected a mosaic spread of 2 0 when the samples were subjected to a magnetic field of 5 Tesla perpendicular to the membrane surface; the reflections were narrower than the camera line width; hence, the lattice disorder has also decreased significantly, although only four orders were measured

  14. The oligomeric state of the active Vps4 AAA ATPase

    Science.gov (United States)

    Monroe, Nicole; Han, Han; Gonciarz, Malgorzata D.; Eckert, Debra M.; Karren, Mary Anne; Whitby, Frank G.; Sundquist, Wesley I.; Hill, Christopher P.

    2013-01-01

    The cellular ESCRT pathway drives membrane constriction toward the cytosol and effects membrane fission during cytokinesis, endosomal sorting, and the release of many enveloped viruses, including HIV. A component of this pathway, the AAA ATPase Vps4, provides energy for pathway progression. Although it is established that Vps4 functions as an oligomer, subunit stoichiometry and other fundamental features of the functional enzyme are unclear. Higher-order oligomers have thus far only been characterized for a Walker B mutant of Vps4 in the presence of ATP. Here, we report that although some mutant Vps4 proteins form dodecameric assemblies, active wild-type S. cerevisiae and S. solfataricus Vps4 enzymes can form hexamers in the presence of ATP and ADP, as assayed by size exclusion chromatography and equilibrium analytical ultracentifugation. The Vta1p activator binds hexameric yeast Vps4p without changing the oligomeric state of Vps4p, implying that the active Vta1p:Vps4p complex also contains a single hexameric ring. Additionally, we report crystal structures of two different archaeal Vps4 homologs, whose structures and lattice interactions suggest a conserved mode of oligomerization. Disruption of the proposed hexamerization interface by mutagenesis abolished the ATPase activity of archaeal Vps4 proteins and blocked Vps4p function in S. cerevisiae. These data challenge the prevailing model that active Vps4 is a double ring dodecamer, and argue that, like other type I AAA ATPases, Vps4 functions as a single ring with six subunits. PMID:24161953

  15. Protein import into chloroplasts requires a chloroplast ATPase

    Energy Technology Data Exchange (ETDEWEB)

    Pain, D.; Blobel, G.

    1987-05-01

    The authors have transcribed mRNA from a cDNA clone coding for pea ribulose-1,5-bisphosphate carboxylase, translated the mRNA in a wheat germ cell-free system, and studied the energy requirement for posttranslational import of the (/sup 35/S)methionine-labeled protein into the stroma of pea chloroplasts. They found that import depends on ATP hydrolysis within the stroma. Import is not inhibited when H/sup +/, K/sup +/, Na/sup +/, or divalent cation gradients across the chloroplast membranes are dissipated by ionophores, as long as exogenously added ATP is also present during the import reaction. The data suggest that protein import into the chloroplast stroma requires a chloroplast ATPase that does not function to generate a membrane potential for driving the import reaction but that exerts its effect in another, yet-to-be-determined, mode. They have carried out a preliminary characterization of this ATPase regarding its nucleotide specificity and the effects of various ATPase inhibitors.

  16. Radiation inactivation analysis of chloroplast CF0-CF1 ATPase

    International Nuclear Information System (INIS)

    Wang, M.Y.; Chien, L.F.; Pan, R.L.

    1988-01-01

    Radiation inactivation technique was employed to measure the functional size of adenosine triphosphatase of spinach chloroplasts. The functional size for acid-base-induced ATP synthesis was 450 +/- 24 kilodaltons; for phenazine methosulfate-mediated ATP synthesis, 613 +/- 33 kilodaltons; and for methanol-activated ATP hydrolysis, 280 +/- 14 kilodaltons. The difference (170 +/- 57 kilodaltons) between 450 +/- 24 and 280 +/- 14 kilodaltons is explained to be the molecular mass of proton channel (coupling factor 0) across the thylakoid membrane. Our data suggest that the stoichiometry of subunits I, II, and III of coupling factor 0 is 1:2:15. Ca2+- and Mg2+-ATPase activated by methanol, heat, and trypsin digestion have a similar functional size. However, anions such as SO 3 (2-) and CO 3 (2-) increased the molecular mass for both ATPase's (except trypsin-activated Mg2+-ATPase) by 12-30%. Soluble coupling factor 1 has a larger target size than that of membrane-bound. This is interpreted as the cold effect during irradiation

  17. Rotary ATPases: models, machine elements and technical specifications.

    Science.gov (United States)

    Stewart, Alastair G; Sobti, Meghna; Harvey, Richard P; Stock, Daniela

    2013-01-01

    Rotary ATPases are molecular rotary motors involved in biological energy conversion. They either synthesize or hydrolyze the universal biological energy carrier adenosine triphosphate. Recent work has elucidated the general architecture and subunit compositions of all three sub-types of rotary ATPases. Composite models of the intact F-, V- and A-type ATPases have been constructed by fitting high-resolution X-ray structures of individual subunits or sub-complexes into low-resolution electron densities of the intact enzymes derived from electron cryo-microscopy. Electron cryo-tomography has provided new insights into the supra-molecular arrangement of eukaryotic ATP synthases within mitochondria and mass-spectrometry has started to identify specifically bound lipids presumed to be essential for function. Taken together these molecular snapshots show that nano-scale rotary engines have much in common with basic design principles of man made machines from the function of individual "machine elements" to the requirement of the right "fuel" and "oil" for different types of motors.

  18. Subcellular localization of H(+)-ATPase from pumpkin hypocotyls (Cucurbita maxima L.) by membrane fractionation.

    Science.gov (United States)

    Scherer, G F

    1984-03-01

    A new method of preparing sealed vesicles from membrane fractions of pumpkin hypocotyls in ethanolamine-containing buffers was used to investigate the subcellular localization of H(+)-ATPase measured as nigericin-stimulated ATPase. In a fluorescence-quench assay, the H(+) pump was directly demonstrated. The H(+) pump was substrate-specific for Mg·ATP and 0.1 mM diethylstilbestrol completely prevented the development of a Δ pH. The presence of unsupecific phosphatase hampered the detection of nigericin-stimulated ATPase. Unspecific phosphatases could be demonstrated by comparing the broad substrate specificity of the hydrolytic activities of the fractions with the clear preference for Mg·ATP as the substrate for the proton pump. Inhibitor studies showed that neither orthovanadate nor molybdate are absolutely specific for ATPase or acid phosphatase, respectively. Diethylstilbestrol seemed to be a specific inhibitor of ATPase activity in fractions containing nigericin-stimulated ATPase, but it stimulated acid phosphatase which tended to obscure its effect on ATPase activity. Nigericin-stimulated ATPase had its optimum at pH 6.0 and the nigericin effect was K(+)-dependent. The combination of valinomycin and carbonylcyanide m-chlorophenylhydrazone had a similar effect to nigericin, but singly these ionophores were much less stimulatory. After prolonged centrifugation on linear sucrose gradients, nigericin-stimulated ATPase correlated in dense fractions with plasma membrane markers but a part of it remained at the interphase. This lessdense part of the nigericin-stimulated ATPase could be derived from tonoplast vesicles because α-mannosidase, an enzyme of the vacuolar sap, remained in the upper part of the gradient. Nigericinstimulated ATPase did not correlate with the mitochondrial marker, cytochrome c oxidase, whereas azide inhibition of ATPase activity did.

  19. Some assembly required: Contributions of Tom Stevens' lab to the V-ATPase field.

    Science.gov (United States)

    Graham, Laurie A; Finnigan, Gregory C; Kane, Patricia M

    2018-02-23

    Tom Stevens' lab has explored the subunit composition and assembly of the yeast V-ATPase for more than 30 years. Early studies helped establish yeast as the predominant model system for study of V-ATPase proton pumps and led to the discovery of protein splicing of the V-ATPase catalytic subunit. The Vma - phenotype, characteristic of loss-of-V-ATPase activity in yeast was key in determining the enzyme's subunit composition via yeast genetics. V-ATPase subunit composition proved to be highly conserved among eukaryotes. Genetic screens for new vma mutants led to identification of a set of dedicated V-ATPase assembly factors and helped unravel the complex pathways for V-ATPase assembly. In later years, exploration of the evolutionary history of several V-ATPase subunits provided new information about the enzyme's structure and function. This review highlights V-ATPase work in the Stevens' lab between 1987 and 2017. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. LOCALIZATION OF Na+, K+-ATPASE AND OTHER ENZYMES IN TELEOST PSEUDOBRANCH

    Science.gov (United States)

    Dendy, Leslie A.; Deter, Russell L.; Philpott, Charles W.

    1973-01-01

    In an effort to determine the subcellular localization of sodium- and potassium-activated adenosine triphosphatase (Na+, K+-ATPase) in the pseudobranch of the pinfish Lagodon rhomboides, this tissue was fractionated by differential centrifugation and the activities of several marker enzymes in the fractions were measured. Cytochrome c oxidase was found primarily in the mitochondrial-light mitochondrial (M+L) fraction. Phosphoglucomutase appeared almost exclusively in the soluble (S) fraction. Monoamine oxidase was concentrated in the nuclear (N) fraction, with a significant amount also in the microsomal (P) fraction but little in M+L or S. Na+, K+-ATPase and ouabain insensitive Mg2+-ATPase were distributed in N, M+L, and P, the former having its highest specific activity in P and the latter in M+L. Rate sedimentation analysis of the M+L fraction indicated that cytochrome c oxidase and Mg2+-ATPase were associated with a rapidly sedimenting particle population (presumably mitochondria), while Na+, K+-ATPase was found primarily in a slowly sedimenting component. At least 75% of the Na+, K+-ATPase in M+L appeared to be associated with structures containing no Mg2+-ATPase. Kinetic properties of the two ATPases were studied in the P fraction and were typical of these enzymes in other tissues. Na+, K+-ATPase activity was highly dependent on the ratio of Na+ and K+ concentrations but independent of absolute concentrations over at least a fourfold range. PMID:4349221

  1. Size of the plasma membrane H+-ATPase from Neurospora crassa determined by radiation inactivation and comparison with the sarcoplasmic reticulum Ca2+-ATPase from skeletal muscle

    International Nuclear Information System (INIS)

    Bowman, B.J.; Berenski, C.J.; Jung, C.Y.

    1985-01-01

    Using radiation inactivation, the authors have measured the size of the H + -ATPase in Neurospora crassa plasma membranes. Membranes were exposed to either high energy electrons from a Van de Graaff generator or to gamma irradiation from 60 Co. Both forms of radiation caused an exponential loss of ATPase activity in parallel with the physical destruction of the Mr = 104,000 polypeptide of which this enzyme is composed. By applying target theory, the size of the H + -ATPase in situ was found to be approximately 2.3 X 10(5) daltons. They also used radiation inactivation to measure the size of the Ca 2+ -ATPase of sarcoplasmic reticulum and got a value of approximately 2.4 X 10(5) daltons, in agreement with previous reports. By irradiating a mixture of Neurospora plasma membranes and rabbit sarcoplasmic reticulum, they directly compared the sizes of these two ATPases and found them to be essentially the same. The authors conclude that both H + -ATPase and Ca 2+ -ATPase are oligomeric enzymes, most likely composed of two approximately 100,000-dalton polypeptides

  2. Size of the plasma membrane H+-ATPase from Neurospora crassa determined by radiation inactivation and comparison with the sarcoplasmic reticulum Ca2+-ATPase from skeletal muscle.

    Science.gov (United States)

    Bowman, B J; Berenski, C J; Jung, C Y

    1985-07-25

    Using radiation inactivation, we have measured the size of the H+-ATPase in Neurospora crassa plasma membranes. Membranes were exposed to either high energy electrons from a Van de Graaff generator or to gamma irradiation from 60Co. Both forms of radiation caused an exponential loss of ATPase activity in parallel with the physical destruction of the Mr = 104,000 polypeptide of which this enzyme is composed. By applying target theory, the size of the H+-ATPase in situ was found to be approximately 2.3 X 10(5) daltons. We also used radiation inactivation to measure the size of the Ca2+-ATPase of sarcoplasmic reticulum and got a value of approximately 2.4 X 10(5) daltons, in agreement with previous reports. By irradiating a mixture of Neurospora plasma membranes and rabbit sarcoplasmic reticulum, we directly compared the sizes of these two ATPases and found them to be essentially the same. We conclude that both H+-ATPase and Ca2+-ATPase are oligomeric enzymes, most likely composed of two approximately 100,000-dalton polypeptides.

  3. The Function of Vacuolar ATPase (V-ATPase) a Subunit Isoforms in Invasiveness of MCF10a and MCF10CA1a Human Breast Cancer Cells*

    Science.gov (United States)

    Capecci, Joseph; Forgac, Michael

    2013-01-01

    The vacuolar H+ ATPases (V-ATPases) are ATP-driven proton pumps that transport protons across both intracellular and plasma membranes. Previous studies have implicated V-ATPases in the invasiveness of various cancer cell lines. In this study, we evaluated the role of V-ATPases in the invasiveness of two closely matched human breast cancer lines. MCF10a cells are a non-invasive, immortalized breast epithelial cell line, and MCF10CA1a cells are a highly invasive, H-Ras-transformed derivative of MCF10a cells selected for their metastatic potential. Using an in vitro Matrigel assay, MCF10CA1a cells showed a much higher invasion than the parental MCF10a cells. Moreover, this increased invasion was completely sensitive to the specific V-ATPase inhibitor concanamycin. MCF10CA1a cells expressed much higher levels of both a1 and a3 subunit isoforms relative to the parental line. Isoforms of subunit a are responsible for subcellular localization of V-ATPases, with a3 and a4 targeting V-ATPases to the plasma membrane of specialized cells. Knockdown of either a3 alone or a3 and a4 together using isoform-specific siRNAs inhibited invasion by MCF10CA1a cells. Importantly, overexpression of a3 but not the other a subunit isoforms greatly increased the invasiveness of the parental MCF10a cells. Similarly, overexpression of a3 significantly increased expression of V-ATPases at the plasma membrane. These studies suggest that breast tumor cells employ particular a subunit isoforms to target V-ATPases to the plasma membrane, where they function in tumor cell invasion. PMID:24072707

  4. The function of vacuolar ATPase (V-ATPase) a subunit isoforms in invasiveness of MCF10a and MCF10CA1a human breast cancer cells.

