WorldWideScience

Sample records for single-stranded dna probes

  1. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    Science.gov (United States)

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  2. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.

    1978-01-01

    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  3. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian

    2012-07-06

    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  4. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy

    2008-01-01

    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  5. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray.

    Science.gov (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino

    2008-08-25

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  6. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Science.gov (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino

    2008-01-01

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  7. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.

    1985-01-01

    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  8. Improved single-strand DNA sizing accuracy in capillary electrophoresis.

    OpenAIRE

    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B

    1997-01-01

    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  9. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  10. Programmable autonomous synthesis of single-stranded DNA

    Science.gov (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

    2018-02-01

    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  11. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase.

    Science.gov (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias

    2017-06-02

    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  13. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela

    2010-01-01

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  14. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    Science.gov (United States)

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  15. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.

    1984-01-01

    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  16. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.

    1987-01-01

    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  17. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.

    1983-01-01

    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  18. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela

    2015-01-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  19. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.

    OpenAIRE

    Barany, F; Boeke, J D

    1983-01-01

    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  20. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der

    1988-01-01

    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  1. Dynamics of RecA filaments on single-stranded DNA

    NARCIS (Netherlands)

    Van Loenhout, M.T.J.; Van der Heijden, T.; Kanaar, R.; Wyman, C.; Dekker, C.

    2009-01-01

    RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on

  2. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  3. Aptamer based voltammetric determination of ampicillin using a single-stranded DNA binding protein and DNA functionalized gold nanoparticles.

    Science.gov (United States)

    Wang, Jun; Ma, Kui; Yin, Huanshun; Zhou, Yunlei; Ai, Shiyun

    2017-12-20

    An aptamer based method is described for the electrochemical determination of ampicillin. It is based on the use of DNA aptamer, DNA functionalized gold nanoparticles (DNA-AuNPs), and single-stranded DNA binding protein (ssDNA-BP). When the aptamer hybridizes with the target DNA on the AuNPs, the ssDNA-BP is captured on the electrode surface via its specific interaction with ss-DNA. This results in a decreased electrochemical signal of the redox probe Fe(CN) 6 3- which is measured best at a voltage of 0.188 mV (vs. reference electrode). In the presence of ampicillin, the formation of aptamer-ampicillin conjugate blocks the further immobilization of DNA-AuNPs and ssDNA-BP, and this leads to an increased response. The method has a linear reposne that convers the 1 pM to 5 nM ampicillin concentration range, with a 0.38 pM detection limit (at an S/N ratio of 3). The assay is selective, stable and reproducible. It was applied to the determination of ampicillin in spiked milk samples where it gave recoveries ranging from 95.5 to 105.5%. Graphical abstract Schematic of a simple and sensitive electrochemical apta-biosensor for ampicillin detection. It is based on the use of gold nanoparticles (AuNPs), DNA aptamer, DNA functionalized AuNPs (DNA-AuNPs), and single-strand DNA binding protein (SSBP).

  4. Ion assisted structural collapse of a single stranded DNA: A molecular dynamics approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Soumadwip; Dixit, Himanshu; Chakrabarti, Rajarshi, E-mail: rajarshi@chem.iitb.ac.in

    2015-09-28

    Highlights: • The dynamics of a single-stranded DNA in presence of different concentrations of Mg{sup 2+} is investigated. • The initial DNA chain collapse is characterized by the formation of non-sequentially stacked base pairs. • The DNA chain re-swells at high concentrations of Mg{sup 2+} as a consequence of overcharging. - Abstract: The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counterions. It is well known that the structural collapse of DNA is favoured in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl{sub 2}) single stranded DNA with base sequence 5′-CGCGAATTCGCG-3′ (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  5. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket.

    Science.gov (United States)

    Pham, Hanh T; Bergoin, Max; Tijssen, Peter

    2013-03-14

    The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  6. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket

    OpenAIRE

    Pham, Hanh T.; Bergoin, Max; Tijssen, Peter

    2013-01-01

    International audience; The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  7. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  8. Stretching and controlled motion of single-stranded DNA in locally heated solid-state nanopores.

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B; Aksimentiev, Aleksei

    2013-08-27

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4-8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA.

  9. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.

    2002-01-01

    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit...

  10. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B

    2006-01-01

    by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  11. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.

    1985-01-01

    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  12. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    Science.gov (United States)

    Hong, Ka Lok

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  13. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud

    2012-06-01

    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  14. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks.

    Science.gov (United States)

    Pachkowski, Brian; Nakamura, Jun

    2013-01-01

    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  15. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

    Science.gov (United States)

    Richardson, Tomas T; Harran, Omar; Murray, Heath

    2016-06-16

    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

  16. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop.

    Science.gov (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S

    2009-05-01

    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  17. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.

    2012-01-01

    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  18. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana.

    Science.gov (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L

    2005-04-01

    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  19. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis.

    Science.gov (United States)

    Olszewski, Marcin; Mickiewicz, Małgorzata; Kur, Józef

    2008-07-01

    The thermophilic bacterium Thermoanaerobacter tengcongensis has two single-stranded DNA-binding (SSB) proteins, designated TteSSB2 and TteSSB3. In a SSB complementation assay in Escherichia coli, only TteSSB3 took over the in vivo function of EcoSSB. We have cloned the ssb genes obtained by PCR and have developed E. coli overexpression systems. The TteSSB2 and TteSSB3 consist of 153 and 150 amino acids with a calculated molecular mass of 17.29 and 16.96 kDa, respectively. They are the smallest known bacterial SSB proteins. The homology between amino acid sequences of these proteins is 40% identity and 53% similarity. They are functional as homotetramers, with each monomer encoding one single-stranded DNA binding domain (OB-fold). In fluorescence titrations with poly(dT), both proteins bind single-stranded DNA with a binding site size of about 40 nt per homotetramer. Thermostability with half-life of about 30 s at 95 degrees C makes TteSSB3 similar to the known SSB of Thermus aquaticus (TaqSSB). The TteSSB2 was fully active even after 6 h incubation at 100 degrees C. Here, we show for the first time paralogous thermostable homotetrameric SSBs, which could be an attractive alternative for known homodimeric thermostable SSB proteins in their applications for molecular biology methods and analytical purposes.

  20. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux

    2016-12-01

    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  1. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    Science.gov (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.

    1988-01-01

    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  3. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams

    2014-01-01

    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  4. Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Gust, I.D.; Feinstone, S.M.; Purcell, R.H.; Alter, H.J.

    1980-01-01

    A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

  5. Biophysical characterization of the association of histones with single-stranded DNA.

    Science.gov (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier

    2017-11-01

    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng

    2015-05-08

    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  7. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted

    2014-01-01

    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  8. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora.

    Science.gov (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E

    2003-08-01

    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  9. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  10. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.

    1980-01-01

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  11. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata).

    Science.gov (United States)

    Jackson, Elliot W; Bistolas, Kalia S I; Button, Jason B; Hewson, Ian

    2016-01-01

    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates.

  12. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.

    1980-01-01

    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  13. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  14. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif

    Science.gov (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  15. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos

    2015-09-01

    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  16. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes

    Science.gov (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.

    2015-01-01

    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  17. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.

    1987-01-01

    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  18. Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages.

    Science.gov (United States)

    Kodaira, K; Godson, N G; Taketo, A

    1995-01-25

    The minus origins for complementary strand DNA synthesis (-ori) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, phi K, alpha 3, and St-1 closely resemble each other in DNA structure and contain two potential secondary hairpin loops (I and II) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the -ori regions of phi K and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the phi K mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several phi K and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway.

  19. Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1

    DEFF Research Database (Denmark)

    Yang, Jay; Bachrati, Csanad Z; Ou, Jiongwen

    2010-01-01

    -passage mechanism. We generated single-stranded catenanes that resemble the proposed dissolution intermediate recognized by human topoisomerase IIIalpha. We demonstrate that human topoisomerase IIIalpha is a single-stranded DNA decatenase that is specifically stimulated by the BLM-RMI1 pair. In addition, RMI1......Human topoisomerase IIIalpha is a type IA DNA topoisomerase that functions with BLM and RMI1 to resolve DNA replication and recombination intermediates. BLM, human topoisomerase IIIalpha, and RMI1 catalyze the dissolution of double Holliday junctions into noncrossover products via a strand...

  20. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik

    1992-04-01

    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  1. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.

    1985-01-01

    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  2. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  3. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  4. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-05

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity*

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.

    2015-01-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  6. Substrate-assisted 2D DNA lattices and algorithmic lattices from single-stranded tiles.

    Science.gov (United States)

    Kim, Junghoon; Ha, Tai Hwan; Park, Sung Ha

    2015-08-07

    We present a simple route to circumvent kinetic traps which affect many types of DNA nanostructures in their self-assembly process. Using this method, a new 2D DNA lattice made up of short, single-stranded tile (SST) motifs was created. Previously, the growth of SST DNA assemblies was restricted to 1D (tubes and ribbons) or finite-sized 2D (molecular canvases). By utilizing the substrate-assisted growth method, sets of SSTs were designed as unit cells to self-assemble into periodic and aperiodic 2D lattices which continuously grow both along and orthogonal to the helical axis. Notably, large-scale (∼1 μm(2)) fully periodic 2D lattices were fabricated using a minimum of just 2 strand species. Furthermore, the ability to create 2D lattices from a few motifs enables certain rules to be encoded into these SSTs to carry out algorithmic self-assembly. A set of these motifs was designed to execute simple 1-input 1-output COPY and NOT algorithms, the space-time manifestations which were aperiodic 2D algorithmic SST lattices. The methodology presented here can be straightforwardly applied to other motifs which fall into this type of kinetic trap to create novel DNA crystals.

  7. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.

    2007-01-01

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  8. Effect of Conformational Entropy on the Nanomechanics of Microcantilever-Based Single-Stranded DNA Sensors

    Directory of Open Access Journals (Sweden)

    Zou-Qing Tan

    2014-09-01

    Full Text Available An entropy-controlled bending mechanism is presented to study the nanomechanics of microcantilever-based single-stranded DNA (ssDNA sensors. First; the conformational free energy of the ssDNA layer is given with an improved scaling theory of thermal blobs considering the curvature effect; and the mechanical energy of the non-biological layer is described by Zhang’s two-variable method for laminated beams. Then; an analytical model for static deflections of ssDNA microcantilevers is formulated by the principle of minimum energy. The comparisons of deflections predicted by the proposed model; Utz–Begley’s model and Hagan’s model are also examined. Numerical results show that the conformational entropy effect on microcantilever deflections cannot be ignored; especially at the conditions of high packing density or long chain systems; and the variation of deflection predicted by the proposed analytical model not only accords with that observed in the related experiments qualitatively; but also appears quantitatively closer to the experimental values than that by the preexisting models. In order to improve the sensitivity of static-mode biosensors; it should be as small as possible to reduce the substrate stiffness.

  9. In vitro selection and characterization of single stranded DNA aptamers for luteolin: A possible recognition tool.

    Science.gov (United States)

    Tuma Sabah, Jinan; Zulkifli, Razauden Mohamed; Shahir, Shafinaz; Ahmed, Farediah; Abdul Kadir, Mohammed Rafiq; Zakaria, Zarita

    2018-03-06

    Distinctive bioactivities possessed by luteolin (3', 4', 5, 7-tetrahydroxy-flavone) are advantageous for sundry practical applications. This paper reports the in vitro selection and characterization of single stranded-DNA (ssDNA) aptamers, specific for luteolin (LUT). 76-mer library containing 1015 randomized ssDNA were screened via systematic evolution of ligands by exponential enrichment (SELEX). The recovered ssDNA pool from the 8th round was amplified with unlabeled primers and cloned into PSTBlue-1 vector prior to sequencing. 22 of LUT-binding aptamer variants were further classified into one of the seven groups based on their N40 random sequence regions, wherein one representative from each group was characterized. The dissociation constant of aptamers designated as LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively with high binding affinity towards LUT. Prediction analysis of the secondary structure suggested discrete features with typical loop and stem motifs. Furthermore, LUT#3 displayed higher specificity with insignificant binding toward kaempferol and quercetin despite its structural and functional similarity compared to LUT#28 and LUT#20. Further LUT#3 can detect free luteolin within 0.2-1 mM in solution. It was suggested that LUT#3 aptamer were the most suitable for LUT recognition tool at laboratory scale based on the condition tested. Copyright © 2018. Published by Elsevier Inc.

  10. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles.

    Science.gov (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng

    2015-11-21

    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  11. Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems.

    Science.gov (United States)

    Musumeci, Domenica; Rozza, Lucia; Merlino, Antonello; Paduano, Luigi; Marzo, Tiziano; Massai, Lara; Messori, Luigi; Montesarchio, Daniela

    2015-08-21

    The interaction of the anticancer Ru(iii) complex AziRu - in comparison with its analogue NAMI-A, currently in advanced clinical trials as an antimetastatic agent - with DNA model systems, both single stranded and duplex oligonucleotides, was investigated using a combined approach, including absorption UV-vis spectroscopy, circular dichroism (CD) and electrospray mass spectrometry (ESI-MS) techniques. UV-vis absorption spectra of the Ru complexes were recorded at different times in a pseudo-physiological solution, to monitor the ligand exchange processes in the absence and in the presence of the examined oligonucleotides. CD experiments provided information on the overall conformational changes of the DNA model systems induced by these metal complexes. UV- and CD-monitored thermal denaturation studies were performed to analyse the effects of AziRu and NAMI-A on the stability of the duplex structures. ESI-MS experiments, carried out on the oligonucleotide/metal complex mixtures under investigation, allowed us to detect the formation of stable adducts between the guanine-containing oligomers and the ruthenium complexes. These data unambiguously demonstrate that both AziRu and NAMI-A can interact with the DNA model systems. Although very similar in their structures, the two metal compounds manifest a markedly different reactivity with the examined sequences, respectively, with either a naked Ru(3+) ion or a Ru(Im)(3+) (Im = imidazole) fragment being incorporated into the oligonucleotide structure via stable linkages.

  12. Distinct circular single-stranded DNA viruses exist in different soil types.

    Science.gov (United States)

    Reavy, Brian; Swanson, Maud M; Cock, Peter J A; Dawson, Lorna; Freitag, Thomas E; Singh, Brajesh K; Torrance, Lesley; Mushegian, Arcady R; Taliansky, Michael

    2015-06-15

    The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  13. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.

    2013-01-01

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  14. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA.

    Science.gov (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi

    2008-03-28

    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  15. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Complex shapes self-assembled from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng

    2012-05-30

    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  17. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.

    1977-01-01

    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  18. Electrical conduction and photoresponses of gamma-ray-irradiated single-stranded DNA/single-walled carbon nanotube composite systems

    Energy Technology Data Exchange (ETDEWEB)

    Hong, W.; Lee, E.M.; Kim, D.W.; Lee, Cheol Eui, E-mail: rscel@korea.ac.kr

    2015-04-15

    Highlights: •Effects of gamma-ray irradiation on single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. •Barrier for thermally activated conduction in the composite systems modified by the gamma-ray irradiation. •Photoresponses reveal photoexcitation and oxygen photodesorption modified by gamma-ray irradiation. -- Abstract: Effects of gamma-ray irradiation on the electrical conductivity and photoresponse have been studied for single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. The temperature-dependent electrical conductivity of the ssDNA/SWNT composite films, well described by a fluctuation-induced tunneling model, indicated modification of the barrier for thermally activated conduction by the gamma-ray irradiation. Besides, the photoresponse measurements indicated modified photoexcited charge carrier generation and oxygen photodesorption in the composite systems due to the gamma-ray irradiation.

  19. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.

    2006-01-01

    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  20. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair

    Science.gov (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.

    2009-01-01

    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  1. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids.

    Science.gov (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R

    2015-04-08

    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  2. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.

    1995-01-01

    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  3. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia

    2009-01-01

    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  4. On-site detection of Phytophthora spp.—single-stranded target DNA as the limiting factor to improve on-chip hybridization

    International Nuclear Information System (INIS)

    Schwenkbier, Lydia; Pollok, Sibyll; Popp, Jürgen; Weber, Karina; König, Stephan; Wagner, Stefan; Werres, Sabine; Weber, Jörg; Hentschel, Martin

    2014-01-01

    We report on a lab-on-a-chip approach for on-site detection of Phytophthora species that allows visual signal readout. The results demonstrate the significance of single-stranded DNA (ssDNA) generation in terms of improving the intensity of the hybridization signal and to improve the reliability of the method. Conventional PCR with subsequent heat denaturation, sodium hydroxide-based denaturation, lambda exonuclease digestion and two asymmetric PCR methods were investigated for the species P. fragariae, P. kernoviae, and P. ramorum. The positioning of the capture probe within the amplified yeast GTP-binding protein (YPT1) target DNA was also of interest because it significantly influences the intensity of the signal. Statistical tests were used to validate the impact of the ssDNA generation methods and the capture-target probe position. The single-stranded target DNA generated by Linear-After-The-Exponential PCR (LATE-PCR) was found to produce signal intensities comparable to post-PCR exonuclease treatment. The LATE-PCR is the best method for the on-site detection of Phytophthora because the enzymatic digestion after PCR is more laborious and time-consuming. (author)

  5. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  6. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  7. Functional analysis of multiple single-stranded DNA-binding proteins from Methanosarcina acetivorans and their effects on DNA synthesis by DNA polymerase BI.

    Science.gov (United States)

    Robbins, Justin B; Murphy, Mary C; White, Bryan A; Mackie, Roderick I; Ha, Taekjip; Cann, Isaac K O

    2004-02-20

    Single-stranded DNA-binding proteins and their functional homologs, replication protein A, are essential components of cellular DNA replication, repair and recombination. We describe here the isolation and characterization of multiple replication protein A homologs, RPA1, RPA2, and RPA3, from the archaeon Methanosarcina acetivorans. RPA1 comprises four single-stranded DNA-binding domains, while RPA2 and RPA3 are each composed of two such domains and a zinc finger domain. Gel filtration analysis suggested that RPA1 exists as homotetramers and homodimers in solution, while RPA2 and RPA3 form only homodimers. Unlike the multiple RPA proteins found in other Archaea and eukaryotes, each of the M. acetivorans RPAs can act as a distinct single-stranded DNA-binding protein. Fluorescence resonance energy transfer and fluorescence polarization anisotropy studies revealed that the M. acetivorans RPAs bind to as few as 10 single-stranded DNA bases. However, more stable binding is achieved with single-stranded DNA of 18-23 bases, and for such substrates the estimated Kd was 3.82 +/- 0.28 nM, 173.6 +/- 105.17 nM, and 5.92 +/- 0.23 nM, for RPA1, RPA2, and RPA3, respectively. The architectures of the M. acetivorans RPAs are different from those of hitherto reported homologs. Thus, these proteins may represent novel forms of replication protein A. Most importantly, our results show that the three RPAs and their combinations highly stimulate the primer extension capacity of M. acetivorans DNA polymerase BI. Although bacterial SSB and eukaryotic RPA have been shown to stimulate DNA synthesis by their cognate DNA polymerases, our findings provide the first in vitro biochemical evidence for the conservation of this property in an archaeon.

  8. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide

    Science.gov (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio

    1998-01-01

    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  9. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  10. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  11. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  12. The Adsorption of Short Single-Stranded DNA Oligomers on Mineral Surfaces

    Science.gov (United States)

    Kopstein, M.; Sverjensky, D. A.; Hazen, R. M.; Cleaves, H. J.

    2009-12-01

    Previous studies have described feasible pathways for the synthesis of simple organic building blocks such as formaldehyde and hydrogen cyanide, and their reaction to form more complex biomolecules such as nucleotide bases, amino acids and sugars (Miller and Orgel 1974, Miller and Cleaves 2006). However, the polymerization of monomers into a useful genetic material remains problematic (Orgel 2004). Organic building blocks were unlikely to polymerize from very dilute aqueous solution in the primitive oceans. Mineral surface adsorption has been suggested as a possible mechanism for concentrating the necessary building blocks (Bernal 1951). This study focused on the adsorption behavior of single-stranded DNA homo-oligomers of adenine and thymine (including the monomers, dimers, tetramers, hexamers, octomers, and decamers) with five different mineral surfaces (pyrite, rutile, hematite, olivine and calcite). Adsorption was studied in 0.1 M pH 8.1 KHCO3 with0.05 M NaCl as background electrolyte. Solutions were mixed for 24 hours at room temperature, centrifuged and the supernatants analyzed by UV/visible spectrophotometry. Equilibrium solution concentrations were measured and used to determine the number of moles adsorbed per square meter. Langmuir isotherms were constructed using the experimental data. It was found that adenine-containing molecules tend to bind much more strongly than thymine-containing molecules. It was also found that the number of moles adsorbed at saturation tends to fall with increasing chain length, while adsorption affinity tends to rise. Oligomer length appears to affect adsorption more than the mineral type. These results may have implications for the primordial organization of the first nucleic acid molecules as the persistence of extra-cellular nucleic acids in the environment. References Bernal, J. D. (1951) The Physical Basis of Life (Routledge, London). Miller S.L. and Cleaves, H.J. (2006) Prebiotic chemistry on the primitive Earth. In

  13. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris

    2016-01-01

    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA-binding pro......Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...... leads to enhanced cooperative binding to DNA.Conclusions: Our findings contribute to the emerging picture that bacterial proteins, exemplified here by SsbA, undergo phosphorylation at multiple residues. This results in a complex regulation of cellular functions, and suggests that the complexity...

  14. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold.

    Science.gov (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G

    2005-05-24

    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  15. Localization of specific sequences and DNA single-strand breaks in individual UV-A-irradiated human lymphocytes by COMET FISH

    Science.gov (United States)

    Bock, Claudia; Rapp, Alexander; Dittmar, Heike; Monajembashi, Shamci; Greulich, Karl-Otto

    1999-01-01

    The COMET assay, a single cell electrophoresis technique which allows to separate electrophoretically fractionated DNA according to size has been combined with fluorescence in situ hybridization (FISH) which allows to localize specific genes or gene regions. This combination (COMET FISH) allows the detection of DNA single strand breaks in specific regions of the genome of human lymphocytes at the single cell level. Various types of DNA probes, e.g. centromere-, (alpha) - satellite-, telomere-, whole chromosome-, single copy- and region specific DNA probes have been used to investigate whether the UV-A induced DNA single strand breaks are distributed randomly all over the human genome or induced at specific sites ('hot spots'). In the investigated human peripheral blood lymphocytes all but one centromere reveal low sensitivity for UV-A irradiation (500 kJ/m2), while telomeres are randomly distributed over COMET heads and tails. The human chromosome 1 is fractionated by irradiation, but remains in the COMET head, indicating an only moderate degree of fractionation. Among three tested single copy probes, c- myc, p53 and p58, the p53 gene located on chromosome 17p13.1 and the p58 gene (1p36) appear to be located in UV-A stable regions of the human genome in 95% of 65 investigated lymphocytes. In contrast, the c-myc proto-oncogene (8q24) is found in the COMET tail in 90% of the 27 investigated lymphocytes and thus appears to be more sensitive to UV-A irradiation.

  16. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity.

    Science.gov (United States)

    Monnet, Jordan; Kozelka, Jiří

    2012-10-01

    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  18. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB).

    Science.gov (United States)

    van Loon, Barbara; Samson, Leona D

    2013-03-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  19. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.

    2006-01-01

    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  20. Surface treatment on amorphous InGaZnO4 thin film for single-stranded DNA biosensing

    Science.gov (United States)

    Sun, Dali; Matsui, Hiroaki; Wu, Chun-Nan; Tabata, Hitoshi

    2015-01-01

    Amorphous InGaZnO4 (aIGZO) has been widely used as a transparent semiconductor. However, no research has been found yet applying aIGZO to biosensing. This paper examined the single strand DNA (ssDNA) immobilization on aIGZO by absorption with a comparison to ITO, which is the first step for many biosensing schemas. The DNA quantification by florescence intensity shows that the absorption capacity of aIGZO film to ssDNA is 6.7 times greater than that of ITO. XPS and contact angle analysis proved the high DNA absorption affinity on aIGZO film is related to its high effectiveness to OH- attachment. A feasible method to immobilized ssDNA on aIGZO thin film is evaluated in this paper, and consequently, enables a possible approach to apply aIGZO in biosensing.

  1. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.

    1978-01-01

    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  2. Highly stable triple helix formation by homopyrimidine (l)-acyclic threoninol nucleic acids with single stranded DNA and RNA

    DEFF Research Database (Denmark)

    Kumar, Vipin; Kesavan, Venkitasamy; Gothelf, Kurt Vesterager

    2015-01-01

    Acyclic (l)-threoninol nucleic acid (aTNA) containing thymine, cytosine and adenine nucleobases were synthesized and shown to form surprisingly stable triplexes with complementary single stranded homopurine DNA or RNA targets. The triplex structures consist of two (l)-aTNA strands and one DNA...... or RNA, and these triplexes are significantly stronger than the corresponding DNA or RNA duplexes as shown in competition experiments. As a unique property the (l)-aTNAs exclusively form triplex structures with DNA and RNA and no duplex structures are observed by gel electrophoresis. The results were...... compared to the known enantiomer (d)-aTNA, which forms much weaker triplexes depending upon temperature and time. It was demonstrated that (l)-aTNA triplexes are able to stop primer extension on a DNA template, showing the potential of (l)-aTNA for antisense applications....

  3. Quenching of Single-Walled Carbon Nanotube Fluorescence by Dissolved Oxygen Reveals Selective Single-Stranded DNA Affinities.

    Science.gov (United States)

    Zheng, Yu; Bachilo, Sergei M; Weisman, R Bruce

    2017-05-04

    The selective interactions between short oligomers of single-stranded DNA (ssDNA) and specific structures of single-walled carbon nanotubes have been exploited in powerful methods for nanotube sorting. We report here that nanotubes coated with ssDNA also display selective interactions through the selective quenching of nanotube fluorescence by dissolved oxygen. In aqueous solutions equilibrated under 1 atm of O 2 , emission intensity from semiconducting nanotubes is reduced by between 9 and 40%, varying with the combination of ssDNA sequence and nanotube structure. This quenching reverses promptly and completely on the removal of dissolved O 2 and may be due to physisorption on nanotube surfaces. Fluorescence quenching offers a simple, nondestructive approach for studying the structure-selective interactions of ssDNA with single-walled carbon nanotubes and identifying recognition sequences.

  4. Characterization of the single-stranded DNA binding protein pV(VGJΦ) of VGJΦ phage from Vibrio cholerae.

    Science.gov (United States)

    Falero, Alina; Caballero, Andy; Trigueros, Sonia; Pérez, Celso; Campos, Javier; Marrero, Karen; Fando, Rafael

    2011-09-01

    pV(VGJΦ), a single-stranded DNA binding protein of the vibriophage VGJΦ was subject to biochemical analysis. Here, we show that this protein has a general affinity for single-stranded DNA (ssDNA) as documented by Electrophoretic Mobility Shift Assay (EMSA). The apparent molecular weight of the monomer is about 12.7kDa as measured by HPLC-SEC. Moreover, isoelectrofocusing showed an isoelectric point for pV(VGJΦ) of 6.82 pH units. Size exclusion chromatography in 150mM NaCl, 50mM sodium phosphate buffer, pH 7.0 revealed a major protein species of 27.0kDa, suggesting homodimeric protein architecture. Furthermore, pV(VGJΦ) binds ssDNA at extreme temperatures and the complex was stable after extended incubation times. Upon frozen storage at -20°C for a year the protein retained its integrity, biological activity and oligomericity. On the other hand, bioinformatics analysis predicted that pV(VGJΦ) protein has a disordered C-terminal, which might be involved in its functional activity. All the aforementioned features make pV(VGJΦ) interesting for biotechnological applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail: meicun2006@163.com; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

    2016-12-01

    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  6. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.

    1994-01-01

    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  7. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler

    2007-12-01

    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  8. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples.

    Science.gov (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J

    2006-03-01

    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  9. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

    1982-01-01

    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  10. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  11. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample.

    Science.gov (United States)

    Cui, Lunbiao; Wu, Binyao; Zhu, Xiaojuan; Guo, Xiling; Ge, Yiyue; Zhao, Kangchen; Qi, Xian; Shi, Zhiyang; Zhu, Fengcai; Sun, Lixin; Zhou, Minghao

    2017-11-01

    Metagenomic analysis through high-throughput sequencing is a tool for detecting both known and novel viruses. Using this technique, a novel circular single-stranded DNA (ssDNA) virus genome was discovered in respiratory secretions from a febrile traveler. The virus, named human respiratory-associated PSCV-5-like virus (HRAPLV), has a genome comprising 3,018 bases, with two major putative ORFs inversely encoding capsid (Cap) and replicase (Rep) protein and separated by two intergenic regions. One stem-loop structure was predicted in the larger intergenic region (LIR). The predicted amino acid sequences of the Cap and Rep proteins of HRAPLV showed highest identity to those of porcine stool-associated circular virus 5 isolate CP3 (PoSCV 5) (53.0% and 48.9%, respectively). The host tropism of the virus is unknown, and further study is warranted to determine whether this novel virus is associated with human disease.

  12. Integrative modelling coupled with ion mobility mass spectrometry reveals structural features of the clamp loader in complex with single-stranded DNA binding protein.

    Science.gov (United States)

    Politis, Argyris; Park, Ah Young; Hall, Zoe; Ruotolo, Brandon T; Robinson, Carol V

    2013-11-29

    DNA polymerase III, a decameric 420-kDa assembly, simultaneously replicates both strands of the chromosome in Escherichia coli. A subassembly of this holoenzyme, the seven-subunit clamp loader complex, is responsible for loading the sliding clamp (β2) onto DNA. Here, we use structural information derived from ion mobility mass spectrometry (IM-MS) to build three-dimensional models of one form of the full clamp loader complex, γ3δδ'ψχ (254 kDa). By probing the interaction between the clamp loader and a single-stranded DNA (ssDNA) binding protein (SSB4) and by identifying two distinct conformational states, with and without ssDNA, we assemble models of ψχ-SSB4 (108 kDa) and the clamp loader-SSB4 (340 kDa) consistent with IM data. A significant increase in measured collision cross-section (~10%) of the clamp loader-SSB4 complex upon DNA binding suggests large conformational rearrangements. This DNA bound conformation represents the active state and, along with the presence of ψχ, stabilises the clamp loader-SSB4 complex. Overall, this study of a large heteromeric complex analysed by IM-MS, coupled with integrative modelling, highlights the potential of such an approach to reveal structural features of previously unknown complexes of high biological importance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  14. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  15. Slowing single-stranded DNA translocation through a solid-state nanopore by decreasing the nanopore diameter.

    Science.gov (United States)

    Akahori, Rena; Haga, Takanobu; Hatano, Toshiyuki; Yanagi, Itaru; Ohura, Takeshi; Hamamura, Hirotaka; Iwasaki, Tomio; Yokoi, Takahide; Anazawa, Takashi

    2014-07-11

    To slow the translocation of single-stranded DNA (ssDNA) through a solid-state nanopore, a nanopore was narrowed, and the effect of the narrowing on the DNA translocation speed was investigated. In order to accurately measure the speed, long (5.3 kb) ssDNA (namely, ss-poly(dA)) with uniform length (±0.4 kb) was synthesized. The diameters of nanopores fabricated by a transmission electron microscope were controlled by atomic-layer deposition. Reducing the nanopore diameter from 4.5 to 2.3 nm slowed down the translocation of ssDNA by more than 16 times (to 0.18 μs base(-1)) when 300 mV was applied across the nanopore. It is speculated that the interaction between the nanopore and the ssDNA dominates the translocation speed. Unexpectedly, the translocation speed of ssDNA through the 4.5 nm nanopore is more than two orders of magnitude higher than that of double-stranded DNA (dsDNA) through a nanopore of almost the same size. The cause of such a faster translocation of ssDNA can be explained by the weaker drag force inside the nanopore. Moreover, the measured translocation speeds of ssDNA and dsDNA agree well with those calculated by molecular-dynamics (MD) simulation. The MD simulation predicted that reducing the nanopore diameter to almost the same as that of ssDNA (i.e. 1.4 nm) decreases the translocation speed (to 1.4 μs base(-1)). Narrowing the nanopore is thus an effective approach for accomplishing nanopore DNA sequencing.