    Science.gov (United States)

    Capecci, Joseph; Forgac, Michael

    2013-11-08

    The vacuolar H(+) ATPases (V-ATPases) are ATP-driven proton pumps that transport protons across both intracellular and plasma membranes. Previous studies have implicated V-ATPases in the invasiveness of various cancer cell lines. In this study, we evaluated the role of V-ATPases in the invasiveness of two closely matched human breast cancer lines. MCF10a cells are a non-invasive, immortalized breast epithelial cell line, and MCF10CA1a cells are a highly invasive, H-Ras-transformed derivative of MCF10a cells selected for their metastatic potential. Using an in vitro Matrigel assay, MCF10CA1a cells showed a much higher invasion than the parental MCF10a cells. Moreover, this increased invasion was completely sensitive to the specific V-ATPase inhibitor concanamycin. MCF10CA1a cells expressed much higher levels of both a1 and a3 subunit isoforms relative to the parental line. Isoforms of subunit a are responsible for subcellular localization of V-ATPases, with a3 and a4 targeting V-ATPases to the plasma membrane of specialized cells. Knockdown of either a3 alone or a3 and a4 together using isoform-specific siRNAs inhibited invasion by MCF10CA1a cells. Importantly, overexpression of a3 but not the other a subunit isoforms greatly increased the invasiveness of the parental MCF10a cells. Similarly, overexpression of a3 significantly increased expression of V-ATPases at the plasma membrane. These studies suggest that breast tumor cells employ particular a subunit isoforms to target V-ATPases to the plasma membrane, where they function in tumor cell invasion.

  5. Prognostic value of the Cu-transporting ATPase in ovarian carcinoma patients receiving cisplatin-based chemotherapy.

    Science.gov (United States)

    Nakayama, Kentaro; Kanzaki, Atsuko; Terada, Kunihiko; Mutoh, Masato; Ogawa, Kenji; Sugiyama, Toshihiro; Takenoshita, Seiichi; Itoh, Kiyoshi; Yaegashi, Nobuo; Miyazaki, Kohji; Neamati, Nouri; Takebayashi, Yuji

    2004-04-15

    A major obstacle in the treatment of ovarian carcinoma is the intrinsic/acquired resistance to cisplatin-based chemotherapy. Cu-transporting ATPase (ATP7B) has been reported to be associated with cisplatin resistance in vitro. However, the clinical significance of this transporter has not previously been addressed. Our goal was to investigate ATP7B expression in ovarian carcinoma and whether its expression correlates with prognosis and reduced responsiveness to cisplatin treatment. We retrospectively examined the expression of ATP7B and p53 in primary ovarian carcinoma and its association with chemotherapeutic effect. Tissues were surgically removed from 104 ovarian carcinomas patients who received cisplatin-based chemotherapy. We performed immunohistochemical analysis of ATP7B and p53 using a monoclonal antibody against ATP7B and DO7 antibody against p53 protein in 104 ovarian carcinomas and adjacent nonneoplastic tissues. The significance of ATP7B and p53 in the prognosis of patients with ovarian carcinomas was also examined in the survival analysis of mortality follow-up data covering the period between 1988 and 2001. Furthermore, mutation analysis at the six Cu-binding domain and ATP-binding domain, which may be important for cisplatin transport, were performed using single-strand conformational polymorphism after reverse transcriptase-PCR. A variable degree of cytoplasmic staining of ATP7B in tumor cells was observed in 34.6% (36 of 104 cases) of the analyzed carcinomas. ATP7B expression was not observed in adjacent nonneoplastic tissues. ATP7B positivity in poorly/moderately differentiated carcinoma was significantly higher than that in low malignant potential tumor/well-differentiated carcinoma (P = 0.0276). Patients with ATP7B-positive tumors had a significantly inferior response to chemotherapy compared with the patients with ATP7B-negative tumors (P = 0.025). The multivariate Cox regression analysis revealed that ATP7B expression (hazard ratio, 1.8; 95

  6. Regulation of Vacuolar H+-ATPase (V-ATPase) Reassembly by Glycolysis Flow in 6-Phosphofructo-1-kinase (PFK-1)-deficient Yeast Cells*

    Science.gov (United States)

    Chan, Chun-Yuan; Dominguez, Dennis; Parra, Karlett J.

    2016-01-01

    Yeast 6-phosphofructo-1-kinase (PFK-1) has two subunits, Pfk1p and Pfk2p. Deletion of Pfk2p alters glucose-dependent V-ATPase reassembly and vacuolar acidification (Chan, C. Y., and Parra, K. J. (2014) Yeast phosphofructokinase-1 subunit Pfk2p is necessary for pH homeostasis and glucose-dependent vacuolar ATPase reassembly. J. Biol. Chem. 289, 19448–19457). This study capitalized on the mechanisms suppressing vacuolar H+-ATPase (V-ATPase) in pfk2Δ to gain new knowledge of the mechanisms underlying glucose-dependent V-ATPase regulation. Because V-ATPase is fully assembled in pfk2Δ, and glycolysis partially suppressed at steady state, we manipulated glycolysis and assessed its direct involvement on V-ATPase function. At steady state, the ratio of proton transport to ATP hydrolysis increased 24% after increasing the glucose concentration from 2% to 4% to enhance the glycolysis flow in pfk2Δ. Tighter coupling restored vacuolar pH when glucose was abundant and glycolysis operated below capacity. After readdition of glucose to glucose-deprived cells, glucose-dependent V1Vo reassembly was proportional to the glycolysis flow. Readdition of 2% glucose to pfk2Δ cells, which restored 62% of ethanol concentration, led to equivalent 60% V1Vo reassembly levels. Steady-state level of assembly (100% reassembly) was reached at 4% glucose when glycolysis reached a threshold in pfk2Δ (≥40% the wild-type flow). At 4% glucose, the level of Pfk1p co-immunoprecipitated with V-ATPase decreased 58% in pfk2Δ, suggesting that Pfk1p binding to V-ATPase may be inhibitory in the mutant. We concluded that V-ATPase activity at steady state and V-ATPase reassembly after readdition of glucose to glucose-deprived cells are controlled by the glycolysis flow. We propose a new mechanism by which glucose regulates V-ATPase catalytic activity that occurs at steady state without changing V1Vo assembly. PMID:27226568

  7. Regulation of Vacuolar H+-ATPase (V-ATPase) Reassembly by Glycolysis Flow in 6-Phosphofructo-1-kinase (PFK-1)-deficient Yeast Cells.

    Science.gov (United States)

    Chan, Chun-Yuan; Dominguez, Dennis; Parra, Karlett J

    2016-07-22

    Yeast 6-phosphofructo-1-kinase (PFK-1) has two subunits, Pfk1p and Pfk2p. Deletion of Pfk2p alters glucose-dependent V-ATPase reassembly and vacuolar acidification (Chan, C. Y., and Parra, K. J. (2014) Yeast phosphofructokinase-1 subunit Pfk2p is necessary for pH homeostasis and glucose-dependent vacuolar ATPase reassembly. J. Biol. Chem. 289, 19448-19457). This study capitalized on the mechanisms suppressing vacuolar H(+)-ATPase (V-ATPase) in pfk2Δ to gain new knowledge of the mechanisms underlying glucose-dependent V-ATPase regulation. Because V-ATPase is fully assembled in pfk2Δ, and glycolysis partially suppressed at steady state, we manipulated glycolysis and assessed its direct involvement on V-ATPase function. At steady state, the ratio of proton transport to ATP hydrolysis increased 24% after increasing the glucose concentration from 2% to 4% to enhance the glycolysis flow in pfk2Δ. Tighter coupling restored vacuolar pH when glucose was abundant and glycolysis operated below capacity. After readdition of glucose to glucose-deprived cells, glucose-dependent V1Vo reassembly was proportional to the glycolysis flow. Readdition of 2% glucose to pfk2Δ cells, which restored 62% of ethanol concentration, led to equivalent 60% V1Vo reassembly levels. Steady-state level of assembly (100% reassembly) was reached at 4% glucose when glycolysis reached a threshold in pfk2Δ (≥40% the wild-type flow). At 4% glucose, the level of Pfk1p co-immunoprecipitated with V-ATPase decreased 58% in pfk2Δ, suggesting that Pfk1p binding to V-ATPase may be inhibitory in the mutant. We concluded that V-ATPase activity at steady state and V-ATPase reassembly after readdition of glucose to glucose-deprived cells are controlled by the glycolysis flow. We propose a new mechanism by which glucose regulates V-ATPase catalytic activity that occurs at steady state without changing V1Vo assembly. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Proton accumulation and ATPase activity in Golgi apparatus-enriched vesicles from rat liver

    International Nuclear Information System (INIS)

    Yeh, H.I.; van Rossum, G.D.

    1991-01-01

    We have studied the mechanism by which liver Golgi apparatus maintains the acidity of its contents, using a subcellular fraction from rat liver highly enriched in Golgi marker enzymes. Proton accumulation (measured by quenching of acridine-orange fluorescence) and anion-dependent ATPase were characterized and compared. Maximal ATPase and proton accumulation required ATP; GTP and other nucleotides gave 10% to 30% of maximal activity. Among anions, Cl- and Br- approximately doubled the activities; others were much less effective. Half-maximal increase of ATPase and H+ uptake required 55 mmol/L and 27 mmol/L Cl-, respectively. In predominantly chloride media, SCN- and NO3- markedly inhibited H+ uptake. Nitrate competitively inhibited both the chloride-dependent ATPase (apparent Ki 6 mmol/L) and proton uptake (apparent Ki 2 mmol/L). Nitrate and SCN- also inhibited uptake of 36Cl. Replacing K+ with Na+ had no effect on the initial rate of proton uptake but somewhat reduced the steady state attained. Replacement of K+ with NH4+ and choline reduced proton uptake without affecting ATPase. The ATPase and H+ uptake were supported equally well by Mg2+ or Mn2+. The ATPase was competitively inhibited by 4-acetamido-4'-isothiocyano-stilbene-2,2'-disulfonic acid (apparent Ki 39 mumol/L). Other agents inhibiting both H+ uptake and ATPase were N-ethylmaleimide, N,N'-dicyclohexylcarbodiimide, chlorpromazine, diethylstilbestrol, Zn2+, Co2+ and Cu2+. In the Cl- medium, accumulated protons were released by ionophores at the relative rates, monensin = nigericin greater than valinomycin greater than carbonyl cyanide mchlorophenylhydrazone; the last of these also reduced ATPase activity. In the absence of Cl-, monensin and valinomycin both stimulated the ATPase. These results show a close association between ATPase activity and acidification of liver Golgi vesicles

  9. Retinoschisin is linked to retinal Na/K-ATPase signaling and localization.

    Science.gov (United States)

    Plössl, Karolina; Royer, Melanie; Bernklau, Sarah; Tavraz, Neslihan N; Friedrich, Thomas; Wild, Jens; Weber, Bernhard H F; Friedrich, Ulrike

    2017-08-01

    Mutations in the RS1 gene cause X-linked juvenile retinoschisis (XLRS), a hereditary retinal dystrophy. We recently showed that retinoschisin, the protein encoded by RS1 , regulates ERK signaling and apoptosis in retinal cells. In this study, we explored an influence of retinoschisin on the functionality of the Na/K-ATPase, its interaction partner at retinal plasma membranes. We show that retinoschisin binding requires the β2-subunit of the Na/K-ATPase, whereas the α-subunit is exchangeable. Our investigations revealed no effect of retinoschisin on Na/K-ATPase-mediated ATP hydrolysis and ion transport. However, we identified an influence of retinoschisin on Na/K-ATPase-regulated signaling cascades and Na/K-ATPase localization. In addition to the known ERK deactivation, retinoschisin treatment of retinoschisin-deficient ( Rs1h -/Y ) murine retinal explants decreased activation of Src, an initial transmitter in Na/K-ATPase signal transduction, and of Ca 2+ signaling marker Camk2. Immunohistochemistry on murine retinae revealed an overlap of the retinoschisin-Na/K-ATPase complex with proteins involved in Na/K-ATPase signaling, such as caveolin, phospholipase C, Src, and the IP3 receptor. Finally, retinoschisin treatment altered Na/K-ATPase localization in photoreceptors of Rs1h -/Y retinae. Taken together, our results suggest a regulatory effect of retinoschisin on Na/K-ATPase signaling and localization, whereas Na/K-ATPase-dysregulation caused by retinoschisin deficiency could represent an initial step in XLRS pathogenesis. © 2017 Plössl et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  10. Effects of phenol on ATPase activities in crude gill homogenates of rainbow trout (Salmo gairdneri Richardson)

    Energy Technology Data Exchange (ETDEWEB)

    Poston, T.M.