  16. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii.

    Science.gov (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten

    2012-01-01

    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  17. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana.

    Science.gov (United States)

    Olszewski, Marcin; Grot, Anna; Wojciechowski, Marek; Nowak, Marta; Mickiewicz, Małgorzata; Kur, Józef

    2010-10-15

    In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. We report the characterization of single-stranded DNA binding proteins (SSBs) from the thermophilic bacteria Thermotoga maritima (TmaSSB) and Thermotoga neapolitana (TneSSB). They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively). They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold) in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC) the melting temperature (Tm) was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR).

  18. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata

    2010-10-01

    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  19. Escherichia coli Single-Stranded DNA-Binding Protein: NanoESI-MS Studies of Salt-Modulated Subunit Exchange and DNA Binding Transactions

    Science.gov (United States)

    Mason, Claire E.; Jergic, Slobodan; Lo, Allen T. Y.; Wang, Yao; Dixon, Nicholas E.; Beck, Jennifer L.

    2013-02-01

    Single-stranded DNA-binding proteins (SSBs) are ubiquitous oligomeric proteins that bind with very high affinity to single-stranded DNA and have a variety of essential roles in DNA metabolism. Nanoelectrospray ionization mass spectrometry (nanoESI-MS) was used to monitor subunit exchange in full-length and truncated forms of the homotetrameric SSB from Escherichia coli. Subunit exchange in the native protein was found to occur slowly over a period of hours, but was significantly more rapid in a truncated variant of SSB from which the eight C-terminal residues were deleted. This effect is proposed to result from C-terminus mediated stabilization of the SSB tetramer, in which the C-termini interact with the DNA-binding cores of adjacent subunits. NanoESI-MS was also used to examine DNA binding to the SSB tetramer. Binding of single-stranded oligonucleotides [one molecule of (dT)70, one molecule of (dT)35, or two molecules of (dT)35] was found to prevent SSB subunit exchange. Transfer of SSB tetramers between discrete oligonucleotides was also observed and is consistent with predictions from solution-phase studies, suggesting that SSB-DNA complexes can be reliably analyzed by ESI mass spectrometry.

  20. Identification and characterization of single-stranded DNA-binding protein from the facultative psychrophilic bacteria Pseudoalteromonas haloplanktis.

    Science.gov (United States)

    Olszewski, Marcin; Nowak, Marta; Cyranka-Czaja, Anna; Kur, Józef

    2014-01-01

    Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism such as DNA replication, repair, and recombination, and is essential for cell survival. This study reports on the ssb-like gene cloning, gene expression and characterization of a single-stranded DNA-binding protein of Pseudoalteromonas haloplanktis (PhaSSB) and is the first report of such a protein from psychrophilic microorganism. PhaSSB possesses a high sequence similarity to Escherichia coli SSB (48% identity and 57% similarity) and has the longest amino acid sequence (244 amino acid residues) of all the known bacterial SSBs with one OB-fold per monomer. An analysis of purified PhaSSB by means of chemical cross-linking experiments, sedimentation analysis and size exclusion chromatography revealed a stable tetramer in solution. Using EMSA, we characterized the stoichiometry of PhaSSB complexed with a series of ssDNA homopolymers, and the size of the binding site was determined as being approximately 35 nucleotides long. In fluorescence titrations, the occluded site size of PhaSSB on poly(dT) is 34 nucleotides per tetramer under low-salt conditions (2mM NaCl), but increases to 54-64 nucleotides at higher-salt conditions (100-300mM NaCl). This suggests that PhaSSB undergoes a transition between ssDNA binding modes, which is observed for EcoSSB. The binding properties of PhaSSB investigated using SPR technology revealed that the affinity of PhaSSB to ssDNA is typical of SSB proteins. The only difference in the binding mode of PhaSSB to ssDNA is a faster association phase, when compared to EcoSSB, though compensated by faster dissociation rate. When analyzed by differential scanning calorimetry (DSC), the melting temperature (Tm) was determined as 63 °C, which is only a few degrees lower than for EcoSSB. Copyright © 2013 Elsevier GmbH. All rights reserved.

  1. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA.

    Science.gov (United States)

    Rogers, Cody M; Bochman, Matthew L

    2017-05-13

    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der

    1978-01-01

    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  3. RADX interacts with single-stranded DNA to promote replication fork stability

    DEFF Research Database (Denmark)

    Schubert, Lisa; Ho, Teresa; Hoffmann, Saskia

    2017-01-01

    has an essential genome maintenance role, protecting ssDNA regions from nucleolytic degradation and providing a recruitment platform for proteins involved in responses to replication stress and DNA damage. Here, we identify the uncharacterized protein RADX (CXorf57) as an ssDNA-binding factor in human...... cells. RADX binds ssDNA via an N-terminal OB fold cluster, which mediates its recruitment to sites of replication stress. Deregulation of RADX expression and ssDNA binding leads to enhanced replication fork stalling and degradation, and we provide evidence that a balanced interplay between RADX and RPA...

  4. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  5. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA.

    Science.gov (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee

    2011-03-24

    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  6. Detection of short single-strand DNA homopolymers with ultrathin Si3N4 nanopores.

    Science.gov (United States)

    Ma, Jian; Qiu, Yinghua; Yuan, Zhishan; Zhang, Yin; Sha, Jingjie; Liu, Lei; Sun, Litao; Ni, Zhonghua; Yi, Hong; Li, Deyu; Chen, Yunfei

    2015-08-01

    A series of nanopores with diameters ranging from 2.5 to 63 nm are fabricated on a reduced Si3N4 membrane by focused ion beam and high energy electron beam. Through measuring the blocked ionic currents for DNA strands threading linearly through those solid-state nanopores, it is found that the blockade ionic current is proportional to the square of the hydrodynamic diameter of the DNA strand. With the nanopore diameter reduced to be comparable with that of DNA strands, the hydrodynamic diameter of the DNA becomes smaller, which is attributed to the size confinement effects. The duration time for the linear DNA translocation events increases monotonically with the nanopore length. By comparing the spatial configurations of DNA strands through nanopores with different diameters, it is found that the nanopore with large diameter has enough space to allow the DNA strand to translocate through with complex conformation. With the decrease of the nanopore diameter, the folded part of the DNA is prone to be straightened by the nanopore, which leads to the increase in the occurrence frequency of the linear DNA translocation events. Reducing the diameter of the nanopore to 2.5 nm allows the detection and discrimination of three nucleotide "G" and three nucleotide "T" homopolymer DNA strands based on differences in their physical dimensions.

  7. Evidence that single-stranded DNA breaks are a normal feature of koala sperm chromatin, while double-stranded DNA breaks are indicative of DNA damage.

    Science.gov (United States)

    Zee, Yeng Peng; López-Fernández, Carmen; Arroyo, F; Johnston, Stephen D; Holt, William V; Gosalvez, Jaime

    2009-08-01

    In this study, we have used single and double comet assays to differentiate between single- and double-stranded DNA damage in an effort to refine the interpretation of DNA damage in mature koala spermatozoa. We have also investigated the likelihood that single-stranded DNA breakage is part of the natural spermiogenic process in koalas, where its function would be the generation of structural bends in the DNA molecule so that appropriate packaging and compaction can occur. Koala spermatozoa were examined using the sperm chromatin dispersion test (SCDt) and comet assays to investigate non-orthodox double-stranded DNA. Comet assays were conducted under 1) neutral conditions; and 2) neutral followed by alkaline conditions (double comet assay); the latter technique enabled simultaneous visualisation of both single-stranded and double-stranded DNA breaks. Following the SCDt, there was a continuum of nuclear morphotypes, ranging from no apparent DNA fragmentation to those with highly dispersed and degraded chromatin. Dispersion morphotypes were mirrored by a similar diversity of comet morphologies that could be further differentiated using the double comet assay. The majority of koala spermatozoa had nuclei with DNA abasic-like residues that produced single-tailed comets following the double comet assay. The ubiquity of these residues suggests that constitutive alkali-labile sites are part of the structural configuration of the koala sperm nucleus. Spermatozoa with 'true' DNA fragmentation exhibited a continuum of comet morphologies, ranging from a more severe form of alkaline-susceptible DNA with a diffuse single tail to nuclei that exhibited both single- and double-stranded breaks with two comet tails.

  8. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.

    1989-01-01

    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  9. Charge enhancement of single-stranded DNA in negative electrospray ionization using the supercharging reagent meta-nitrobenzyl alcohol.

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1% m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1% m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  10. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  11. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)

    2015-04-22

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  12. Double-stranded DNA dissociates into single strands when dragged into a poor solvent.

    Science.gov (United States)

    Cui, Shuxun; Yu, Jin; Kühner, Ferdinand; Schulten, Klaus; Gaub, Hermann E

    2007-11-28

    DNA displays a richness of biologically relevant supramolecular structures, which depend on both sequence and ambient conditions. The effect of dragging double-stranded DNA (dsDNA) from water into poor solvent on the double-stranded structure is still unclear because of condensation. Here, we employed single molecule techniques based on atomic force microscopy and molecular dynamics (MD) simulations to investigate the change in structure and mechanics of DNA during the ambient change. We found that the two strands are split apart when the dsDNA is pulled at one strand from water into a poor solvent. The findings were corroborated by MD simulations where dsDNA was dragged from water into poor solvent, revealing details of the strand separation at the water/poor solvent interface. Because the structure of DNA is of high polarity, all poor solvents show a relatively low polarity. We speculate that the principle of spontaneous unwinding/splitting of dsDNA by providing a low-polarity (in other word, hydrophobic) micro-environment is exploited as one of the catalysis mechanisms of helicases.

  13. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-01

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  14. Comment on "Monomer Dynamics in Double- and Single-Stranded DNA Polymers"

    OpenAIRE

    Tothova, J.; Brutovsky, B.; Lisy, V.

    2005-01-01

    It is discussed that the kinetics observed by Shusterman et al. [Phys. Rev. Lett. 92, 048303] for long dsDNA is not the Rouse one and, in fact, the macromolecule behaves (approximately) as the Zimm polymer.

  15. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin.

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-13

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecule, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G • U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G • U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  16. Determination of nanogram quantities of osmium-labeled single stranded DNA by differential pulse stripping voltammetry

    Czech Academy of Sciences Publication Activity Database

    Kizek, René; Havran, Luděk; Fojta, Miroslav; Paleček, Emil

    2002-01-01

    Roč. 55, 1/2 (2002), s. 199-121 ISSN 1567-5394 R&D Projects: GA ČR GV204/97/K084; GA ČR GA204/00/D049; GA AV ČR IAA4004108 Institutional research plan: CEZ:AV0Z5004920 Keywords : differential pulse stripping voltammetry * microdetermination of DNA * chemical modification of DNA Subject RIV: BO - Biophysics Impact factor: 1.463, year: 2002

  17. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-04-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  18. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-02-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  19. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)

    2012-04-04

    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  20. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.

    1985-01-01

    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  1. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage

    Science.gov (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio

    1998-01-01

    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  2. Electric light scattering from single-stranded DNA in linear polyacrylamide solutions.

    Science.gov (United States)

    Todorov, R; Starchev, K; Stoylov, S P

    2001-01-01

    The electric light scattering (ELS) of ssDNA (calf thymus, 10 kbp, 55 micrograms/mL) in denaturing polyacrylamide (PAA) solutions was studied as a function of applied sinusoidal electric field and polymer concentration. Electric fields of strengths up to 300 V/cm and of frequencies between 100 and 5000 Hz were applied. It was found that the ELS effect increases with the field strength and decreases at high frequencies. The dependence of the ELS effect of ssDNA on polymer concentration passes through a maximum at 1% PAA. The relaxation times of decay of the ELS effect increase with increasing polymer concentrations. It was demonstrated that ELS is a useful method for investigation of ssDNA behavior in the course of pulse-field electrophoresis in polymer solutions.

  3. Expansion during PCR of short single-stranded DNA fragments carrying nonselfcomplementary dinucleotide or trinucleotide repeats

    Czech Academy of Sciences Publication Activity Database

    Reichová, Naďa; Kypr, Jaroslav

    2003-01-01

    Roč. 30, č. 3 (2003), s. 155-163 ISSN 0301-4851 R&D Projects: GA ČR GA301/01/0590 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA * PCR * expansion Subject RIV: BO - Biophysics Impact factor: 0.565, year: 2003

  4. Oligo(dT) is not a correct native PAGE marker for single-stranded DNA

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Kypr, Jaroslav; Vorlíčková, Michaela

    2007-01-01

    Roč. 353, č. 3 (2007), s. 776-779 ISSN 0006-291X R&D Projects: GA AV ČR(CZ) IAA4004201; GA AV ČR(CZ) IAA1004201 Institutional research plan: CEZ:AV0Z50040702 Keywords : polyacrylamide gel electrophoresis * DNA length markers * oligo(dT) Subject RIV: BO - Biophysics Impact factor: 2.749, year: 2007

  5. Differentiation of Short Single-Stranded DNA Homopolymers in Solid-State Nanopores

    Science.gov (United States)

    Venta, Kimberly; Shemer, Gabriel; Puster, Matthew; Rodríguez-Manzo, Julio A.; Balan, Adrian; Rosenstein, Jacob K.; Shepard, Ken; Drndić, Marija

    2013-01-01

    In the last two decades, new techniques that monitor ionic current modulations as single molecules pass through a nanoscale pore have enabled numerous single-molecule studies. While biological nanopores have recently shown the ability to resolve single nucleotides within individual DNA molecules, similar developments with solid-state nanopores have lagged, due to challenges both in fabricating stable nanopores of similar dimensions as biological nanopores and in achieving sufficiently low-noise and high-bandwidth recordings. Here we show that small silicon nitride nanopores (0.8 to 2-nm-diameter in 5 to 8-nm-thick membranes) can resolve differences between ionic current signals produced by short (30 base) ssDNA homopolymers (poly(dA), poly(dC), poly(dT)), when combined with measurement electronics that allow a signal-to-noise ratio of better than 10 to be achieved at 1 MHz bandwidth. While identifying intramolecular DNA sequences with silicon nitride nanopores will require further improvements in nanopore sensitivity and noise levels, homopolymer differentiation represents an important milestone in the development of solid-state nanopores. PMID:23621759

  6. Theoretical Study of the Transpore Velocity Control of Single-Stranded DNA

    Directory of Open Access Journals (Sweden)

    Weixin Qian

    2014-08-01

    Full Text Available The electrokinetic transport dynamics of deoxyribonucleic acid (DNA molecules have recently attracted significant attention in various fields of research. Our group is interested in the detailed examination of the behavior of DNA when confined in micro/nanofluidic channels. In the present study, the translocation mechanism of a DNA-like polymer chain in a nanofluidic channel was investigated using Langevin dynamics simulations. A coarse-grained bead-spring model was developed to simulate the dynamics of a long polymer chain passing through a rectangular cross-section nanopore embedded in a nanochannel, under the influence of a nonuniform electric field. Varying the cross-sectional area of the nanopore was found to allow optimization of the translocation process through modification of the electric field in the flow channel, since a drastic drop in the electric potential at the nanopore was induced by changing the cross-section. Furthermore, the configuration of the polymer chain in the nanopore was observed to determine its translocation velocity. The competition between the strength of the electric field and confinement in the small pore produces various transport mechanisms and the results of this study thus represent a means of optimizing the design of nanofluidic devices for single molecule detection.

  7. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.

    1982-01-01

    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  8. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    Science.gov (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Genomic analysis of Pseudomonas putida phage tf with localized single-strand DNA interruptions.

    Directory of Open Access Journals (Sweden)

    Anatoly S Glukhov

    Full Text Available The complete sequence of the 46,267 bp genome of the lytic bacteriophage tf specific to Pseudomonas putida PpG1 has been determined. The phage genome has two sets of convergently transcribed genes and 186 bp long direct terminal repeats. The overall genomic architecture of the tf phage is similar to that of the previously described Pseudomonas aeruginosa phages PaP3, LUZ24 and phiMR299-2, and 39 out of the 72 products of predicted tf open reading frames have orthologs in these phages. Accordingly, tf was classified as belonging to the LUZ24-like bacteriophage group. However, taking into account very low homology levels between tf DNA and that of the other phages, tf should be considered as an evolutionary divergent member of the group. Two distinguishing features not reported for other members of the group were found in the tf genome. Firstly, a unique end structure--a blunt right end and a 4-nucleotide 3'-protruding left end--was observed. Secondly, 14 single-chain interruptions (nicks were found in the top strand of the tf DNA. All nicks were mapped within a consensus sequence 5'-TACT/RTGMC-3'. Two nicks were analyzed in detail and were shown to be present in more than 90% of the phage population. Although localized nicks were previously found only in the DNA of T5-like and phiKMV-like phages, it seems increasingly likely that this enigmatic structural feature is common to various other bacteriophages.

  10. Single stranded loops of quadruplex DNA as key benchmark for testing nucleic acids force fields

    Czech Academy of Sciences Publication Activity Database

    Fadrná, E.; Špačková, Naďa; Sarzynska, J.; Koča, J.; Orozco, M.; Cheatham III, T.E.; Kulinski, T.; Šponer, Jiří

    2009-01-01

    Roč. 5, č. 9 (2009), s. 2514-2530 ISSN 1549-9618 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802 Grant - others:GA ČR(CZ) GA203/09/1476 Program:GA Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA quadruplex * MD simulation * force fields Subject RIV: BO - Biophysics Impact factor: 4.804, year: 2009

  11. Ion Density Analysis of Single-Stranded DNA in Liquid Crystal

    Science.gov (United States)

    Iwabata, Kazuki; Seki, Yasutaka; Toizumi, Ryota; Shimada, Yuki; Furue, Hirokazu; Sakaguchi, Kengo

    2013-09-01

    With the widespread use of liquid crystals (LCs) in liquid crystal displays, we have looked into the application of liquid crystals in biotechnology. The purpose of the study described here is to investigate the physical properties of DNA using LCs. Synthetic oligonucleotide molecules were dispersed in MLC6884, the sample injected into antiparallel cells, and the amount of mobile ions was measured. The LC cell doped with oligonucleotide molecules showed a sequence-dependent, specific correlation between oligonucleotide concentration and the amount of mobile ions in the LC cells. In the framework of the Stokes model and polyacrylamide gel electrophoresis (PAGE) analysis, we speculate that this result arises from the difference in ion mobility, which is caused by the shape of the oligonucleotide molecule in the LC.

  12. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines.

    Science.gov (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao

    2017-07-01

    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  13. EFFECTOR OF TRANSCRIPTION2 is involved in xylem differentiation and includes a functional DNA single strand cutting domain.

    Science.gov (United States)

    Ivanov, Rumen; Tiedemann, Jens; Czihal, Andreas; Schallau, Anna; Diep, Le Hong; Mock, Hans-Peter; Claus, Bernhard; Tewes, Annegret; Bäumlein, Helmut

    2008-01-01

    EFFECTORS OF TRANSCRIPTION2 (ET) are plant-specific regulatory proteins characterized by the presence of two to five C-terminal DNA- and Zn-binding repeats, and a highly conserved cysteine pattern. We describe the structural characterization of the three member Arabidopsis thaliana ET gene family and reveal some allelic sequence polymorphisms. A mutation analysis showed that AtET2 affects the expression of various KNAT genes involved in the maintenance of the undifferentiated state of cambial meristem cells. It also plays a role in the regulation of GA5 (gibberellin 3-beta-dioxygenase) and the cell-cycle-related GASA4. A correlation was established between AtET2 expression and the cellular differentiation state. AtET-GFP fusion proteins shuttle between the cytoplasm and nucleus, with the AtET2 product prevented from entering the nucleus in non-differentiating cells. Within the nucleus, AtET2 probably acts via a single strand cutting domain. A more general regulatory role for ET factors is proposed, governing cell differentiation in cambial meristems, a crucial process for the development of plant vascular tissues.

  14. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.

    1994-01-01

    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  15. DNA probes

    International Nuclear Information System (INIS)

    Castelino, J.

    1992-01-01

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with 32 P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism's genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens

  16. Detection of hybridization of single-strand DNA PCR products in temperature change process by a novel metal-clamping piezoelectric sensor.

    Science.gov (United States)

    Chen, Qinghai; Bian, Zhiheng; Hua, Xing; Yao, Chunyan; Wu, Wei; Zhang, Xue; Zhang, Bo; Huang, Junfu; Tang, Wanli; Fu, Weiling

    2010-05-15

    Oligonucleotide probes on the sensor surface can be hybridized with single-strand DNA (ssDNA) that is formed from PCR products in ice bath after degeneration. Thus, detection of PCR products by piezoelectric sensors requires the participation of ssDNA PCR products in ice bath. When PCR products in ice bath are added into the buffer of the sensor well at room temperature, there will be a temperature change process during mixing. However, it still remains unclear whether the temperature change affects the frequency baseline stability of the sensor and the result judgment, which is the basic condition for detecting hybridization of nucleic acid. In this study, we detected the hybridization of HPV PCR products during temperature change process by a self-designed adjustable metal-clamping piezoelectric sensor. The study mainly involves sensor adjustment, probe immobilization and ice bath sample addition (at different concentrations and different volumes). The response curve of basic frequency in temperature change process showed three stages, i.e., increase, decrease to baseline, and continuous decrease to stability. The early increase of frequency and duration of the time can reach 55+/-7.4 Hz and 39 min when 40 microL sample (0-1 degrees C) was added into 110 microL buffer (25 degrees C). The frequency increase effect caused by temperature difference at early stage depends on the volume ratio of two liquids and on the temperature difference. The results indicate that we should pay more attention to possibly small volume of PCR products in ice bath and minor temperature difference of two liquids in operation. 2010 Elsevier B.V. All rights reserved.

  17. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: simonaclichici@yahoo.com [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)

    2012-03-15

    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  18. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family.

    Science.gov (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław

    2017-05-01

    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  19. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.

    1992-01-01

    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  20. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy

    OpenAIRE

    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried

    2013-01-01

    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  1. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  2. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.

    1979-10-01

    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  3. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  4. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues

    Science.gov (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak

    2006-01-01

    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  5. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers

    OpenAIRE

    Antolin, M. F.; Bosio, C. F.; Cotton, J.; Sweeney, W.; Strand, M. R.; Black-IV, W. C.

    1996-01-01

    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  6. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr

    2015-01-01

    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single- strand ed DNA -binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  7. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  8. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H

    2012-02-22

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  9. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.

    1992-01-01

    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  10. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  11. Functional roles of the N- and C-terminal regions of the human mitochondrial single-stranded DNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Marcos T Oliveira

    2010-10-01

    Full Text Available Biochemical studies of the mitochondrial DNA (mtDNA replisome demonstrate that the mtDNA polymerase and the mtDNA helicase are stimulated by the mitochondrial single-stranded DNA-binding protein (mtSSB. Unlike Escherichia coli SSB, bacteriophage T7 gp2.5 and bacteriophage T4 gp32, mtSSBs lack a long, negatively charged C-terminal tail. Furthermore, additional residues at the N-terminus (notwithstanding the mitochondrial presequence are present in the sequence of species across the animal kingdom. We sought to analyze the functional importance of the N- and C-terminal regions of the human mtSSB in the context of mtDNA replication. We produced the mature wild-type human mtSSB and three terminal deletion variants, and examined their physical and biochemical properties. We demonstrate that the recombinant proteins adopt a tetrameric form, and bind single-stranded DNA with similar affinities. They also stimulate similarly the DNA unwinding activity of the human mtDNA helicase (up to 8-fold. Notably, we find that unlike the high level of stimulation that we observed previously in the Drosophila system, stimulation of DNA synthesis catalyzed by human mtDNA polymerase is only moderate, and occurs over a narrow range of salt concentrations. Interestingly, each of the deletion variants of human mtSSB stimulates DNA synthesis at a higher level than the wild-type protein, indicating that the termini modulate negatively functional interactions with the mitochondrial replicase. We discuss our findings in the context of species-specific components of the mtDNA replisome, and in comparison with various prokaryotic DNA replication machineries.

  12. The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange.

    Science.gov (United States)

    Qian, Yufeng; Johnson, Kenneth A

    2017-08-04

    The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB-ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB) 30 and (SSB) 60 , defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB) 60 and (SSB) 30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 10 9 m -1 s -1 ) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Cytogenetic Markers, DNA Single-Strand Breaks, Urinary Metabolites, and DNA Repair Rates in Styrene-Exposed Lamination Workers

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Tuimala, J.; Štětina, R.; Kumar, R.; Manini, P.; Naccarati, Alessio; Maestri, L.; Vodičková, L.; Kuricová, Miroslava; Jarventaus, H.; Majvalková, Z.; Hirvonen, A.; Imbriani, M.; Mutti, A.; Norppa, H.; Hemminki, K.

    2004-01-01

    Roč. 112, č. 8 (2004), s. 867-871 ISSN 0091-6765 R&D Projects: GA ČR GA310/03/0437; GA ČR GA310/01/0802 Institutional research plan: CEZ:AV0Z5039906 Keywords : DNA repair rates * genotoxicity Subject RIV: FM - Hygiene Impact factor: 3.929, year: 2004

  14. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  15. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    Science.gov (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Conformation effects of CpG methylation on single-stranded DNA oligonucleotides: analysis of the opioid peptide dynorphin-coding sequences.

    Directory of Open Access Journals (Sweden)

    Malik Mumtaz Taqi

    Full Text Available Single-stranded DNA (ssDNA is characterized by high conformational flexibility that allows these molecules to adopt a variety of conformations. Here we used native polyacrylamide gel electrophoresis (PAGE, circular dichroism (CD spectroscopy and nuclear magnetic resonance (NMR spectroscopy to show that cytosine methylation at CpG sites affects the conformational flexibility of short ssDNA molecules. The CpG containing 37-nucleotide PDYN (prodynorphin fragments were used as model molecules. The presence of secondary DNA structures was evident from differences in oligonucleotide mobilities on PAGE, from CD spectra, and from formation of A-T, G-C, and non-canonical G-T base pairs observed by NMR spectroscopy. The oligonucleotides displayed secondary structures at 4°C, and some also at 37°C. Methylation at CpG sites prompted sequence-dependent formation of novel conformations, or shifted the equilibrium between different existing ssDNA conformations. The effects of methylation on gel mobility and base pairing were comparable in strength to the effects induced by point mutations in the DNA sequences. The conformational effects of methylation may be relevant for epigenetic regulatory events in a chromatin context, including DNA-protein or DNA-DNA recognition in the course of gene transcription, and DNA replication and recombination when double-stranded DNA is unwinded to ssDNA.

  17. Isolation and characterization of a single-stranded DNA virus infecting the marine diatom Chaetoceros sp. strain SS628-11 isolated from western Japan.

    Directory of Open Access Journals (Sweden)

    Kei Kimura

    Full Text Available Diatoms are significant organisms for primary production in the earth's aquatic environment. Hence, their dynamics are an important focus area in current studies. Viruses are a great concern as potential factors of diatom mortality, along with other physical, chemical, and biological factors. We isolated and characterized a new diatom virus (Csp07DNAV that lyses the marine planktonic diatom Chaetoceros sp. strain SS628-11. This paper examines the physiological, morphological, and genomic characteristics of Csp07DNAV. The virus was isolated from a surface water sample that was collected at Hiroshima Bay, Japan. It was icosahedral, had a diameter of 34 nm, and accumulated in the nuclei of host cells. Rod-shaped virus particles also coexisted in the host nuclei. The latent period and burst size were estimated to be <12 h and 29 infectious units per host cell, respectively. Csp07DNAV had a closed circular single-stranded DNA genome (5,552 nucleotides, which included a double-stranded region and 3 open reading frames. The monophyly of Csp07DNAV and other Bacilladnavirus group single-stranded DNA viruses was supported by phylogenetic analysis that was based on the amino acid sequence of each virus protein. On the basis of these results, we considered Csp07DNAV to be a new member of the genus Bacilladnavirus.

  18. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2016-05-28

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  20. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system.

    Science.gov (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus

    2011-04-06

    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  1. Flow cytometry analysis of single-strand DNA damage in neuroblastoma cell lines using the F7-26 monoclonal antibody.

    Science.gov (United States)

    Grigoryan, Rita S; Yang, Bo; Keshelava, Nino; Barnhart, Jerry R; Reynolds, C Patrick

    2007-11-01

    The F7-26 monoclonal antibody (Mab) has been reported to be specific for single-strand DNA damage (ssDNA) and to also identify cells in apoptosis. We carriedout studies to determine if F7-26 binding measured by flow cytometry was able to specifically identify exogenous ssDNA as opposed to DNA damage from apoptosis. Neuroblastoma cells were treated with melphalan (L-PAM), fenretinide, 4-hydroperoxycyclophosphamide (4-HC)+/-pan-caspase inhibitor BOC-d-fmk, topotecan or with 10Gy gamma radiation+/-hydrogen peroxide (H2O2) and fixed immediately postradiation. Cytotoxicity was measured by DIMSCAN digital imaging fluorescence assay. The degree of ssDNA damage was analyzed by flow cytometry using Mab F7-26, with DNA visualized by propidium iodide counterstaining. Flow cytometry was used to measure apoptosis detected by terminal deoxynucleotidyltransferase (TUNEL) assay and reactive oxygen species (ROS) by carboxy-dichlorofluorescein diacetate. Irradiated and immediately fixed neuroblastoma cells showed increased ssDNA, but not apoptosis by TUNEL (TUNEL-negative). 4-HC or L-PAM+/-BOC-d-fmk increased ssDNA (F7-26-positive), but BOC-d-fmk prevented TUNEL staining. Fenretinide increased apoptosis by TUNEL but not ssDNA damage detected with F7-26. Enhanced ssDNA in neuroblastoma cells treated with radiation+H2O2 was associated with increased ROS. Topotecan increased both ssDNA and cytotoxicity in 4-HC-treated cells. These data demonstrate that Mab F7-26 recognized ssDNA due to exogenous DNA damage, rather than apoptosis. This assay should be useful to characterize the mechanism of action of antineoplastic drugs. Copyright (c) 2007 International Society for Analytical Cytology.

  2. Influence of the single-strand linker composition on the structural/dynamical properties of a truncated octahedral DNA nano-cage family.

    Science.gov (United States)

    Iacovelli, Federico; Alves, Cassio; Falconi, Mattia; Oteri, Francesco; de Oliveira, Cristiano L P; Desideri, Alessandro

    2014-10-01

    The structural/dynamical properties of three truncated octahedral DNA nano-cages composed by identical double helices but single strand linkers with different composition, namely 7 thymidines, 7 adenines, and 7 alternated thymidines and adenines, have been investigated through classical molecular dynamics simulations. Trajectories have been analyzed to investigate the role of the linkers in defining nano-cages stability and flexibility, including possible influence on the internal cages motions. The data indicate that the cages behavior is almost identical and that the structural/dynamical parameters measured along the trajectories are not particularly affected by the presence of different bases. These results demonstrate that the constraints imposed by the nano-structure geometry are the main factor in modulating these properties

  3. Human Rad51 filaments on double- and single-stranded DNA : Correlating regular and irregular forms with recombination function

    NARCIS (Netherlands)

    Ristic, D.; Modesti, M.; Van der Heijden, T.; Van Noort, J.; Dekker, C.; Kanaar, R.; Wyman, C.