    1979-01-01

    The ATPase specific activities from crude gill homogenates of rainbow trout were lower than those from microsomal preparations reported in the literature. Sodium pump activity (ouabain sensitive NaK-ATPase) was demonstrable at 37/sup 0/C. An ouabain insensitive NaK-ATPase was demonstrable at temperatures below 30/sup 0/C and may represent a Na-ATPase activity reported by others. Energy of activation at 25/sup 0/C for total NaK-ATPase ws 10,500 cal.mole/sup -1/. Mg-baseline activity had an energy of activation at 25/sup 0/C of 15,600 cal.mole/sup -1/. Mg-baseline activity was thermally labile at temperatures in excess of 30/sup 0/C. Concentrations of Mg/sup +2/ in excess of 5 mM appeared to inhibit total NaK-ATPase activity. At 37/sup 0/C, Na/sup +/ and K/sup +/ exerted little, if any, stimulatory effect on ATPase activities, in spite of the fact that 37/sup 0/C was the only temperature at which sodium pump activity was demonstrable. MS-222 failed to produce any discernible changes in any of the demonstrable ATPase activities in crude gill homogenates. Total NaK-ATPase activities were more sensitive than Mg-baseline activities to in vitro inhibition by phenol. Concentrations of phenol which produce 50% inhibition in total NaK-ATPase produced only 35% inhibition in Mg-baseline activity. The nature of in vitro inhibition was uncompetitive. Sodium pump activity was unaffected by phenol at concentrations as high as 25 mM. An effort was made to demonstrate an in vivo effects of phenol on rainbow trout gill ATPase activites. An infestation of a parasite (Gyrodactilus) on the experimental fish precludes any definative assessment of in vivo effects.

  11. Relationship between serum adiponectin level and ATPase activity of erythrocyte membrance in patients with 2-type diabetes

    International Nuclear Information System (INIS)

    Song Jiejin

    2008-01-01

    Objective: To explore the possible mechanism of development nephrosis as related to changes of serum adiponectin levels and alteration of activities of Na + ·K + -ATPase and Ca +2 ·Mg +2 -ATPase of erythrocyte membrance in patients with 2-type diabetes. Methods: Serum adiponectin levels (with RIA) and erythrocyte membrance (prepared with Reilnila method) Na + ·K + - ATPase and Ca +2 ·Mg +2 -ATPase activity were determined in 45 DM2 patients without nephropathy, 31 DM2 patients with nephropathy and 30 controls. Results: Serum adiponectin levels in the diabetic patients were significantly lower than those in controls (P + ·K + -ATPase and Ca +2 ·Mg +2 -ATPase activities were also significantly lower than those in controls (P + ·K + -ATPase and Ca +2 ·Mg +2 -ATPase activities of erythrocyte membrance. (authors)

  12. Asn792 participates in the hydrogen bond network around the K+-binding pocket of gastric H,K-ATPase.

    NARCIS (Netherlands)

    Swarts, H.G.P.; Koenderink, J.B.; Willems, P.H.G.M.; Krieger, E.; Pont, J.J.H.H.M. de

    2005-01-01

    Asn792 present in M5 of gastric H,K-ATPase is highly conserved within the P-type ATPase family. A direct role in K+ binding was postulated for Na,K-ATPase but was not found in a recent model for gastric H,K-ATPase (Koenderink, J. B., Swarts, H. G. P., Willems, P. H. G. M., Krieger, E., and De Pont,

  13. Membrane-bound ATPase contributes to hop resistance of Lactobacillus brevis

    NARCIS (Netherlands)

    Sakamoto, K; van Veen, HW; Saito, H; Kobayashi, H; Konings, WN

    2002-01-01

    The activity of the membrane-bound H+-ATPase of the beer spoilage bacterium Lactobacillus brevis ABBC45 increased upon adaptation to bacteriostatic hop compounds. The ATPase activity was optimal around pH 5.6 and increased up to fourfold when L. brevis was exposed to 666 muM hop compounds. The

  14. Study on the changes in the levels of membrane-bound ATPases ...

    African Journals Online (AJOL)

    An attempt has been made to determine the deleterious effects of λ cyhalothrin- induced in fresh water tilapia (Oreochromis mossambicus) with respect to changes in the activities of membrane-bound ATPases (Na+/K+, Mg+ and Ca2+ ATPase) and mineral status ...

  15. Cation Transport Coupled to ATP Hydrolysis by the (Na, K)-ATPase: An Integrated, Animated Model

    Science.gov (United States)

    Leone, Francisco A.; Furriel, Rosa P. M.; McNamara, John C.; Horisberger, Jean D.; Borin, Ivana A.

    2010-01-01

    An Adobe[R] animation is presented for use in undergraduate Biochemistry courses, illustrating the mechanism of Na[superscript +] and K[superscript +] translocation coupled to ATP hydrolysis by the (Na, K)-ATPase, a P[subscript 2c]-type ATPase, or ATP-powered ion pump that actively translocates cations across plasma membranes. The enzyme is also…

  16. Membrane Anchoring and Ion-Entry Dynamics in P-type ATPase Copper Transport

    DEFF Research Database (Denmark)

    Grønberg, Christina; Sitsel, Oleg; Lindahl, Erik

    2016-01-01

    Cu(+)-specific P-type ATPase membrane protein transporters regulate cellular copper levels. The lack of crystal structures in Cu(+)-binding states has limited our understanding of how ion entry and binding are achieved. Here, we characterize the molecular basis of Cu(+) entry using molecular...... and provide a molecular understanding of ion entry in Cu(+)-transporting P-type ATPases....

  17. Purification and functional motifs of the recombinant ATPase of orf virus.

    Science.gov (United States)

    Lin, Fong-Yuan; Chan, Kun-Wei; Wang, Chi-Young; Wong, Min-Liang; Hsu, Wei-Li

    2011-10-01

    Our previous study showed that the recombinant ATPase encoded by the A32L gene of orf virus displayed ATP hydrolysis activity as predicted from its amino acids sequence. This viral ATPase contains four known functional motifs (motifs I-IV) and a novel AYDG motif; they are essential for ATP hydrolysis reaction by binding ATP and magnesium ions. The motifs I and II correspond with the Walker A and B motifs of the typical ATPase, respectively. To examine the biochemical roles of these five conserved motifs, recombinant ATPases of five deletion mutants derived from the Taiping strain were expressed and purified. Their ATPase functions were assayed and compared with those of two wild type strains, Taiping and Nantou isolated in Taiwan. Our results showed that deletions at motifs I-III or IV exhibited lower activity than that of the wild type. Interestingly, deletion of AYDG motif decreased the ATPase activity more significantly than those of motifs I-IV deletions. Divalent ions such as magnesium and calcium were essential for ATPase activity. Moreover, our recombinant proteins of orf virus also demonstrated GTPase activity, though weaker than the original ATPase activity. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Further investigations on the inorganic phosphate binding site of beef heart mitochondrial F1-ATPase

    International Nuclear Information System (INIS)

    Pougeois, R.; Lauquin, G.J.

    1985-01-01

    The possibility that 4-azido-2-nitrophenyl phosphate (ANPP), a photoreactive derivative of inorganic phosphate (P /sub i/ ), could mimic ATP was investigated. ANPP was hydrolyzed in the dark by sarcoplasmic reticulum Ca 2+ -ATPase in the presence of Ca 2+ but not in the presence of ethylene glycol bis(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid. ANPP was not hydrolyzed by purified mitochondrial F1-ATPase; however, ADP and ATP protected F1-ATPase against ANPP photoinactivation. On the other hand, the trinitrophenyl nucleotide analogues (TNP-ADP, TNP-ATP, and TNP-AMP-PNP), which bind specifically at the two catalytic sites of F1-ATPase, abolished P /sub i/ binding on F1-ATPase; they do not protect F1-ATPase against ANPP photoinactivation. Furthermore, ANPP-photoinactivated F1-ATPase binds the TNP analogues in the same way as the native enzyme. The Pi binding site of F1-ATPase, which is shown to be photolabeled by ANPP, does not appear to be at the gamma-phosphate position of the catalytic sites

  19. Mammary gland involution is associated with rapid down regulation of major mammary Ca**2+-ATPases

    Science.gov (United States)

    Sixty percent of calcium in milk is transported across the mammary cells apical membrane by the plasma membrane Ca**2+-ATPase 2 (PMCA2). The effect of abrupt cessation of milk production on the Ca**2+-ATPases and mammary calcium transport is unknown. We found that 24 hours after stopping milk prod...

  20. Two types of essential carboxyl groups in Rhodospirillum rubrum proton ATPase

    International Nuclear Information System (INIS)

    Ceccarelli, E.; Vallejos, R.H.

    1983-01-01

    Two different types of essential carboxyl groups were detected in the extrinsic component of the proton ATPase of Rhodospirillum rubrum. Chemical modification of R. rubrum chromatophores or its solubilized ATPase by Woodward's reagent K resulted in inactivation of photophosphorylating and ATPase activities. The apparent order of reaction was nearly 1 with respect to reagent concentration and similar K1 were obtained for the soluble and membrane-bound ATPases suggesting that inactivation was associated with modification of one essential carboxyl group located in the soluble component of the proton ATPase. Inactivation was prevented by adenine nucleotides but not by divalent cations. Dicyclohexylcarbodiimide completely inhibited the solubilized ATPase with a K1 of 5.2 mM and a K2 of 0.81 min-1. Mg2+ afforded nearly complete protection with a Kd of 2.8 mM. Two moles of [14C]dicyclohexylcarbodiimide were incorporated per mole of enzyme for complete inactivation but in the presence of 30 mM MgCl2 only one mole was incorporated and there was no inhibition. The labeling was recovered mostly from the beta subunit. The incorporation of the labeled reagent into the ATPase was not prevented by previous modification with Woodward's reagent K. It is concluded that both reagents modified two different essential carboxyl groups in the soluble ATPase from R. rubrum

  1. Excess capacity of H+ ATPase and inverse respiratory control in Escherichia coli

    DEFF Research Database (Denmark)

    Jensen, Peter Ruhdal; Westerhoff, Hans V.; Michelsen, Ole

    1993-01-01

    With succinate as free-energy source, Escherichia coli generating virtually all ATP by oxidative phosphorylation might be expected heavily to tax its ATP generating capacity. To examine this the H+-ATPase (ATP synthase) was modulated over a 30-fold range. Decreasing the amount of H+-ATPase reduce...

  2. A possible mechanism for low affinity of silkworm Na+/K+-ATPase for K.

    Science.gov (United States)

    Homareda, Haruo; Otsu, Masahiro; Yamamoto, Sachiko; Ushimaru, Makoto; Ito, Sayaka; Fukutomi, Toshiyuki; Jo, Taeho; Eishi, Yoshinobu; Hara, Yukichi

    2017-12-01

    The affinity for K + of silkworm nerve Na + /K + -ATPase is markedly lower than that of mammalian Na + /K + -ATPase (Homareda 2010). In order to obtain clues on the molecular basis of the difference in K + affinities, we cloned cDNAs of silkworm (Bombyx mori) nerve Na + /K + -ATPase α and β subunits, and analyzed the deduced amino acid sequences. The molecular masses of the α and β subunits were presumed to be 111.5 kDa with ten transmembrane segments and 37.7 kDa with a single transmembrane segment, respectively. The α subunit showed 75% identity and 93% homology with the pig Na + /K + -ATPase α1 subunit. On the other hand, the amino acid identity of the β subunit with mammalian counterparts was as low as 30%. Cloned α and β cDNAs were co-expressed in cultured silkworm ovary-derived cells, BM-N cells, which lack endogenous Na + /K + -ATPase. Na + /K + -ATPase expressed in the cultured cells showed a low affinity for K + and a high affinity for Na + , characteristic of the silkworm nerve Na + /K + -ATPase. These results suggest that the β subunit is responsible for the affinity for K + of Na + /K + -ATPase.

  3. Modulation of FXYD interaction with Na,K-ATPase by anionic phospholipids and protein kinase phosphorylation

    DEFF Research Database (Denmark)

    Cornelius, Flemming; Mahmmoud, Yasser Ahmed

    2007-01-01

    acids of FXYD10 had been cleaved by mild, controlled trypsin treatment. Several kinetic properties of the Na,K-ATPase reaction cycle as well as the FXYD-regulation of Na,K-ATPase activity were found to be affected by acidic phospholipids like PI, PS, and PG. This takes into consideration the Na+ and K...

  4. Inhibitory effects of selected Thai medicinal plants on Na+,K+-ATPase.

    Science.gov (United States)

    Ngamrojanavanich, Nattaya; Manakit, Srinual; Pornpakakul, Surachai; Petsom, Amorn

    2006-09-01

    Extracts of ten Thai indigenous medicinal plants having ethnomedical application in the treatment of dysuria were tested for their Na(+),K(+)-ATPase inhibitory activity. The hexane extracts of Cyperus rotundus and Orthosiphon aristatus showed high potent inhibitory activity on crude enzyme Na(+),K(+)-ATPase from rat brain.

  5. Ligand-induced variations in subunit associations in bovine heart F1 ATPase.

    Science.gov (United States)

    Goldsmith, C D; Reid, R A

    1983-05-31

    Bovine heart soluble F1 ATPase shows ligand dependent changes in subunit accessibility to the protein labelling reagents acetic anhydride and diazonium benzenesulphonic acid. These correlate with changes in the ATPase activity of the enzyme induced by the same ligands. In particular, NAD+ and NADH show concentration dependent effects, the effect of the reduced nucleotide being opposite to that of the oxidised form.

  6. Role of matrix metalloprotease-2 in oxidant activation of Ca ATPase ...

    Indian Academy of Sciences (India)

    Unknown

    Exposure of bovine pulmonary artery smooth muscle plasma membrane suspension with the oxidant H2O2. (1 mM) stimulated Ca2+ATPase activity. We sought to determine the role of matrix metalloprotease-2 (MMP-2) in stimulating Ca2+ATPase activity by H2O2 in the smooth muscle plasma membrane. The smooth ...

  7. Na+,K+-ATPase Na+ affinity in rat skeletal muscle fiber types

    DEFF Research Database (Denmark)

    Kristensen, Michael; Juel, Carsten

    2010-01-01

    Previous studies in expression systems have found different ion activation of the Na(+)/K(+)-ATPase isozymes, which suggest that different muscles have different ion affinities. The rate of ATP hydrolysis was used to quantify Na(+),K(+)-ATPase activity, and the Na(+) affinity of Na(+),K(+)-ATPase......Previous studies in expression systems have found different ion activation of the Na(+)/K(+)-ATPase isozymes, which suggest that different muscles have different ion affinities. The rate of ATP hydrolysis was used to quantify Na(+),K(+)-ATPase activity, and the Na(+) affinity of Na......(+),K(+)-ATPase was studied in total membranes from rat muscle and purified membranes from muscle with different fiber types. The Na(+) affinity was higher (K(m) lower) in oxidative muscle compared with glycolytic muscle and in purified membranes from oxidative muscle compared with glycolytic muscle. Na......(+),K(+)-ATPase isoform analysis implied that heterodimers containing the beta(1) isoform have a higher Na(+) affinity than heterodimers containing the beta(2) isoform. Immunoprecipitation experiments demonstrated that dimers with alpha(1) are responsible for approximately 36% of the total Na,K-ATPase activity. Selective...

  8. Carbonylation Modification Regulates Na/K-ATPase Signaling and Salt Sensitivity: A Review and a Hypothesis.

    Science.gov (United States)

    Shah, Preeya T; Martin, Rebecca; Yan, Yanling; Shapiro, Joseph I; Liu, Jiang

    2016-01-01

    Na/K-ATPase signaling has been implicated in different physiological and pathophysiological conditions. Accumulating evidence indicates that oxidative stress not only regulates the Na/K-ATPase enzymatic activity, but also regulates its signaling and other functions. While cardiotonic steroids (CTS)-induced increase in reactive oxygen species (ROS) generation is an intermediate step in CTS-mediated Na/K-ATPase signaling, increase in ROS alone also stimulates Na/K-ATPase signaling. Based on literature and our observations, we hypothesize that ROS have biphasic effects on Na/K-ATPase signaling, transcellular sodium transport, and urinary sodium excretion. Oxidative modulation, in particular site specific carbonylation of the Na/K-ATPase α1 subunit, is a critical step in proximal tubular Na/K-ATPase signaling and decreased transcellular sodium transport leading to increases in urinary sodium excretion. However, once this system is overstimulated, the signaling, and associated changes in sodium excretion are blunted. This review aims to evaluate ROS-mediated carbonylation of the Na/K-ATPase, and its potential role in the regulation of pump signaling and sodium reabsorption in the renal proximal tubule (RPT).

  9. Nitric oxide and Na,K-ATPase activity in rat skeletal muscle.

    Science.gov (United States)

    Juel, C

    2016-04-01

    It has been suggested that nitric oxide (NO) stimulates the Na,K-ATPase in cardiac myocytes. Therefore, the aims of this study were to investigate whether NO increases Na,K-ATPase activity in skeletal muscle and, if that is the case, to identify the underlying mechanism. The study used isolated rat muscle, muscle homogenates and purified membranes as model systems. Na,K-ATPase activity was quantified from phosphate release due to ATP hydrolysis. Exposure to the NO donor spermine NONOate (10 μm) increased the maximal Na,K-ATPase activity by 27% in isolated glycolytic muscles, but had no effect in oxidative muscles. Spermine NONOate increased the maximal Na,K-ATPase activity by 58% (P Na,K-ATPase α-isoform. Incubation with cGMP (1 mm) increased the maximal Na,K-ATPase activity in homogenates from glycolytic muscle by 16% (P Na,K-ATPase in glycolytic skeletal muscle. Direct S-nitrosylation and interference with S-glutathionylation seem to be excluded. In addition, phosphorylation of phospholemman at serine 68 is not involved. Most likely, the NO/cGMP/protein kinase G signalling pathway is involved. © 2015 Scandinavian Physiological Society. Published by John Wiley & Sons Ltd.

  10. Electrophysiological analysis of the mutated Na,K-ATPase cation binding pocket.

    NARCIS (Netherlands)

    Koenderink, J.B.; Geibel, S.; Grabsch, E.; Pont, J.J.H.H.M. de; Bamberg, E.; Friedrich, T.

    2003-01-01

    Na,K-ATPase mediates net electrogenic transport by extruding three Na+ ions and importing two K+ ions across the plasma membrane during each reaction cycle. We mutated putative cation coordinating amino acids in transmembrane hairpin M5-M6 of rat Na,K-ATPase: Asp776 (Gln, Asp, Ala), Glu779 (Asp,

  11. Na,K-ATPase activity modulates Src activation: A role for ATP/ADP ratio.

    NARCIS (Netherlands)

    Weigand, K.M.; Swarts, H.G.P.; Fedosova, N.U.; Russel, F.G.M.; Koenderink, J.B.

    2012-01-01

    Digitalis-like compounds (DLCs), specific inhibitors of Na,K-ATPase, are implicated in cellular signaling. Exposure of cell cultures to ouabain, a well-known DLC, leads to up- or down regulation of various processes and involves activation of Src kinase. Since Na,K-ATPase is the only known target

  12. Hierarchy of mechanisms involved in generating Na/K-ATPase polarity in MDCK epithelial cells

    NARCIS (Netherlands)

    Mays, R.W.; Siemers, K.A.; Fritz, B.A.; Lowe, A.W.; van Meer, G.; Nelson, W.J.

    1995-01-01

    We have studied mechanisms involved in generating a polarized distribution of Na/K-ATPase in the basal-lateral membrane of two clones of MDCK II cells. Both clones exhibit polarized distributions of marker proteins of the apical and basal-lateral membranes, including Na/K-ATPase, at steady state.

  13. Hemin reconstitutes proton extrusion in an H+-ATPase-negative mutant of Lactococcus lactis

    DEFF Research Database (Denmark)

    Blank, L.M.; Købmann, Brian Jensen; Michelsen, Ole

    2001-01-01

    H+-ATPase is considered essential for growth of Lactococcus lactis. However, media containing hemin restored the aerobic growth of an H+-ATPase-negative mutant, suggesting that hemin complements proton extrusion. We show that inverted membrane vesicles prepared from hemin-grown L. lactis cells...

  14. Altered expression and insulin-induced trafficking of Na+-K+-ATPase in rat skeletal muscle

    DEFF Research Database (Denmark)

    Galuska, Dana; Kotova, Olga; Barres, Romain

    2009-01-01

    Skeletal muscle Na(+)-K(+)-ATPase plays a central role in the clearance of K(+) from the extracellular fluid, therefore maintaining blood [K(+)]. Na(+)-K(+)-ATPase activity in peripheral tissue is impaired in insulin resistant states. We determined effects of high-fat diet (HFD) and exercise trai...

  15. Regulatory Mechanisms in the P4-ATPase Complex

    DEFF Research Database (Denmark)

    Costa, Sara

    . The functionality on the P4-ATPase complex is essential for several cellular processes, such as vesicle-mediated transport. However, the specific role of flippase activity in vesicle biogenesis and the regulatory mechanism behind this process is still poorly understood. In these studies, we identified...... as these transporters are trapped in an environment formed by their own substrate (lipids). Most lipid uptake assays use fluorescent lipid analogues in combination with flow cytometry analysis. However, flow cytometry systems are rather expensive and require extensive maintenance. Thus, we present a simple and more...

  16. Structural and functional studies of heavy metal ATPases

    DEFF Research Database (Denmark)

    Sitsel, Oleg

    2015-01-01

    to handle heavy metal ions. LpCopA is then compared to its two human homologues ATP7A and ATP7B, which cause the severe Menkes and Wilson diseases when malfunctioning. The differences between the three proteins are described and disease-causing mutations in the human proteins are analyzed. The crystal......Copper and zinc are trace elements that are crucial for the well-being of all cells and are an indispensable part of many proteins. At the same time, the intracellular levels of these metals require careful regulation, as an excess or deficiency may be lethal. P1B-ATPases are key players in Cu...

  17. Do Src Kinase and Caveolin Interact Directly with Na,K-ATPase?*

    Science.gov (United States)

    Yosef, Eliyahu; Katz, Adriana; Peleg, Yoav; Mehlman, Tevie; Karlish, Steven J. D.

    2016-01-01

    Much evidence points to a role of Na,K-ATPase in ouabain-dependent signal transduction. Based on experiments with different cell lines and native tissue membranes, a current hypothesis postulates direct interactions between the Na,K-ATPase and Src kinase (non-receptor tyrosine kinase). Na,K-ATPase is proposed to bind Src kinase and inhibit its activity, whereas ouabain, the specific Na,K-ATPase inhibitor, binds and stabilizes the E2 conformation, thus exposing the Src kinase domain and its active site Tyr-418 for activation. Ouabain-dependent signaling is thought to be mediated within caveolae by a complex consisting of Na,K-ATPase, caveolin, and Src kinase. In the current work, we have looked for direct interactions utilizing purified recombinant Na,K-ATPase (human α1β1FXYD1 or porcine α1D369Nβ1FXYD1) and purified human Src kinase and human caveolin 1 or interactions between these proteins in native membrane vesicles isolated from rabbit kidney. By several independent criteria and techniques, no stable interactions were detected between Na,K-ATPase and purified Src kinase. Na,K-ATPase was found to be a substrate for Src kinase phosphorylation at Tyr-144. Clear evidence for a direct interaction between purified human Na,K-ATPase and human caveolin was obtained, albeit with a low molar stoichiometry (1:15–30 caveolin 1/Na,K-ATPase). In native renal membranes, a specific caveolin 14–5 oligomer (95 kDa) was found to be in direct interaction with Na,K-ATPase. We inferred that a small fraction of the renal Na,K-ATPase molecules is in a ∼1:1 complex with a caveolin 14–5 oligomer. Thus, overall, whereas a direct caveolin 1/Na,K-ATPase interaction is confirmed, the lack of direct Src kinase/Na,K-ATPase binding requires reassessment of the mechanism of ouabain-dependent signaling. PMID:27022017

  18. 75 FR 1798 - Prospective Grant of Exclusive License: Development of V-ATPase Inhibitor Compounds for the...

    Science.gov (United States)

    2010-01-13

    ... Exclusive License: Development of V-ATPase Inhibitor Compounds for the Treatment of Human Cancers and... Antitumor V-ATPase Inhibitor Compounds, Compositions and Methods of Use Thereof'' [HHS Ref. No. E- 191-2002... ``Chondropsin-Class Antitumor V-ATPase Inhibitor Compounds, Compositions and Methods of Use Thereof'' [HHS Ref...

  19. The influence of blood plasma of irradiated animals on activity of Ca2+ - ATPase and Mg2+ - ATPase in plasma membrane of thymocytes

    International Nuclear Information System (INIS)

    Dreval', V.I.

    1994-01-01

    Rats were irradiated at doses 1.5, 4.0, 7.0 and 10 Gy. After 1, 8, 15, 22 and 30 days the effect of blood plasma on activity of Ca 2+ -ATPase and Mg 2+ -ATPase in plasma membrane of thymocytes was investigated. It was found that the raise of irradiation dose leads to increasing of blood plasma effect on membrane-bound enzymes

  20. Increasing acidification of nonreplicating Lactococcus lactis Delta thyA mutants by incorporating ATPase activity

    DEFF Research Database (Denmark)

    Pedersen, Martin Bastian; Købmann, Brian Jensen; Jensen, Peter Ruhdal

    2002-01-01

    % of that of exponentially growing MBP71. However, when nonspecific ATPase activity was incorporated into MBP71, the lactic acid flux was restored to 100% but not above that point, indicating that control over the flux switched from ATP demand to ATP supply (i.e., to sugar transport and glycolysis). As determined by growing...... nonreplicating cells with high ATPase activity on various sugar sources, it appeared that glycolysis exerted the majority of the control. ATPase activity also stimulated the rate of acidification by noureplicating MBP71 growing in milk, and pH 5.2 was reached 40% faster than it was without ATPase activity. We...... concluded that ATPase activity is a functional means of increasing acidification by nonreplicating L. lactis....

  1. In vitro effects of toxaphene on mitochondrial calcium ATPase and calcium uptake in selected rat tissues

    International Nuclear Information System (INIS)

    Trottman, C.H.; Rao, K.S.P.; Morrow, W.; Uzodinma, J.E.; Desaiah, D.

    1985-01-01

    In vitro effects of toxaphene on Ca 2+ -ATPase activity and 45 Ca 2+ -uptake were studied in mitochondrial fractions of heart, kidney and liver tissues of rat. Mitochondrial fractions were prepared by the conventional centrifugation method. Ca 2+ -ATPase activity was determined by measuring the inorganic phosphate liberated during ATP hydrolysis. Toxaphene inhibited Ca 2+ -ATPase in a concentration dependent manner in all the three tissues. Substrate activation kinetics, with heart, kidney and liver tissue fractions, revealed that toxaphene inhibited Ca 2+ -ATPase activity non-competetively by decreasing the maximum velocity of the enzyme without affecting the enzyme-substrate affinity. Toxaphene also inhibited mitochondrial 45 Ca 2+ -uptake in the three selected tissues in a concentration dependent manner. These results indicate that toxaphene is an inhibitor of mitochondrial Ca 2+ -ATPase and calcium transport in heart, kidney and liver tissues of rat. 19 references, 5 figures

  2. Tetrahydrocarbazoles are a novel class of potent P-type ATPase inhibitors with antifungal activity

    DEFF Research Database (Denmark)

    Bublitz, Maike; Kjellerup, Lasse; Cohrt, Karen O.Hanlon

    2018-01-01

    We have identified a series of tetrahydrocarbazoles as novel P-type ATPase inhibitors. Using a set of rationally designed analogues, we have analyzed their structure-activity relationship using functional assays, crystallographic data and computational modeling. We found that tetrahydrocarbazoles...... inhibit adenosine triphosphate (ATP) hydrolysis of the fungal H+-ATPase, depolarize the fungal plasma membrane and exhibit broad-spectrum antifungal activity. Comparative inhibition studies indicate that many tetrahydrocarbazoles also inhibit the mammalian Ca2+-ATPase (SERCA) and Na+,K+-ATPase...... with an even higher potency than Pma1. We have located the binding site for this compound class by crystallographic structure determination of a SERCA-tetrahydrocarbazole complex to 3.0 Å resolution, finding that the compound binds to a region above the ion inlet channel of the ATPase. A homology model...