    Recombinase proteins assembled into helical filaments on DNA are believed to be the catalytic core of homologous recombination. The assembly, disassembly and dynamic rearrangements of this structure must drive the DNA strand exchange reactions of homologous recombination. The sensitivity of

  4. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB)

    OpenAIRE

    van Loon, Barbara; Samson, Leona D.

    2013-01-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known...

  5. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  6. Probing the DNA Structural Requirements for Facilitated Diffusion

    Science.gov (United States)

    2015-01-01

    DNA glycosylases perform a genome-wide search to locate damaged nucleotides among a great excess of undamaged nucleotides. Many glycosylases are capable of facilitated diffusion, whereby multiple sites along the DNA are sampled during a single binding encounter. Electrostatic interactions between positively charged amino acids and the negatively charged phosphate backbone are crucial for facilitated diffusion, but the extent to which diffusing proteins rely on the double-helical structure DNA is not known. Kinetic assays were used to probe the DNA searching mechanism of human alkyladenine DNA glycosylase (AAG) and to test the extent to which diffusion requires B-form duplex DNA. Although AAG excises εA lesions from single-stranded DNA, it is not processive on single-stranded DNA because dissociation is faster than N-glycosidic bond cleavage. However, the AAG complex with single-stranded DNA is sufficiently stable to allow for DNA annealing when a complementary strand is added. This observation provides evidence of nonspecific association of AAG with single-stranded DNA. Single-strand gaps, bubbles, and bent structures do not impede the search by AAG. Instead, these flexible or bent structures lead to the capture of a nearby site of damage that is more efficient than that of a continuous B-form duplex. The ability of AAG to negotiate these helix discontinuities is inconsistent with a sliding mode of diffusion but can be readily explained by a hopping mode that involves microscopic dissociation and reassociation. These experiments provide evidence of relatively long-range hops that allow a searching protein to navigate around DNA binding proteins that would serve as obstacles to a sliding protein. PMID:25495964

  7. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Boye, E.; Johansen, I.; Brustad, T.

    1976-01-01

    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 2 0 C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 2 0 C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  8. Selection and Characterization of Single-Stranded DNA Aptamers Binding Human B-Cell Surface Protein CD20 by Cell-SELEX

    Directory of Open Access Journals (Sweden)

    Mansoureh Haghighi

    2018-03-01

    Full Text Available The B-lymphocyte antigen (CD20 is a suitable target for single-stranded (ss nucleic acid oligomer (aptamers. The aim of study was selection and characterization of a ssDNA aptamer against CD20 using Cell-Systematic Evolution of Ligands by Exponential Enrichment (Cell-SELEX. The cDNA clone of CD20 (pcDNA-CD20 was transfected to human embryonic kidney (HEK293T cells. Ten rounds of Cell-SELEX was performed on recombinant HEK-CD20 cells. The final eluted ssDNA pool was amplified and ligated in T/A vector for cloning. The plasmids of positive clones were extracted, sequenced and the secondary structures of the aptamers predicted using DNAMAN® software. The sequencing results revealed 10 different types; three of them had the highest thermodynamic stability, named AP-1, AP-2 and AP-3. The AP-1 aptamer was the most thermodynamically stable one (ΔGAP-1 = −10.87 kcal/mol with the highest binding affinity to CD20 (96.91 ± 4.5 nM. Since, the CD20 is a suitable target for recognition of B-Cell. The selected aptamers could be comparable to antibodies with many advantages. The AP-1, AP-2 and AP-3 could be candidate instead of antibodies for diagnostic and therapeutic applications in immune deficiency, autoimmune diseases, leukemia and lymphoma.

  9. Characterization of the Single Stranded DNA Binding Protein SsbB Encoded in the Gonoccocal Genetic Island

    NARCIS (Netherlands)

    Jain, Samta; Zweig, Maria; Peeters, Eveline; Siewering, Katja; Hackett, Kathleen T.; Dillard, Joseph P.; van der Does, Chris

    2012-01-01

    Background: Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in

  10. Human Rad51 filaments on double- and single-stranded DNA: correlating regular and irregular forms with recombination function.

    NARCIS (Netherlands)

    D. Ristic (Dejan); M. Modesti (Mauro); T. van der Heijden (Thijn); J. Noort (John); C. Dekker (Cees); R. Kanaar (Roland); C. Wyman (Claire)

    2005-01-01

    textabstractRecombinase proteins assembled into helical filaments on DNA are believed to be the catalytic core of homologous recombination. The assembly, disassembly and dynamic rearrangements of this structure must drive the DNA strand exchange reactions of homologous recombination. The sensitivity

  11. RNA binding to APOBEC3G induces the disassembly of functional deaminase complexes by displacing single-stranded DNA substrates

    Science.gov (United States)

    Polevoda, Bogdan; McDougall, William M.; Tun, Bradley N.; Cheung, Michael; Salter, Jason D.; Friedman, Alan E.; Smith, Harold C.

    2015-01-01

    APOBEC3G (A3G) DNA deaminase activity requires a holoenzyme complex whose assembly on nascent viral reverse transcripts initiates with A3G dimers binding to ssDNA followed by formation of higher-order A3G homo oligomers. Catalytic activity is inhibited when A3G binds to RNA. Our prior studies suggested that RNA inhibited A3G binding to ssDNA. In this report, near equilibrium binding and gel shift analyses showed that A3G assembly and disassembly on ssDNA was an ordered process involving A3G dimers and multimers thereof. Although, fluorescence anisotropy showed that A3G had similar nanomolar affinity for RNA and ssDNA, RNA stochastically dissociated A3G dimers and higher-order oligomers from ssDNA, suggesting a different modality for RNA binding. Mass spectrometry mapping of A3G peptides cross-linked to nucleic acid suggested ssDNA only bound to three peptides, amino acids (aa) 181–194 in the N-terminus and aa 314–320 and 345–374 in the C-terminus that were part of a continuous exposed surface. RNA bound to these peptides and uniquely associated with three additional peptides in the N- terminus, aa 15–29, 41–52 and 83–99, that formed a continuous surface area adjacent to the ssDNA binding surface. The data predict a mechanistic model of RNA inhibition of ssDNA binding to A3G in which competitive and allosteric interactions determine RNA-bound versus ssDNA-bound conformational states. PMID:26424853

  12. Cyclic voltammetry of echinomycin and its interaction with double-stranded and single-stranded DNA adsorbed at the electrode

    Czech Academy of Sciences Publication Activity Database

    Jelen, František; Erdem, A.; Paleček, Emil

    2002-01-01

    Roč. 55, 1/2 (2002), s. 165-167 ISSN 1567-5394 R&D Projects: GA AV ČR IAA4004901; GA ČR GV204/97/K084 Institutional research plan: CEZ:AV0Z5004920 Keywords : electrochemistry of DNA * interaction of DNA with echinomycin * hanging mercury drop electrode Subject RIV: BO - Biophysics Impact factor: 1.463, year: 2002

  13. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS.

    Science.gov (United States)

    Pachkowski, Brian F; Tano, Keizo; Afonin, Valeriy; Elder, Rhoderick H; Takeda, Shunichi; Watanabe, Masami; Swenberg, James A; Nakamura, Jun

    2009-12-01

    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase beta.

  14. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against the Pesticide Fipronil and Sensitive Detection in River Water

    Directory of Open Access Journals (Sweden)

    Ka L. Hong

    2017-12-01

    Full Text Available Fipronil is a commonly used insecticide that has been shown to have environmental and human health risks. The current standard methods of detection for fipronil and its metabolites, such as GC-MS, are time consuming and labor intensive. In this study, a variant of systematic evolution of ligands by exponential enrichment (SELEX, was utilized to identify the first single-stranded DNA (ssDNA molecular recognition element (MRE that binds to fipronil with high affinity (Kd = 48 ± 8 nM. The selected MRE displayed low cross binding activity on various environmentally relevant, structurally unrelated herbicides and pesticides, in addition to broad-spectrum binding activity on major metabolites of fipronil and a structurally similar pesticide in prepared river samples. Additionally, a proof-of-principle fluorescent detection assay was developed by using the selected ssDNA MRE as a signal-reporting element, with a limit of detection of 105 nM in a prepared river water sample.

  15. Guanine quadruplex monoclonal antibody 1H6 cross-reacts with restrained thymidine-rich single stranded DNA

    NARCIS (Netherlands)

    Kazemier, Hinke G.; Paeschke, Katrin; Lansdorp, Peter M.

    2017-01-01

    Previously we reported the production and characterization of monoclonal antibody 1H6 raised against (T(4)G(4))(2) intermolecular guanine quadruplex (G4) DNA structures (Henderson A. et al. (2014) Nucleic Acids Res., 42, 860-869; Hoffmann R. F. et al. (2016) Nucleic Acids Res., 44, 152-163). It was

  16. Direct imaging of hexaamine-ruthenium(III) in domain boundaries in monolayers of single-stranded DNA

    DEFF Research Database (Denmark)

    Grubb, Mikala; Wackerbarth, Hainer; Wengel, J.

    2007-01-01

    We describe adsorption and identification of the binding sites of [Ru(NH3)(6)](3+) (RuHex) molecules in a closely packed monolayer of a 13-base ss-DNA on Au(111) electrodes by electrochemical in situ scanning tunneling microscopy (STM), cyclic voltammetry and interfacial capacitance data. In situ...

  17. Gauging the Nanotoxicity of h2D-C2N toward Single-Stranded DNA: An in Silico Molecular Simulation Approach.

    Science.gov (United States)

    Mukhopadhyay, Titas Kumar; Bhattacharyya, Kalishankar; Datta, Ayan

    2018-04-12

    Recent toxicological assessments of graphene, graphene oxides, and some other two-dimensional (2D) materials have shown them to be substantially toxic at the nanoscale, where they inhibit and eventually disrupt biological processes. These shortfalls of graphene and analogs have resulted in a quest for novel biocompatible 2D materials with minimum cytotoxicity. In this article, we demonstrate C 2 N (h2D-C 2 N), a newly synthesized 2D porous graphene analog, to be non-nanotoxic toward genetic materials from an "in-silico" point of view through sequence-dependent binding of different polynucleotide single-stranded DNA (ssDNA) onto it. The calculated binding energy of nucleobases and the free energy of binding of polynucleotides follow the common trait, cytosine > guanine > adenine > thymine, and are well within the limits of physisorption. Ab-initio simulations completely exclude the possibility of any chemical reaction, demonstrating purely noncovalent binding of nucleobases with C 2 N through a crucial interplay between hydrogen bonding and π-stacking interactions with the surface. Further, we show that the extent of distortion inflicted upon ssDNA by C 2 N is negligible. Analysis of the density of states of the nucleobase-C 2 N hybrids confirms minimum electronic perturbation of the bases after adsorption. Most importantly, we demonstrate the potency of C 2 N in nucleic acid transportation via reversible binding of ssDNA. The plausible use of C 2 N as a template for DNA repair is illustrated through an example of C 2 N-assisted complementary ssDNA winding.

  18. Detection of benzo[a]pyrene-guanine adducts in single-stranded DNA using the α-hemolysin nanopore

    Science.gov (United States)

    Perera, Rukshan T.; Fleming, Aaron M.; Johnson, Robert P.; Burrows, Cynthia J.; White, Henry S.

    2015-02-01

    The carcinogenic precursor benzo[a]pyrene (BP), a polycyclic aromatic hydrocarbon, is released into the environment through the incomplete combustion of hydrocarbons. Metabolism of BP in the human body yields a potent alkylating agent (benzo[a]pyrene diol epoxide, BPDE) that reacts with guanine (G) in DNA to form an adduct implicated in cancer initiation. We report that the α-hemolysin (αHL) nanopore platform can be used to detect a BPDE adduct to G in synthetic oligodeoxynucleotides. Translocation of a 41-mer poly-2‧-deoxycytidine strand with a centrally located BPDE adduct to G through αHL in 1 M KCl produces a unique multi-level current signature allowing the adduct to be detected. This readily distinguishable current modulation was observed when the BPDE-adducted DNA strand translocated from either the 5‧ or 3‧ directions. This study suggests that BPDE adducts and other large aromatic biomarkers can be detected with αHL, presenting opportunities for the monitoring, quantification, and sequencing of mutagenic compounds from cellular DNA samples.

  19. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA.

    Science.gov (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S

    2000-09-20

    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  20. Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody: a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody.

    Science.gov (United States)

    Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua

    2018-02-01

    Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.

  1. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes.

    Science.gov (United States)

    Pietilä, Maija K; Roine, Elina; Sencilo, Ana; Bamford, Dennis H; Oksanen, Hanna M

    2016-01-01

    Viruses infecting archaea show a variety of virion morphotypes, and they are currently classified into more than ten viral families or corresponding groups. A pleomorphic virus morphotype is very common among haloarchaeal viruses, and to date, several such viruses have been isolated. Here, we propose the classification of eight such viruses and formation of a new family, Pleolipoviridae (from the Greek pleo for more or many and lipos for lipid), containing three genera, Alpha-, Beta-, and Gammapleolipovirus. The proposal is currently under review by the International Committee on Taxonomy of Viruses (ICTV). The members of the proposed family Pleolipoviridae infect halophilic archaea and are nonlytic. They share structural and genomic features and differ from any other classified virus. The virion of pleolipoviruses is composed of a pleomorphic membrane vesicle enclosing the genome. All pleolipoviruses have two major structural protein species, internal membrane and spike proteins. Although the genomes of the pleolipoviruses are single- or double-stranded, linear or circular DNA molecules, they share the same genome organization and gene synteny and show significant similarity at the amino acid level. The canonical features common to all members of the proposed family Pleolipoviridae show that they are closely related and thus form a new viral family.

  2. A biomarker model of sublethal genotoxicity (DNA single-strand breaks and adducts) using the sentinel organism Aporrectodea longa in spiked soil

    International Nuclear Information System (INIS)

    Martin, Francis L.; Piearce, Trevor G.; Hewer, Alan; Phillips, David H.; Semple, Kirk T.

    2005-01-01

    There is a need to develop risk biomarkers during the remediation of contaminated land. We employed the earthworm, Aporrectodea longa (Ude), to determine whether genotoxicity measures could be applied to this organism's intestinal tissues. Earthworms were added, for 24 h or 7 days, to soil samples spiked with benzo[a]pyrene (B[a]P) and/or lindane. After exposure, intestinal tissues (crop/gizzard or intestine) were removed prior to the measurement in disaggregated cells of DNA single-strand breaks (SSBs) by the alkaline comet assay. Damage was quantified by comet tail length (CTL, μm). B[a]P 24-h exposure induced dose-related increases (P 32 P-postlabelling, showed a two-adduct-spot pattern. This preliminary investigation suggests that earthworm tissues may be incorporated into genotoxicity assays to facilitate hazard identification within terrestrial ecosystems. - Sublethal genotoxicity in the sentinel organism A. longa can be used to monitor the effects of contaminants in soil

  3. Ampelomyces mycoparasites from apple powdery mildew identified as a distinct group based on single-stranded conformation polymorphism analysis of the rDNA ITS region.

    Science.gov (United States)

    Szentiványi, Orsolya; Kiss, Levente; Russell, John C; Kovács, Gábor M; Varga, Krisztina; Jankovics, Tünde; Lesemann, Silke; Xu, Xiang-Ming; Jeffries, Peter

    2005-04-01

    Pycnidial fungi belonging to the genus Ampelomyces are the most common natural antagonists of powdery mildews worldwide. During a study of the interactions between apple powdery mildew (Podosphaera leucotricha) and Ampelomyces mycoparasites, 52 new Ampelomyces isolates were obtained from P. leucotricha and, in addition, 13 new isolates from other species of the Erysiphaceae in four European countries. Their genetic diversity was screened using single-stranded conformation polymorphism (SSCP) analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). For comparison, 24 isolates obtained from genetic resource collections or other sources were included in this study. Based on the ITS-SSCP patterns, the isolates were placed in eight groups. The isolates belonged to two types based on their growth in culture. The faster-growing and the slower-growing isolates were included in different SSCP groups. A phylogenetic analysis of the ITS sequences of representatives of these groups confirmed the results obtained with the SSCP method, and showed that the faster-growing isolates do not belong to Ampelomyces as suggested by earlier studies. All the isolates from P. leucotricha fell into a distinct SSCP group of genetically homogeneous isolates. This suggests that Ampelomyces mycoparasites which occur in apple powdery mildew are slightly different from the other Ampelomyces groups which contain mycoparasites from various powdery mildew species. This may be because the main growth period of Ampelomyces mycoparasites in apple powdery mildew is isolated in time from that of Ampelomyces isolates that occur in other species of the Erysiphaceae. P. leucotricha starts its life-cycle early in the season, usually in March-April, while most powdery mildews are active in the same environments only late in the year.

  4. Contribution of single-strand breaks and alkali-labile bonds to the loss of infectivity of γ-irradiated phiX174 RF-DNA in E. coli cells mutant in various repair functions

    International Nuclear Information System (INIS)

    McKee, R.H.

    1975-01-01

    Twenty-one radiation sensitive mutants have been examined for their capacity to support gamma-irradiated phiX174 RF-DNA. The survival of phiX174 RF-DNA was reduced in essentially all of the sensitive mutants. The irradiated phiX174 RF-DNA was then separated into populations containing either single-strand breaks or alkali-labile bonds to examine the capacity of the mutants to repair each of the classes of lesions. It was found that all E. coli strains are unable to repair 22 percent of the single-strand breaks and all sensitive mutants are unable to repair an additional 10 percent of the breaks. All the repair functions examined are involved in single-strand break repair and none are more or less necessary than any of the others. PhiX174 RF-DNA is also inactivated by alkali-labile bonds. In the normal strains the inactivation efficiency is 0.16 lethal events per lesion with a threshold dose of 15 to 20 krads. The mutants are divided into two classes by their sensitivity to alkali-labile bonds. Both classes of mutants are also inactivated by alkali-labile bonds with efficiencies of about 0.17 and 0.29 lethal events per lesion, respectively. It is proposed that the differences seen in survival curves of phiX174 measured in the sensitive mutants is due to this difference. Although in normal cells the efficiency of inactivation of phiX174 by single-strand breaks is 50 percent greater than by alkali-labile bonds, alkali-labile bonds are produced at approximately twice the rate of single-strand breaks so alkali-labile bonds account for about 61 percent of the overall inactivation. In the mutants of least sensitivity alkali-labile bonds account for about 54 percent of the inactivating events and in the most sensitive about 67 percent

  5. OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

    Directory of Open Access Journals (Sweden)

    Kevin M. Bradley

    2014-08-01

    Full Text Available Synthetic biologists wishing to self-assemble large DNA (L-DNA constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson–Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS, and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting" software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

  6. Conformationally locked aryl C-nucleosides: synthesis of phosphoramidite monomers and incorporation into single-stranded DNA and LNA (locked nucleic acid)

    DEFF Research Database (Denmark)

    Babu, B. Ravindra; Prasad, Ashok K.; Trikha, Smriti

    2002-01-01

    . The phosphoramidite approach was used for automated incorporation of the LNA-type beta-configured C-aryl monomers 17a-17e into short DNA and 2'-OMe-RNA/LNA strands. It is shown that universal hybridization can be obtained with a conformationally restricted monomer as demonstrated most convincingly for the pyrene LNA...... monomer 17d, both in a DNA context and in an RNA-like context. Increased binding affinity of oligonucleotide probes for universal hybridization can be induced by combining the pyrene LNA monomer 17d with affinity-enhancing 2'-OMe-RNA/LNA monomers....

  7. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  8. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: tcheng@ntu.edu.tw [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)

    2013-02-01

    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ► To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ► ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ► PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ► The findings

  9. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.

    1976-02-01

    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  10. Increased type I collagen content and DNA binding activity of a single-stranded, cytosine-rich sequence in the high-salt buffer protein extract of the copper-deficient rat heart.

    Science.gov (United States)

    Zeng, Huawei; Saari, Jack T

    2004-11-01

    Dietary copper (Cu) deficiency not only causes a hypertrophic cardiomyopathy but also increases cancer risk in rodent models. However, a possible alteration in gene expression has not been fully examined. The present study was undertaken to determine the effect of Cu deficiency on protein profiles in rat heart tissue. Male Sprague-Dawley rats were fed diets that were either a Cu-adequate diet (6.0 microg Cu/g diet, n = 6) or a Cu-deficient diet (0.3 microg Cu/g diet, n = 6) for 5 weeks. The high-salt buffer (HSB) protein extract from heart tissue of Cu-deficient, but not Cu-adequate rats showed a 132 kDa protein band by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. This protein band stained pink with Coomassie Blue, suggesting the presence of collagens or other proline-rich proteins. Dot immunoblotting demonstrated that total type I collagen was increased by 110% in HSB protein extract from Cu-deficient, relative to Cu-adequate, rats. Liquid chromatography with mass spectrometry analysis indicated that the 132 kDa protein band contained a collagen alpha (I) chain precursor as well as a leucine-rich protein 130 (LRP130) in HSB protein extract from Cu-deficient but not Cu-adequate rats. A gel shift assay showed that HSB protein extract from Cu-deficient rats bound to a single-stranded cytosine-rich DNA with higher affinity than the extract of Cu-adequate rats, similar to reports of an increase in LRP130 single-stranded DNA binding activity in several types of tumor cells. Collectively, these results not only suggest an additional feature of altered collagen metabolism with Cu deficiency but also demonstrate for the first time an increase in single-stranded cytosine-rich DNA binding in Cu-deficient rat heart.

  11. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: skim1@lsuhsc.edu [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  12. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee

    2012-01-01

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  13. Phenolic extracts of brewers' spent grain (BSG) as functional ingredients - assessment of their DNA protective effect against oxidant-induced DNA single strand breaks in U937 cells.

    Science.gov (United States)

    McCarthy, Aoife L; O'Callaghan, Yvonne C; Connolly, Alan; Piggott, Charles O; Fitzgerald, Richard J; O'Brien, Nora M

    2012-09-15

    Brewers' spent grain (BSG), a by-product of the brewing industry, contains high amounts of phenolic acids, which have antioxidant effects. The present study examined the ability of BSG extracts to protect against the genotoxic effects of oxidants, hydrogen peroxide (H(2)O(2)), 3-morpholinosydnonimine hydrochloride (SIN-1), 4-nitroquinoline 1-oxide (4-NQO) and tert-butylhydroperoxide (t-BOOH) in U937 cells. Four pale (P1-P4) and four black (B1-B4) BSG extracts were investigated. U937 cells were pre-incubated with BSG extracts, exposed to the oxidants and the DNA damage was measured by the Comet assay. The black BSG extracts (B1-B4) significantly protected against H(2)O(2)-induced DNA damage. Extract B2, which had the highest phenol content, provided the greatest protection. Extracts P2, B2, B3 and B4 provided significant protection against SIN-1-induced DNA damage. None of the extracts protected against DNA damage induced by t-BOOH and 4-NQO. The DNA protective effects of the BSG phenolic extracts may be related to iron chelation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Engineering BspQI nicking enzymes and application of N.BspQI in DNA labeling and production of single-strand DNA.

    Science.gov (United States)

    Zhang, Penghua; Too, Priscilla Hiu-Mei; Samuelson, James C; Chan, Siu-Hong; Vincze, Tamas; Doucette, Stephanie; Bäckström, Stefan; Potamousis, Konstantinos D; Schramm, Timothy M; Forrest, Dan; Schwartz, David C; Xu, Shuang-yong

    2010-02-01

    BspQI is a thermostable Type IIS restriction endonuclease (REase) with the recognition sequence 5'GCTCTTC N1/N4 3'. Here we report the cloning and expression of the bspQIR gene for the BspQI restriction enzyme in Escherichia coli. Alanine scanning of the BspQI charged residues identified a number of DNA nicking variants. After sampling combinations of different amino acid substitutions, an Nt.BspQI triple mutant (E172A/E248A/E255K) was constructed with predominantly top-strand DNA nicking activity. Furthermore, a triple mutant of BspQI (Nb.BspQI, N235A/K331A/R428A) was engineered to create a bottom-strand nicking enzyme. In addition, we demonstrated the application of Nt.BspQI in optical mapping of single DNA molecules. Nt or Nb.BspQI-nicked dsDNA can be further digested by E. coli exonuclease III to create ssDNA for downstream applications. BspQI contains two potential catalytic sites: a top-strand catalytic site (Ct) with a D-H-N-K motif found in the HNH endonuclease family and a bottom-strand catalytic site (Cb) with three scattered Glu residues. BlastP analysis of proteins in GenBank indicated a putative restriction enzyme with significant amino acid sequence identity to BspQI from the sequenced bacterial genome Croceibacter atlanticus HTCC2559. This restriction gene was amplified by PCR and cloned into a T7 expression vector. Restriction mapping and run-off DNA sequencing of digested products from the partially purified enzyme indicated that it is an EarI isoschizomer with 6-bp recognition, which we named CatHI (CTCTTC N1/N4).

  15. The Mycoplasma pneumoniae MPN229 gene encodes a protein that selectively binds single-stranded DNA and stimulates Recombinase A-mediated DNA strand exchange

    NARCIS (Netherlands)

    M. Sluijter (Marcel); T.A. Hoogenboezem (Thomas); N.G. Hartwig (Nico); C. Vink (Cornelis)

    2008-01-01

    textabstractBackground. Mycoplasma pneumoniae has previously been characterized as a micro-organism that is genetically highly stable. In spite of this genetic stability, homologous DNA recombination has been hypothesized to lie at the basis of antigenic variation of the major surface protein, P1,

  16. The interaction of hyperthermophilic TATA-box binding protein with single-stranded DNA is entropically favorable and exhibits a large negative heat capacity change at high salt concentration.

    Science.gov (United States)

    Nagatoishi, Satoru; Tanaka, Yoshikazu; Kudou, Motonori; Tsumoto, Kouhei

    2009-09-01

    We have investigated the thermodynamics of the interaction between the TATA-box-binding protein from Pyrococcus horikoshii (PhoTBP) and its target DNA (TATA-1). The interaction between PhoTBP and double-stranded DNA (dsDNA) is entropically favorable and enthalpically unfavorable. The thermodynamic parameters for TATA-1 duplex formation in the presence of PhoTBP, that is, ternary PhoTBP-dsDNA complexation, are similar to those for TATA-1 duplex formation, which is enthalpically favorable. Surface plasmon resonance analysis indicates that the interaction between PhoTBP and single-stranded DNA (ssDNA) of TATA-1 is entropy driven and has a large negative heat capacity change (-1.19 kcal mol(-1) K(-1)) at high salt concentration (800 mM NaCl). These results suggest that the favorable entropic effect corresponding to the interaction between PhoTBP and dsDNA is due not to ternary complexation but to the interaction between PhoTBP and ssDNA. This report is the first to describe the thermodynamics of the interaction between TBP and ssDNA.

  17. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  18. Preparation of fluorescent DNA probe by solid-phase organic synthesis

    Directory of Open Access Journals (Sweden)

    2009-08-01

    Full Text Available Fluorescent DNA probe based on fluorescence resonance energy transfer (FRET was prepared by solid-phase organic synthesis when CdTe quantum dots (QDs were as energy donors and Au nanoparticles (AuNPs were as energy accepters. The poly(divinylbenzene core/poly(4-vinylpyridine shell microspheres, as solid-phase carriers, were prepared by seeds distillation-precipitation polymerization with 2,2′-azobisisobutyronitrile (AIBN as initiator in neat acetonitrile. The CdTe QDs and AuNPs were self-assembled on the surface of core/shell microspheres, and then the linkage of CdTe QDs with oligonucleotides (CdTe-DNA and AuNPs with complementary single-stranded DNA (Au-DNA was on the solid-phase carriers instead of in aqueous solution. The hybridization of complementary double stranded DNA (dsDNA bonded to the QDs and AuNPs (CdTe-dsDNA-Au determined the FRET distance of CdTe QDs and AuNPs. Compared with the fluorescence of CdTe-DNA, the fluorescence of CdTe-dsDNA-Au conjugates (DNA probes decreased extremely, which indicated that the FRET occurred between CdTe QDs and AuNPs. The probe system would have a certain degree recovery of fluorescence when the complementary single stranded DNA was introduced into this system, which showed that the distance between CdTe QDs and AuNPs was increased.

  19. The Rev1 interacting region (RIR) motif in the scaffold protein XRCC1 mediates a low-affinity interaction with polynucleotide kinase/phosphatase (PNKP) during DNA single-strand break repair.

    Science.gov (United States)

    Breslin, Claire; Mani, Rajam S; Fanta, Mesfin; Hoch, Nicolas; Weinfeld, Michael; Caldecott, Keith W

    2017-09-29

    The scaffold protein X-ray repair cross-complementing 1 (XRCC1) interacts with multiple enzymes involved in DNA base excision repair and single-strand break repair (SSBR) and is important for genetic integrity and normal neurological function. One of the most important interactions of XRCC1 is that with polynucleotide kinase/phosphatase (PNKP), a dual-function DNA kinase/phosphatase that processes damaged DNA termini and that, if mutated, results in ataxia with oculomotor apraxia 4 (AOA4) and microcephaly with early-onset seizures and developmental delay (MCSZ). XRCC1 and PNKP interact via a high-affinity phosphorylation-dependent interaction site in XRCC1 and a forkhead-associated domain in PNKP. Here, we identified using biochemical and biophysical approaches a second PNKP interaction site in XRCC1 that binds PNKP with lower affinity and independently of XRCC1 phosphorylation. However, this interaction nevertheless stimulated PNKP activity and promoted SSBR and cell survival. The low-affinity interaction site required the highly conserved Rev1-interacting region (RIR) motif in XRCC1 and included three critical and evolutionarily invariant phenylalanine residues. We propose a bipartite interaction model in which the previously identified high-affinity interaction acts as a molecular tether, holding XRCC1 and PNKP together and thereby promoting the low-affinity interaction identified here, which then stimulates PNKP directly. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Replication of the plasmid pBR322 under the control of a cloned replication origin from the single-stranded DNA phage M13.

    OpenAIRE

    Cleary, J M; Ray, D S

    1980-01-01

    The replication origins of viral and complementary strands of bacteriophage M13 DNA are contained within a 507-nucleotide intergenic region of the viral genome. Chimeric plasmids have been constructed by inserting restriction endonuclease fragments of the M13 intergenic region into the plasmid pBR322. Replication of these hybrid plasmids, under conditions not permissive for the plasmid replicon, depends on specific segments of the M13 origin region and on the presence of M13 helper virus. Thu...

  1. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi

    1990-01-01

    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  2. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  3. DNA probe for lactobacillus delbrueckii

    Energy Technology Data Exchange (ETDEWEB)

    Delley, M.; Mollet, B.; Hottinger, H. (Nestle Research Centre, Lausanne (Switzerland))

    1990-06-01

    From a genomic DNA library of Lactobacillus delbrueckii subsp. bulgaricus, a clone was isolated which complements a leucine auxotrophy of an Escherichia coli strain (GE891). Subsequent analysis of the clone indicated that it could serve as a specific DNA probe. Dot-blot hybridizations with over 40 different Lactobacillus strains showed that this clone specifically recognized L. delbrueckii subsp. delbrueckii, bulgaricus, and lactis. The sensitivity of the method was tested by using an {alpha}-{sup 32}P-labeled probe.

  4. DNA probe for lactobacillus delbrueckii

    International Nuclear Information System (INIS)

    Delley, M.; Mollet, B.; Hottinger, H.