  3. Effect of hindlimb unweighting on single soleus fiber maximal shortening velocity and ATPase activity

    Science.gov (United States)

    Mcdonald, K. S.; Fitts, R. H.

    1993-01-01

    The effect of hindlimb unweighting (HU) for 1 to 3 wks on the shortening velocity of a soleus fiber, its ATPase content, and the relative contents of the slow and fast myosin was investigated by measuring fiber force, V(0), ATPase activity, and myosin content in SDS protein profiles of a single rat soleus fiber suspended between a motor arm and a transducer. It was found that HU induces a progressive increase in fiber V(0) that is likely caused, at least in part, by an increase in the fiber's myofibrillar ATPase activity. The HU-induced increases in V(0) and ATPase were associated with the presence of a greater percentage of fast type IIa fibers. However, a large population of fibers after 1, 2, and 3 wks of HU showed increases in V(0) and ATPase but displayed the same myosin protein profile on SDS gels as control fibers.

  4. Crystal structure of a copper-transporting PIB-type ATPase

    DEFF Research Database (Denmark)

    Gourdon, Pontus Emanuel; Liu, Xiang-Yu; Skjørringe, Tina

    2011-01-01

    Heavy-metal homeostasis and detoxification is crucial for cell viability. P-type ATPases of the class IB (PIB) are essential in these processes, actively extruding heavy metals from the cytoplasm of cells. Here we present the structure of a PIB-ATPase, a Legionella pneumophila CopA Cu......(+)-ATPase, in a copper-free form, as determined by X-ray crystallography at 3.2 Å resolution. The structure indicates a three-stage copper transport pathway involving several conserved residues. A PIB-specific transmembrane helix kinks at a double-glycine motif displaying an amphipathic helix that lines a putative...... copper entry point at the intracellular interface. Comparisons to Ca(2+)-ATPase suggest an ATPase-coupled copper release mechanism from the binding sites in the membrane via an extracellular exit site. The structure also provides a framework to analyse missense mutations in the human ATP7A and ATP7B...

  5. Single-molecule, structural and functional studies of Listeria monocytogenes Ca2+-ATPase

    DEFF Research Database (Denmark)

    Dyla, Mateusz

    -ion transport (e.g. H+ for Ca2+-ATPases). P-type ATPases undergo major conformational changes during their functional cycle, as has been learned from a wealth of atomic-resolution X-ray crystallographic structures (4). In this work, single-molecule, structural and functional studies were employed to investigate...... the dynamics and mechanism of the transport cycle of P-type ATPase at a single molecule level. A representative P-type ATPase, the Listeria monocytogenes Ca2+-ATPase (LMCA1) was engineered and characterized to facilitate smFRET studies. Pairs of cysteines were introduced and reacted with maleimide derivatives...... transitions to the E2 state triggered by ATP binding and phosphorylation were very brief, and could only be characterized in a dephosphorylation-deficient LMCA1 mutant. Owing to a spontaneous dephosphorylation of this mutant, full transport cycles at a single-molecule resolution were observed for the first...

  6. The Structure and Function of the Na,K-ATPase Isoforms in Health and Disease

    Directory of Open Access Journals (Sweden)

    Michael V. Clausen

    2017-06-01

    Full Text Available The sodium and potassium gradients across the plasma membrane are used by animal cells for numerous processes, and the range of demands requires that the responsible ion pump, the Na,K-ATPase, can be fine-tuned to the different cellular needs. Therefore, several isoforms are expressed of each of the three subunits that make a Na,K-ATPase, the alpha, beta and FXYD subunits. This review summarizes the various roles and expression patterns of the Na,K-ATPase subunit isoforms and maps the sequence variations to compare the differences structurally. Mutations in the Na,K-ATPase genes encoding alpha subunit isoforms have severe physiological consequences, causing very distinct, often neurological diseases. The differences in the pathophysiological effects of mutations further underline how the kinetic parameters, regulation and proteomic interactions of the Na,K-ATPase isoforms are optimized for the individual cellular needs.

  7. The Structure and Function of the Na,K-ATPase Isoforms in Health and Disease.

    Science.gov (United States)

    Clausen, Michael V; Hilbers, Florian; Poulsen, Hanne

    2017-01-01

    The sodium and potassium gradients across the plasma membrane are used by animal cells for numerous processes, and the range of demands requires that the responsible ion pump, the Na,K-ATPase, can be fine-tuned to the different cellular needs. Therefore, several isoforms are expressed of each of the three subunits that make a Na,K-ATPase, the alpha, beta and FXYD subunits. This review summarizes the various roles and expression patterns of the Na,K-ATPase subunit isoforms and maps the sequence variations to compare the differences structurally. Mutations in the Na,K-ATPase genes encoding alpha subunit isoforms have severe physiological consequences, causing very distinct, often neurological diseases. The differences in the pathophysiological effects of mutations further underline how the kinetic parameters, regulation and proteomic interactions of the Na,K-ATPase isoforms are optimized for the individual cellular needs.

  8. Functional analysis of a potential regulatory K+-binding site in the Na+, K+-ATPase

    DEFF Research Database (Denmark)

    Schack, Vivien Rodacker; Vilsen, Bente

    The Na+, K+-ATPase functions by actively transporting 3 Na+ ions out of and 2 K+ ions into the cell, thereby creating ion gradients crucial for many physiological processes. Recently, a combined structural and functional study of the closely related Ca2+-ATPase indicated the presence...... of a regulatory K+-binding site in the P-domain of the enzyme, identifying E732 as being of particular importance (Sorensen, Clausen et al. 2004). In addition, P709 is thought to play a significant role in the structural organization of this site. Both E732 and P709 are highly conserved among P-type ATPases (E732...... is present as either glutamic acid or aspartic acid), which supports their importance and additionally raises the question whether this site may play a general role among P-type ATPases. In Na+, K+-ATPase, K+ functions directly as a substrate for membrane binding sites, however, an additional regulatory...

  9. Phosphorylation of plant plasma membrane H+-ATPase by the heterologous host S.cerevisiae

    DEFF Research Database (Denmark)

    L. Rudashevskaya, Elena; Ye, Juanying; Jensen, Ole Nørregaard

    +-ATPases are app. 60 amino acid residues longer than their yeast homologous. Yeast is found to phosphorylate at least one residue within the plant C-terminus. At the same time a wide range of investigations on structure, function, regulation and interaction of H+-ATPase is carried out with implication...... functioning of the residues and suggests, that plant H+-ATPase could be regulated by phosphorylation at several sites being in yeast cells. Plant H+-ATPase purified from yeast cells by his-tag affinity chromatography was subjected to IMAC and TiO2 for enrichment of phosphopeptides. The phosphopeptides were...... It is known, that phosphorylation of both plant and yeast plasma membrane H+-ATPase results in enzyme activation or inhibition. Several sites at the regulatory C-terminus of the enzyme have been found to undergo phosphorylation in vivo in both plant and yeast. The C-termini of plant H...

  10. Glutamate transporter activity promotes enhanced Na+/K+-ATPase-mediated extracellular K+ management during neuronal activity

    DEFF Research Database (Denmark)

    Larsen, Brian Roland; Holm, Rikke; Vilsen, Bente

    2016-01-01

    , in addition, Na+/K+-ATPase-mediated K+ clearance could be governed by astrocytic [Na+]i. During most neuronal activity, glutamate is released in the synaptic cleft and is re-absorbed by astrocytic Na+-coupled glutamate transporters, thereby elevating [Na+]i. It thus remains unresolved whether the different Na......+/K+-ATPase isoforms are controlled by [K+]o or [Na+]i during neuronal activity. Hippocampal slice recordings of stimulus-induced [K+]o transients with ion-sensitive microelectrodes revealed reduced Na+/K+-ATPase-mediated K+ management upon parallel inhibition of the glutamate transporter. The apparent intracellular...... isoforms than the β2 isoform. In summary, enhanced astrocytic Na+/K+-ATPase-dependent K+ clearance was obtained with parallel glutamate transport activity. The astrocytic Na+/K+-ATPase isoform constellation α2β1 appeared to be specifically geared to respond to the [Na+]i transients associated with activity...

  11. Specific inhibition of p97/VCP ATPase and kinetic analysis demonstrate interaction between D1 and D2 ATPase domains.

    Science.gov (United States)

    Chou, Tsui-Fen; Bulfer, Stacie L; Weihl, Conrad C; Li, Kelin; Lis, Lev G; Walters, Michael A; Schoenen, Frank J; Lin, Henry J; Deshaies, Raymond J; Arkin, Michelle R

    2014-07-29

    The p97 AAA (ATPase associated with diverse cellular activities), also called VCP (valosin-containing protein), is an important therapeutic target for cancer and neurodegenerative diseases. p97 forms a hexamer composed of two AAA domains (D1 and D2) that form two stacked rings and an N-terminal domain that binds numerous cofactor proteins. The interplay between the three domains in p97 is complex, and a deeper biochemical understanding is needed in order to design selective p97 inhibitors as therapeutic agents. It is clear that the D2 ATPase domain hydrolyzes ATP in vitro, but whether D1 contributes to ATPase activity is controversial. Here, we use Walker A and B mutants to demonstrate that D1 is capable of hydrolyzing ATP and show for the first time that nucleotide binding in the D2 domain increases the catalytic efficiency (kcat/Km) of D1 ATP hydrolysis 280-fold, by increasing kcat 7-fold and decreasing Km about 40-fold. We further show that an ND1 construct lacking D2 but including the linker between D1 and D2 is catalytically active, resolving a conflict in the literature. Applying enzymatic observations to small-molecule inhibitors, we show that four p97 inhibitors (DBeQ, ML240, ML241, and NMS-873) have differential responses to Walker A and B mutations, to disease-causing IBMPFD mutations, and to the presence of the N domain binding cofactor protein p47. These differential effects provide the first evidence that p97 cofactors and disease mutations can alter p97 inhibitor potency and suggest the possibility of developing context-dependent inhibitors of p97. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Combined effects of EGFR tyrosine kinase inhibitors and vATPase inhibitors in NSCLC cells

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Hyeon-Ok [KIRAMS Radiation Biobank, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Hong, Sung-Eun [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Kim, Chang Soon [Department of Microbiological Engineering, Kon-Kuk University, 120 Neungdong-ro, Gwangjin-gu, Seoul, 143–701 (Korea, Republic of); Park, Jin-Ah; Kim, Jin-Hee; Kim, Ji-Young; Kim, Bora [KIRAMS Radiation Biobank, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Chang, Yoon Hwan; Hong, Seok-Il; Hong, Young Jun [Department of Laboratory Medicine, Korea Cancer Center Hospital, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Park, In-Chul, E-mail: parkic@kirams.re.kr [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Lee, Jin Kyung, E-mail: jklee@kirams.re.kr [KIRAMS Radiation Biobank, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Department of Laboratory Medicine, Korea Cancer Center Hospital, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of)

    2015-08-15

    Despite excellent initial clinical responses of non-small cell lung cancer (NSCLC) patients to epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs), many patients eventually develop resistance. According to a recent report, vacuolar H + ATPase (vATPase) is overexpressed and is associated with chemotherapy drug resistance in NSCLC. We investigated the combined effects of EGFR TKIs and vATPase inhibitors and their underlying mechanisms in the regulation of NSCLC cell death. We found that combined treatment with EGFR TKIs (erlotinib, gefitinib, or lapatinib) and vATPase inhibitors (bafilomycin A1 or concanamycin A) enhanced synergistic cell death compared to treatments with each drug alone. Treatment with bafilomycin A1 or concanamycin A led to the induction of Bnip3 expression in an Hif-1α dependent manner. Knock-down of Hif-1α or Bnip3 by siRNA further enhanced cell death induced by bafilomycin A1, suggesting that Hif-1α/Bnip3 induction promoted resistance to cell death induced by the vATPase inhibitors. EGFR TKIs suppressed Hif-1α and Bnip3 expression induced by the vATPase inhibitors, suggesting that they enhanced the sensitivity of the cells to these inhibitors by decreasing Hif-1α/Bnip3 expression. Taken together, we conclude that EGFR TKIs enhance the sensitivity of NSCLC cells to vATPase inhibitors by decreasing Hif-1α/Bnip3 expression. We suggest that combined treatment with EGFR TKIs and vATPase inhibitors is potentially effective for the treatment of NSCLC. - Highlights: • Co-treatment with EGFR TKIs and vATPase inhibitors induces synergistic cell death • EGFR TKIs enhance cell sensitivity to vATPase inhibitors via Hif-1α downregulation • Co-treatment of these inhibitors is potentially effective for the treatment of NSCLC.

  13. K+ Stimulation of ATPase Activity Associated with the Chloroplast Inner Envelope 1

    Science.gov (United States)

    Wu, Weihua; Berkowitz, Gerald A.

    1992-01-01

    Studies were conducted to characterize ATPase activity associated with purified chloroplast inner envelope preparations from spinach (Spinacea oleracea L.) plants. Comparison of free Mg2+ and Mg·ATP complex effects on ATPase activity revealed that any Mg2+ stimulation of activity was likely a function of the use of the Mg·ATP complex as a substrate by the enzyme; free Mg2+ may be inhibitory. In contrast, a marked (one- to twofold) stimulation of ATPase activity was noted in the presence of K+. This stimulation had a pH optimum of approximately pH 8.0, the same pH optimum found for enzyme activity in the absence of K+. K+ stimulation of enzyme activity did not follow simple Michaelis-Menton kinetics. Rather, K+ effects were consistent with a negative cooperativity-type binding of the cation to the enzyme, with the Km increasing at increasing substrate. Of the total ATPase activity associated with the chloroplast inner envelope, the K+-stimulated component was most sensitive to the inhibitors oligomycin and vanadate. It was concluded that K+ effects on this chloroplast envelope ATPase were similar to this cation's effects on other transport ATPases (such as the plasmalemma H+-ATPase). Such ATPases are thought to be indirectly involved in active K+ uptake, which can be facilitated by ATPase-dependent generation of an electrical driving force. Thus, K+ effects on the chloroplast enzyme in vitro were found to be consistent with the hypothesized role of this envelope ATPase in facilitating active cation transport in vivo. ImagesFigure 3 PMID:16668922

  14. Combined effects of EGFR tyrosine kinase inhibitors and vATPase inhibitors in NSCLC cells

    International Nuclear Information System (INIS)

    Jin, Hyeon-Ok; Hong, Sung-Eun; Kim, Chang Soon; Park, Jin-Ah; Kim, Jin-Hee; Kim, Ji-Young; Kim, Bora; Chang, Yoon Hwan; Hong, Seok-Il; Hong, Young Jun; Park, In-Chul; Lee, Jin Kyung

    2015-01-01

    Despite excellent initial clinical responses of non-small cell lung cancer (NSCLC) patients to epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs), many patients eventually develop resistance. According to a recent report, vacuolar H + ATPase (vATPase) is overexpressed and is associated with chemotherapy drug resistance in NSCLC. We investigated the combined effects of EGFR TKIs and vATPase inhibitors and their underlying mechanisms in the regulation of NSCLC cell death. We found that combined treatment with EGFR TKIs (erlotinib, gefitinib, or lapatinib) and vATPase inhibitors (bafilomycin A1 or concanamycin A) enhanced synergistic cell death compared to treatments with each drug alone. Treatment with bafilomycin A1 or concanamycin A led to the induction of Bnip3 expression in an Hif-1α dependent manner. Knock-down of Hif-1α or Bnip3 by siRNA further enhanced cell death induced by bafilomycin A1, suggesting that Hif-1α/Bnip3 induction promoted resistance to cell death induced by the vATPase inhibitors. EGFR TKIs suppressed Hif-1α and Bnip3 expression induced by the vATPase inhibitors, suggesting that they enhanced the sensitivity of the cells to these inhibitors by decreasing Hif-1α/Bnip3 expression. Taken together, we conclude that EGFR TKIs enhance the sensitivity of NSCLC cells to vATPase inhibitors by decreasing Hif-1α/Bnip3 expression. We suggest that combined treatment with EGFR TKIs and vATPase inhibitors is potentially effective for the treatment of NSCLC. - Highlights: • Co-treatment with EGFR TKIs and vATPase inhibitors induces synergistic cell death • EGFR TKIs enhance cell sensitivity to vATPase inhibitors via Hif-1α downregulation • Co-treatment of these inhibitors is potentially effective for the treatment of NSCLC

  15. Retrieval of the vacuolar H-ATPase from phagosomes revealed by live cell imaging.

    Directory of Open Access Journals (Sweden)

    Margaret Clarke

    2010-01-01

    Full Text Available The vacuolar H+-ATPase, or V-ATPase, is a highly-conserved multi-subunit enzyme that transports protons across membranes at the expense of ATP. The resulting proton gradient serves many essential functions, among them energizing transport of small molecules such as neurotransmitters, and acidifying organelles such as endosomes. The enzyme is not present in the plasma membrane from which a phagosome is formed, but is rapidly delivered by fusion with endosomes that already bear the V-ATPase in their membranes. Similarly, the enzyme is thought to be retrieved from phagosome membranes prior to exocytosis of indigestible material, although that process has not been directly visualized.To monitor trafficking of the V-ATPase in the phagocytic pathway of Dictyostelium discoideum, we fed the cells yeast, large particles that maintain their shape during trafficking. To track pH changes, we conjugated the yeast with fluorescein isothiocyanate. Cells were labeled with VatM-GFP, a fluorescently-tagged transmembrane subunit of the V-ATPase, in parallel with stage-specific endosomal markers or in combination with mRFP-tagged cytoskeletal proteins.We find that the V-ATPase is commonly retrieved from the phagosome membrane by vesiculation shortly before exocytosis. However, if the cells are kept in confined spaces, a bulky phagosome may be exocytosed prematurely. In this event, a large V-ATPase-rich vacuole coated with actin typically separates from the acidic phagosome shortly before exocytosis. This vacuole is propelled by an actin tail and soon acquires the properties of an early endosome, revealing an unexpected mechanism for rapid recycling of the V-ATPase. Any V-ATPase that reaches the plasma membrane is also promptly retrieved.Thus, live cell microscopy has revealed both a usual route and alternative means of recycling the V-ATPase in the endocytic pathway.

  16. Molecular basis for the binding and modulation of V-ATPase by a bacterial effector protein.

    Directory of Open Access Journals (Sweden)

    Jianhua Zhao

    2017-06-01

    Full Text Available Intracellular pathogenic bacteria evade the immune response by replicating within host cells. Legionella pneumophila, the causative agent of Legionnaires' Disease, makes use of numerous effector proteins to construct a niche supportive of its replication within phagocytic cells. The L. pneumophila effector SidK was identified in a screen for proteins that reduce the activity of the proton pumping vacuolar-type ATPases (V-ATPases when expressed in the yeast Saccharomyces cerevisae. SidK is secreted by L. pneumophila in the early stages of infection and by binding to and inhibiting the V-ATPase, SidK reduces phagosomal acidification and promotes survival of the bacterium inside macrophages. We determined crystal structures of the N-terminal region of SidK at 2.3 Å resolution and used single particle electron cryomicroscopy (cryo-EM to determine structures of V-ATPase:SidK complexes at ~6.8 Å resolution. SidK is a flexible and elongated protein composed of an α-helical region that interacts with subunit A of the V-ATPase and a second region of unknown function that is flexibly-tethered to the first. SidK binds V-ATPase strongly by interacting via two α-helical bundles at its N terminus with subunit A. In vitro activity assays show that SidK does not inhibit the V-ATPase completely, but reduces its activity by ~40%, consistent with the partial V-ATPase deficiency phenotype its expression causes in yeast. The cryo-EM analysis shows that SidK reduces the flexibility of the A-subunit that is in the 'open' conformation. Fluorescence experiments indicate that SidK binding decreases the affinity of V-ATPase for a fluorescent analogue of ATP. Together, these results reveal the structural basis for the fine-tuning of V-ATPase activity by SidK.

  17. Oxidative stress (glutathionylation and Na,K-ATPase activity in rat skeletal muscle.

    Directory of Open Access Journals (Sweden)

    Carsten Juel

    Full Text Available Changes in ion distribution across skeletal muscle membranes during muscle activity affect excitability and may impair force development. These changes are counteracted by the Na,K-ATPase. Regulation of the Na,K-ATPase is therefore important for skeletal muscle function. The present study investigated the presence of oxidative stress (glutathionylation on the Na,K-ATPase in rat skeletal muscle membranes.Immunoprecipitation with an anti-glutathione antibody and subsequent immunodetection of Na,K-ATPase protein subunits demonstrated 9.0±1.3% and 4.1±1.0% glutathionylation of the α isoforms in oxidative and glycolytic skeletal muscle, respectively. In oxidative muscle, 20.0±6.1% of the β1 units were glutathionylated, whereas 14.8±2.8% of the β2-subunits appear to be glutathionylated in glycolytic muscle. Treatment with the reducing agent dithiothreitol (DTT, 1 mM increased the in vitro maximal Na,K-ATPase activity by 19% (P<0.05 in membranes from glycolytic muscle. Oxidized glutathione (GSSG, 0-10 mM increased the in vitro glutathionylation level detected with antibodies, and decreased the in vitro maximal Na,K-ATPase activity in a dose-dependent manner, and with a larger effect in oxidative compared to glycolytic skeletal muscle.This study demonstrates the existence of basal glutathionylation of both the α and the β units of rat skeletal muscle Na,K-ATPase. In addition, the study suggests a negative correlation between glutathionylation levels and maximal Na,K-ATPase activity.Glutathionylation likely contributes to the complex regulation of Na,K-ATPase function in skeletal muscle. Especially, glutathionylation induced by oxidative stress may have a role in Na,K-ATPase regulation during prolonged muscle activity.

  18. The AAA+ ATPase p97, a cellular multitool.

    Science.gov (United States)

    Stach, Lasse; Freemont, Paul S

    2017-08-17

    The AAA+ (ATPases associated with diverse cellular activities) ATPase p97 is essential to a wide range of cellular functions, including endoplasmic reticulum-associated degradation, membrane fusion, NF-κB (nuclear factor kappa-light-chain-enhancer of activated B cells) activation and chromatin-associated processes, which are regulated by ubiquitination. p97 acts downstream from ubiquitin signaling events and utilizes the energy from ATP hydrolysis to extract its substrate proteins from cellular structures or multiprotein complexes. A multitude of p97 cofactors have evolved which are essential to p97 function. Ubiquitin-interacting domains and p97-binding domains combine to form bi-functional cofactors, whose complexes with p97 enable the enzyme to interact with a wide range of ubiquitinated substrates. A set of mutations in p97 have been shown to cause the multisystem proteinopathy inclusion body myopathy associated with Paget's disease of bone and frontotemporal dementia. In addition, p97 inhibition has been identified as a promising approach to provoke proteotoxic stress in tumors. In this review, we will describe the cellular processes governed by p97, how the cofactors interact with both p97 and its ubiquitinated substrates, p97 enzymology and the current status in developing p97 inhibitors for cancer therapy. © 2017 The Author(s).

  19. Activation of the Na+,K+-ATPase in Narcine brasiliensis

    International Nuclear Information System (INIS)

    Blum, H.; Nioka, Shoko; Johnson, R.G. Jr.

    1990-01-01

    The in vivo activation and turnover rates of the sodium pump (Na + ,K + -ATPase) were investigated in the electrocytes of the electric organ of the elasmobranch Narcine brasiliensis. The Narcine electric organ appears to be an excellent model for the study of sodium pump activation in an excitable tissue. The sodium transmembrane gradient and high-energy phosphagens were concurrently measured by 23 Na and 31 P NMR spectroscopy. The resting electric organ, which depends primarily on anaerobic metabolism displays a high concentration of phosphocreatin (PCr). It has an intracellular sodium concentration ([Na + ] i ) of 20±10 milliequivalents/liter as estimated by NMR. Electrical stimulation of the nerves innervating the electric organ results in an increase in [Na + ] i in the electrolyte and rapid depletion of PCr. Ouabain causes an 85% decrease in utilization of high-energy phosphagens, indicating that rapid PCr turnover in this tissue is mainly due to Na + ,K + -ATPase activity. From these data the authors can determine that the rate of sodium pump turnover increases by >3 orders of magnitude within several hundred milliseconds. The authors conclude that cholinergic stimulation of the electric organ causes a rapid and extremely large increase in sodium pump turnover, which is regulated predominantly by factors other than [Na + ] i

  20. The Unbinding of ATP from F1-ATPase

    Science.gov (United States)

    Antes, Iris; Chandler, David; Wang, Hongyun; Oster, George

    2003-01-01

    Using molecular dynamics, we study the unbinding of ATP in F1-ATPase from its tight binding state to its weak binding state. The calculations are made feasible through use of interpolated atomic structures from Wang and Oster [Nature 1998, 396: 279–282]. These structures are applied to atoms distant from the catalytic site. The forces from these distant atoms gradually drive a large primary region through a series of sixteen equilibrated steps that trace the hinge bending conformational change in the β-subunit that drives rotation of γ-subunit. As the rotation progresses, we find a sequential weakening and breaking of the hydrogen bonds between the ATP molecule and the α- and β-subunits of the ATPase. This finding agrees with the “binding-zipper” model [Oster and Wang, Biochim. Biophys. Acta 2000, 1458: 482–510.] In this model, the progressive formation of the hydrogen bonds is the energy source driving the rotation of the γ-shaft during hydrolysis. Conversely, the corresponding sequential breaking of these bonds is driven by rotation of the shaft during ATP synthesis. Our results for the energetics during rotation suggest that the nucleotide's coordination with Mg2+ during binding and release is necessary to account for the observed high efficiency of the motor. PMID:12885621

  1. Inositol phosphates influence the membrane bound Ca2+/Mg2+ stimulated ATPase from human erythrocyte membranes

    International Nuclear Information System (INIS)

    Kester, M.; Ekholm, J.; Kumar, R.; Hanahan, D.J.