    1990-01-01

    From a genomic DNA library of Lactobacillus delbrueckii subsp. bulgaricus, a clone was isolated which complements a leucine auxotrophy of an Escherichia coli strain (GE891). Subsequent analysis of the clone indicated that it could serve as a specific DNA probe. Dot-blot hybridizations with over 40 different Lactobacillus strains showed that this clone specifically recognized L. delbrueckii subsp. delbrueckii, bulgaricus, and lactis. The sensitivity of the method was tested by using an α- 32 P-labeled probe

  5. Detection of Toxoplasma gondii with a DNA molecular beacon probe

    Science.gov (United States)

    Zhou, Cun; Xu, Shichao; Yang, Juan; Zhang, Jimei; Dai, Zhao; Zheng, Guo; Sun, Bo; Sun, Shuqing; Feng, Teilin; Zi, Yan; Liang, Chu; Luo, Hao

    2009-07-01

    Toxoplasma gondii is a kind of microscopic parasite that may infect humans, and there are increasing concerns on the early detection of latent Toxoplasma gondii infection in recent years. This research highlights a new type of molecular beacon (MB) fluorescent probe for Toxoplasma DNA testing. We combined high-efficiency fluorescent inorganic core-shell quantum dots-CdTe/ZnS (as fluorescent energy donor) and BHQ-2 (energy acceptor) to the single-strand DNA of Toxoplasma gondii, and a molecular beacon sensing system based on fluorescence resonance energy transfer (FRET) was achieved. Core-shell quantum dots CdTe/ZnS was firstly prepared in aqueous solution, and the influencing factor of its fluorescent properties, including CdTe/Na2S/Zn(CH3COO)2 (v/v), dependence of reaction time, temperature, and pH, is investigated systematically. The synthesized quantum dots and molecular beacon were characterized by transmission electron microscopy (TEM), ultraviolet-visible spectrophotometer (UV-vis), fluorescent spectrophotometer (FS), respectively. The TEM results showed that CdTe/ZnS core-shell quantum dots is ~11nm in size, and the quantum dots is water-soluble well. The sensing ability of target DNA of assembled MB was investigated, and results showed that the target Toxoplasma gonddi DNA can be successfully detected by measuring the change of fluorescence intensity. The results showed that the current sensing probe will be a useful and convenient tool in Toxoplasma gondii early detection.

  6. Nonisotopic DNA probe techniques

    National Research Council Canada - National Science Library

    Kricka, Larry J

    1992-01-01

    The objective of this book is to bring together descriptions of the principal nonisotopic methods for DNA hybridization assays, together with experimental details of the methods, including labelling...

  7. Mutagenesis of the Agrobacterium VirE2 single-stranded DNA-binding protein identifies regions required for self-association and interaction with VirE1 and a permissive site for hybrid protein construction.

    Science.gov (United States)

    Zhou, X R; Christie, P J

    1999-07-01

    The VirE2 single-stranded DNA-binding protein (SSB) of Agrobacterium tumefaciens is required for delivery of T-DNA to the nuclei of susceptible plant cells. By yeast two-hybrid and immunoprecipitation analyses, VirE2 was shown to self-associate and to interact with VirE1. VirE2 mutants with small deletions or insertions of a 31-residue oligopeptide (i31) at the N or C terminus or with an i31 peptide insertion at Leu236 retained the capacity to form homomultimers. By contrast, VirE2 mutants with modifications outside a central region located between residues 320 and 390 retained the capacity to interact with VirE1. These findings suggest the tertiary structure of VirE2 is important for homomultimer formation whereas a central domain mediates formation of a complex with VirE1. The capacity of VirE2 mutants to interact with full-length VirE2 in the yeast Saccharomyces cerevisiae correlated with the abundance of the mutant proteins in A. tumefaciens, suggesting that VirE2 is stabilized by homomultimerization in the bacterium. We further characterized the promoter and N- and C-terminal sequence requirements for synthesis of functional VirE2. A PvirB::virE2 construct yielded functional VirE2 protein as defined by complementation of a virE2 null mutation. By contrast, PvirE or Plac promoter constructs yielded functional VirE2 only if virE1 was coexpressed with virE2. Deletion of 10 or 9 residues from the N or C terminus of VirE2, respectively, or addition of heterologous peptides or proteins to either terminus resulted in a loss of protein function. However, an i31 peptide insertion at Tyr39 had no effect on protein function as defined by the capacity of the mutant protein to (i) interact with native VirE2, (ii) interact with VirE1, (iii) accumulate at abundant levels in A. tumefaciens, and (iv) restore wild-type virulence to a virE2 null mutant. We propose that Tyr39 of VirE2 corresponds to a permissive site for insertion of heterologous peptides or proteins of interest

  8. Repair of ultraviolet light damage in Saccharomyces cerevisiae as studied with double- and single-stranded incoming DNAs

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, D.; Hieda, K.

    1992-01-01

    Purified double- and single-stranded DNAs of the autonomously replicating vector M13RK9-T were irradiated with ultraviolet light (UV) in vitro and introduced into competent whole cells of Saccharomyces cerevisiae. Incoming double-stranded DNA was more sensitive to UV in excision repair-deficient rad2-1 cells than in proficient repair RAD + cells, while single-stranded DNA exhibited high sensitivity in both host cells. The results indicate that in yeast there is no effective rescue of UV-incoming single-stranded DNA by excision repair or other constitutive dark repair processes

  9. Detection of DNA hybridization by various spectroscopic methods using the copper tetraphenylporphyrin complex as a probe

    International Nuclear Information System (INIS)

    Gong, H.; Cai, C.; Ma, Y.; Chen, X.

    2012-01-01

    We are presenting new and highly sensitive hybridization assays. They are based on various spectroscopic methods including resonance light scattering, circular dichroism, ultraviolet spectra and fluorescence spectra, as well as atomic force microscopy, and relies on the interaction of the Cu(II), Ni(II), Mg(II), Co(II), Cd(II), and Zn(II) complexes, respectively, of tetraphenylporphyrin (TPP) with double-strand DNA (dsDNA) and single strand DNA (ssDNA). The interaction results in amplified resonance light scattering (RLS) signals and enables the detection of hybridization without the need for labeling DNA. The RLS signals are strongest in case of the Cu (II)-TPP complex which therefore was selected as the probe. The technique is simple, robust, accurate, and can be completed in less than one hour. (author)

  10. Probing the structure of DNA aptamers with a classic heterocycle.

    Science.gov (United States)

    Wood, Arthur E; Bishop, G Reid

    2004-02-28

    DNA aptamers are synthetic, single-stranded DNA oligonucleotides selected by SELEX methods for their binding with specific ligands. Here we present ethidium binding results for three related DNA aptamers (PDB code: 1OLD, 1DB6, and 2ARG)that bind L-argininamide (L-Arm). The ligand bound form of each aptamer's structure has been reported and each are found to be composed primarily of two domains consisting of a stem helical region and a loop domain that forms a binding pocket for the cognate ligand. Previous thermodynamic experiments demonstrated that the DNA aptamer 1OLD undergoes a large conformational ordering upon binding to L-Arm. Here we extend those linkage binding studies by examining the binding of the heterocyclic intercalator ethidium to each of the three aptamers by fluorescence and absorption spectrophotometric titrations. Our results reveal that ethidium binds to each aptamer with DeltaG degree's in the range of -8.7 to -9.4 kcal/mol. The stoichiometry of binding is 2:1 for each aptamer and is quantitatively diminished in the presence of L-Arm as is the overall fluorescence intensity of ethidium. Together, these results demonstrate that a portion of the bound ethidium is excluded from the aptamer in the presence of a saturating amount of L-Arm. These results demonstrate the utility of ethidium and related compounds for the probing of non-conventional DNA structures and reveal an interesting fundamental thermodynamic linkage in DNA aptamers. Results are discussed in the context of the thermodynamic stability and structure of each of the aptamers examined.

  11. A DNA probe based on phosphorescent resonance energy transfer for detection of transgenic 35S promoter DNA.

    Science.gov (United States)

    Lv, Jinzhi; Miao, Yanming; Yang, Jiajia; Qin, Jin; Li, Dongxia; Yan, Guiqin

    2017-05-15

    A QDs-DNA nano-probe was made by combining Mn-doped ZnS room-temperature phosphorescence (RTP) quantum dots (QDs) and DNA. Then an RTP sensor for quantitative detection of genetically-modified mark sequence cauliflower mosaic virus 35S promoter (Ca MV 35S) DNA was built on basis of phosphorescent resonance energy transfer (PRET). The underlying principles were that a QDs-DNA water-soluble nano-probe was built by connecting single-strand DNA to the surfaces of QDs via a ligand exchange method. This probe had good RTP performance and could well identify Ca MV 35S. Thereby, the simple, rapid and efficient detection of genetically-modified organisms was realized. With the increase of target DNA sequence, the phosphorescent intensity of QDs was gradually reduced due to the energy transfer between QDs and the organic quencher BHQ 2 . This sensor had a detection limit of 4.03nM and a detection range of 12-300nM. Moreover, this sensor had high selectivity. This sensor could effectively detect the target DNA compared with mismatched and random sequences. Thus, this method is very promising for biological analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Probing the Structure of DNA Aptamers with a Classic Heterocycle.

    Directory of Open Access Journals (Sweden)

    G. Reid Bishop

    2004-02-01

    Full Text Available DNA aptamers are synthetic, single-stranded DNA oligonucleotides selectedby SELEX methods for their binding with specific ligands. Here we present ethidiumbinding results for three related DNA aptamers (PDB code: 1OLD, 1DB6, and 2ARGthat bind L-argininamide (L-Arm. The ligand bound form of each aptamer's structurehas been reported and each are found to be composed primarily of two domainsconsisting of a stem helical region and a loop domain that forms a binding pocket for thecognate ligand. Previous thermodynamic experiments demonstrated that the DNAaptamer 1OLD undergoes a large conformational ordering upon binding to L-Arm. Herewe extend those linkage binding studies by examining the binding of the heterocyclicintercalator ethidium to each of the three aptamers by fluorescence and absorptionspectrophotometric titrations. Our results reveal that ethidium binds to each aptamer with∆Go's in the range of -8.7 to -9.4 kcal/mol. The stoichiometry of binding is 2:1 for eachaptamer and is quantitatively diminished in the presence of L-Arm as is the overallfluorescence intensity of ethidium. Together, these results demonstrate that a portion ofthe bound ethidium is excluded from the aptamer in the presence of a saturating amountof L-Arm. These results demonstrate the utility of ethidium and related compounds forthe probing of non-conventional DNA structures and reveal an interesting fundamentalthermodynamic linkage in DNA aptamers. Results are discussed in the context of thethermodynamic stability and structure of each of the aptamers examined.

  13. DNA degradation, UV sensitivity and SOS-mediated mutagenesis in strains of Escherichia coli deficient in single-strand DNA binding protein: Effects of mutations and treatments that alter levels of exonuclease V or RecA protein

    International Nuclear Information System (INIS)

    Lieberman, H.B.; Witkin, E.M.

    1983-01-01

    Certain strains suppress the temperature-sensitivity caused by ssb-1, which encodes a mutant ssDNA binding protein (SSB). At 42 0 C, such strains are extremely UV-sensitive, degrade their DNA extensively after UV irradiation, and are defficient in UV mutability and UV induction of recA protein synthesis. We transduced recC22, which eliminates Exonuclease V activity, and recAo281, which causes operator-constitutive synthesis of recA protein, into such an ssb-1 strain. Both double mutants degraded their DNA extensively at 42 0 C after UV irradiation, and both were even more UV-sensitive than the ssb-1 single mutant. We conclude that one or more nucleases other than Exonuclease V degrades DNA in the ssb recC strain, and that recA protein, even if synthesized copiously, can function efficiently in recombinational DNA repair and in control of post-UV DNA degradation only if normal SSB is also present. Pretreatment with nalidixic acid at 30 0 C restored normal UV mutability at 42 0 C, but did not increase UV resistance, in an ssb-1 strain. Another ssb allele, ssb-113, which blocks SOS induction at 30 0 C, increases spontaneous mutability more than tenfold. The ssb-113 allele was transduced into the SOS-constitutive recA730 strain SC30. This double mutant expressed the same elevated spontaneous and UV-induced mutability at 30 0 C as the ssb + recA730 strain, and was three times more UV-resistant than its ssb-113 recA + parent. We conclude that ssb-1 at 42 0 C and ssb-113 at 30 0 C block UV-induced activation of recA protease, but that neither allele interferes with subsequent steps in SOS-mediated mutagenesis. (orig.)

  14. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.

    1982-01-01

    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  15. In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides

    International Nuclear Information System (INIS)

    Oppenheim, Amos B.; Rattray, Alison J.; Bubunenko, Mikhail; Thomason, Lynn C.; Court, Donald L.

    2004-01-01

    We demonstrate that the bacteriophage λ Red functions efficiently recombine linear DNA or single-strand oligonucleotides (ss-oligos) into bacteriophage λ to create specific changes in the viral genome. Point mutations, deletions, and gene replacements have been created. While recombineering with oligonucleotides, we encountered other mutations accompanying the desired point mutational change. DNA sequence analysis suggests that these unwanted mutations are mainly frameshift deletions introduced during oligonucleotide synthesis

  16. Interfacing click chemistry with automated oligonucleotide synthesis for the preparation of fluorescent DNA probes containing internal xanthene and cyanine dyes

    DEFF Research Database (Denmark)

    Astakhova, I Kira; Wengel, Jesper

    2013-01-01

    for the first time performed solid-phase copper(I)-catalyzed azide-alkyne cycloaddition (CuAAC) click labeling during the automated phosphoramidite oligonucleotide synthesis followed by postsynthetic click reactions in solution. We demonstrate that our novel strategy is rapid and efficient for the preparation...... Stokes shifts (40-110 nm), quenched fluorescence of single-stranded probes accompanied by up to 7.7-fold light-up effect of emission upon target DNA/RNA binding, remarkable sensitivity to single-nucleotide mismatches, generally high fluorescence brightness values (FB up to 26), and hence low limit...

  17. Probe and method for DNA detection

    Science.gov (United States)

    Yeh, Hsin-Chih; Werner, James Henry; Sharma, Jaswinder Kumar; Martinez, Jennifer Suzanne

    2013-07-02

    A hybridization probe containing two linear strands of DNA lights up upon hybridization to a target DNA using silver nanoclusters that have been templated onto one of the DNA strands. Hybridization induces proximity between the nanoclusters on one strand and an overhang on the other strand, which results in enhanced fluorescence emission from the nanoclusters.

  18. Development and application of DNA molecular probes

    Directory of Open Access Journals (Sweden)

    Priya Vizzini

    2017-02-01

    Full Text Available The development of DNA probes started from 1950's for diagnostic purposes and it is still growing. DNA probes are applied in several fields such as food, medical, veterinary, environment and security, with the aim of prevention, diagnosis and treatment. The use of DNA probes permits microorganism identification, including pathogen detection, and their quantification when used in specific systems. Various techniques obtained success by the utilization of specific DNA probes, that allowed the obtainment of rapid and specific results. From PCR, qPCR and blotting techniques that were first used in well equipped laboratories to biosensors such as fiber optic, surface plasmon resonance (SPR, electrochemical, and quartz crystal microbalance (QCM biosensors that use different transduction systems. This review describes i the design and production of primers and probes, and their utilization from the traditional techniques to the new emerging techniques like biosensors used in current applications; ii the possibility to use labelled-free probes and probes labelled with an enzyme/fluorophore, etc.; iii the different sensitivity obtained by using specific systems; and iv the advantage obtained by using biosensors.

  19. Modeling Hybridization Kinetics of Gene Probes in a DNA Biochip Using FEMLAB

    Science.gov (United States)

    Munir, Ahsan; Waseem, Hassan; Williams, Maggie R.; Stedtfeld, Robert D.; Gulari, Erdogan; Tiedje, James M.; Hashsham, Syed A.

    2017-01-01

    Microfluidic DNA biochips capable of detecting specific DNA sequences are useful in medical diagnostics, drug discovery, food safety monitoring and agriculture. They are used as miniaturized platforms for analysis of nucleic acids-based biomarkers. Binding kinetics between immobilized single stranded DNA on the surface and its complementary strand present in the sample are of interest. To achieve optimal sensitivity with minimum sample size and rapid hybridization, ability to predict the kinetics of hybridization based on the thermodynamic characteristics of the probe is crucial. In this study, a computer aided numerical model for the design and optimization of a flow-through biochip was developed using a finite element technique packaged software tool (FEMLAB; package included in COMSOL Multiphysics) to simulate the transport of DNA through a microfluidic chamber to the reaction surface. The model accounts for fluid flow, convection and diffusion in the channel and on the reaction surface. Concentration, association rate constant, dissociation rate constant, recirculation flow rate, and temperature were key parameters affecting the rate of hybridization. The model predicted the kinetic profile and signal intensities of eighteen 20-mer probes targeting vancomycin resistance genes (VRGs). Predicted signal intensities and hybridization kinetics strongly correlated with experimental data in the biochip (R2 = 0.8131). PMID:28555058

  20. Modeling Hybridization Kinetics of Gene Probes in a DNA Biochip Using FEMLAB

    Directory of Open Access Journals (Sweden)

    Ahsan Munir

    2017-05-01

    Full Text Available Microfluidic DNA biochips capable of detecting specific DNA sequences are useful in medical diagnostics, drug discovery, food safety monitoring and agriculture. They are used as miniaturized platforms for analysis of nucleic acids-based biomarkers. Binding kinetics between immobilized single stranded DNA on the surface and its complementary strand present in the sample are of interest. To achieve optimal sensitivity with minimum sample size and rapid hybridization, ability to predict the kinetics of hybridization based on the thermodynamic characteristics of the probe is crucial. In this study, a computer aided numerical model for the design and optimization of a flow-through biochip was developed using a finite element technique packaged software tool (FEMLAB; package included in COMSOL Multiphysics to simulate the transport of DNA through a microfluidic chamber to the reaction surface. The model accounts for fluid flow, convection and diffusion in the channel and on the reaction surface. Concentration, association rate constant, dissociation rate constant, recirculation flow rate, and temperature were key parameters affecting the rate of hybridization. The model predicted the kinetic profile and signal intensities of eighteen 20-mer probes targeting vancomycin resistance genes (VRGs. Predicted signal intensities and hybridization kinetics strongly correlated with experimental data in the biochip (R2 = 0.8131.

  1. Development of DNA probes for Candida albicans

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, L.L.; Hudson, J.B.

    1988-07-01

    An attempt was made to produce DNA probes that could be used as a rapid and efficient means of detecting candidiasis (invasive Candida infection) in immunocompromised patients. Whole DNA from Candida albicans was digested with restriction endonuclease, and the resulting fragments were randomly cloned into a plasmid vector. Several recombinant plasmids were evaluated for cross-hybridization to various other Candida species, other fungal DNAs, and to nonfungal DNAs. Cross reactions were observed between the probes and different yeasts, but none with unrelated DNAs. Some recombinants were genus-specific, and two of these were applied to the analysis of C. albicans growth curves. It became evident that, although both /sup 32/P- and biotin-labelled probes could be made quite sensitive, a possible limitation in their diagnostic potential was the poor liberation of Candida DNA from cells. Thus, better methods of treatment of clinical specimens will be required before such probes will be useful in routine diagnosis.

  2. Development of DNA probes for Candida albicans

    International Nuclear Information System (INIS)

    Cheung, L.L.; Hudson, J.B.

    1988-01-01

    An attempt was made to produce DNA probes that could be used as a rapid and efficient means of detecting candidiasis (invasive Candida infection) in immunocompromised patients. Whole DNA from Candida albicans was digested with restriction endonuclease, and the resulting fragments were randomly cloned into a plasmid vector. Several recombinant plasmids were evaluated for cross-hybridization to various other Candida species, other fungal DNAs, and to nonfungal DNAs. Cross reactions were observed between the probes and different yeasts, but none with unrelated DNAs. Some recombinants were genus-specific, and two of these were applied to the analysis of C. albicans growth curves. It became evident that, although both 32 P- and biotin-labelled probes could be made quite sensitive, a possible limitation in their diagnostic potential was the poor liberation of Candida DNA from cells. Thus, better methods of treatment of clinical specimens will be required before such probes will be useful in routine diagnosis

  3. Spectroscopic studies of DNA interactions with food colorant indigo carmine with the use of ethidium bromide as a fluorescence probe.

    Science.gov (United States)

    Ma, Yadi; Zhang, Guowen; Pan, Junhui

    2012-10-31

    The interaction of indigo carmine (IC) with calf thymus DNA in physiological buffer (pH 7.4), using ethidium bromide (EB) dye as a fluorescence probe, was investigated by ultraviolet-visible absorption, fluorescence, and circular dichroism (CD) spectroscopy, coupled with viscosity measurements and DNA-melting studies. Hypochromicity of the absorption spectra of IC and enhancement in fluorescence polarization of IC were observed with the addition of DNA. Moreover, the binding of IC to DNA was able to decrease iodide and single-stranded DNA (ssDNA) quenching effects, increase the melting temperature and relative viscosity of DNA, and induce the changes in CD spectra of DNA. All of the evidence indicated that IC interacted with DNA in the mode of intercalative binding. Furthermore, the three-way synchronous fluorescence spectra data obtained from the interaction between IC and DNA-EB were resolved by parallel factor analysis (PARAFAC), and the results provided simultaneously the concentration information and the pure spectra for the three reaction components (IC, EB, and DNA-EB) of the system at equilibrium. This PARAFAC demonstrated that the intercalation of IC molecules into DNA proceeded by substituting for EB in the DNA-EB complex. The calculated thermodynamic parameters, ΔH° and ΔS°, suggested that both hydrophobic interactions and hydrogen bonds played a predominant role in the binding of IC to DNA.

  4. A New FRET-Based Sensitive DNA Sensor for Medical Diagnostics using PNA Probe and Water-Soluble Blue Light Emitting Polymer

    Directory of Open Access Journals (Sweden)

    Nidhi Mathur

    2008-01-01

    Full Text Available A reliable, fast, and low-cost biosensor for medical diagnostics using DNA sequence detection has been developed and tested for the detection of the bacterium “Bacillus anthracis.” In this sensor, Poly [9,9-di (6,6′- N, N′ trimethylammonium hexylfluorenyl-2, 7-diyl-alt-co- (1,4-phenylene] dibromide salt (PFP has been taken as cationic conjugated polymer (CCP and PNA attached with fluorescein dye (PNAC∗ as a probe. The basic principle of this sensor is that when a PNAC∗ probe is hybridized with a single strand DNA (ssDNA having complementary sequence, Forster resonance energy transfer (FRET may take place from PFP to the PNAC∗/DNA complex. If the FRET is efficient, the photoluminescence from the PFP will be highly quenched and that from PNAC∗ will be enhanced. On the other hand, if the DNA sequence is noncomplementary to PNA, FRET will not occur.

  5. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)

    student

    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  6. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth

    2014-01-01

    . We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices......Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells...

  7. Chromosome-specific DNA Repeat Probes

    Energy Technology Data Exchange (ETDEWEB)

    Baumgartner, Adolf; Weier, Jingly Fung; Weier, Heinz-Ulrich G.

    2006-03-16

    In research as well as in clinical applications, fluorescence in situ hybridization (FISH) has gained increasing popularity as a highly sensitive technique to study cytogenetic changes. Today, hundreds of commercially available DNA probes serve the basic needs of the biomedical research community. Widespread applications, however, are often limited by the lack of appropriately labeled, specific nucleic acid probes. We describe two approaches for an expeditious preparation of chromosome-specific DNAs and the subsequent probe labeling with reporter molecules of choice. The described techniques allow the preparation of highly specific DNA repeat probes suitable for enumeration of chromosomes in interphase cell nuclei or tissue sections. In addition, there is no need for chromosome enrichment by flow cytometry and sorting or molecular cloning. Our PCR-based method uses either bacterial artificial chromosomes or human genomic DNA as templates with {alpha}-satellite-specific primers. Here we demonstrate the production of fluorochrome-labeled DNA repeat probes specific for human chromosomes 17 and 18 in just a few days without the need for highly specialized equipment and without the limitation to only a few fluorochrome labels.

  8. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes

    OpenAIRE

    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  9. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Science.gov (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  10. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong

    2011-04-01

    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  11. Assaying multiple restriction endonucleases functionalities and inhibitions on DNA microarray with multifunctional gold nanoparticle probes.

    Science.gov (United States)

    Ma, Lan; Zhu, Zhijun; Li, Tao; Wang, Zhenxin

    2014-02-15

    Herein, a double-stranded (ds) DNA microarray-based resonance light scattering (RLS) assay with multifunctional gold nanoparticle (GNP) probes has been developed for studying restriction endonuclease functionality and inhibition. Because of decreasing significantly melting temperature, the enzyme-cleaved dsDNAs easily unwind to form single-stranded (ss) DNAs. The ssDNAs are hybridized with multiplex complementary ssDNAs functionalized GNP probes followed by silver enhancement and RLS detection. Three restriction endonucleases (EcoRI, BamHI and EcoRV) and three potential inhibitors (doxorubicin hydrochloride (DOX), ethidium bromide (EB) and an EcoRI-derived helical peptide (α4)) were selected to demonstrate capability of the assay. Enzyme activities of restriction endonucleases are detected simultaneously with high specificity down to the limits of 2.0 × 10(-2)U/mL for EcoRI, 1.1 × 10(-2)U/mL for BamHI and 1.6 × 10(-2)U/mL for EcoRV, respectively. More importantly, the inhibitory potencies of three inhibitors are showed quantitatively, indicating that our approach has great promise for high-throughput screening of restriction endonuclease inhibitors. © 2013 Elsevier B.V. All rights reserved.

  12. Detection of human DNA polymorphisms with a simplified denaturing gradient gel electrophoresis technique.

    OpenAIRE

    Noll, W W; Collins, M

    1987-01-01

    Single base pair differences between otherwise identical DNA molecules can result in altered melting behavior detectable by denaturing gradient gel electrophoresis. We have developed a simplified procedure for using denaturing gradient gel electrophoresis to detect base pair changes in genomic DNA. Genomic DNA is digested with restriction enzymes and hybridized in solution to labeled single-stranded probe DNA. The excess probe is then hybridized to complementary phage M13 template DNA, and th...

  13. Hydration induced stress on DNA monolayers grafted on microcantilevers.

    Science.gov (United States)

    Domínguez, Carmen M; Kosaka, Priscila M; Mokry, Guillermo; Pini, Valerio; Malvar, Oscar; del Rey, Mercedes; Ramos, Daniel; San Paulo, Alvaro; Tamayo, Javier; Calleja, Montserrat

    2014-09-16

    Surface tethered single-stranded DNA films are relevant biorecognition layers for oligonucleotide sequence identification. Also, hydration induced effects on these films have proven useful for the nanomechanical detection of DNA hybridization. Here, we apply nanomechanical sensors and atomic force microscopy to characterize in air and upon varying relative humidity conditions the swelling and deswelling of grafted single stranded and double stranded DNA films. The combination of these techniques validates a two-step hybridization process, where complementary strands first bind to the surface tethered single stranded DNA probes and then slowly proceed to a fully zipped configuration. Our results also demonstrate that, despite the slow hybridization kinetics observed for grafted DNA onto microcantilever surfaces, ex situ sequence identification does not require hybridization times typically longer than 1 h, while quantification is a major challenge.

  14. Elastic properties of alternative versus single-stranded leveling archwires.

    Science.gov (United States)

    Rucker, Brian K; Kusy, Robert P

    2002-11-01

    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  15. Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries

    Science.gov (United States)

    Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-ting; Gulari, Erdogan; Rouillard, Jean-Marie

    2016-01-01

    Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection–based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization. PMID:26054766

  16. Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

    Science.gov (United States)

    Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

    2015-06-01

    Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

  17. Surface and bulk dissolution properties, and selectivity of DNA-linked nanoparticle assemblies

    NARCIS (Netherlands)

    Lukatsky, D.B.; Frenkel, D.

    2005-01-01

    Using a simple mean-field model, we analyze the surface and bulk dissolution properties of DNA-linked nanoparticle assemblies. We find that the dissolution temperature and the sharpness of the dissolution profiles increase with the grafting density of the single-stranded DNA "probes" on the surface

  18. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan

    2015-01-01

    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  19. Electrochemical DNA Biosensor Based on a Tetrahedral Nanostructure Probe for the Detection of Avian Influenza A (H7N9) Virus.

    Science.gov (United States)

    Dong, Shibiao; Zhao, Rongtao; Zhu, Jiangong; Lu, Xiao; Li, Yang; Qiu, Shaofu; Jia, Leili; Jiao, Xiong; Song, Shiping; Fan, Chunhai; Hao, RongZhang; Song, HongBin

    2015-04-29

    A DNA tetrahedral nanostructure-based electrochemical biosensor was developed to detect avian influenza A (H7N9) virus through recognizing a fragment of the hemagglutinin gene sequence. The DNA tetrahedral probe was immobilized onto a gold electrode surface based on self-assembly between three thiolated nucleotide sequences and a longer nucleotide sequence containing complementary DNA to hybridize with the target single-stranded (ss)DNA. The captured target sequence was hybridized with a biotinylated-ssDNA oligonucleotide as a detection probe, and then avidin-horseradish peroxidase was introduced to produce an amperometric signal through the interaction with 3,3',5,5'-tetramethylbenzidine substrate. The target ssDNA was obtained by asymmetric polymerase chain reaction (PCR) of the cDNA template, reversely transcribed from the viral lysate of influenza A (H7N9) virus in throat swabs. The results showed that this electrochemical biosensor could specifically recognize the target DNA fragment of influenza A (H7N9) virus from other types of influenza viruses, such as influenza A (H1N1) and (H3N2) viruses, and even from single-base mismatches of oligonucleotides. Its detection limit could reach a magnitude of 100 fM for target nucleotide sequences. Moreover, the cycle number of the asymmetric PCR could be reduced below three with the electrochemical biosensor still distinguishing the target sequence from the negative control. To the best of our knowledge, this is the first report of the detection of target DNA from clinical samples using a tetrahedral DNA probe functionalized electrochemical biosensor. It displays that the DNA tetrahedra has a great potential application as a probe of the electrochemical biosensor to detect avian influenza A (H7N9) virus and other pathogens at the gene level, which will potentially aid the prevention and control of the disease caused by such pathogens.

  20. Genetic evidence for single-strand lesions initiating Nbs1-dependent homologous recombination in diversification of Ig v in chicken B lymphocytes.

    Directory of Open Access Journals (Sweden)

    Makoto Nakahara

    2009-01-01

    Full Text Available Homologous recombination (HR is initiated by DNA double-strand breaks (DSB. However, it remains unclear whether single-strand lesions also initiate HR in genomic DNA. Chicken B lymphocytes diversify their Immunoglobulin (Ig V genes through HR (Ig gene conversion and non-templated hypermutation. Both types of Ig V diversification are initiated by AID-dependent abasic-site formation. Abasic sites stall replication, resulting in the formation of single-stranded gaps. These gaps can be filled by error-prone DNA polymerases, resulting in hypermutation. However, it is unclear whether these single-strand gaps can also initiate Ig gene conversion without being first converted to DSBs. The Mre11-Rad50-Nbs1 (MRN complex, which produces 3' single-strand overhangs, promotes the initiation of DSB-induced HR in yeast. We show that a DT40 line expressing only a truncated form of Nbs1 (Nbs1(p70 exhibits defective HR-dependent DSB repair, and a significant reduction in the rate--though not the fidelity--of Ig gene conversion. Interestingly, this defective gene conversion was restored to wild type levels by overproduction of Escherichia coli SbcB, a 3' to 5' single-strand-specific exonuclease, without affecting DSB repair. Conversely, overexpression of chicken Exo1 increased the efficiency of DSB-induced gene-targeting more than 10-fold, with no effect on Ig gene conversion. These results suggest that Ig gene conversion may be initiated by single-strand gaps rather than by DSBs, and, like SbcB, the MRN complex in DT40 may convert AID-induced lesions into single-strand gaps suitable for triggering HR. In summary, Ig gene conversion and hypermutation may share a common substrate-single-stranded gaps. Genetic analysis of the two types of Ig V diversification in DT40 provides a unique opportunity to gain insight into the molecular mechanisms underlying the filling of gaps that arise as a consequence of replication blocks at abasic sites, by HR and error

  1. Highly specific detection of genetic modification events using an enzyme-linked probe hybridization chip.

    Science.gov (United States)

    Zhang, M Z; Zhang, X F; Chen, X M; Chen, X; Wu, S; Xu, L L

    2015-08-10

    The enzyme-linked probe hybridization chip utilizes a method based on ligase-hybridizing probe chip technology, with the principle of using thio-primers for protection against enzyme digestion, and using lambda DNA exonuclease to cut multiple PCR products obtained from the sample being tested into single-strand chains for hybridization. The 5'-end amino-labeled probe was fixed onto the aldehyde chip, and hybridized with the single-stranded PCR product, followed by addition of a fluorescent-modified probe that was then enzymatically linked with the adjacent, substrate-bound probe in order to achieve highly specific, parallel, and high-throughput detection. Specificity and sensitivity testing demonstrated that enzyme-linked probe hybridization technology could be applied to the specific detection of eight genetic modification events at the same time, with a sensitivity reaching 0.1% and the achievement of accurate, efficient, and stable results.

  2. A Fluorescent Probe to Measure DNA Damage and Repair.

    Directory of Open Access Journals (Sweden)

    Allison G Condie

    Full Text Available DNA damage and repair is a fundamental process that plays an important role in cancer treatment. Base excision repair (BER is a major repair pathway that often leads to drug resistance in DNA-targeted cancer chemotherapy. In order to measure BER, we have developed a near infrared (NIR fluorescent probe. This probe binds to a key intermediate, termed apurinic/apyrimidinic (AP site, in the BER pathway where DNA damage and repair occurs. We have developed an assay to show the efficacy of the probe binding to AP sites and have shown that it can distinguish AP sites in DNA extract from chemotherapy treated cells. This probe has potential application in monitoring patient response to chemotherapy and evaluating new drugs in development.

  3. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong

    2008-01-01

    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  4. Gene Specific Impedimetric Bacterial DNA Sensor for Rheumatic Heart Disease.

    Science.gov (United States)

    Singh, Swati; Kaushal, Ankur; Gupta, Sunil; Kumar, Ashok

    2017-03-01

    An impedimetric mga gene specific DNA sensor was developed by immobilization of single stranded DNA probe onto the screen printed modified gold-dendrimer nanohybrid composite electrode for early and rapid detection of S. pyogenes in human throat swab samples causing rheumatic heart disease. Electrochemical impedance response was measured after hybridization with bacterial single stranded genomic DNA (ssG-DNA) with probe. The sensor was found highly specific to S. pyogenes and can detect as low as 0.01 ng ssDNA in 6 µL sample only in 30 min. The nanohybrid sensor was also tested with non-specific pathogens and characterized by FTIR. An early detection of the pathogen S. pyogenes in human can save damage of mitral and aortic heart valves (rheumatic heart disease) by proper medical care.

  5. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2003-01-01

    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  6. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska

    2017-12-01

    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  7. Towards HIV detection: Novel Poly(propylene imine) Dendrimer-Streptavidin platform for electrochemical DNA and gp120 aptamer biosensors

    CSIR Research Space (South Africa)

    John, SV

    2014-07-01

    Full Text Available a marked reduction in charge transfer resistance (Rct) after modification. The biosensor was prepared by the immobilisation of single stranded 5'- biotynilated probe DNA and B40 aptamer on the modified electrode and then used to detect complementary...

  8. Probe Selection for DNA Microarrays using OligoWiz

    DEFF Research Database (Denmark)

    Wernersson, Rasmus; Juncker, Agnieszka; Nielsen, Henrik Bjørn

    2007-01-01

    Nucleotide abundance measurements using DNA microarray technology are possible only if appropriate probes complementary to the target nucleotides can be identified. Here we present a protocol for selecting DNA probes for microarrays using the OligoWiz application. OligoWiz is a client-server appl......Nucleotide abundance measurements using DNA microarray technology are possible only if appropriate probes complementary to the target nucleotides can be identified. Here we present a protocol for selecting DNA probes for microarrays using the OligoWiz application. OligoWiz is a client......-server application that offers a detailed graphical interface and real-time user interaction on the client side, and massive computer power and a large collection of species databases (400, summer 2007) on the server side. Probes are selected according to five weighted scores: cross-hybridization, deltaT(m), folding...... computer skills and can be executed from any Internet-connected computer. The probe selection procedure for a standard microarray design targeting all yeast transcripts can be completed in 1 h....

  9. Small DNA circles as probes of DNA topology.

    Science.gov (United States)

    Bates, Andrew D; Noy, Agnes; Piperakis, Michael M; Harris, Sarah A; Maxwell, Anthony

    2013-04-01

    Small DNA circles can occur in Nature, for example as protein-constrained loops, and can be synthesized by a number of methods. Such small circles provide tractable systems for the study of the structure, thermodynamics and molecular dynamics of closed-circular DNA. In the present article, we review the occurrence and synthesis of small DNA circles, and examine their utility in studying the properties of DNA and DNA-protein interactions. In particular, we highlight the analysis of small circles using atomistic simulations.

  10. DNA probes for the detection of Fasciola hepatica in snails.

    Science.gov (United States)

    Heussler, V; Kaufmann, H; Strahm, D; Liz, J; Dobbelaere, D

    1993-08-01

    Fasciola hepatica, also called the large liver fluke, is a trematode which can infect most mammals. Monitoring the infection rate of snails, which function as intermediate hosts and harbour larval stages of F. hepatica, is an important component of epidemiological studies on fascioliasis. For this purpose, DNA probes were generated which can be used for the detection of F. hepatica larvae in snails. Four highly repetitive DNA fragments were cloned in a plasmid vector and tested by Southern blot hybridization to the DNA of various trematodes for specificity and sensitivity. The probes Fhr-I, Fhr-II and Fhr-III hybridized only to F. hepatica DNA. Fhr-IV contained ribosomal RNA gene sequences and cross-hybridize with the DNA from various other trematode species. Squash blot analysis showed that the different probes were able to detect the parasite larvae in trematode-infected snails even as isolated single larvae. No signals were obtained in squash blots of uninfected snails. Probes Fhr-I, Fhr-II and Fhr-III are thus useful specific tools for studying the epidemiology of fascioliasis. The probe Fhr-IV, because of its broader spectrum, can be used to detect the larvae of a wide range of trematode species of waterbirds, which are the causative agents of swimmer's itch.

  11. Colorimetric DNA detection of transgenic plants using gold nanoparticles functionalized with L-shaped DNA probes

    Science.gov (United States)

    Nourisaeid, Elham; Mousavi, Amir; Arpanaei, Ayyoob

    2016-01-01

    In this study, a DNA colorimetric detection system based on gold nanoparticles functionalized with L-shaped DNA probes was prepared and evaluated. We investigated the hybridization efficiency of the L-shaped probes and studied the effect of nanoparticle size and the L-shaped DNA probe length on the performance of the as-prepared system. Probes were attached to the surface of gold nanoparticles using an adenine sequence. An optimal sequence of 35S rRNA gene promoter from the cauliflower mosaic virus, which is frequently used in the development of transgenic plants, and the two complementary ends of this gene were employed as model target strands and probe molecules, respectively. The spectrophotometric properties of the as-prepared systems indicated that the large NPs show better changes in the absorption spectrum and consequently present a better performance. The results of this study revealed that the probe/Au-NPs prepared using a vertical spacer containing 5 thymine oligonucleotides exhibited a stronger spectrophotometric response in comparison to that of larger probes. These results in general indicate the suitable performance of the L-shaped DNA probe-functionalized Au-NPs, and in particular emphasize the important role of the gold nanoparticle size and length of the DNA probes in enhancing the performance of such a system.

  12. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism.

    Science.gov (United States)

    Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong

    2016-07-01

    A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.

  13. A high throughput system for the preparation of single stranded templates grown in microculture.

    Science.gov (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M

    1994-01-01

    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  14. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)

    1994-09-01

    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  15. Electrochemical DNA probe for Hg(2+) detection based on a triple-helix DNA and Multistage Signal Amplification Strategy.

    Science.gov (United States)

    Wang, Huan; Zhang, Yihe; Ma, Hongmin; Ren, Xiang; Wang, Yaoguang; Zhang, Yong; Wei, Qin

    2016-12-15

    In this work, an ultrasensitive electrochemical sensor was developed for detection of Hg(2+). Gold nanoparticles decorated bovine serum albumin reduction of graphene oxide (AuNP-BSA-rGO) were used as subsurface material for the immobilization of triple-helix DNA. The triple-helix DNA containing a thiol labelled single-stranded DNA (sDNA) and a thymine-rich DNA (T-rich DNA), which could be unwinded in the present of Hg(2+) to form more stable thymine-Hg(2+)-thymine (T-Hg(2+)-T) complex. T-Hg(2+)-T complex was then removed and the sDNA was left on the electrode. At this time, gold nanoparticle carrying thiol labelled cytosine-rich complementary DNA (cDNA-AuNP) could bind with the free sDNA. Meanwhile, the other free cDNA on AuNP could bind with each other in the present of Ag(+) to form the stable cytosine-Ag(+)-cytosine (C-Ag(+)-C) complex and circle amplification. Plenty of C-Ag(+)-C could form silver nanoclusters by electrochemical reduction and the striping signal of Ag could be measured for purpose of the final electrochemical detection of Hg(2+). This sensor could detect Hg(2+) over a wide concentration range from 0.1 to 130nM with a detection limit of 0.03nM. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Synthetic Nucleotides as Probes of DNA Polymerase Specificity

    Directory of Open Access Journals (Sweden)

    Jason M. Walsh

    2012-01-01

    Full Text Available The genetic code is continuously expanding with new nucleobases designed to suit specific research needs. These synthetic nucleotides are used to study DNA polymerase dynamics and specificity and may even inhibit DNA polymerase activity. The availability of an increasing chemical diversity of nucleotides allows questions of utilization by different DNA polymerases to be addressed. Much of the work in this area deals with the A family DNA polymerases, for example, Escherichia coli DNA polymerase I, which are DNA polymerases involved in replication and whose fidelity is relatively high, but more recent work includes other families of polymerases, including the Y family, whose members are known to be error prone. This paper focuses on the ability of DNA polymerases to utilize nonnatural nucleotides in DNA templates or as the incoming nucleoside triphosphates. Beyond the utility of nonnatural nucleotides as probes of DNA polymerase specificity, such entities can also provide insight into the functions of DNA polymerases when encountering DNA that is damaged by natural agents. Thus, synthetic nucleotides provide insight into how polymerases deal with nonnatural nucleotides as well as into the mutagenic potential of nonnatural nucleotides.

  17. DNA/DNA in situ hybridization with enzyme linked probes

    Energy Technology Data Exchange (ETDEWEB)

    Grillo, S.; Mosher, M.; Charles, P.; Henry, S.; Taub, F.

    1987-05-01

    A non-radioactive in situ nucleic acid hybridization method which requires no antibodies, haptens, avidin or biotin intermediateries is presented. Horseradish peroxidase (HRP) labeled nucleic acid probes are hybridized in situ for 2 hours or less, followed by brief washing of hybridized cells and the direct detection of in situ hybrids with diaminobenzidine (DAB). Application of this method to the detection of Human Papilloma Virus (HPV) in human cells is shown.

  18. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  19. Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library.

    Directory of Open Access Journals (Sweden)

    Sumate Pengpumkiat

    Full Text Available Chemical synthesis of oligonucleotides is a widely used tool in the field of biochemistry. Several methods for gene synthesis have been introduced in the growing area of genomics. In this paper, a novel method of constructing dsDNA is proposed. Short (28-mer oligo fragments from a library were assembled through successive annealing and ligation processes, followed by PCR. First, two oligo fragments annealed to form a dsDNA molecule. The double-stranded oligo was immobilized onto magnetic beads (solid support via streptavidin-biotin binding. Next, single-stranded oligo fragments were added successively through ligation to form the complete DNA molecule. The synthesized DNA was amplified through PCR and gel electrophoresis was used to characterize the product. Sanger sequencing showed that more than 97% of the nucleotides matched the expected sequence. Extending the length of the DNA molecule by adding single-stranded oligonucleotides from a basis set (library via ligation enables a more convenient and rapid mechanism for the design and synthesis of oligonucleotides on the go. Coupled with an automated dispensing system and libraries of short oligo fragments, this novel DNA synthesis method would offer an efficient and cost-effective method for producing dsDNA.

  20. Validation of DNA probes for molecular cytogenetics by mapping onto immobilized circular DNA

    Energy Technology Data Exchange (ETDEWEB)

    Greulich-Bode, Karin; Wang, Mei; Rhein, Andreas; Weier, Jingly; Weier, Heinz-Ulli

    2008-12-16

    Fluorescence in situ hybridization (FISH) is a sensitive and rapid procedure to detect gene rearrangements in tumor cells using non-isotopically labeled DNA probes. Large insert recombinant DNA clones such as bacterial artificial chromosome (BAC) or P1/PAC clones have established themselves in recent years as preferred starting material for probe preparations due to their low rates of chimerism and ease of use. However, when developing probes for the quantitative analysis of rearrangements involving genomic intervals of less than 100kb, careful probe selection and characterization are of paramount importance. We describe a sensitive approach to quality control probe clones suspected of carrying deletions or for measuring clone overlap with near kilobase resolution. The method takes advantage of the fact that P1/PAC/BAC's can be isolated as circular DNA molecules, stretched out on glass slides and fine-mapped by multicolor hybridization with smaller probe molecules. Two examples demonstrate the application of this technique: mapping of a gene-specific {approx}6kb plasmid onto an unusually small, {approx}55kb circular P1 molecule and the determination of the extent of overlap between P1 molecules homologous to the human NF-?B2 locus. The relatively simple method presented here does not require specialized equipment and may thus find widespread applications in DNA probe preparation and characterization, the assembly of physical maps for model organisms or in studies on gene rearrangements.

  1. Validation of DNA probes for molecular cytogenetics by mapping onto immobilized circular DNA

    Energy Technology Data Exchange (ETDEWEB)

    Greulich-Bode, Karin M.; Wang, Mei; Rhein, Andreas P.; Weier, Jingly F.; Weier, Heinz-Ulli G.

    2008-12-04

    Fluorescence in situ hybridization (FISH) is a sensitive and rapid procedure to detect gene rearrangements in tumor cells using non-isotopically labeled DNA probes. Large insert recombinant DNA clones such as bacterial artificial chromosome (BAC) or P1/PAC clones have established themselves in recent years as preferred starting material for probe preparations due to their low rates of chimerism and ease of use. However, when developing probes for the quantitative analysis of rearrangements involving genomic intervals of less than 100kb, careful probe selection and characterization are of paramount importance. We describe a sensitive approach to quality control probe clones suspected of carrying deletions or for measuring clone overlap with near kilobase resolution. The method takes advantage of the fact that P1/PAC/BAC's can be isolated as circular DNA molecules, stretched out on glass slides and fine-mapped by multicolor hybridization with smaller probe molecules. Two examples demonstrate the application of this technique: mapping of a gene-specific {approx}6kb plasmid onto an unusually small, {approx}55kb circular P1 molecule and the determination of the extent of overlap between P1 molecules homologous to the human NF-{kappa}B2 locus. The relatively simple method presented here does not require specialized equipment and may thus find widespread applications in DNA probe preparation and characterization, the assembly of physical maps for model organisms or in studies on gene rearrangements.

  2. DNA Probe Pooling for Rapid Delineation of Chromosomal Breakpoints

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Chun-Mei; Kwan, Johnson; Baumgartner, Adolf; Weier, Jingly F.; Wang, Mei; Escudero, Tomas; Munne' , Santiago; Zitzelsberger, Horst F.; Weier, Heinz-Ulrich

    2009-01-30

    Structural chromosome aberrations are hallmarks of many human genetic diseases. The precise mapping of translocation breakpoints in tumors is important for identification of genes with altered levels of expression, prediction of tumor progression, therapy response, or length of disease-free survival as well as the preparation of probes for detection of tumor cells in peripheral blood. Similarly, in vitro fertilization (IVF) and preimplantation genetic diagnosis (PGD) for carriers of balanced, reciprocal translocations benefit from accurate breakpoint maps in the preparation of patient-specific DNA probes followed by a selection of normal or balanced oocytes or embryos. We expedited the process of breakpoint mapping and preparation of case-specific probes by utilizing physically mapped bacterial artificial chromosome (BAC) clones. Historically, breakpoint mapping is based on the definition of the smallest interval between proximal and distal probes. Thus, many of the DNA probes prepared for multi-clone and multi-color mapping experiments do not generate additional information. Our pooling protocol described here with examples from thyroid cancer research and PGD accelerates the delineation of translocation breakpoints without sacrificing resolution. The turnaround time from clone selection to mapping results using tumor or IVF patient samples can be as short as three to four days.

  3. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2001-01-01

    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  4. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP

    1996-01-01

    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  5. Sensitive detection of mercury and copper ions by fluorescent DNA/Ag nanoclusters in guanine-rich DNA hybridization.

    Science.gov (United States)

    Peng, Jun; Ling, Jian; Zhang, Xiu-Qing; Bai, Hui-Ping; Zheng, Liyan; Cao, Qiu-E; Ding, Zhong-Tao

    2015-02-25

    In this work, we designed a new fluorescent oligonucleotides-stabilized silver nanoclusters (DNA/AgNCs) probe for sensitive detection of mercury and copper ions. This probe contains two tailored DNA sequence. One is a signal probe contains a cytosine-rich sequence template for AgNCs synthesis and link sequence at both ends. The other is a guanine-rich sequence for signal enhancement and link sequence complementary to the link sequence of the signal probe. After hybridization, the fluorescence of hybridized double-strand DNA/AgNCs is 200-fold enhanced based on the fluorescence enhancement effect of DNA/AgNCs in proximity of guanine-rich DNA sequence. The double-strand DNA/AgNCs probe is brighter and stable than that of single-strand DNA/AgNCs, and more importantly, can be used as novel fluorescent probes for detecting mercury and copper ions. Mercury and copper ions in the range of 6.0-160.0 and 6-240 nM, can be linearly detected with the detection limits of 2.1 and 3.4 nM, respectively. Our results indicated that the analytical parameters of the method for mercury and copper ions detection are much better than which using a single-strand DNA/AgNCs. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus

    Science.gov (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.

    2016-01-01

    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  7. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast.

    Science.gov (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A

    2010-08-05

    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  8. Psoralens cleave pBR322 DNA under ultraviolet radiation

    International Nuclear Information System (INIS)

    Kagan, J.; Xinsheng Chen; Wang, T.P.

    1992-01-01

    Supercoiled (SC) pBR322 was used to probe the recent claim that 5-geranoxylpsoralen (5-GOP) did not photoreact with DNA. Contrary to expectations, 5-GOP was found to damage DNA in the presence of UV-A through two competing pathways; (a) single strand breaks, identified by the conversion of supercoiled into open circular and linear DNA, and (b) cross-linking, revealed by the fluence-dependent decrease in the extent of denaturation of the double stranded supercoiled DNA to single stranded circular DNA. In addition, a fluence-dependent modification reduced the ability of the restriction enzyme EcoR I to linearize the photosensitized DNA, and alkali-labile lesions were generated. Psoralen, 5-methoxypsoralen, and 8-methoxypsoralen, which are well-known to undergo cycloaddition to DNA, had a more pronounced effect on supercoiled DNA. Single strand breaks occurred more readily than with 5-GOP, and the surviving SC form remaining had reduced electrophoretic mobility in agarose gels. In all cases, the DNA damage was more prominent when oxygen was absent. (author)

  9. Terbium fluorescence as a sensitive, inexpensive probe for UV-induced damage in nucleic acids

    International Nuclear Information System (INIS)

    El-Yazbi, Amira F.; Loppnow, Glen R.

    2013-01-01

    Graphical abstract: -- Highlights: •Simple, inexpensive, mix-and-read assay for positive detection of DNA damage. •Recognition of undamaged DNA via hybridization to a hairpin probe. •Terbium(III) fluorescence reports the amount of damage by binding to ssDNA. •Tb/hairpin is a highly selective and sensitive fluorescent probe for DNA damage. -- Abstract: Much effort has been focused on developing methods for detecting damaged nucleic acids. However, almost all of the proposed methods consist of multi-step procedures, are limited, require expensive instruments, or suffer from a high level of interferences. In this paper, we present a novel simple, inexpensive, mix-and-read assay that is generally applicable to nucleic acid damage and uses the enhanced luminescence due to energy transfer from nucleic acids to terbium(III) (Tb 3+ ). Single-stranded oligonucleotides greatly enhance the Tb 3+ emission, but duplex DNA does not. With the use of a DNA hairpin probe complementary to the oligonucleotide of interest, the Tb 3+ /hairpin probe is applied to detect ultraviolet (UV)-induced DNA damage. The hairpin probe hybridizes only with the undamaged DNA. However, the damaged DNA remains single-stranded and enhances the intrinsic fluorescence of Tb 3+ , producing a detectable signal directly proportional to the amount of DNA damage. This allows the Tb 3+ /hairpin probe to be used for sensitive quantification of UV-induced DNA damage. The Tb 3+ /hairpin probe showed superior selectivity to DNA damage compared to conventional molecular beacons probes (MBs) and its sensitivity is more than 2.5 times higher than MBs with a limit of detection of 4.36 ± 1.2 nM. In addition, this probe is easier to synthesize and more than eight times cheaper than MBs, which makes its use recommended for high-throughput, quantitative analysis of DNA damage

  10. DNA imaging and quantification using chemi-luminescent probes

    International Nuclear Information System (INIS)

    Dorner, G.; Redjdal, N.; Laniece, P.; Siebert, R.; Tricoire, H.; Valentin, L.

    1999-01-01

    During this interdisciplinary study we have developed an ultra sensitive and reliable imaging system of DNA labelled by chemiluminescence. Based on a liquid nitrogen cooled CCD, the system achieves sensitivities down to 10 fg/mm 2 labelled DNA over a surface area of 25 x 25 cm 2 with a sub-millimeter resolution. Commercially available chemi-luminescent - and enhancer molecules are compared and their reaction conditions optimized for best signal-to-noise ratios. Double labelling was performed to verify quantification with radioactive probes. (authors)

  11. Simplified detection of the hybridized DNA using a graphene field effect transistor

    Science.gov (United States)

    Manoharan, Arun Kumar; Chinnathambi, Shanmugavel; Jayavel, Ramasamy; Hanagata, Nobutaka

    2017-01-01

    Abstract Detection of disease-related gene expression by DNA hybridization is a useful diagnostic method. In this study a monolayer graphene field effect transistor (GFET) was fabricated for the detection of a particular single-stranded DNA (target DNA). The probe DNA, which is a single-stranded DNA with a complementary nucleotide sequence, was directly immobilized onto the graphene surface without any linker. The VDirac was shifted to the negative direction in the probe DNA immobilization. A further shift of VDirac in the negative direction was observed when the target DNA was applied to GFET, but no shift was observed upon the application of non-complementary mismatched DNA. Direct immobilization of double-stranded DNA onto the graphene surface also shifted the VDirac in the negative direction to the same extent as that of the shift induced by the immobilization of probe DNA and following target DNA application. These results suggest that the further shift of VDirac after application of the target DNA to the GFET was caused by the hybridization between the probe DNA and target DNA. PMID:28179957

  12. Toxoplasma gondii DNA detection with a magnetic molecular beacon probe

    Science.gov (United States)

    Xu, Shichao; Yao, Cuicui; Wei, Shuoming; Zhang, Jimei; Dai, Zhao; Zheng, Guo; Sun, Bo; Han, Qing; Hu, Fei; Zhou, Hongming

    2008-12-01

    Toxoplasma Gondii infection is widespread in humans worldwide and reported infection rates range from 3%-70%, depending on the populations or geographic areas, and it has been recognized as a potential food safety hazard in our daily life. A magnetic molecular beacon probe (mMBP), based on theory of fluorescence resonance energy transfer (FRET), was currently reported to detect Toxoplasma Gondii DNA. Nano-sized Fe3O4 were primarily prepared by coprecipitation method in aqueous phase with NaOH as precipitator, and was used as magnetic core. The qualified coreshell magnetic quantum dots (mQDs), i.e. CdTe(symbol)Fe3O4, were then achieved by layer-by-layer method when mol ratio of Fe3O4/CdTe is 1/3, pH at 6.0, 30 °C, and reactant solution was refluxed for 30 min, the size of mQDs were determined to be 12-15 nm via transmission electron microscopy (TEM). Over 70% overlap between emission spectrum of mQDs and absorbance spectrum of BHQ-2 was observed, this result suggests the synthesized mQDs and BHQ-2 can be utilized as energy donor and energy acceptor, respectively. The sensing probe was fabricated and a stem-loop Toxoplasma Gondii DNA oligonucleotide was labeled with mQDs at the 5' end and BHQ-2 at 3' end, respectively. Target Toxoplasma gondii DNA was detected under conditions of 37 °C, hybridization for 2h, at pH8.0 in Tris-HCl buffer. About 30% recovery of fluorescence intensity was observed via fluorescence spectrum (FS) after the Toxoplasma gondii DNA was added, which suggested that the Toxoplasma Gondii DNA was successfully detected. Specificity investigation of the mMBP indicated that relative low recovery of fluorescence intensity was obtained when the target DNA with one-base pair mismatch was added, this result indicated the high specificity of the sensing probe. Our research simultaneously indicated that mMBP can be conveniently separated from the unhybridized stem-loop DNA and target DNA, which will be meaningful in DNA sensing and purification process.

  13. Label-free potentiometry for detecting DNA hybridization using peptide nucleic acid and DNA probes.

    Science.gov (United States)

    Goda, Tatsuro; Singi, Ankit Balram; Maeda, Yasuhiro; Matsumoto, Akira; Torimura, Masaki; Aoki, Hiroshi; Miyahara, Yuji

    2013-02-07

    Peptide nucleic acid (PNA) has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM)-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry.

  14. Label-Free Potentiometry for Detecting DNA Hybridization Using Peptide Nucleic Acid and DNA Probes

    Science.gov (United States)

    Goda, Tatsuro; Singi, Ankit Balram; Maeda, Yasuhiro; Matsumoto, Akira; Torimura, Masaki; Aoki, Hiroshi; Miyahara, Yuji

    2013-01-01

    Peptide nucleic acid (PNA) has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM)-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry. PMID:23435052

  15. Normalized cDNA libraries

    Science.gov (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  16. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification

    OpenAIRE

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-01-01

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen...

  17. Intercalation of single-strand oligonucleotides between nucleolipid anionic membranes: a neutron diffraction study.

    Science.gov (United States)

    Milani, Silvia; Berti, Debora; Dante, Silvia; Hauss, Thomas; Baglioni, Piero

    2009-04-07

    This contribution presents a neutron diffraction investigation of anionic lamellar phases composed of mixtures of 1-palmitoyl, 2-oleoyl phosphatidyl-nucleosides (POPN, where N is either adenosine or uridine), and POPC (1-palmitoyl,2-oleoyl-phosphatidyl-choline). Their behavior is studied for two different mole ratios and in the presence of nucleic acids. The samples are formed by the evaporation of liposomal dispersions prepared in water or in solutions containing single-strand oligonucleotides. Previous small angle X-ray scattering (SAXS) experiments on the system POPA/polyU (polyuridylic acid, high degree of polymerization, synthetic ribonucleic acid) proved that the insertion and ordering of the biopolymer in the phospholipid lamellae were driven by molecular recognition. In the present study, we extend the previous investigation to single-strand monodisperse oligonucleotides (50-mers). Structural details of the membranes were obtained from the analysis of the neutron diffraction scattering length density profiles. The evidence of direct and specific interactions, driven by molecular recognition between the nucleic polar heads of the nucleolipid and the single-strand nucleic acid, is strengthened by the comparison with identically charged bilayers formed by POPG/POPC. These results contribute to the understanding of the parameters governing the interactions between nucleolipid membranes and oligonucleotides, providing a novel strategy for the design of lipid-based vehicles for nucleic acids.

  18. Simulation-Guided DNA Probe Design for Consistently Ultraspecific Hybridization

    Science.gov (United States)

    Wang, J. Sherry; Zhang, David Yu

    2015-01-01

    Hybridization of complementary sequences is one of the central tenets of nucleic acid chemistry; however, the unintended binding of closely related sequences limits the accuracy of hybridization-based approaches for analyzing nucleic acids. Thermodynamics-guided probe design and empirical optimization of reaction conditions have been used to enable discrimination of single nucleotide variants, but typically these approaches provide only an approximate 25-fold difference in binding affinity. Here we show that simulations of the binding kinetics are both necessary and sufficient to design nucleic acid probe systems with consistently high specificity as they enable the discovery of an optimal combination of thermodynamic parameters. Simulation-guided probe systems designed against 44 different target single nucleotide variants sequences showed between 200- and 3000-fold (median 890) higher binding affinity than their corresponding wildtype sequences. As a demonstration of the usefulness of this simulation-guided design approach we developed probes which, in combination with PCR amplification, we use to detect low concentrations of variant alleles (1%) in human genomic DNA. PMID:26100802

  19. Detection of Helicobacter Pylori Genome with an Optical Biosensor Based on Hybridization of Urease Gene with a Gold Nanoparticles-Labeled Probe

    Science.gov (United States)

    Shahrashoob, M.; Mohsenifar, A.; Tabatabaei, M.; Rahmani-Cherati, T.; Mobaraki, M.; Mota, A.; Shojaei, T. R.

    2016-05-01

    A novel optics-based nanobiosensor for sensitive determination of the Helicobacter pylori genome using a gold nanoparticles (AuNPs)-labeled probe is reported. Two specific thiol-modified capture and signal probes were designed based on a single-stranded complementary DNA (cDNA) region of the urease gene. The capture probe was immobilized on AuNPs, which were previously immobilized on an APTES-activated glass, and the signal probe was conjugated to different AuNPs as well. The presence of the cDNA in the reaction mixture led to the hybridization of the AuNPs-labeled capture probe and the signal probe with the cDNA, and consequently the optical density of the reaction mixture (AuNPs) was reduced proportionally to the cDNA concentration. The limit of detection was measured at 0.5 nM.

  20. Procedure for normalization of cDNA libraries

    Science.gov (United States)

    Bonaldo, Maria DeFatima; Soares, Marcelo Bento

    1997-01-01

    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

  1. Capillary electrophoresis ribosomal RNA single-stranded conformation polymorphism: a new approach for characterization of low-diversity microbial communities.

    Science.gov (United States)

    Nai, Yi H; Zemb, Oliver; Gutierrez-Zamora, Maria-Luisa; Manefield, Mike; Powell, Shane M; Breadmore, Michael C

    2012-10-01

    Capillary electrophoresis (CE) has been the principle system for nucleic acid analysis since the early 1990s due to its inherent advantages such as fast analysis time, high resolution and efficiency, minimal sample requirement, high detection sensitivity, and automation. In the past few decades, microbial community fingerprinting methods such as terminal restriction fragment length polymorphism and single-stranded conformation polymorphism (SSCP) have migrated to CE to utilize its advantages over conventional slab gel electrophoresis. Recently, a gel-based direct rRNA fingerprint method was demonstrated. Different from other existing microbial community characterization approaches, this novel approach is polymerase chain reaction free and capable of providing information on the relative abundance of rRNA from individual phylotypes in low-diversity samples. As a gel-based method, it has a long analysis time and relatively large reagent and sample requirements. Here, we addressed these limitations by transferring the RNA fingerprint approach to the CE platform. Analysis time significantly improved from 24 h to 60 min, and the use of a fluorescently labeled hybridization probe as the detection strategy decreased the sample requirement by ten-fold. The combination of fast analysis time, low sample requirement, and sensitive fluorescence detection makes CE-RNA-SSCP an appealing new approach for characterizing low-diversity microbial communities.