    1986-01-01

    The modulation by exogenous inositol phosphates of the membrane Ca 2+ /Mg 2+ ATPase from saponin/EGTA lysed human erythrocytes was determined in a buffer (pH 7.6) containing histidine, 80 mM, MgCl 2 , 3.3 mM, NaCl, 74 mM, KCl, 30 mM, Na 2 ATP, 2.3 mM, ouabain, 0.83 mM, with variable amounts of CaCl 2 and EGTA. The ATPase assay was linear with time at 44 0 C. The inositol phosphates were commercially obtained and were also prepared from 32 P labeled rabbit platelet inositol phospholipids. Inositol triphosphate (IP 3 ) elevated the Ca 2+ /Mg 2+ ATPase activity over basal levels in a dose, time, and calcium dependent manner and were increased up to 85% of control values. Activities for the Na + /K + -ATPase and a Mg 2+ ATPase were not effected by IP 3 . Ca 2+ /Mg 2+ APTase activity with IP 2 or IP 3 could be synergistically elevated with calmodulin addition. The activation of the ATPase with IP 3 was calcium dependent in a range from .001 to .02 mM. The apparent Km and Vmax values were determined for IP 3 stimulated Ca 2+ /Mg 2+ ATPase

  2. Quantitative measurement of membrane Na+-K+ ATPase activity using thallium-201: comparison with rubidium-86

    International Nuclear Information System (INIS)

    Lee, Jae Tae; Shon, Sang Kyun; Lee, Kyu Bo; Lee, In Kyu

    1998-01-01

    Na + -K + ATPase activity has been estimated by the degree of inhibition of cation transport by cardiac glycosides (ouabain) using Rb-86 as a substrate. The biological characteristics of Tl-201 is known to be similar to those of potassium as a transport substrate in the presence of glucose, insulin or phobol myristate acetate (PMA). The purpose of this study was to measure ouabain sensitive Na + -K + ATPase activity using Tl-201 and compare with that using Rb-86. Smooth muscle cells isolated from rat aorta or human placental umbilical artery were cultured, and used to measure cellular Na + -K + ATPase activity. Na + -K + ATPase activity was measured as a percentage decrease in cellular uptake of Tl-201 or Rb-86 by ouabain under the presence of glucose, insulin or PMA in media. Na + -K + ATPase activity measured with Tl-201, as a transport substrate, was not different from those measured with Rb-86 in rat or human smooth muscle cell preparation. Incubation with high concentration glucose resulted in about 30% decrease in enzyme activity. In contrast, insulin or PMA resulted in 50-70% or 28% increase from baseline activity, respectively. These results suggests that Tl-201 could replace Rb-86 in measurement of ouabain sensitive Na + -K + ATPase activity in vitro. High level of glucose concentration decreased cellular Na + -K + ATPase activity, but insulin or PMA increased it

  3. Single-molecule analysis of inhibitory pausing states of V1-ATPase.

    Science.gov (United States)

    Uner, Naciye Esma; Nishikawa, Yoshihiro; Okuno, Daichi; Nakano, Masahiro; Yokoyama, Ken; Noji, Hiroyuki

    2012-08-17

    V(1)-ATPase, the hydrophilic V-ATPase domain, is a rotary motor fueled by ATP hydrolysis. Here, we found that Thermus thermophilus V(1)-ATPase shows two types of inhibitory pauses interrupting continuous rotation: a short pause (SP, 4.2 s) that occurred frequently during rotation, and a long inhibitory pause (LP, >30 min) that terminated all active rotations. Both pauses occurred at the same angle for ATP binding and hydrolysis. Kinetic analysis revealed that the time constants of inactivation into and activation from the SP were too short to represent biochemically predicted ADP inhibition, suggesting that SP is a newly identified inhibitory state of V(1)-ATPase. The time constant of inactivation into LP was 17 min, consistent with one of the two time constants governing the inactivation process observed in bulk ATPase assay. When forcibly rotated in the forward direction, V(1) in LP resumed active rotation. Solution ADP suppressed the probability of mechanical activation, suggesting that mechanical rotation enhanced inhibitory ADP release. These features were highly consistent with mechanical activation of ADP-inhibited F(1), suggesting that LP represents the ADP-inhibited state of V(1)-ATPase. Mechanical activation largely depended on the direction and angular displacement of forced rotation, implying that V(1)-ATPase rotation modulates the off rate of ADP.

  4. Congruence between PM H+-ATPase and NADPH oxidase during root growth: a necessary probability.

    Science.gov (United States)

    Majumdar, Arkajo; Kar, Rup Kumar

    2018-02-12

    Plasma membrane (PM) H + -ATPase and NADPH oxidase (NOX) are two key enzymes responsible for cell wall relaxation during elongation growth through apoplastic acidification and production of ˙OH radical via O 2 ˙ - , respectively. Our experiments revealed a putative feed-forward loop between these enzymes in growing roots of Vigna radiata (L.) Wilczek seedlings. Thus, NOX activity was found to be dependent on proton gradient generated across PM by H + -ATPase as evident from pharmacological experiments using carbonyl cyanide m-chlorophenylhydrazone (CCCP; protonophore) and sodium ortho-vanadate (PM H + -ATPase inhibitor). Conversely, H + -ATPase activity retarded in response to different ROS scavengers [CuCl 2 , N, N' -dimethylthiourea (DMTU) and catalase] and NOX inhibitors [ZnCl 2 and diphenyleneiodonium (DPI)], while H 2 O 2 promoted PM H + -ATPase activity at lower concentrations. Repressing effects of Ca +2 antagonists (La +3 and EGTA) on the activity of both the enzymes indicate its possible mediation. Since, unlike animal NOX, the plant versions do not possess proton channel activity, harmonized functioning of PM H + -ATPase and NOX appears to be justified. Plasma membrane NADPH oxidase and H + -ATPase are functionally synchronized and they work cooperatively to maintain the membrane electrical balance while mediating plant cell growth through wall relaxation.

  5. Inhibitory effect of lidocaine on the sarcoplasmic reticulum Ca2+-dependent atpase from temporalis muscle.

    Science.gov (United States)

    Sánchez, Gabriel A; Casadoumecq, Ana C; Alonso, Guillermo L; Takara, Delia

    2010-01-01

    Myotoxic effects of local anesthetics on skeletal musclefibers involve the inhibition ofsarcoplasmic reticulum Ca2+ -dependent ATPase activity and Ca2 transport. Lidocaine is a local anesthetic frequently used to relieve the symptoms of trigeminal neuralgia. The aim of this work was to test the inhibitory and/or stimulatory effect of lidocaine on sarcoplasmic reticulum Ca2+ -dependent ATPase isolated from rabbit temporalis muscle. Ca2+ -dependent ATPase activity was determined by a colorimetric method Calcium-binding to the Ca dependent ATPase, Ca2+ transport, and phosphorylation of the enzyme by ATP were determined with radioisotopic techniques. Lidocaine inhibited the Ca2+ -dependent ATPase activity in a concentration-dependent manner. The preincubation of the sarcoplasmic reticulum membranes with lidocaine enhanced the Ca2+ dependent ATPase activity in the absence of calcium ionophore. Lidocaine also inhibited both Ca2+ uptake and enzyme phosphorylation by ATP but had no effect on Ca2+ -binding to the enzyme. We conclude that the effect of lidocaine on the sarcoplasmic reticulum Ca2+ -dependent ATPase from temporalis muscle is due to the drug's direct interaction with the enzyme and the increased permeability of the sarcoplasmic reticulum membrane to Ca.

  6. Response of plasma membrane H+-ATPase in rice (Oryza sativa) seedlings to simulated acid rain.

    Science.gov (United States)

    Liang, Chanjuan; Ge, Yuqing; Su, Lei; Bu, Jinjin

    2015-01-01

    Understanding the adaptation of plants to acid rain is important to find feasible approaches to alleviate such damage to plants. We studied effects of acid rain on plasma membrane H(+)-ATPase activity and transcription, intracellular H(+), membrane permeability, photosynthetic efficiency, and relative growth rate during stress and recovery periods. Simulated acid rain at pH 5.5 did not affect plasma membrane H(+)-ATPase activity, intracellular H(+), membrane permeability, photosynthetic efficiency, and relative growth rate. Plasma membrane H(+)-ATPase activity and transcription in leaves treated with acid rain at pH 3.5 was increased to maintain ion homeostasis by transporting excessive H(+) out of cells. Then intracellular H(+) was close to the control after a 5-day recovery, alleviating damage on membrane and sustaining photosynthetic efficiency and growth. Simulated acid rain at pH 2.5 inhibited plasma membrane H(+)-ATPase activity by decreasing the expression of H(+)-ATPase at transcription level, resulting in membrane damage and abnormal intracellular H(+), and reduction in photosynthetic efficiency and relative growth rate. After a 5-day recovery, all parameters in leaves treated with pH 2.5 acid rain show alleviated damage, implying that the increased plasma membrane H(+)-ATPase activity and its high expression were involved in repairing process in acid rain-stressed plants. Our study suggests that plasma membrane H(+)-ATPase can play a role in adaptation to acid rain for rice seedlings.

  7. Regulation of alpha1 Na/K-ATPase expression by cholesterol.

    Science.gov (United States)

    Chen, Yiliang; Li, Xin; Ye, Qiqi; Tian, Jiang; Jing, Runming; Xie, Zijian

    2011-04-29

    We have reported that α1 Na/K-ATPase regulates the trafficking of caveolin-1 and consequently alters cholesterol distribution in the plasma membrane. Here, we report the reciprocal regulation of α1 Na/K-ATPase by cholesterol. Acute exposure of LLC-PK1 cells to methyl β-cyclodextrin led to parallel decreases in cellular cholesterol and the expression of α1 Na/K-ATPase. Cholesterol repletion fully reversed the effect of methyl β-cyclodextrin. Moreover, inhibition of intracellular cholesterol trafficking to the plasma membrane by compound U18666A had the same effect on α1 Na/K-ATPase. Similarly, the expression of α1, but not α2 and α3, Na/K-ATPase was significantly reduced in the target organs of Niemann-Pick type C mice where the intracellular cholesterol trafficking is blocked. Mechanistically, decreases in the plasma membrane cholesterol activated Src kinase and stimulated the endocytosis and degradation of α1 Na/K-ATPase through Src- and ubiquitination-dependent pathways. Thus, the new findings, taken together with what we have already reported, revealed a previously unrecognized feed-forward mechanism by which cells can utilize the Src-dependent interplay among Na/K-ATPase, caveolin-1, and cholesterol to effectively alter the structure and function of the plasma membrane.

  8. Specialized functional diversity and interactions of the Na,K-ATPase

    Directory of Open Access Journals (Sweden)

    Igor I. Krivoi

    2016-05-01

    Full Text Available Na,K-ATPase is a protein ubiquitously expressed in the plasma membrane of all animal cells and vitally essential for their functions. A specialized functional diversity of the Na,K-ATPase isozymes is provided by molecular heterogeneity, distinct subcellular localizations and functional interactions with molecular environment. Studies over the last decades clearly demonstrated complex and isoform-specific reciprocal functional interactions between the Na,K-ATPase and neighboring proteins and lipids. These interactions are enabled by a spatially restricted ion homeostasis, direct protein-protein/lipid interactions and protein kinase signaling pathways. In addition to its ‘classical’ function in ion translocation, the Na,K-ATPase is now considered as one of the most important signaling molecules in neuronal, epithelial, skeletal, cardiac and vascular tissues. Accordingly, the Na,K-ATPase forms specialized sub-cellular multimolecular microdomains which act as receptors to circulating endogenous cardiotonic steroids triggering a number of signaling pathways. Changes in these endogenous cardiotonic steroid levels and initiated signaling responses have significant adaptive values for tissues and whole organisms under numerous physiological and pathophysiological conditions. This review discusses recent progress in the studies of functional interactions between the Na,K-ATPase and molecular microenvironment, the Na,K-ATPase-dependent signaling pathways and their significance for diversity of cell function.

  9. Characterization and effect of light on the plasma membrane H(+) -ATPase of bean leaves

    Science.gov (United States)

    Linnemeyer, P. A.; Van Volkenburgh, E.; Cleland, R. E.

    1990-01-01

    Proton excretion from bean (Phaseolus vulgaris L.) leaf cells is increased by bright white light. To test whether this could be due, at least in part, to an increase in plasma membrane (PM) ATPase activity, PM vesicles were isolated from primary leaves by phase partitioning and used to characterize PM ATPase activity and changes in response to light. ATPase activity was characterized as magnesium ion dependent, vanadate sensitive, and slightly stimulated by potassium chloride. The pH optimum was 6.5, the Km was approximately 0.30 millimolar ATP, and the activity was about 60% latent. PM vesicles were prepared from leaves of plants grown for 11 days in dim red light (growing slowly) or grown for 10 days in dim red light and then transferred to bright white-light for 1 day (growing rapidly). For both light treatments, ATPase specific activity was approximately 600 to 700 nanomoles per milligram protein per minute, and the latency, Km, and sensitivity to potassium chloride were also similar. PM vesicles from plants grown in complete darkness, however, exhibited a twofold greater specific activity. We conclude that the promotion of leaf growth and proton excretion by bright white light is not due to an increase in ATPase specific activity. Light does influence ATPase activity, however; both dim red light and bright white light decreased the ATPase specific activity by nearly 50% as compared with dark-grown leaves.

  10. Identification of Novel Bisbenzimidazole Derivatives as Anticancer Vacuolar (H+-ATPase Inhibitors

    Directory of Open Access Journals (Sweden)

    Renukadevi Patil

    2017-09-01

    Full Text Available The vacuolar (H+-ATPases (V-ATPases are a family of ATP-driven proton pumps and they have been associated with cancer invasion, metastasis, and drug resistance. Despite the clear involvement of V-ATPases in cancer, the therapeutic use of V-ATPase-targeting small molecules has not reached human clinical trials to date. Thus, V-ATPases are emerging as important targets for the identification of potential novel therapeutic agents. We identified a bisbenzimidazole derivative (V as an initial hit from a similarity search using four known V-ATPase inhibitors (I–IV. Based on the initial hit (V, we designed and synthesized a focused set of novel bisbenzimidazole analogs (2a–e. All newly prepared compounds have been screened for selected human breast cancer (MDA-MB-468, MDA-MB-231, and MCF7 and ovarian cancer (A2780, Cis-A2780, and PA-1 cell lines, along with the normal breast epithelial cell line, MCF10A. The bisbenzimidazole derivative (2e is active against all cell lines tested. Remarkably, it demonstrated high cytotoxicity against the triple-negative breast cancer (TNBC cell line, MDA-MB-468 (IC50 = 0.04 ± 0.02 μM. Additionally, it has been shown to inhibit the V-ATPase pump that is mainly responsible for acidification. To the best of our knowledge the bisbenzimidazole pharmacophore has been identified as the first V-ATPase inhibitor in its class. These results strongly suggest that the compound 2e could be further developed as a potential anticancer V-ATPase inhibitor for breast cancer treatment.