  2. Effect of secondary structure on the thermodynamics and kinetics of PNA hybridization to DNA hairpins

    DEFF Research Database (Denmark)

    Kushon, S A; Jordan, J P; Seifert, J L

    2001-01-01

    structures in both target and probe molecules are shown to depress the melting temperatures and free energies of the probe-target duplexes. Kinetic analysis of hybridization yields reaction rates that are up to 160-fold slower than hybridization between two unstructured strands. The thermodynamic and kinetic......-DNA and DNA-DNA duplexes can be formed with these target hairpins, even when the melting temperatures for the resulting duplexes are up to 50 degrees C lower than that of the hairpin target. Both hairpin/single-stranded and hairpin/hairpin interactions are considered in the scope of these studies. Secondary...

  3. Protocols for 16S rDNA Array Analyses of Microbial Communities by Sequence-Specific Labeling of DNA Probes

    Directory of Open Access Journals (Sweden)

    Knut Rudi

    2003-01-01

    Full Text Available Analyses of complex microbial communities are becoming increasingly important. Bottlenecks in these analyses, however, are the tools to actually describe the biodiversity. Novel protocols for DNA array-based analyses of microbial communities are presented. In these protocols, the specificity obtained by sequence-specific labeling of DNA probes is combined with the possibility of detecting several different probes simultaneously by DNA array hybridization. The gene encoding 16S ribosomal RNA was chosen as the target in these analyses. This gene contains both universally conserved regions and regions with relatively high variability. The universally conserved regions are used for PCR amplification primers, while the variable regions are used for the specific probes. Protocols are presented for DNA purification, probe construction, probe labeling, and DNA array hybridizations.

  4. Reaction of single-standard DNA with hydroxyl radical generated by iron(II)-ethylenediaminetetraacetic acid

    International Nuclear Information System (INIS)

    Prigodich, R.V.; Martin, C.T.

    1990-01-01

    This study demonstrates that the reaction of Fe(II)-EDTA and hydrogen peroxide with the single-stranded nucleic acids d(pT) 70 and a 29-base sequence containing a mixture of bases results in substantial damage which is not directly detected by gel electrophoresis. Cleavage of the DNA sugar backbone is enhanced significantly after the samples are incubated at 90 degree C in the presence of piperidine. The latter reaction is used in traditional Maxam-Gilbert DNA sequencing to detect base damage, and the current results are consistent with reaction of the hydroxyl radical with the bases in single-stranded DNA (although reaction with sugar may also produce adducts that are uncleaved but labile to cleavage by piperidine). We the authors propose that hydroxyl radicals may react preferentially with the nucleic acid bases in ssDNA and that reaction of the sugars in dsDNA is dominant because the bases are sequestered within the double helix. These results have implications both for the study of single-stranded DNA binding protein binding sites and for the interpretation of experiments using the hydroxyl radical to probe DNA structure or to footprint double-stranded DNA binding protein binding sites

  5. Detection of DNA fingerprints of cultivated rice by hybridization with a human minisatellite DNA probe

    International Nuclear Information System (INIS)

    Dallas, J.F.

    1988-01-01

    A human minisatellite DNA probe detects several restriction fragment length polymorphisms in cultivars of Asian and African rice. Certain fragments appear to be inherited in a Mendelian fashion and may represent unlinked loci. The hybridization patterns appear to be cultivar-specific and largely unchanged after the regeneration of plants from tissue culture. The results suggest that these regions of the rice genome may be used to generate cultivar-specific DNA fingerprints. The demonstration of similarity between a human minisatellite sequence and polymorphic regions in the rice genome suggests that such regions also occur in the genomes of many other plant species

  6. Labelling of HBV-DNA probe using reagent made in China

    International Nuclear Information System (INIS)

    Wang Quanshi

    1991-01-01

    The labelling hepatitis Bvirus DNA (HBV-DNA) probe was studied by using reagent made in China. The results showed that: (1) The dNTPs with high specific activity was necessary for the labelling of nigh specific activity HBV-DNA probe; (2) reaction of labelling HBV-DNA probe was completed in a few minutes; (3) 0.37 MBq 3 H dTTP (specific activity 1.554TBq/mmol) was enough to label 1 μg HBV-DNA and the specific activity of probe reached 3.4 x 10 cpm/μg; (4) 7 MBqα- 32 P dATP (specific activity > 111 TBq/mmol) can label HBV-DNA probe to specific activity 1.35 x 10 cpm/μg. It was concluded that the reagent made in China can be used for the study in molecular biology

  7. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification.

    Science.gov (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-10-07

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  8. Detection of human DNA polymorphisms with a simplified denaturing gradient gel electrophoresis technique

    International Nuclear Information System (INIS)

    Noll, W.W.; Collins, M.

    1987-01-01

    Single base pair differences between otherwise identical DNA molecules can result in altered melting behavior detectable by denaturing gradient gel electrophoresis. The authors have developed a simplified procedure for using denaturing gradient gel electrophoresis to detect base pair changes in genomic DNA. Genomic DNA is digested with restriction enzymes and hybridized in solution to labeled single-stranded probe DNA. The excess probe is then hybridized to complementary phage M13 template DNA, and the reaction mixture is electrophoresed on a denaturing gradient gel. Only the genomic DNA probe hybrids migrate into the gel. Differences in hybrid mobility on the gel indicate base pair changes in the genomic DNA. They have used this technique to identify two polymorphic sites within a 1.2-kilobase region of human chromosome 20. This approach should greatly facilitate the identification of DNA polymorphisms useful for gene linkage studies and the diagnosis of genetic diseases

  9. Iodination as a probe for small regions of disrupted secondary structure in double-stranded DNA

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank; Nes, Ingolf F.; Wells, Robert D.

    1976-01-01

    Conditions were established where the thallium-catalyzed iodination of random coil DNA proceeded 100–200 times faster than for native DNA. This reaction was explored as a probe for localized regions of disrupted base pairs in duplex DNA. A heteroduplex was constructed between DNA fragments produced...

  10. Absorption by DNA single strands of adenine isolated in vacuo: The role of multiple chromophores

    DEFF Research Database (Denmark)

    Nielsen, L.M.; Pedersen, S.O.; Kirketerp, M.-B.S.

    2012-01-01

    to that for the adenine molecule and the dAMP mononucleotide. Desolvation has little effect on the bandwidth, which implies that inhomogenous broadening of the absorption bands in aqueous solution is of minor importance compared to, e.g., conformational disorder. Finally, at high photon energies, internal conversion...

  11. A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B.

    Directory of Open Access Journals (Sweden)

    Jeffrey A DeGrasse

    Full Text Available The bacterium Staphylococcus aureus is a common foodborne pathogen capable of secreting a cocktail of small, stable, and strain-specific, staphylococcal enterotoxins (SEs. Staphylococcal food poisoning (SFP results when improperly handled food contaminated with SEs is consumed. Gastrointestinal symptoms of SFP include emesis, diarrhea and severe abdominal pain, which manifest within hours of ingesting contaminated food. Immuno-affinity based methods directly detect, identify, and quantify several SEs within a food or clinical sample. However, the success of these assays depends upon the availability of a monoclonal antibody, the development of which is non-trivial and costly. The current scope of the available immuno-affinity based methods is limited to the classical SEs and does not encompass all of the known or emergent SEs. In contrast to antibodies, aptamers are short nucleic acids that exhibit high affinity and specificity for their targets without the high-costs and ethical concerns of animal husbandry. Further, researchers may choose to freely distribute aptamers and develop assays without the proprietary issues that increase the per-sample cost of immuno-affinity assays. This study describes a novel aptamer, selected in vitro, with affinity to staphylococcal enterotoxin B (SEB that may be used in lieu of antibodies in SE detection assays. The aptamer, designated APT(SEB1, successfully isolates SEB from a complex mixture of SEs with extremely high discrimination. This work sets the foundation for future aptamer and assay development towards the entire family of SEs. The rapid, robust, and low-cost identification and quantification of all of the SEs in S. aureus contaminated food is essential for food safety and epidemiological efforts. An in vitro generated library of SE aptamers could potentially allow for the comprehensive and cost-effective analysis of food samples that immuno-affinity assays currently cannot provide.

  12. Oxidized base damage and single-strand break repair in mammalian genomes: role of disordered regions and posttranslational modifications in early enzymes.

    Science.gov (United States)

    Hegde, Muralidhar L; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic endonuclease 1 (APE1), form complexes with downstream repair (and other noncanonical) proteins via pairwise interactions. Furthermore, a unique feature of mammalian early BER/SSBR enzymes is the presence of a disordered terminal extension that is absent in their Escherichia coli prototypes. These nonconserved segments usually contain organelle-targeting signals, common interaction interfaces, and sites of posttranslational modifications that may be involved in regulating their repair function including lesion scanning. Finally, the linkage of BER/SSBR deficiency to cancer, aging, and human neurodegenerative diseases, and therapeutic targeting of BER/SSBR are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. Probing protein: DNA interactions using a uniform monolayer of DNA and surface plasmon resonance

    Science.gov (United States)

    Shumaker-Parry, Jennifer S.; Campbell, Charles T.; Stormo, Gary D.; Silbaq, Fauzi S.; Aebersold, Rudolf H.

    2000-04-01

    A method is described for immobilizing double-stranded DNAs to a planar gold surface with high density and uniform spacing. This is accomplished by adsorbing biotinylated DNAs onto a nearly close-packed monolayer of the protein streptavidin. This streptavidin monolayer, which offers approximately 5 X 1012 biotin sites per cm2, is prepared first by adsorbing it onto a mixed self-assembled monolayer on gold which contains biotin-terminated and oligo-terminated alkylthiolates in a 3/7 ratio. This DNA- functionalized surface resists non-specific protein adsorption and is useful for probing the kinetics and equilibrium binding of proteins to DNA with surface plasmon resonance. This is demonstrated with the Mnt protein, which is found to bind in 3.8:1 ratio to its immobilized DNA operator sequence. This is consistent with its behavior in homogeneous solution, where it binds as a tetramer to its DNA. A sequence with a single base-pair mutation shows nearly as much Mnt binding, but a completely random DNA sequence shows only 5 percent of this binding. This proves that DNA-binding proteins bind sequence-specifically to double-stranded DNAs which are immobilized to gold with this streptavidin linker layer.

  14. An Internalin A Probe-Based Genosensor for Listeria monocytogenes Detection and Differentiation

    Directory of Open Access Journals (Sweden)

    Laura Bifulco

    2013-01-01

    Full Text Available Internalin A (InlA, a protein required for Listeria monocytogenes virulence, is encoded by the inlA gene, which is only found in pathogenic strains of this genus. One of the best ways to detect and confirm the pathogenicity of the strain is the detection of one of the virulence factors produced by the microorganism. This paper focuses on the design of an electrochemical genosensor used to detect the inlA gene in Listeria strains without labelling the target DNA. The electrochemical sensor was obtained by immobilising an inlA gene probe (single-stranded oligonucleotide on the surfaces of screen-printed gold electrodes (Au-SPEs by means of a mercaptan-activated self-assembled monolayer (SAM. The hybridisation reaction occurring on the electrode surface was electrochemically transduced by differential pulse voltammetry (DPV using methylene blue (MB as an indicator. The covalently immobilised single-stranded DNA was able to selectively hybridise to its complementary DNA sequences in solution to form double-stranded DNA on the gold surface. A significant decrease of the peak current of the voltammogram (DPV upon hybridisation of immobilised ssDNA was recorded. Whole DNA samples of L. monocytogenes strains could be discriminated from other nonpathogenic Listeria species DNA with the inlA gene DNA probe genosensor.

  15. A Catalytic DNA Probe with Stem-loop Motif for Human T47D Breast Cancer Cells.

    Science.gov (United States)

    Gao, Fei; Liu, Feng; Zheng, Jing; Zeng, MeiYun; Jiang, Yuyang

    2015-01-01

    In vitro selection methods allow for isolation of DNAzymes (catalytic DNAs) from random DNA pools. Here we describe a fluorogenic DNAzyme, LYF5, isolated using a double-random selection approach: a random DNA pool was selected against a complex molecular mixture derived from a breast cancer cell line, T47D. LYF5 specifically indicates the T47D breast cancer cell line with high sensitivity. After sequence optimization, the second-generation DNAzyme, 2G-LYF5, exhibited an approximately 2-fold higher cleavage percentage. Finally, we have determined that the intramolecular stem-loop motif plays a crucial role in 2G-LYF5 activity. Our findings underscore the capability of single-stranded DNA molecules to perform highly sophisticated functions that are amenable to the development of diagnostic tests for early identification of breast cancer.

  16. Empirical model for matching spectrophotometric reflectance of yarn windings and multispectral imaging reflectance of single strands of yarns.

    Science.gov (United States)

    Luo, Lin; Shen, Hui-Liang; Shao, Si-Jie; Xin, John

    2015-08-01

    The state-of-the-art multispectral imaging system can directly acquire the reflectance of a single strand of yarn that is impossible for traditional spectrophotometers. Instead, the spectrophotometric reflectance of a yarn winding, which is constituted by yarns wound on a background card, is regarded as the yarn reflectance in textile. While multispectral imaging systems and spectrophotometers can be separately used to acquire the reflectance of a single strand of yarn and corresponding yarn winding, the quantitative relationship between them is not yet known. In this paper, the relationship is established based on models that describe the spectral response of a spectrophotometer to a yarn winding and that of a multispectral imaging system to a single strand of yarn. The reflectance matching function from a single strand of yarn to corresponding yarn winding is derived to be a second degree polynomial function, which coefficients are the solutions of a constrained nonlinear optimization problem. Experiments on 100 pairs of samples show that the proposed approach can reduce the color difference between yarn windings and single strands of yarns from 2.449 to 1.082 CIEDE2000 units. The coefficients of the optimal reflection matching function imply that the reflectance of a yarn winding measured by a spectrophotometer consists of not only the intrinsic reflectance of yarn but also the nonignorable interreflection component between yarns.

  17. Probing single nanometer-scale pores with polymeric molecular rulers

    Science.gov (United States)

    Henrickson, Sarah E.; DiMarzio, Edmund A.; Wang, Qian; Stanford, Vincent M.; Kasianowicz, John J.

    2010-04-01

    We previously demonstrated that individual molecules of single-stranded DNA can be driven electrophoretically through a single Staphylococcus aureus α-hemolysin ion channel. Polynucleotides thread through the channel as extended chains and the polymer-induced ionic current blockades exhibit stable modes during the interactions. We show here that polynucleotides can be used to probe structural features of the α-hemolysin channel itself. Specifically, both the pore length and channel aperture profile can be estimated. The results are consistent with the channel crystal structure and suggest that polymer-based "molecular rulers" may prove useful in deducing the structures of nanometer-scale pores in general.

  18. The effect of the shape of single, sub-ms voltage pulses on the rates of surface immobilization and hybridization of DNA

    International Nuclear Information System (INIS)

    Cabeca, R; Rodrigues, M; Chu, V; Conde, J P; Prazeres, D M F

    2009-01-01

    Electric fields generated by single square and sinusoidal voltage pulses with amplitudes below 2 V were used to assist the covalent immobilization of single-stranded, thiolated DNA probes, onto a chemically functionalized SiO 2 surface and to assist the specific hybridization of single-stranded DNA targets with immobilized complementary probes. The single-stranded immobilized DNA probes were either covalently immobilized (chemisorption) or electrostatically adsorbed (physisorption) to a chemically functionalized surface. Comparing the speed of electric field assisted immobilization and hybridization with the corresponding control reactions (without electric field), an increase of several orders of magnitude is observed, with the reaction timescaled down from 1 to 2 h to a range between 100 ns and 1 ms. The influence of the shape of the voltage pulse (square versus sinusoidal) and its duration were studied for both immobilization and hybridization reactions. The results show that pulsed electric fields are a useful tool to achieve temporal and spatial control of surface immobilization and hybridization reactions of DNA.

  19. Uropathogenic Escherichia coli virulence genes: invaluable approaches for designing DNA microarray probes.

    Science.gov (United States)

    Jahandeh, Nadia; Ranjbar, Reza; Behzadi, Payam; Behzadi, Elham

    2015-01-01

    The pathotypes of uropathogenic Escherichia coli (UPEC) cause different types of urinary tract infections (UTIs). The presence of a wide range of virulence genes in UPEC enables us to design appropriate DNA microarray probes. These probes, which are used in DNA microarray technology, provide us with an accurate and rapid diagnosis and definitive treatment in association with UTIs caused by UPEC pathotypes. The main goal of this article is to introduce the UPEC virulence genes as invaluable approaches for designing DNA microarray probes. Main search engines such as Google Scholar and databases like NCBI were searched to find and study several original pieces of literature, review articles, and DNA gene sequences. In parallel with in silico studies, the experiences of the authors were helpful for selecting appropriate sources and writing this review article. There is a significant variety of virulence genes among UPEC strains. The DNA sequences of virulence genes are fabulous patterns for designing microarray probes. The location of virulence genes and their sequence lengths influence the quality of probes. The use of selected virulence genes for designing microarray probes gives us a wide range of choices from which the best probe candidates can be chosen. DNA microarray technology provides us with an accurate, rapid, cost-effective, sensitive, and specific molecular diagnostic method which is facilitated by designing microarray probes. Via these tools, we are able to have an accurate diagnosis and a definitive treatment regarding UTIs caused by UPEC pathotypes.

  20. DNA Replication Arrest and DNA Damage Responses Induced by Alkylating Minor Groove Binders

    National Research Council Canada - National Science Library

    Kuo, Shue-Ru

    2001-01-01

    .... Both DNA-PK and the unknown factor are functioned as trans-acting inhibitors. RPA is the major eukaryotic single-stranded DNA binding protein required for DNA replication, repair and recombination...

  1. In situ detection of tandem DNA repeat length

    Energy Technology Data Exchange (ETDEWEB)

    Yaar, R.; Szafranski, P.; Cantor, C.R.; Smith, C.L. [Boston Univ., MA (United States)

    1996-11-01

    A simple method for scoring short tandem DNA repeats is presented. An oligonucleotide target, containing tandem repeats embedded in a unique sequence, was hybridized to a set of complementary probes, containing tandem repeats of known lengths. Single-stranded loop structures formed on duplexes containing a mismatched (different) number of tandem repeats. No loop structure formed on duplexes containing a matched (identical) number of tandem repeats. The matched and mismatched loop structures were enzymatically distinguished and differentially labeled by treatment with S1 nuclease and the Klenow fragment of DNA polymerase. 7 refs., 4 figs.

  2. An improved gold nanoparticle probe-based assay for HCV core antigen ultrasensitive detection.

    Science.gov (United States)

    Yin, Hui-Qiong; Ji, Chang-Fu; Yang, Xi-Qin; Wang, Rui; Yang, Shu; Zhang, He-Qiu; Zhang, Jin-Gang

    2017-05-01

    A gold nanoparticle probe-based assay (GNPA) was developed for ultrasensitive detection of Hepatitis C virus (HCV) core antigen. In the GNPA, after anti-HCV core antigen polyclonal antibodies and single-stranded barcode signal DNA were labeled on gold nanoparticle probe (NP), DNA enzyme was used to degrade the unbound barcode DNAs. The anti-HCV core antigen monoclonal antibodies were coated on magnetic microparticles probe (MMP). Then the NP-HCV core antigen-MMP sandwich immuno-complex was formed when the target antigen protein was added and captured. Magnetically separated, the immuno-complex containing the single-stranded barcode signal DNA was characterized by TaqMan probe based real-time fluorescence PCR. A detection limit of 1 fg/ml was determined for the HCV core antigen which is magnitude greater than that of ELISA (2ng/ml). The coefficients of variation (CV) of intra-assay and inter-assay respectively ranged from 0.22-2.62% and 1.92-3.01%. The improved GNPA decreased the interference of unbound barcode DNAs and may be an new way for HCV core antigen detection. Copyright © 2017. Published by Elsevier B.V.

  3. Torsional regulation of hRPA-induced unwinding of double-stranded DNA

    NARCIS (Netherlands)

    De Vlaminck, I.; Vidic, I.; Van Loenhout, M.T.J.; Kanaar, R.; Lebbink, J.H.G.; Dekker, C.

    2010-01-01

    All cellular single-stranded (ss) DNA is rapidly bound and stabilized by single stranded DNA-binding proteins (SSBs). Replication protein A, the main eukaryotic SSB, is able to unwind double-stranded (ds) DNA by binding and stabilizing transiently forming bubbles of ssDNA. Here, we study the

  4. A versatile proximity-dependent probe based on light-up DNA-scaffolded silver nanoclusters.

    Science.gov (United States)

    Ma, Jin-Liang; Yin, Bin-Cheng; Ye, Bang-Ce

    2016-02-21

    It is well-known that proximity-dependent probes containing an analyte recognization site and a signal formation domain could be assembled specifically into a sandwich-like structure (probe-analyte-probe) via introducing an analyte. In this work, using the design for zirconium ion (Zr(4+)) detection as the model, we develop a novel and reliable proximity-dependent DNA-scaffolded silver nanocluster (DNA/AgNC) probe for Zr(4+) detection via target-induced emitter proximity. The proposed strategy undergoes the two following processes: target-mediated emitter pair proximity as target recognition implement and the synthesis of DNA/AgNCs with fluorescence as a signal reporter. Upon combination of the rationally designed probe with Zr(4+), the intact templates were obtained according to the -PO3(2-)-Zr(4+)-PO3(2-)- pattern. The resultant structure with an emitter pair serves as a potent template to achieve highly fluorescent DNA/AgNCs. To verify the universality of the proposed proximity-dependent DNA/AgNC probe, we extend the application of the proximity-dependent probe to DNA and adenosine triphosphate (ATP) detection by virtue of a specific DNA complementary sequence and ATP aptamer as a recognition unit, respectively. The produced fluorescence enhancement of the DNA/AgNCs in response to the analyte concentration allows a quantitative evaluation of the target, including Zr(4+), DNA, and ATP with detection limits of ∼3.00 μM, ∼9.83 nM, and ∼0.81 mM, respectively. The proposed probe possesses good performance with simple operation, cost-effectiveness, good selectivity, and without separation procedures.

  5. An electrochemical alkaline phosphatase biosensor fabricated with two DNA probes coupled with λ exonuclease.

    Science.gov (United States)

    Miao, Peng; Ning, Limin; Li, Xiaoxi; Shu, Yongqian; Li, Genxi

    2011-09-15

    In this work we have developed a novel electrochemical biosensor for the detection of alkaline phosphatase (AP) by the use of two complementary DNA probes (DNA 1 and DNA 2) coupled with λ exonuclease (λ exo). Firstly, the 5'-phosphoryl end of DNA 1 is dephosphorylated by AP. Then DNA 1 hybridizes with DNA 2, previously modified on a gold electrode surface. In this double-strand DNA, DNA 2 strand will be promptly cleaved by λ exo with its phosphoryl at the 5' end. After the DNA 2 strand is completely digested, DNA 1 will be released from the double strands and then hybridizes with another DNA 2 strand on the electrode surface, thus the cycle of the release of DNA 1 and the digestion of DNA 2 continues. Since the DNA probes may absorb hexaammineruthenium(III) chloride, the electrochemical species, and the removal of the DNA 2 strand from the electrode surface will result in the decrease of the detected electrochemical signal, which is initially activated by AP, an electrochemical biosensor to assay the activity of AP is proposed in this work. This method may have a linear detection range from 1 to 20 unit/mL with a detection limit of 0.1 unit/mL, and the detection of the enzymatic activity in complex biological fluids can also be realized. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol

    2010-05-01

    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  7. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks.

    Science.gov (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P

    2012-09-01

    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  8. Probing structural changes of self assembled i-motif DNA

    KAUST Repository

    Lee, Iljoon

    2015-01-01

    We report an i-motif structural probing system based on Thioflavin T (ThT) as a fluorescent sensor. This probe can discriminate the structural changes of RET and Rb i-motif sequences according to pH change. This journal is

  9. Detection of anthrax lef with DNA-based photonic crystal sensors

    Science.gov (United States)

    Zhang, Bailin; Dallo, Shatha; Peterson, Ralph; Hussain, Syed; Weitao, Tao; Ye, Jing Yong

    2011-12-01

    Bacillus anthracis has posed a threat of becoming biological weapons of mass destruction due to its virulence factors encoded by the plasmid-borne genes, such as lef for lethal factor. We report the development of a fast and sensitive anthrax DNA biosensor based on a photonic crystal structure used in a total-internal-reflection configuration. For the detection of the lef gene, a single-stranded DNA lef probe was biotinylated and immobilized onto the sensor via biotin-streptavidin interactions. A positive control, lef-com, was the complementary strand of the probe, while a negative control was an unrelated single-stranded DNA fragment from the 16S rRNA gene of Acinetobacter baumannii. After addition of the biotinylated lef probe onto the sensor, significant changes in the resonance wavelength of the sensor were observed, resulting from binding of the probe to streptavidin on the sensor. The addition of lef-com led to another significant increase as a result of hybridization between the two DNA strands. The detection sensitivity for the target DNA reached as low as 0.1 nM. In contrast, adding the unrelated DNAs did not cause an obvious shift in the resonant wavelength. These results demonstrate that detection of the anthrax lef by the photonic crystal structure in a total-internal-reflection sensor is highly specific and sensitive.

  10. Combining ligation reaction and capillary gel electrophoresis to obtain reliable long DNA probes.

    Science.gov (United States)

    García-Cañas, Virginia; Mondello, Monica; Cifuentes, Alejandro

    2011-05-01

    New DNA amplification methods are continuously developed for sensitive detection and quantification of specific DNA target sequences for, e.g. clinical, environmental or food applications. These new applications often require the use of long DNA oligonucleotides as probes for target sequences hybridization. Depending on the molecular technique, the length of DNA probes ranges from 40 to 450 nucleotides, solid-phase chemical synthesis being the strategy generally used for their production. However, the fidelity of chemical synthesis of DNA decreases for larger DNA probes. Defects in the oligonucleotide sequence result in the loss of hybridization efficiency, affecting the sensitivity and selectivity of the amplification method. In this work, an enzymatic procedure has been developed as an alternative to solid-phase chemical synthesis for the production of long oligonucleotides. The enzymatic procedure for probe production was based on ligation of short DNA sequences. Long DNA probes were obtained from smaller oligonucleotides together with a short sequence that acts as bridge stabilizing the molecular complex for DNA ligation. The ligation reactions were monitored by capillary gel electrophoresis with laser-induced fluorescence detection (CGE-LIF) using a bare fused-silica capillary. The capillary gel electrophoresis-LIF method demonstrated to be very useful and informative for the characterization of the ligation reaction, providing important information about the nature of some impurities, as well as for the fine optimization of the ligation conditions (i.e. ligation cycles, oligonucleotide and enzyme concentration). As a result, the yield and quality of the ligation product were highly improved. The in-lab prepared DNA probes were used in a novel multiplex ligation-dependent genome amplification (MLGA) method for the detection of genetically modified maize in samples. The great possibilities of the whole approach were demonstrated by the specific and sensitive

  11. Micro-RNA detection based on fluorescence resonance energy transfer of DNA-carbon quantum dots probes.

    Science.gov (United States)

    Khakbaz, Faeze; Mahani, Mohamad

    2017-04-15

    Carbon quantum dots have been proposed as an effective platform for miRNA detection. Carbon dots were synthesized by citric acid. The synthesized dots were characterized by dynamic light scattering, UV-Vis spectrophotometry, spectrofluorimetry, transmission electron microscopy and FT-IR spectrophotometry. The fluorescence quantum yield of the synthesized dots was determined using quinine sulfate as the standard. The FAM-labeled single stranded DNA, as sensing element, was adsorbed on dots by π-π interaction. The quenching of the dots fluorescence due to fluorescence resonance energy transfer (FRET) was used for mir 9-1 detection. In the presence of the complementary miRNA, the FRET did not take place and the fluorescence was recovered. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. DNA probe functionalized QCM biosensor based on gold nanoparticle amplification for Bacillus anthracis detection.

    Science.gov (United States)

    Hao, Rong-Zhang; Song, Hong-Bin; Zuo, Guo-Min; Yang, Rui-Fu; Wei, Hong-Ping; Wang, Dian-Bing; Cui, Zong-Qiang; Zhang, ZhiPing; Cheng, Zhen-Xing; Zhang, Xian-En

    2011-04-15

    The rapid detection of Bacillus anthracis, the causative agent of anthrax disease, has gained much attention since the anthrax spore bioterrorism attacks in the United States in 2001. In this work, a DNA probe functionalized quartz crystal microbalance (QCM) biosensor was developed to detect B. anthracis based on the recognition of its specific DNA sequences, i.e., the 168 bp fragment of the Ba813 gene in chromosomes and the 340 bp fragment of the pag gene in plasmid pXO1. A thiol DNA probe was immobilized onto the QCM gold surface through self-assembly via Au-S bond formation to hybridize with the target ss-DNA sequence obtained by asymmetric PCR. Hybridization between the target DNA and the DNA probe resulted in an increase in mass and a decrease in the resonance frequency of the QCM biosensor. Moreover, to amplify the signal, a thiol-DNA fragment complementary to the other end of the target DNA was functionalized with gold nanoparticles. The results indicate that the DNA probe functionalized QCM biosensor could specifically recognize the target DNA fragment of B. anthracis from that of its closest species, such as Bacillus thuringiensis, and that the limit of detection (LOD) reached 3.5 × 10(2)CFU/ml of B. anthracis vegetative cells just after asymmetric PCR amplification, but without culture enrichment. The DNA probe functionalized QCM biosensor demonstrated stable, pollution-free, real-time sensing, and could find application in the rapid detection of B. anthracis. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D

    2010-01-01

    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  14. Non-radioactive DNA probe and polymerase chain reaction procedures for the specific detection of Acanthamoeba.

    Science.gov (United States)

    Lai, S; Asgari, M; Henney, H R

    1994-02-01

    Acanthamoebae are potential pathogens which can cause serious infections of humans. A non-radioactive rDNA probe and polymerase chain reaction (PCR) amplification procedures which are specific, rapid, sensitive and safe for the detection of Acanthamoeba have been developed. A restriction fragment (126 bp; ArDNA-a) from a variable region of the cloned 26S rDNA unit of Acanthamoeba castellanii (from plasmid pAR2) was labelled by biotinylation. Cells and DNAs were incubated with the labelled rDNA probe to define conditions providing the highest hybridization specificity for Acanthamoeba by both colorimetric and chemiluminescent assays. Four recent isolates of Acanthamoeba, Acanthamoeba polyphaga, various bacteria, Herpes simplex virus, other eukaryotic amoebae and human cell lines, were sources of DNA for testing. The rDNA probe was found to be highly specific for Acanthamoeba and is capable of directly detecting about 250 cells without prior DNA purification. PCR primers for this unique ArDNA-a fragment have also been designed. Amplification of the targeted sequence by PCR using those primers yielded a single product which was specifically generated for Acanthamoeba template DNA and not DNA from the other control cells. This PCR procedure provided increased sensitivity with the direct detection of as few as 10 Acanthamoeba cells.

  15. Probing the binding mode of psoralen to calf thymus DNA.

    Science.gov (United States)

    Zhou, Xiaoyue; Zhang, Guowen; Wang, Langhong

    2014-06-01

    The binding properties between psoralen (PSO) and calf thymus DNA (ctDNA) were predicted by molecular docking, and then determined with the use of UV-vis absorption, fluorescence, circular dichroism (CD) and Fourier transform infrared (FT-IR) spectroscopy, coupled with DNA melting and viscosity measurements. The data matrix obtained from UV-vis spectra was resolved by multivariate curve resolution-alternating least squares (MCR-ALS) approach. The pure spectra and the equilibrium concentration profiles for PSO, ctDNA and PSO-ctDNA complex extracted from the highly overlapping composite response were obtained simultaneously to evaluate the PSO-ctDNA interaction. The intercalation mode of PSO binding to ctDNA was supported by the results from the melting studies, viscosity measurements, iodide quenching and fluorescence polarization experiments, competitive binding investigations and CD analysis. The molecular docking prediction showed that the specific binding most likely occurred between PSO and adenine bases of ctDNA. FT-IR spectra studies further confirmed that PSO preferentially bound to adenine bases, and this binding decreased right-handed helicity of ctDNA and enhanced the degree of base stacking with the preservation of native B-conformation. The calculated thermodynamic parameters indicated that hydrogen bonds and van der Waals forces played a major role in the binding process. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Data Mining Empowers the Generation of a Novel Class of Chromosome-specific DNA Probes

    Energy Technology Data Exchange (ETDEWEB)

    Zeng, Hui; Weier, Heinz-Ulrich G.; Kwan, Johnson; Wang, Mei; O' Brien, Benjamin

    2011-03-08

    Probes that allow accurate delineation of chromosome-specific DNA sequences in interphase or metaphase cell nuclei have become important clinical tools that deliver life-saving information about the gender or chromosomal make-up of a product of conception or the probability of an embryo to implant, as well as the definition of tumor-specific genetic signatures. Often such highly specific DNA probes are proprietary in nature and have been the result of extensive probe selection and optimization procedures. We describe a novel approach that eliminates costly and time consuming probe selection and testing by applying data mining and common bioinformatics tools. Similar to a rational drug design process in which drug-protein interactions are modeled in the computer, the rational probe design described here uses a set of criteria and publicly available bioinformatics software to select the desired probe molecules from libraries comprised of hundreds of thousands of probe molecules. Examples describe the selection of DNA probes for the human X and Y chromosomes, both with unprecedented performance, but in a similar fashion, this approach can be applied to other chromosomes or species.

  17. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses.

    Science.gov (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn

    2011-06-01

    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  18. Magnetic porous carbon nanocomposites derived from metal-organic frameworks as a sensing platform for DNA fluorescent detection

    Energy Technology Data Exchange (ETDEWEB)

    Tan, Hongliang, E-mail: hltan@jxnu.edu.cn; Tang, Gonge; Wang, Zhixiong; Li, Qian; Gao, Jie; Wu, Shimeng

    2016-10-12

    Metal-organic frameworks (MOFs) have emerged as very fascinating functional materials due to their tunable nature and diverse applications. In this work, we prepared a magnetic porous carbon (MPC) nanocomposite by employing iron-containing MOFs (MIL-88A) as precursors through a one-pot thermolysis method. It was found that the MPC can absorb selectively single-stranded DNA (ssDNA) probe to form MPC/ssDNA complex and subsequently quench the labelled fluorescent dye of the ssDNA probe, which is resulted from the synergetic effect of magnetic nanoparticles and carbon matrix. Upon the addition of complementary target DNA, however, the absorbed ssDNA probe could be released from MPC surface by forming double-stranded DNA with target DNA, and accompanied by the recovery of the fluorescence of ssDNA probe. Based on these findings, a sensing platform with low background signal for DNA fluorescent detection was developed. The proposed sensing platform exhibits high sensitivity with detection limit of 1 nM and excellent selectivity to specific target DNA, even single-base mismatched nucleotide can be distinguished. We envision that the presented study would provide a new perspective on the potential applications of MOF-derived nanocomposites in biomedical fields. - Highlights: • A MOF-derived magnetic porous carbon-based DNA fluorescent sensor was developed. • The MPC can absorb selectively single-stranded DNA probe and subsequently quench its labelled fluorescent dye. • The DNA fluorescent sensor showed excellent selectivity and high sensitivity.

  19. Simultaneous detection of DNA from ten food allergens by ligation-dependent probe amplification

    OpenAIRE

    Engel, Karl-Heinz; Demmel, Anja; Ehlert, Alexandra; Hupfer, Christine; Busch, Ulrich

    2009-01-01

    Abstract The simultaneous detection of DNA from different potentially allergenic food ingredients by a ligation-dependent probe amplification (LPA) system is described. The approach allows the detection of several targets in a one-tube assay. Synthetic oligonucleotides were designed to detect DNA from peanut, cashew nut, pecan nut, pistachio nut, hazelnut, sesame seeds, macadamia nut, almond, walnut and brazil nut. The specificity of the system was tested with DNA from more than 50...

  20. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide

    2015-10-01

    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  1. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    Science.gov (United States)

    2014-09-30

    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  2. Selective binding and reverse transcription inhibition of single-strand poly(A) RNA by metal TMPyP complexes.

    Science.gov (United States)

    Zhou, Zhu-Xin; Gao, Feng; Chen, Xing; Tian, Xiang-Jing; Ji, Liang-Nian

    2014-10-06

    Ni-, Cu-, and Zn-TMPyP are capable of binding to single-strand poly(A) RNA with high preference and affinity and inhibiting the reverse transcription of RNA by both M-MuLV and HIV-1 reverse transcriptase. With 10 nM azidothymidine, the IC50 value of M-TMPyP could be lowered to 10(-1) μM order.

  3. Immobilization-free electrochemical DNA detection with anthraquinone-labeled pyrrolidinyl peptide nucleic acid probe.

    Science.gov (United States)

    Kongpeth, Jutatip; Jampasa, Sakda; Chaumpluk, Piyasak; Chailapakul, Orawon; Vilaivan, Tirayut

    2016-01-01

    Electrochemical detection provides a simple, rapid, sensitive and inexpensive method for DNA detection. In traditional electrochemical DNA biosensors, the probe is immobilized onto the electrode. Hybridization with the DNA target causes a change in electrochemical signal, either from the intrinsic signal of the probe/target or through a label or a redox indicator. The major drawback of this approach is the requirement for probe immobilization in a controlled fashion. In this research, we take the advantage of different electrostatic properties between PNA and DNA to develop an immobilization-free approach for highly sequence-specific electrochemical DNA sensing on a screen-printed carbon electrode (SPCE) using a square-wave voltammetric (SWV) technique. Anthraquinone-labeled pyrrolidinyl peptide nucleic acid (AQ-PNA) was employed as a probe together with an SPCE that was modified with a positively-charged polymer (poly quaternized-(dimethylamino-ethyl)methacrylate, PQDMAEMA). The electrostatic attraction between the negatively-charged PNA-DNA duplex and the positively-charged modified SPCE attributes to the higher signal of PNA-DNA duplex than that of the electrostatically neutral PNA probe, resulting in a signal change. The calibration curve of this proposed method exhibited a linear range between 0.35 and 50 nM of DNA target with a limit of detection of 0.13 nM (3SD(blank)/Slope). The sub-nanomolar detection limit together with a small sample volume required (20 μL) allowed detection of syndrome virus (WSSV) DNA was successfully demonstrated. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

    Science.gov (United States)

    Soares, Marcelo Bento; Bonaldo, Maria de Fatima

    1998-01-01

    This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

  5. DNA Origami: Folded DNA-Nanodevices That Can Direct and Interpret Cell Behavior

    Science.gov (United States)

    Kearney, Cathal J.; Lucas, Christopher R.; O'Brien, Fergal J.; Castro, Carlos E.

    2016-01-01

    DNA origami is a DNA-based nanotechnology that utilizes programmed combinations of short complementary oligonucleotides to fold a large single strand of DNA into precise 2-D and 3-D shapes. The exquisite nanoscale shape control of this inherently biocompatible material is combined with the potential to spatially address the origami structures with diverse cargos including drugs, antibodies, nucleic acid sequences, small molecules and inorganic particles. This programmable flexibility enables the fabrication of precise nanoscale devices that have already shown great potential for biomedical applications such as: drug delivery, biosensing and synthetic nanopore formation. In this Progress Report, we will review the advances in the DNA origami field since its inception several years ago and then focus on how these DNA-nanodevices can be designed to interact with cells to direct or probe their behavior. PMID:26840503

  6. 2-Aminopurine hairpin probes for the detection of ultraviolet-induced DNA damage

    International Nuclear Information System (INIS)

    El-Yazbi, Amira F.; Loppnow, Glen R.

    2012-01-01

    Highlights: ► Molecular beacon with 2AP bases detects DNA damage in a simple mix-and-read assay. ► Molecular beacons with 2AP bases detect damage at a 17.2 nM limit of detection. ► The 2AP molecular beacon is linear over a 0–3.5 μM concentration range for damage. - Abstract: Nucleic acid exposure to radiation and chemical insults leads to damage and disease. Thus, detection and understanding DNA damage is important for elucidating molecular mechanisms of disease. However, current methods of DNA damage detection are either time-consuming, destroy the sample, or are too specific to be used for generic detection of damage. In this paper, we develop a fluorescence sensor of 2-aminopurine (2AP), a fluorescent analogue of adenine, incorporated in the loop of a hairpin probe for the quantification of ultraviolet (UV) C-induced nucleic acid damage. Our results show that the selectivity of the 2AP hairpin probe to UV-induced nucleic acid damage is comparable to molecular beacon (MB) probes of DNA damage. The calibration curve for the 2AP hairpin probe shows good linearity (R 2 = 0.98) with a limit of detection of 17.2 nM. This probe is a simple, fast and economic fluorescence sensor for the quantification of UV-induced damage in DNA.

  7. Probing the Conformational Distributions of Sub-Persistence Length DNA

    Energy Technology Data Exchange (ETDEWEB)

    Mastroianni, Alexander; Sivak, David; Geissler, Phillip; Alivisatos, Paul

    2009-06-08

    We have measured the bending elasticity of short double-stranded DNA (dsDNA) chains through small-angle X-ray scattering from solutions of dsDNA-linked dimers of gold nanoparticles. This method, which does not require exertion of external forces or binding to a substrate, reports on the equilibrium distribution of bending fluctuations, not just an average value (as in ensemble FRET) or an extreme value (as in cyclization), and in principle provides a more robust data set for assessing the suitability of theoretical models. Our experimental results for dsDNA comprising 42-94 basepairs (bp) are consistent with a simple worm-like chain model of dsDNA elasticity, whose behavior we have determined from Monte Carlo simulations that explicitly represent nanoparticles and their alkane tethers. A persistence length of 50 nm (150 bp) gave a favorable comparison, consistent with the results of single-molecule force-extension experiments on much longer dsDNA chains, but in contrast to recent suggestions of enhanced flexibility at these length scales.

  8. Effect of structure on sensing performance of a target induced signaling probe shifting DNA-based (TISPS-DNA) sensor.

    Science.gov (United States)

    Yu, Xiang; Yu, Zhigang; Li, Fengqin; Xu, Yanmei; He, Xunjun; Xu, Lan; Shi, Wenbing; Zhang, Guiling; Yan, Hong

    2017-05-15

    A type of "signal on" displacement-based sensors named target induced signaling probe shifting DNA-based (TISPS-DNA) sensor were developed for a designated DNA detection. The signaling mechanism of the signaling probe (SP) shifting different from the classical conformation/flexibility change mode endows the sensor with high sensitivity. Through using thiolated or no thiolated capturing probe (CP), two 3-probe sensing structures, sensor-1 and sensor-2, were designed and constructed. The systematical comparing research results show that both sensors exhibit some similarities or big differences in sensing performance. On the one hand, the similarity in structures determines the similarity in some aspects of signaling mechanism, background signal, signal changing form, anti-fouling ability and versatility; on the other hand, the slight difference in structures also results in two opposite hybridization modes of gradual increasing resistance and gradual decreasing resistance which can affect the hybridization efficiency between the assistant probe (AP) and the SP, further producing some big differences in sensing performance, for example, apparently different signal enhancement (SE) change, point mutation discrimination ability and response speed. Under the optimized fabrication and detection conditions, both sensors feature high sensitivity for target DNAs with the detection limits of ∼10 fM for sensor-1 and ∼7 fM for sensor-2, respectively. Among many acquired sensing virtues, the sensor-1 shows a peculiar specificity adjustability which is also a highlight in this work. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Role of electrostatics in the assembly pathway of a single-stranded RNA virus.

    Science.gov (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M

    2014-09-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  10. Determination for Enterobacter cloacae based on a europium ternary complex labeled DNA probe

    Science.gov (United States)

    He, Hui; Niu, Cheng-Gang; Zeng, Guang-Ming; Ruan, Min; Qin, Pin-Zhu; Liu, Jing

    2011-11-01

    The fast detection and accurate diagnosis of the prevalent pathogenic bacteria is very important for the treatment of disease. Nowadays, fluorescence techniques are important tools for diagnosis. A two-probe tandem DNA hybridization assay was designed for the detection of Enterobacter cloacae based on time-resolved fluorescence. In this work, the authors synthesized a novel europium ternary complex Eu(TTA) 3(5-NH 2-phen) with intense luminescence, high fluorescence quantum yield and long lifetime before. We developed a method based on this europium complex for the specific detection of original extracted DNA from E. cloacae. In the hybridization assay format, the reporter probe was labeled with Eu(TTA) 3(5-NH 2-phen) on the 5'-terminus, and the capture probe capture probe was covalent immobilized on the surface of the glutaraldehyde treated glass slides. The original extracted DNA of samples was directly used without any DNA purification and amplification. The detection was conducted by monitoring the fluorescence intensity from the glass surface after DNA hybridization. The detection limit of the DNA was 5 × 10 -10 mol L -1. The results of the present work proved that this new approach was easy to operate with high sensitivity and specificity. It could be conducted as a powerful tool for the detection of pathogen microorganisms in the environment.

  11. Conformational Diversity of Single-Stranded DNA from Bacterial Repetitive Extragenic Palindromes: Implications for the DNA Recognition Elements of Transposases

    Czech Academy of Sciences Publication Activity Database

    Charnavets, Tatsiana; Nunvář, Jaroslav; Nečasová, Iva; Voelker, J.; Breslauer, K.J.; Schneider, Bohdan

    2015-01-01

    Roč. 103, č. 10 (2015), s. 585-596 ISSN 0006-3525 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109; GA ČR GAP305/12/1801; GA MŠk(CZ) EE2.3.30.0020 Institutional support: RVO:86652036 Keywords : bacterial repetitive extragenic palindromes (REP) * circular dichroism spectroscopy * REP associated tyrosine transposases (RAYTs) Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.248, year: 2015

  12. Enzyme-Free Detection of Mutations in Cancer DNA Using Synthetic Oligonucleotide Probes and Fluorescence Microscopy

    DEFF Research Database (Denmark)

    Miotke, Laura; Maity, Arindam; Ji, Hanlee

    2015-01-01

    BACKGROUND: Rapid reliable diagnostics of DNA mutations are highly desirable in research and clinical assays. Current development in this field goes simultaneously in two directions: 1) high-throughput methods, and 2) portable assays. Non-enzymatic approaches are attractive for both types......) and finally, detection by fluorescence microscopy. The LNA containing probes display high binding affinity and specificity to DNA containing mutations, which allows for the detection of mutation abundance with an intercalating EvaGreen dye. We used a second probe, which increases the overall number of base...... pairs in order to produce a higher fluorescence signal by incorporating more dye molecules. Indeed we show here that using EvaGreen dye and LNA probes, genomic DNA containing BRAF V600E mutation could be detected by fluorescence microscopy at low femtomolar concentrations. Notably, this was at least...

  13. Probing DNA with micro- and nanocapillaries and optical tweezers

    Energy Technology Data Exchange (ETDEWEB)

    Steinbock, L J; Otto, O; Skarstam, D R; Jahn, S; Chimerel, C; Gornall, J L; Keyser, U F, E-mail: ufk20@cam.ac.u [Cavendish Laboratory, University of Cambridge, J J Thomson Avenue, Cambridge CB3 0HE (United Kingdom)

    2010-11-17

    We combine for the first time optical tweezer experiments with the resistive pulse technique based on capillaries. Quartz glass capillaries are pulled into a conical shape with tip diameters as small as 27 nm. Here, we discuss the translocation of {lambda}-phage DNA which is driven by an electrophoretic force through the nanocapillary. The resulting change in ionic current indicates the folding state of single {lambda}-phage DNA molecules. Our flow cell design allows for the straightforward incorporation of optical tweezers. We show that a DNA molecule attached to an optically trapped colloid is pulled into a capillary by electrophoretic forces. The detected electrophoretic force is in good agreement with measurements in solid-state nanopores.

  14. A repetitive DNA probe for the sensitive detection of Fasciola hepatica infected snails.

    Science.gov (United States)

    Kaplan, R M; Dame, J B; Reddy, G R; Courtney, C H

    1995-05-01

    Epizootiologic studies on F. hepatica frequently use microscopic techniques for the detection of infected snails, however, the poor efficiency, sensitivity, and specificity associated with these techniques limit their usefulness. A DNA-based test for the identification of snails infected with larval stages of F. hepatica would solve these problems and enable a level of detection accuracy previously unavailable. We have cloned and sequenced a 124 bp fragment of repetitive DNA from F. hepatica which hybridizes specifically with DNA of F. hepatica but not with DNA of its snail intermediate hosts Fossaria cubensis and Pseudosuccinea columella, or with DNA of Fascioloides magna and Paramphistomum liorchis, ruminant trematodes which share the same intermediate host and same enzootic range as F. hepatica. Using this 124 bp fragment as a probe, infection in snails was detected immediately following miracidial penetration, thus a sensitivity equivalent to the minimum biologic unit of the parasite was achieved. This 124 bp repeated sequence belongs to a large family of 124 bp repeats that share a high level of sequence identity and constitute approximately 15% of the F. hepatica genome. We also report here the development of a quick and inexpensive DNA extraction protocol for use in field-collected snails. Thus, we have developed both a highly sensitive and specific DNA probe and a means to use the probe in a large epizootiologic study of F. hepatica where thousands of field-collected snails need to be assayed for infection.

  15. Clonal origin of multiple lung cancers: K-ras and p53 mutations determined by nonradioisotopic single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Lau, D H; Yang, B; Hu, R; Benfield, J R

    1997-08-01

    Disease stage is the most important factor in determining prognosis and treatment of lung cancer. Staging of lung cancer is complicated by presentation of multiple pulmonary malignant lesions with a similar histology. It is a dilemma to decide if these lesions are synchronous primaries arising from different malignant clones or metastases from a single clone. Lung cancer is associated with multiple genetic abnormalities including mutations of K-ras and p53, which are believed to occur prior to onset of metastasis. To determine the clonal origin of multiple pulmonary malginant nodules, we analyzed point-mutations of K-ras and p53 by microdissection, polymerase chain reactions (PCR), nonradioisotopic single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. Each pulmonary lesion was microdissected from paraffin slides. Genomic DNA was amplified by two sequential PCRs followed by electrophoresis in a minigel and silver staining. Deoxyribonucleic acid sequencing was performed if necessary to confirm a mutation found upon SSCP analysis. Applying this molecular approach, we were able to differentiate the clonal origins of multiple malignant nodules of the lung as exemplified by the two cases presented.

  16. Microarray long oligo probe designing for Escherichia coli: an in-silico DNA marker extraction.

    Science.gov (United States)

    Behzadi, Payam; Najafi, Ali; Behzadi, Elham; Ranjbar, Reza

    2016-01-01

    Urinary tract infections are predominant diseases which may be caused by different pathogenic microorganisms, particularly Escherichia coli (E.coli). DNA microarray technology is an accurate, rapid, sensitive, and specific diagnostic tool which may lead to definite diagnosis and treatment of several infectious diseases. DNA microarray is a multi-process method in which probe designing plays an important. Therefore, the authors of the present study have tried to design a range of effective and proper long oligo microarray probes for detection and identification of different strains of pathogenic E.coli and in particular, uropathogenic E.coli (UPEC). E.coli O26 H11 11368 uid41021 was selected as the standard strain for probe designing. This strain encompasses the largest nucleotide sequence and the most number of genes among other pathogenic strains of E.coli. For performing this in silico survey, NCBI database, GReview Server, PanSeq Server, Oligoanalyzer tool, and AlleleID 7.7 were used to design accurate, appropriate, effective, and flexible long oligo microarray probes. Moreover, the genome of E.coli and its closely related microorganisms were compared. In this study, 15 long oligo microarray probes were designed for detecting and identifying different strains of E.coli such as UPEC. These probes possessed the best physico-chemical characteristics. The functional and structural properties of the designed probes were recognized by practical tools and softwares. The use of reliable advanced technologies and methodologies for probe designing guarentees the high quality of microarray probes and makes DNA microarray technology more flexible and an effective diagnostic technique.

  17. Use of Ti plasmid DNA probes for determining tumorigenicity of agrobacterium strains

    International Nuclear Information System (INIS)

    Burr, T.J.; Norelli, J.L.; Katz, B.H.; Bishop, A.L.

    1990-01-01

    Probes consisting of T-DNA genes from the Ti plasmid of Agrobacterium tumefaciens were used for determining tumorigenicity of strains. Two 32 P-labeled probes hybridized with 28 of 28 tumorigenic strains of the pathogen but not with 20 of 22 nontumorigenic strains. One probe, pTHE17, consists of all but the far left portion of the T-DNA of strain C58. Probe SmaI7 consists of SmaI fragment 7 of pTiC58, including onc genes 1, 4, and 6a and most of 2. Another probe, pAL4044, consisting of the vir region of strain Ach-5, hybridized with several nontumorigenic as well as tumorigenic strains. Colony hybridizations were done with 28 tumorigenic and 22 nontumorigenic Agrobacterium strains. About 10 6 CFU of the different tumorigenic strains were detectable with this method. Southern analyses confirmed the presence or absence of Ti plasmids in strains for which tumorigenicity was questioned. Colony hybridization with the T-DNA probes provides a rapid and sensitive means for determining the tumorigenic nature of Agrobacterium strains

  18. Normal formation and repair of γ-radiation-induced single and double strand DNA breaks in Down syndrome fibroblasts

    International Nuclear Information System (INIS)

    Steiner, M.E.; Woods, W.G.

    1982-01-01

    Fibroblasts from patients with Down syndrome (Trisomy 21) were examined for repair capability of γ-radiation-induced single strand and double strand DNA breaks. Formation and repair of DNA breaks were determined by DNA alkaline and non-denaturing elution techniques. Down syndrome fibroblasts were found to repair single strand and double strand breaks as well as fibroblasts from normal controls. (orig.)

  19. Phase Transition of DNA-Linked Gold Nanoparticle

    OpenAIRE

    Kiang, Ching-Hwa

    2001-01-01

    Melting and hybridization of DNA-capped gold nanoparticle networks are investigated with optical absorption spectroscopy. Single-stranded, 12-base DNA-capped gold nanoparticles are linked with complementary, single-stranded, 24-base linker DNA to form particle networks. Compared to free DNA, a sharp melting transition is seen in these networked DNA-nanoparticle systems. The sharpness is explained by percolation transition phenomena.

  20. Increased detectability of somatic changes in the DNA from human tumours after probing with "synthetic" and "genome-derived" hypervariable multilocus probes

    DEFF Research Database (Denmark)

    Lagoda, P J; Seitz, G; Epplen, J T

    1989-01-01

    DNA fingerprinting with two minisatellite (33.15, M13) and two simple repeat probes [(GACA)4, (CAC)5/(GTG)s] was performed to screen for somatic changes in the DNA from various solid human tumours in comparison with constitutional DNA from the same patient. Loss of bands or changes in band...... intensities were observed. Together the probes 33.15 and (CAC)5/(GTG)5 detected deviating fingerprint patterns in 63% of the colorectal carcinomas investigated. In mammary and stomach carcinomas, only 1/11 and 2/11 tumours, respectively, showed differences with either of the three probes, 33.15, (GACA)4...

  1. Gold nanoparticle-based probes for the colorimetric detection of Mycobacterium avium subspecies paratuberculosis DNA.

    Science.gov (United States)

    Ganareal, Thenor Aristotile Charles S; Balbin, Michelle M; Monserate, Juvy J; Salazar, Joel R; Mingala, Claro N

    2018-02-12

    Gold nanoparticle (AuNP) is considered to be the most stable metal nanoparticle having the ability to be functionalized with biomolecules. Recently, AuNP-based DNA detection methods captured the interest of researchers worldwide. Paratuberculosis or Johne's disease, a chronic gastroenteritis in ruminants caused by Mycobacterium avium subsp. paratuberculosis (MAP), was found to have negative effect in the livestock industry. In this study, AuNP-based probes were evaluated for the specific and sensitive detection of MAP DNA. AuNP-based probe was produced by functionalization of AuNPs with thiol-modified oligonucleotide and was confirmed by Fourier-Transform Infrared (FTIR) spectroscopy. UV-Vis spectroscopy and Scanning Electron Microscopy (SEM) were used to characterize AuNPs. DNA detection was done by hybridization of 10 μL of DNA with 5 μL of probe at 63 °C for 10 min and addition of 3 μL salt solution. The method was specific to MAP with detection limit of 103 ng. UV-Vis and SEM showed dispersion and aggregation of the AuNPs for the positive and negative results, respectively, with no observed particle growth. This study therefore reports an AuNP-based probes which can be used for the specific and sensitive detection of MAP DNA. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. DNA polymorphisms in the Sahiwal breed of Zebu cattle revealed by synthetic oligonucleotide probes

    International Nuclear Information System (INIS)

    Shashikanth; Yadav, B.R.

    2005-01-01

    Genomic DNA of 15 randomly selected unrelated animals and from two sire families (11 animals) of the Sahiwal breed of Zebu cattle were investigated. Four oligonucleotide probes - (GTG) 5 , (TCC) 5 , (GT) 8 and (GT) 12 - were used on genomic DNA digested with restriction enzymes AluI, HinfI, MboI, EcoRI and HaeIII in different combinations. All four probes produced multiloci fingerprints with differing levels of polymorphisms. Total bands and shared bands in the fingerprints of each individual were in the range of 2.5 to 23.0 KB. Band number ranged from 9 to 17, with 0.48 average band sharing. Probes (GT) 8 , (GT) 12 and (TCC) 5 produced fingerprinting patterns of medium to low polymorphism, whereas probe (GTG) 5 produced highly polymorphic patterns. Probe (GTG) 5 in combination with the HaeIII enzyme was highly polymorphic with a heterozygosity level of 0.85, followed by (GT) 8 , (TCC) 5 and (GT) 12 with heterozygosity levels of 0.70, 0.65 and 0.30, respectively. Probe GTG 5 or its complementary sequence CAC 5 produced highly polymorphic fingerprints, indicating that the probe can be used for analysing population structure, parentage verification and identifying loci controlling quantitative traits and fertility status. (author)

  3. Probing the binding of coumarins and cyclothialidines to DNA gyrase

    DEFF Research Database (Denmark)

    Kampranis, S C; Gormley, N A; Tranter, R

    1999-01-01

    B and coumarin and cyclothialidine drugs and made mutations by site-directed mutagenesis. We used proteolysis as a probe of drug binding to wild-type and mutant proteins. Limited proteolysis of gyrase revealed that binding of these antibiotics is associated with a characteristic proteolytic fingerprint......, suggesting a drug-induced conformational change. The ability of the mutants to bind the drugs was studied by testing their ability to induce the coumarin-associated proteolytic signature and to bind to a novobiocin-affinity column. To analyze further the interaction of the drugs with gyrase, we studied...

  4. Mitochondrial DNA repair and replication proteins revealed by targeted chemical probes.

    Science.gov (United States)

    Wisnovsky, Simon; Jean, Sae Rin; Kelley, Shana O

    2016-07-01

    Efficient and accurate replication and repair of mitochondrial DNA is essential for cellular viability, yet only a minimal complement of mitochondrial proteins with relevant activities have been identified. Here, we describe an approach to screen for new pathways involved in the maintenance of mitochondrial DNA (mtDNA) that leverages the activities of DNA-damaging probes exhibiting specific subcellular localization. By conducting a siRNA screen of known nuclear DNA maintenance factors, and monitoring synergistic effects of gene depletion on the activity of mitochondria-specific DNA-damaging agents, we identify a series of proteins not previously recognized to act within mitochondria. These include proteins that function in pathways of oxidative DNA damage repair and dsDNA break repair, along with a novel mitochondrial DNA polymerase, POLθ, that facilitates efficient DNA replication in an environment prone to oxidative stress. POLθ expression levels affect the mutational rate of mitochondrial DNA, but this protein also appears critical for efficient mtDNA replication.

  5. Evaluation of a PCR/DNA Probe Colorimetric Membrane Assay for Identification of Campylobacter spp. in Human Stool Specimens

    OpenAIRE

    Collins, Evelyn; Glennon, Maura; Hanley, Shirley; Murray, Anne-Marie; Cormican, Martin; Smith, Terry; Maher, Majella

    2001-01-01

    DNA was extracted from 50 human stool specimens using the QIAamp DNA stool minikit. PCR amplification was followed by post-PCR hybridization to DNA probes specific for the Campylobacter genus, Campylobacter jejuni, and Campylobacter coli in a colorimetric membrane assay. Thirty-two of 38 culture-positive specimens were PCR/DNA probe positive for C. jejuni. The assay is rapid and simple and can be applied to stool specimens for the detection of Campylobacter.

  6. Absolute and direct microRNA quantification using DNA-gold nanoparticle probes.

    Science.gov (United States)

    Degliangeli, Federica; Kshirsagar, Prakash; Brunetti, Virgilio; Pompa, Pier Paolo; Fiammengo, Roberto

    2014-02-12

    DNA-gold nanoparticle probes are implemented in a simple strategy for direct microRNA (miRNA) quantification. Fluorescently labeled DNA-probe strands are immobilized on PEGylated gold nanoparticles (AuNPs). In the presence of target miRNA, DNA-RNA heteroduplexes are formed and become substrate for the endonuclease DSN (duplex-specific nuclease). Enzymatic hydrolysis of the DNA strands yields a fluorescence signal due to diffusion of the fluorophores away from the gold surface. We show that the molecular design of our DNA-AuNP probes, with the DNA strands immobilized on top of the PEG-based passivation layer, results in nearly unaltered enzymatic activity toward immobilized heteroduplexes compared to substrates free in solution. The assay, developed in a real-time format, allows absolute quantification of as little as 0.2 fmol of miR-203. We also show the application of the assay for direct quantification of cancer-related miR-203 and miR-21 in samples of extracted total RNA from cell cultures. The possibility of direct and absolute quantification may significantly advance the use of microRNAs as biomarkers in the clinical praxis.

  7. Dual-Specific Interaction to Detect DNA on Gold Nanoparticles

    Directory of Open Access Journals (Sweden)

    Andrew Tobias Aveling Jenkins

    2013-05-01

    Full Text Available An approach to selectively and efficiently detect single strand DNA is developed by using streptavidin coated gold nanoparticles (StAuNPs as efficient quenchers. The central concept for the successful detection is the combination the of streptavidin-biotin interaction with specific probe-target DNA hybridization. Biotin labeled probe DNAs act as “bridges” to bring Cy5 labeled targets to the particle surface and the fluorophore dye can be rapidly and efficiently quenched by StAuPNs. By measuring the changes of photoluminescence intensity of Cy5, an efficient, selective, and reversed detection of DNA hybridization is realized. The methodology may pave a new way for simple and rapid detections of biomolecules.