  11. Na/K-ATPase/src complex mediates regulation of CD40 in renal parenchyma.

    Science.gov (United States)

    Xie, Jeffrey X; Zhang, Shungang; Cui, Xiaoyu; Zhang, Jue; Yu, Hui; Khalaf, Fatimah K; Malhotra, Deepak; Kennedy, David J; Shapiro, Joseph I; Tian, Jiang; Haller, Steven T

    2017-12-22

    Recent studies have highlighted a critical role for CD40 in the pathogenesis of renal injury and fibrosis. However, little is currently understood about the regulation of CD40 in this setting. We use novel Na/K-ATPase cell lines and inhibitors in order to demonstrate the regulatory function of Na/K-ATPase with regards to CD40 expression and function. We utilize 5/6 partial nephrectomy as well as direct infusion of a Na/K-ATPase ligand to demonstrate this mechanism exists in vivo. We demonstrate that knockdown of the α1 isoform of Na/K-ATPase causes a reduction in CD40 while rescue of the α1 but not the α2 isoform restores CD40 expression in renal epithelial cells. Second, because the major functional difference between α1 and α2 is the ability of α1 to form a functional signaling complex with Src, we examined whether the Na/K-ATPase/Src complex is important for CD40 expression. We show that a gain-of-Src binding α2 mutant restores CD40 expression while loss-of-Src binding α1 reduces CD40 expression. Furthermore, loss of a functional Na/K-ATPase/Src complex also disrupts CD40 signaling. Importantly, we show that use of a specific Na/K-ATPase/Src complex antagonist, pNaKtide, can attenuate cardiotonic steroid (CTS)-induced induction of CD40 expression in vitro. Because the Na/K-ATPase/Src complex is also a key player in the pathogenesis of renal injury and fibrosis, our new findings suggest that Na/K-ATPase and CD40 may comprise a pro-fibrotic feed-forward loop in the kidney and that pharmacological inhibition of this loop may be useful in the treatment of renal fibrosis. © The Author 2017. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved.

  12. Comparative properties of caveolar and noncaveolar preparations of kidney Na+/K+-ATPase.

    Science.gov (United States)

    Liu, Lijun; Ivanov, Alexander V; Gable, Marjorie E; Jolivel, Florent; Morrill, Gene A; Askari, Amir

    2011-10-11

    To evaluate previously proposed functions of renal caveolar Na(+)/K(+)-ATPase, we modified the standard procedures for the preparation of the purified membrane-bound kidney enzyme, separated the caveolar and noncaveolar pools, and compared their properties. While the subunits of Na(+)/K(+)-ATPase (α,β,γ) constituted most of the protein content of the noncaveolar pool, the caveolar pool also contained caveolins and major caveolar proteins annexin-2 tetramer and E-cadherin. Ouabain-sensitive Na(+)/K(+)-ATPase activities of the two pools had similar properties and equal molar activities, indicating that the caveolar enzyme retains its ion transport function and does not contain nonpumping enzyme. As minor constituents, both caveolar and noncaveolar pools also contained Src, EGFR, PI3K, and several other proteins known to be involved in stimulous-induced signaling by Na(+)/K(+)-ATPase, indicating that signaling function is not limited to the caveolar pool. Endogenous Src was active in both pools but was not further activated by ouabain, calling into question direct interaction of Src with native Na(+)/K(+)-ATPase. Chemical cross-linking, co-immunoprecipitation, and immunodetection studies showed that in the caveolar pool, caveolin-1 oligomers, annexin-2 tetramers, and oligomers of the α,β,γ-protomers of Na(+)/K(+)-ATPase form a large multiprotein complex. In conjunction with known roles of E-cadherin and the β-subunit of Na(+)/K(+)-ATPase in cell adhesion and noted intercellular β,β-contacts within the structure of Na(+)/K(+)-ATPase, our findings suggest that interacting caveolar Na(+)/K(+)-ATPases located at renal adherens junctions maintain contact of two adjacent cells, conduct essential ion pumping, and are capable of locus-specific signaling in junctional cells.

  13. Src-independent ERK signaling through the rat α3 isoform of Na/K-ATPase.

    Science.gov (United States)

    Madan, Namrata; Xu, Yunhui; Duan, Qiming; Banerjee, Moumita; Larre, Isabel; Pierre, Sandrine V; Xie, Zijian

    2017-03-01

    The Na/K-ATPase α1 polypeptide supports both ion-pumping and signaling functions. The Na/K-ATPase α3 polypeptide differs from α1 in both its primary structure and its tissue distribution. The expression of α3 seems particularly important in neurons, and recent clinical evidence supports a unique role of this isoform in normal brain function. The nature of this specific role of α3 has remained elusive, because the ubiquitous presence of α1 has hindered efforts to characterize α3-specific functions in mammalian cell systems. Using Na/K-ATPase α1 knockdown pig kidney cells (PY-17), we generated the first stable mammalian cell line expressing a ouabain-resistant form of rat Na/K-ATPase α3 in the absence of endogenous pig α1 detectable by Western blotting. In these cells, Na/K-ATPase α3 formed a functional ion-pumping enzyme and rescued the expression of Na/K-ATPase β1 and caveolin-1 to levels comparable with those observed in PY-17 cells rescued with a rat Na/K-ATPase α1 (AAC-19). The α3-containing enzymes had lower Na + affinity and lower ouabain-sensitive transport activity than their α1-containing counterparts under basal conditions, but showed a greater capacity to be activated when intracellular Na + was increased. In contrast to Na/K-ATPase α1, α3 could not regulate Src. Upon exposure to ouabain, Src activation did not occur, yet ERK was activated through Src-independent pathways involving PI3K and PKC. Hence, α3 expression confers signaling and pumping properties that are clearly distinct from that of cells expressing Na/K-ATPase α1. Copyright © 2017 the American Physiological Society.

  14. Long-term regulation of Na,K-ATPase pump during T-cell proliferation.

    Science.gov (United States)

    Karitskaya, Inna; Aksenov, Nikolay; Vassilieva, Irina; Zenin, Valerii; Marakhova, Irina

    2010-09-01

    The aim of the study was to elucidate the mechanism responsible for the proliferation-related regulation of Na,K-ATPase pump. Our data demonstrate that in mitogen-stimulated human blood lymphocytes, enhanced ouabain-sensitive Rb(K) fluxes in the middle/late stage of G(0)/G(1)/S transit are associated with the increased number of Na,K-ATPase pumps expressed at the cell surface (as determined by the [(3)H]ouabain binding). Analysis of total RNA (reverse transcription-polymerase chain reaction) and protein (Western blotting) showed a threefold increase in the level of Na,K-ATPase alpha1-subunit and beta1-subunit mRNAs and significant increase in the Na,K-ATPase alpha1-subunit protein during the first day of mitogen-induced proliferation. The elevated K transport as well as the increased expression of Na,K-ATPase is closely associated with the IL-2-dependent stage of T-cell response. The pharmacological inhibition of IL-2-induced MEK/ERK or JAK/STAT cascades suppressed the IL-2-induced proliferation and reduced the functional and protein expressions of Na,K-ATPase. It is concluded that during the lymphocyte transition from resting stage to proliferation, (1) long-term activation of Na,K-ATPase pump is due to the enhanced expression of Na,K-ATPase protein and mRNA, and (2) the cytokine signaling via the IL-2 receptor is necessary for the cell cycle-associated upregulation of Na,K-ATPase.

  15. Alteration of aluminium inhibition of synaptosomal (Na(+)/K(+))ATPase by colestipol administration.

    Science.gov (United States)

    Silva, V S; Oliveira, L; Gonçalves, P P

    2013-11-01

    The ability of aluminium to inhibit the (Na(+)/K(+))ATPase activity has been observed by several authors. During chronic dietary exposure to AlCl3, brain (Na(+)/K(+))ATPase activity drops, even if no alterations of catalytic subunit protein expression and of energy charge potential are observed. The aluminium effect on (Na(+)/K(+))ATPase activity seems to implicate the reduction of interacting protomers within the oligomeric ensemble of the membrane-bound (Na(+)/K(+))ATPase. The activity of (Na(+)/K(+))ATPase is altered by the microviscosity of lipid environment. We studied if aluminium inhibitory effect on (Na(+)/K(+))ATPase is modified by alterations in synaptosomal membrane cholesterol content. Adult male Wistar rats were submitted to chronic dietary AlCl3 exposure (0.03 g/day of AlCl3) and/or to colestipol, a hypolidaemic drug (0.31 g/day) during 4 months. The activity of (Na(+)/K(+))ATPase was studied in brain cortex synaptosomes with different cholesterol contents. Additionally, we incubate synaptosomes with methyl-β-cyclodextrin for both enrichment and depletion of membrane cholesterol content, with or without 300 μM AlCl3. This enzyme activity was significantly reduced by micromolar AlCl3 added in vitro and when aluminium was orally administered to rats. The oral administration of colestipol reduced the cholesterol content and concomitantly inhibited the (Na(+)/K(+))ATPase. The aluminium inhibitory effect on synaptosomal (Na(+)/K(+))ATPase was reduced by cholesterol depletion both in vitro and in vivo. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. The effects of dexamethasone on the Na,K-ATPase activity and pump function of corneal endothelial cells.

    Science.gov (United States)

    Hatou, Shin; Yamada, Masakazu; Mochizuki, Hiroshi; Shiraishi, Atsushi; Joko, Takeshi; Nishida, Teruo

    2009-05-01

    The Na(+)- and K(+)-dependent ATPase (Na,K-ATPase) expressed in the basolateral membrane of corneal endothelial cells plays an important role in the pump function of the corneal endothelium. We investigated the possible role of dexamethasone in the regulation of Na,K-ATPase activity and pump function in corneal endothelial cells. Confluent monolayers of mouse corneal endothelial cells were exposed to dexamethasone. ATPase activity of the cells was evaluated by spectrophotometric measurement of phosphate released from ATP with the use of ammonium molybdate, with Na,K-ATPase activity being defined as the portion of total ATPase activity sensitive to ouabain. Pump function of the cells was measured with the use of an Ussing chamber, with the pump function attributable to Na,K-ATPase activity being defined as the portion of the total short-circuit current sensitive to ouabain. Western blot analysis was examined to measure the expression of the Na,K-ATPase alpha(1)-subunit. Dexamethasone (1 or 10 microM) increased the Na,K-ATPase activity and pump function of the cultured cells. These effects of dexamethasone were blocked by cycloheximide, a protein synthesis inhibitor. Western blot analysis also indicated that dexamethasone increased the expression of the Na,K-ATPase alpha(1)-subunit, whereas it decreased the expression of the phospho-Na,K-ATPase alpha(1)-subunit. Our results suggest that dexamethasone stimulates Na,K-ATPase activity in mouse corneal endothelial cells. The effect of dexamethasone activation in these cells is mediated by Na,K-ATPase synthesis and increase in an enzymatic activity by dephosphorylation of Na,K-ATPase alpha(1)-subunits.

  17. The effect of near-UV light on Na-K-ATPase of the rat lens

    International Nuclear Information System (INIS)

    Torriglia, A.; Zigman, S.

    1988-01-01

    The influence of in vitro near-UV radiation exposure on the physical state of the rat lens and on its membrane-bound Na-K-ATPase activity was investigated. Lens swelling was correlated to the appearance of opacities and the inactivation of the enzyme. The results show a significant decrease in the Na-K-ATPase activity which may be an early change leading to osmotic type cataracts. The dose-effect curves obtained for cortical and epithelial enzymes were different. Since the data do not follow a mono-exponential function, the existence of two forms of Na-K-ATPase in the lens is discussed. (author)

  18. Na+,K+-ATPase concentration in rodent and human heart and skeletal muscle

    DEFF Research Database (Denmark)

    Kjeldsen, K; Bjerregaard, P; Richter, Erik

    1988-01-01

    rats, cardiomyopathic hamsters, and human subjects. These methods have earlier been shown to quantify the Na+,K+-ATPase concentration in muscle tissue with high accuracy. When rats were swim trained for six weeks the heart ventricular muscle Na+,K+-ATPase concentration was increased by 20% (p less than...... was increased by up to 46% (p less than 0.001) and decreased by up to 30% (p less than 0.005) after training and immobilisation respectively. Cardiomyopathic hamsters showed a reduction of 33% (p less than 0.005) in the heart ventricular Na+,K+-ATPase concentration compared with normal hamsters. This decrease...

  19. Structure and Function of the Membrane Deformation AAA ATPase Vps4

    Science.gov (United States)

    Hill, Christopher P.; Babst, Markus

    2011-01-01

    The ATPase Vps4 belongs to the type-I AAA family of proteins. Vps4 functions together with a group of proteins referred to as ESCRTs in membrane deformation and fission events. These cellular functions include vesicle formation at the endosome, cytokinesis and viral budding. The highly dynamic quaternary structure of Vps4 and its interactions with a network of regulators and co-factors have made the analysis of this ATPase challenging. Nevertheless, recent advances in the understanding of the cell biology of Vps4 together with structural information and in vitro studies are guiding mechanistic models of this ATPase. PMID:21925211

  20. RIN4 functions with plasma membrane H+-ATPases to regulate stomatal apertures during pathogen attack

    DEFF Research Database (Denmark)

    Liu, Jun; Elmore, James M.; Fuglsang, Anja Thoe

    2009-01-01

    Abstract Pathogen perception by the plant innate immune system is of central importance to plant survival and productivity. The Arabidopsis protein RIN4 is a negative regulator of plant immunity. In order to identify additional proteins involved in RIN4- mediated immune signal transduction, we...... exhibit differential PM H+-ATPase activity. PM H+-ATPase activation induces stomatal opening, enabling bacteria to gain entry into the plant leaf; inactivation induces stomatal closure thus restricting bacterial invasion. The rin4 knockout line exhibited reduced PM H+-ATPase activity and, importantly, its...... apertures, inhibiting the entry of bacterial pathogens into the plant leaf during infection....