  8. Fast, Background-Free DNA-PAINT Imaging Using FRET-Based Probes.

    Science.gov (United States)

    Auer, Alexander; Strauss, Maximilian T; Schlichthaerle, Thomas; Jungmann, Ralf

    2017-10-11

    DNA point accumulation in nanoscale topography (DNA-PAINT) enables super-resolution microscopy by harnessing the predictable, transient hybridization between short dye-labeled "imager" and complementary target-bound "docking" strands. DNA-PAINT microscopy allows sub-5 nm spatial resolution, spectrally unlimited multiplexing, and quantitative image analysis. However, these abilities come at the cost of nonfluorogenic imager strands, also emitting fluorescence when not bound to their docking strands. This has thus far prevented rapid image acquisition with DNA-PAINT, as the blinking rate of probes is limited by an upper-bound of imager strand concentrations, which in turn is dictated by the necessity to facilitate the detection of single-molecule binding events over the background of unbound, freely diffusing probes. To overcome this limitation and enable fast, background-free DNA-PAINT microscopy, we here introduce FRET-based imaging probes, alleviating the concentration-limit of imager strands and speeding up image acquisition by several orders of magnitude. We assay two approaches for FRET-based DNA-PAINT (or FRET-PAINT) using either fixed or transient acceptor dyes in combination with transiently binding donor-labeled DNA strands and achieve high-quality super-resolution imaging on DNA origami structures in a few tens of seconds. Finally, we also demonstrate the applicability of FRET-PAINT in a cellular environment by performing super-resolution imaging of microtubules in under 30 s. FRET-PAINT combines the advantages of conventional DNA-PAINT with fast image acquisition times, facilitating the potential study of dynamic processes.

  9. Scanning Probe Optical Tweezers: a new tool to study DNA-protein interactions

    NARCIS (Netherlands)

    Huisstede, J.H.G.

    2006-01-01

    The main goal of the work described in this thesis is to construct a microscope in which OT and scanning probe microscopy (SPM) are combined, to be able to localize proteins while simultaneously controlling the tension within the DNA molecule. This apparatus enables the study of the effect of

  10. DNA-based stable isotope probing: a link between community structure and function

    Czech Academy of Sciences Publication Activity Database

    Uhlík, Ondřej; Ječná, K.; Leigh, M. B.; Macková, Martina; Macek, Tomáš

    2009-01-01

    Roč. 407, č. 12 (2009), s. 3611-3619 ISSN 0048-9697 Grant - others:GA MŠk(CZ) 2B08031 Program:2B Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA-based stable isotope probing * microbial diversity * bioremediation Subject RIV: EI - Biotechnology ; Bionics Impact factor: 2.905, year: 2009

  11. Custom-Designed MLPA Using Multiple Short Synthetic Probes Application to Methylation Analysis of Five Promoter CpG Islands in Tumor and Urine Specimens from Patients with Bladder Cancer

    DEFF Research Database (Denmark)

    Serizawa, R.R.; Ralfkiaer, U.; Dahl, C.

    2010-01-01

    this assay to analyze DNA from tumor tissue and corresponding urine samples from patients with bladder cancer. Our data show that the use of multiple short synthetic probes provides a simple means for custom-designed MS-MLPA analysis. (J Mol Diagn 2010, 12:402-408; DOI: 10.2353/jmoldx.2010.090152)......Ligation of two oligonucleotide probes hybridized adjacently to a DNA template has been widely used for detection of genome alterations. The multiplex ligation-dependent probe amplification (MLPA) technique allows simultaneous screening of multiple target sequences in a single reaction by using...... pairs of probes that carry tails for binding of common amplification primers. Resolution of the various targets is achieved by electrophoresis on the basis of pre-defined differences in amplicon length. In the conventional MLPA approach, one of the two target probes is generated by cloning in a single-stranded...

  12. DNA-based MRI probes for specific detection of chronic exposure to amphetamine in living brains.

    Science.gov (United States)

    Liu, Christina H; Ren, Jia Q; Yang, Jinsheng; Liu, Charng-ming; Mandeville, Joseph B; Rosen, Bruce R; Bhide, Pradeep G; Yanagawa, Yuchio; Liu, Philip K

    2009-08-26

    We designed phosphorothioate-modified DNA probes linked to superparamagnetic iron oxide nanoparticles (SPION) for in vivo magnetic resonance imaging (MRI) of fosB and Delta fosB mRNA after amphetamine (AMPH) exposure in mice. Specificity of both the fosB and Delta fosB probes was verified by in vitro reverse transcriptase-PCR amplification to a single fragment of total cDNA obtained from acutely AMPH-exposed mouse brains. We confirmed time-dependent uptake and retention profiles of both probes in neurons of GAD67-green fluorescent protein knock-in mice. MRI signal of SPION-labeled fosB probe delivered via intracerebroventricular route was elevated in both acutely and chronically AMPH-exposed mice; the signal was suppressed by dopaminergic receptor antagonist pretreatment. SPION-labeled Delta fosB probe signal elevation occurred only in chronically AMPH-exposed mice. The in vivo target specificity of these probes permits reliable MRI visualization of AMPH-induced differential elevations of fosB and Delta fosB mRNA in living brains.

  13. Combination probes with intercalating anchors and proximal fluorophores for DNA and RNA detection.

    Science.gov (United States)

    Qiu, Jieqiong; Wilson, Adam; El-Sagheer, Afaf H; Brown, Tom

    2016-09-30

    A new class of modified oligonucleotides (combination probes) has been designed and synthesised for use in genetic analysis and RNA detection. Their chemical structure combines an intercalating anchor with a reporter fluorophore on the same thymine nucleobase. The intercalator (thiazole orange or benzothiazole orange) provides an anchor, which upon hybridisation of the probe to its target becomes fluorescent and simultaneously stabilizes the duplex. The anchor is able to communicate via FRET to a proximal reporter dye (e.g. ROX, HEX, ATTO647N, FAM) whose fluorescence signal can be monitored on a range of analytical devices. Direct excitation of the reporter dye provides an alternative signalling mechanism. In both signalling modes, fluorescence in the unhybridised probe is switched off by collisional quenching between adjacent intercalator and reporter dyes. Single nucleotide polymorphisms in DNA and RNA targets are identified by differences in the duplex melting temperature, and the use of short hybridization probes, made possible by the stabilisation provided by the intercalator, enhances mismatch discrimination. Unlike other fluorogenic probe systems, placing the fluorophore and quencher on the same nucleobase facilitates the design of short probes containing multiple modifications. The ability to detect both DNA and RNA sequences suggests applications in cellular imaging and diagnostics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Development of an Interaction Assay between Single-Stranded Nucleic Acids Trapped with Silica Particles and Fluorescent Compounds

    Directory of Open Access Journals (Sweden)

    R. Maeda

    2012-09-01

    Full Text Available Biopolymers are easily denatured by heating, a change in pH or chemical substances when they are immobilized on a substrate. To prevent denaturation of biopolymers, we developed a method to trap a polynucleotide on a substrate by hydrogen bonding using silica particles with surfaces modified by aminoalkyl chains ([A-AM silane]/SiO2. [A-AM silane]/SiO2 was synthesized by silane coupling reaction of N-2-(aminoethyl-3-aminopropyltrimethoxysilane (A-AM silane with SiO2 particles with a diameter of 5 μm at 100 °C for 20 min. The surface chemical structure of [A-AM silane]/SiO2 was characterized by Fourier transform infrared spectroscopy and molecular orbital calculations. The surface of the silica particles was modified with A-AM silane and primary amine groups were formed. [A-AM silane]/SiO2 was trapped with single-stranded nucleic acids [(Poly-X; X = A (adenine, G (guanine and C (cytosine] in PBS solution at 37 °C for 1 h. The single-stranded nucleic acids were trapped on the surface of the [A-AM silane]/SiO2 by hydrogen bonding to form conjugated materials. The resulting complexes were further conjugated by derivatives of acridine orange (AO as fluorescent labels under the same conditions to form [AO:Poly-X:A-AM silane]/SiO2 complexes. Changes in the fluorescence intensity of these complexes originating from interactions between the single-stranded nucleic acid and aromatic compounds were also evaluated. The change in intensity displayed the order [AO: Poly-G: A-AM silane]/SiO2 > [AO:Poly-A:A-AM silane]/SiO2 >> [AO:Poly-C:A-AM silane]/SiO2. This suggests that the single-stranded nucleic acids conjugated with aminoalkyl chains on the surfaces of SiO2 particles and the change in fluorescence intensity reflected the molecular interaction between AO and the nucleic-acid base in a polynucleotide.

  15. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    Science.gov (United States)

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  16. The field effect transistor DNA biosensor based on ITO nanowires in label-free hepatitis B virus detecting compatible with CMOS technology.

    Science.gov (United States)

    Shariati, Mohsen

    2018-05-15

    In this paper the field-effect transistor DNA biosensor for detecting hepatitis B virus (HBV) based on indium tin oxide nanowires (ITO NWs) in label free approach has been fabricated. Because of ITO nanowires intensive conductance and functional modified surface, the probe immobilization and target hybridization were increased strongly. The high resolution transmission electron microscopy (HRTEM) measurement showed that ITO nanowires were crystalline and less than 50nm in diameter. The single-stranded hepatitis B virus DNA (SS-DNA) was immobilized as probe on the Au-modified nanowires. The DNA targets were measured in a linear concentration range from 1fM to 10µM. The detection limit of the DNA biosensor was about 1fM. The time of the hybridization process for defined single strand was 90min. The switching ratio of the biosensor between "on" and "off" state was ~ 1.1 × 10 5 . For sensing the specificity of the biosensor, non-complementary, mismatch and complementary DNA oligonucleotide sequences were clearly discriminated. The HBV biosensor confirmed the highly satisfied specificity for differentiating complementary sequences from non-complementary and the mismatch oligonucleotides. The response time of the DNA sensor was 37s with a high reproducibility. The stability and repeatability of the DNA biosensor showed that the peak current of the biosensor retained 98% and 96% of its initial response for measurements after three and five weeks, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Structure of the replicative form of bacteriophage φX174 : VI. Studies on alkali-denatured double-stranded φX DNA

    NARCIS (Netherlands)

    Pouwels, P.H.; Knijnenburg, C.M.; Rotterdam, J. van; Cohen, J.A.; Jansz, H.S.

    1968-01-01

    Double-stranded φX DNA which accumulates after infection with bacteriophage φX174 in the presence of chloramphenicol consists mainly of twisted circular double-stranded DNA with no single-strand breaks (component I) and of circular double-stranded DNA, in which single-strand breaks are present

  18. An approach to sequence DNA without tagging

    Science.gov (United States)

    Niu, Sanjun; Saraf, Ravi F.

    2002-10-01

    Microarray technology is playing an increasingly important role in biology and medicine and its application to genomics for gene expression analysis has already reached the market with a variety of commercially available instruments. In these combinatorial analysis methods, known probe single-strand DNA (ssDNA) 'primers' are attached in clusters of typically 100 µm × 100 µm pixels. Each pixel of the array has a slightly different sequence. On exposure to 'unknown' target ssDNA, the pixels with the right complementary probe ssDNA sequence convert to double-stranded DNA (dsDNA) by a hybridization reaction. To transduct the conversion of the pixel to dsDNA, the target ssDNA is labelled with a photoluminescent tag during the polymerase chain reaction (PCR) amplification process. Due to the statistical distribution of the tags in the target ssDNA, it becomes significantly difficult to implement these methods as a diagnostic tool in a pathology laboratory. A method to sequence DNA without tagging the molecule is developed. The fabrication process is compatible with current microelectronics and (emerging) soft-material fabrication technologies, allowing the method to be integrable with micro-electromechanical systems (MEMS) and lab-on-a-chip devices. An estimated sensitivity of 10-12 g on a 1 cm2 device area is obtained.

  19. Multi-Probe Based Artificial DNA Encoding and Matching Classifier for Hyperspectral Remote Sensing Imagery

    Directory of Open Access Journals (Sweden)

    Ke Wu

    2016-08-01

    Full Text Available In recent years, a novel matching classification strategy inspired by the artificial deoxyribonucleic acid (DNA technology has been proposed for hyperspectral remote sensing imagery. Such a method can describe brightness and shape information of a spectrum by encoding the spectral curve into a DNA strand, providing a more comprehensive way for spectral similarity comparison. However, it suffers from two problems: data volume is amplified when all of the bands participate in the encoding procedure and full-band comparison degrades the importance of bands carrying key information. In this paper, a new multi-probe based artificial DNA encoding and matching (MADEM method is proposed. In this method, spectral signatures are first transformed into DNA code words with a spectral feature encoding operation. After that, multiple probes for interesting classes are extracted to represent the specific fragments of DNA strands. During the course of spectral matching, the different probes are compared to obtain the similarity of different types of land covers. By computing the absolute vector distance (AVD between different probes of an unclassified spectrum and the typical DNA code words from the database, the class property of each pixel is set as the minimum distance class. The main benefit of this strategy is that the risk of redundant bands can be deeply reduced and critical spectral discrepancies can be enlarged. Two hyperspectral image datasets were tested. Comparing with the other classification methods, the overall accuracy can be improved from 1.22% to 10.09% and 1.19% to 15.87%, respectively. Furthermore, the kappa coefficient can be improved from 2.05% to 15.29% and 1.35% to 19.59%, respectively. This demonstrated that the proposed algorithm outperformed other traditional classification methods.

  20. Mechanism and stoichiometry of interaction of DnaG primase with DnaB helicase of Escherichia coli in RNA primer synthesis.

    Science.gov (United States)

    Mitkova, Atanaska V; Khopde, Sujata M; Biswas, Subhasis B

    2003-12-26

    Initiation and synthesis of RNA primers in the lagging strand of the replication fork in Escherichia coli requires the replicative DnaB helicase and the DNA primase, the DnaG gene product. In addition, the physical interaction between these two replication enzymes appears to play a role in the initiation of chromosomal DNA replication. In vitro, DnaB helicase stimulates primase to synthesize primers on single-stranded (ss) oligonucleotide templates. Earlier studies hypothesized that multiple primase molecules interact with each DnaB hexamer and single-stranded DNA. We have examined this hypothesis and determined the exact stoichiometry of primase to DnaB hexamer. We have also demonstrated that ssDNA binding activity of the DnaB helicase is necessary for directing the primase to the initiator trinucleotide and synthesis of 11-20-nucleotide long primers. Although, association of these two enzymes determines the extent and rate of synthesis of the RNA primers in vitro, direct evidence of the formation of primase-DnaB complex has remained elusive in E. coli due to the transient nature of their interaction. Therefore, we stabilized this complex using a chemical cross-linker and carried out a stoichiometric analysis of this complex by gel filtration. This allowed us to demonstrate that the primase-helicase complex of E. coli is comprised of three molecules of primase bound to one DnaB hexamer. Fluorescence anisotropy studies of the interaction of DnaB with primase, labeled with the fluorescent probe Ru(bipy)3, and Scatchard analysis further supported this conclusion. The addition of DnaC protein, leading to the formation of the DnaB-DnaC complex, to the simple priming system resulted in the synthesis of shorter primers. Therefore, interactions of the DnaB-primase complex with other replication factors might be critical for determining the physiological length of the RNA primers in vivo and the overall kinetics of primer synthesis.

  1. Electrochemical label-free and sensitive nanobiosensing of DNA hybridization by graphene oxide modified pencil graphite electrode.

    Science.gov (United States)

    Ahour, F; Shamsi, A

    2017-09-01

    Based on the strong interaction between single-stranded DNA (ss-DNA) and graphene material, we have constructed a novel label-free electrochemical biosensor for rapid and facile detection of short sequences ss-DNA molecules related to hepatitis C virus 1a using graphene oxide modified pencil graphite electrode. The sensing mechanism is based on the superior adsorption of single-stranded DNA to GO over double stranded DNA (ds-DNA). The intrinsic guanine oxidation signal measured by differential pulse voltammetry (DPV) has been used for duplex DNA formation detection. The probe ss-DNA adsorbs onto the surface of GO via the π- π* stacking interactions leading to a strong background guanine oxidation signal. In the presence of complementary target, formation of helix which has weak binding ability to GO induced ds-DNA to release from the electrode surface and significant variation in differential pulse voltammetric response of guanine bases. The results indicated that the oxidation peak current was proportional to the concentration of complementary strand in the range of 0.1 nM-0.5 μM with a detection limit of 4.3 × 10 -11  M. The simple fabricated electrochemical biosensor has high sensitivity, good selectivity, and could be applied as a new platform for a range of target molecules in future. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Development of a graphene oxide-based assay for the sequence-specific detection of double-stranded DNA molecules.

    Directory of Open Access Journals (Sweden)

    Anna Maria Giuliodori

    Full Text Available Graphene oxide (GO is a promising material for the development of cost-effective detection systems. In this work, we have devised a simple and rapid GO-based method for the sequence-specific identification of DNA molecules generated by PCR amplification. The csp genes of Escherichia coli, which share a high degree of sequence identity, were selected as paradigm DNA templates. All tested csp genes were amplified with unlabelled primers, which can be rapidly removed at the end of the PCR taking advantage of the preferential binding to GO of single-stranded versus duplex DNA molecules. The amplified DNAs (targets were heat-denatured and hybridized to a fluorescently-labelled single strand oligonucleotide (probe, which recognizes a region of the target DNAs displaying sequence variability. This interaction is extremely specific, taking place with high efficiency only when target and probe show perfect or near perfect matching. Upon GO addition, the unbound fraction of the probe was captured and its fluorescence quenched by the GO's molecular properties. On the other hand, the probe-target complexes remained in solution and emitted a fluorescent signal whose intensity was related to their degree of complementarity.

  3. Probing the nature of hydrogen bonds in DNA base pairs.

    Science.gov (United States)

    Mo, Yirong

    2006-07-01

    Energy decomposition analyses based on the block-localized wave-function (BLW-ED) method are conducted to explore the nature of the hydrogen bonds in DNA base pairs in terms of deformation, Heitler-London, polarization, electron-transfer and dispersion-energy terms, where the Heitler-London energy term is composed of electrostatic and Pauli-exchange interactions. A modest electron-transfer effect is found in the Watson-Crick adenine-thymine (AT), guanine-cytosine (GC) and Hoogsteen adenine-thymine (H-AT) pairs, confirming the weak covalence in the hydrogen bonds. The electrostatic attraction and polarization effects account for most of the binding energies, particularly in the GC pair. Both theoretical and experimental data show that the GC pair has a binding energy (-25.4 kcal mol(-1) at the MP2/6-31G** level) twice that of the AT (-12.4 kcal mol(-1)) and H-AT (-12.8 kcal mol(-1)) pairs, compared with three conventional N-H...O(N) hydrogen bonds in the GC pair and two in the AT or H-AT pair. Although the remarkably strong binding between the guanine and cytosine bases benefits from the opposite orientations of the dipole moments in these two bases assisted by the pi-electron delocalization from the amine groups to the carbonyl groups, model calculations demonstrate that pi-resonance has very limited influence on the covalence of the hydrogen bonds. Thus, the often adopted terminology "resonance-assisted hydrogen bonding (RHAB)" may be replaced with "resonance-assisted binding" which highlights the electrostatic rather than electron-transfer nature of the enhanced stabilization, as hydrogen bonds are usually regarded as weak covalent bonds.

  4. Cloning and Characterization of a Complex DNA Fingerprinting Probe for Candida parapsilosis

    Science.gov (United States)

    Enger, Lee; Joly, Sophie; Pujol, Claude; Simonson, Patricia; Pfaller, Michael; Soll, David R.

    2001-01-01

    Candida parapsilosis accounts for a significant number of nosocomial fungemias, but in fact, no effective and verified genetic fingerprinting method has emerged for assessing the relatedness of independent isolates for epidemiological studies. A complex 15-kb DNA fingerprinting probe, Cp3-13, was therefore isolated from a library of C. parapsilosis genomic DNA fragments. The efficacy of Cp3-13 for DNA fingerprinting was verified by a comparison of its clustering capacity with those of randomly amplified polymorphic DNA analysis and internally transcribed spacer region sequencing, by testing species specificity, and by assessing its capacity to identify microevolutionary changes both in vitro and in vivo. Southern blot hybridization of EcoRI/SalI-digested DNA with Cp3-13 provides a fingerprinting system that (i) identifies the same strain in independent isolates, (ii) discriminates between unrelated isolates, (iii) separates independent isolates into valid groups in a dendrogram, (iv) identifies microevolution in infecting populations, and (v) is amenable to automatic computer-assisted DNA fingerprint analysis. This probe is now available for epidemiological studies. PMID:11158125

  5. A sensitive DNA biosensor based on a facile sulfamide coupling reaction for capture probe immobilization

    International Nuclear Information System (INIS)

    Wang, Qingxiang; Ding, Yingtao; Gao, Feng; Jiang, Shulian; Zhang, Bin; Ni, Jiancong; Gao, Fei

    2013-01-01

    Graphical abstract: A novel DNA biosensor was fabricated through a facile sulfamide coupling reaction between probe DNA and the sulfonic dye of 1-amino-2-naphthol-4-sulfonic acid that electrodeposited on a glassy carbon electrode. -- Highlights: •A versatile sulfonic dye of ANS was electrodeposited on a GCE. •A DNA biosensor was fabricated based on a facile sulfamide coupling reaction. •High probe DNA density of 3.18 × 10 13 strands cm −2 was determined. •A wide linear range and a low detection limit were obtained. -- Abstract: A novel DNA biosensor was fabricated through a facile sulfamide coupling reaction. First, the versatile sulfonic dye molecule of 1-amino-2-naphthol-4-sulfonate (AN-SO 3 − ) was electrodeposited on the surface of a glassy carbon electrode (GCE) to form a steady and ordered AN-SO 3 − layer. Then the amino-terminated capture probe was covalently grafted to the surface of SO 3 − -AN deposited GCE through the sulfamide coupling reaction between the amino groups in the probe DNA and the sulfonic groups in the AN-SO 3 − . The step-by-step modification process was characterized by electrochemistry and attenuated total reflectance Fourier transform infrared (ATR-FTIR) spectroscopy. Using Ru(NH 3 ) 6 3+ as probe, the probe density and the hybridization efficiency of the biosensor were determined to be 3.18 × 10 13 strands cm −2 and 86.5%, respectively. The hybridization performance of the biosensor was examined by differential pulse voltammetry using Co(phen) 3 3+/2+ (phen = 1,10-phenanthroline) as the indicator. The selectivity experiments showed that the biosensor presented distinguishable response after hybridization with the three-base mismatched, non-complementary and complementary sequences. Under the optimal conditions, the oxidation peak currents of Co(phen) 3 3+/2+ increased linearly with the logarithm values of the concentration of the complementary sequences in the range from 1.0 × 10 −13 M to 1.0 × 10 −8 M with

  6. Graphene oxide directed in-situ deposition of electroactive silver nanoparticles and its electrochemical sensing application for DNA analysis

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Ningning [College of Chemistry and Environment, Fujian Province Key Laboratory of Modern Analytical Science and Separation Technology, Minnan Normal University, Zhangzhou, 363000 (China); Gao, Feng, E-mail: fgao1981@mnnu.edu.cn [College of Chemistry and Environment, Fujian Province Key Laboratory of Modern Analytical Science and Separation Technology, Minnan Normal University, Zhangzhou, 363000 (China); Department of Chemistry, Graduate School of Science and Engineering, Shimane University, 1060 Nishikawatsu, Matsue, Shimane, 690-8504 (Japan); He, Suyu; Zhu, Qionghua; Huang, Jiafu [College of Chemistry and Environment, Fujian Province Key Laboratory of Modern Analytical Science and Separation Technology, Minnan Normal University, Zhangzhou, 363000 (China); Tanaka, Hidekazu [Department of Chemistry, Graduate School of Science and Engineering, Shimane University, 1060 Nishikawatsu, Matsue, Shimane, 690-8504 (Japan); Wang, Qingxiang, E-mail: axiang236@126.com [College of Chemistry and Environment, Fujian Province Key Laboratory of Modern Analytical Science and Separation Technology, Minnan Normal University, Zhangzhou, 363000 (China)

    2017-01-25

    The development of high-performance biosensing platform is heavily dependent on the recognition property of the sensing layer and the output intensity of the signal probe. Herein, we present a simple and highly sensitive biosensing interface for DNA detection on the basis of graphene oxide nanosheets (GONs) directed in-situ deposition of silver nanoparticles (AgNPs). The fabrication process and electrochemical properties of the biosensing interface were probed by electrochemical techniques and scanning electron microscopy. The results indicate that GONs can specifically adsorb at the single-stranded DNA probe surface, and induces the deposition of highly electroactive AgNPs. Upon hybridization with complementary oligonucleotides to generate the duplex DNA on the electrode surface, the GONs with the deposited AgNPs will be liberated from the sensing interface due to the inferior affinity of GONs and duplex DNA, resulting in the reduction of the electrochemical signal. Such a strategy combines the superior recognition of GONs toward single-stranded DNA and double-stranded DNA, and the strong electrochemical response of in-situ deposited AgNPs. Under optimal conditions, the biosensor can detect target DNA over a wide range from 10 fM to 10 nM with a detection limit of 7.6 fM. Also, the developed biosensor shows outstanding discriminating ability toward oligonucleotides with different mismatching degrees. - Highlights: • An novel DNA biosensor was constructed based on GONs with deposited AgNPs. • GONs catalyze the in-situ deposition of AgNPs on the sensing interface. • Unique π-stacking of GONs with probe DNA contributes high selectivity of the biosensor. • High electroactivity of AgNPs leads to low detection limit (7.6 fM) for target DNA.

  7. A Novel Open Tubular Capillary Electrochromatographic Method for Differentiating the DNA Interaction Affinity of Environmental Contaminants.

    Directory of Open Access Journals (Sweden)

    Lucia D'Ulivo

    Full Text Available The interaction of chemicals with DNA may lead to genotoxicity, mutation or carcinogenicity. A simple open tubular capillary electrochromatographic method is proposed to rapidly assess the interaction affinity of three environmental contaminants (1,4-phenylenediamine, pyridine and 2,4-diaminotoluene to DNA by measuring their retention in the capillaries coated with DNA probes. DNA oligonucleotide probes were immobilized on the inner wall of a fused silica capillary that was first derivatized with 3-(aminopropyl-triethoxysilane (APTES. The difference in retention times and factors was considered as the difference in interaction affinity of the contaminants to the DNA probes. The interaction of the contaminants with both double-stranded (dsDNA and single-stranded DNA (ssDNA coatings was compared. Retention factors of 1,4-phenylenediamine, pyridine and 2,4-diaminotoluene in the capillary coated with ssDNA probe were 0.29, 0.42, and 0.44, respectively. A similar trend was observed in the capillary coated with dsDNA, indicating that 2,4-diaminotoluene has the highest affinity among the three contaminants. The relative standard deviation (RSD for the retention factors was in the range of 0.05-0.69% (n = 3. The results demonstrated that the developed technique could be applied for preliminary screening purpose to provide DNA interaction affinity information of various environmental contaminants.

  8. Improving Probe Immobilization for Label-Free Capacitive Detection of DNA Hybridization on Microfabricated Gold Electrodes

    Directory of Open Access Journals (Sweden)

    Sandro Carrara

    2008-02-01

    Full Text Available Alternative approaches to labeled optical detection for DNA arrays are actively investigated for low-cost point-of-care applications. In this domain, label-free capacitive detection is one of the most intensely studied techniques. It is based on the idea to detect the Helmholtz ion layer displacements when molecular recognition occurs at the electrodes/solution interface. The sensing layer is usually prepared by using thiols terminated DNA single-strength oligonucleotide probes on top of the sensor electrodes. However, published data shows evident time drift, which greatly complicates signal conditioning and processing and ultimately increases the uncertainty in DNA recognition sensing. The aim of this work is to show that newly developed ethylene-glycol functionalized alkanethiols greatly reduce time drift, thereby significantly improving capacitance based label-free detection of DNA.

  9. Detection of p53 mutations by single-strand conformation polymorphisms (SSCP) gel electrophoresis. A comparative study of radioactive and nonradioactive silver-stained SSCP analysis.

    Science.gov (United States)

    Bosari, S; Marchetti, A; Buttitta, F; Graziani, D; Borsani, G; Loda, M; Bevilacqua, G; Coggi, G

    1995-12-01

    p53 mutations are the most common genetic abnormality in humans tumors, but their clinical significance remains to be precisely elucidated. Conventional single-strand conformation polymorphism (SSCP) analysis, a well-established technique for detecting p53 mutations, uses radioactively labeled polymerase chain reaction (PCR) products, which migrate abnormally in the presence of mutations. We performed radioactive PCR-SSCP analysis in a series of 30 formalin-fixed, paraffin-embedded ovarian carcinomas and two cell lines (SW480 and Caov4) harboring known homozygous p53 mutations and compared the results with nonradioactive silver-stained SSCP. The purpose was to assess whether nonradioactive SSCP is suitable for detecting p53 mutations in a rapid, sensitive, cost-effective fashion, without the need of radioactive isotopes. We accomplished PCR amplification of p53 exons 5 through 8 in 26 carcinomas, and radioactive SSCP detected p53 mutations in 13 tumors; three mutations were localized in exon 5, six in exon 6, two in exon 7, and two in exon 8. All mutations were correctly identified with nonradioactive SSCP, except for one exon 8 mutation. To establish the sensitivity of nonradioactive SSCP, DNA samples of SW480 and Caov4 were mixed with increasing amounts (0-90%) of normal DNA and subjected to PCR-SSCP analysis. Mutations were detected until the concentration of SW480 and Caov4 was 15% and 10%, respectively, of the total sample. The results of our investigation demonstrate that nonradioactive silver-stained SSCP is a sensitive, rapid, and simple technique to detect p53 mutations, even in formalin-fixed tissues, and could be easily used to investigate large series of patients to assess the clinical significance of p53 mutations in human tumors.

  10. DNA Replication Arrest and DNA Damage Responses Induced by Alkylating Minor Groove Binders

    National Research Council Canada - National Science Library

    Kuo, Shu-Ru

    2003-01-01

    .... We found that RPA purified from cells treated with adozelesin has the same single-stranded DNA binding activity and support nucleotide excision repair as normal RPA, but is not able to support SV40...

  11. The detection of HBV DNA with gold-coated iron oxide nanoparticle gene probes

    International Nuclear Information System (INIS)

    Xi Dong; Luo Xiaoping; Lu Qianghua; Yao Kailun; Liu Zuli; Ning Qin

    2008-01-01

    Gold-coated iron oxide nanoparticle Hepatitis B virus (HBV) DNA probes were prepared, and their application for HBV DNA measurement was studied. Gold-coated iron oxide nanoparticles were prepared by the citrate reduction of tetra-chloroauric acid in the presence of iron oxide nanoparticles which were added as seeds. With a fluorescence-based method, the maximal surface coverage of hexaethiol 30-mer oligonucleotides and the maximal percentage of hybridization strands on gold-coated iron oxide nanoparticles were (120 ± 8) oligonucleotides per nanoparticle, and (14 ± 2%), respectively, which were comparable with those of (132 ± 10) and (22 ± 3%) in Au nanoparticle groups. Large network aggregates were formed when gold-coated iron oxide nanoparticle HBV DNA gene probe was applied to detect HBV DNA molecules as evidenced by transmission electron microscopy and the high specificity was verified by blot hybridization. Our results further suggested that detecting DNA with iron oxide nanoparticles and magnetic separator was feasible and might be an alternative effective method

  12. DNA probes for distinguishing Psychodopygus wellcomei from Psychodopygus complexus (Diptera: Psychodidae

    Directory of Open Access Journals (Sweden)

    P. D. Ready

    1991-03-01

    Full Text Available Genomic DNA fragments from males of Psychodopygus wellcomei were isolated and shown to be useful as sensitive diagnostic probles for positively separting individuals of this species from those of Ps. complexus. These two members of the Ps. squamiventris series are found sympatrically in foci of cutaneous leishmaniasis in the hill forests of southern Pará State. Of the two species, only Ps. welcomei is thought to be an important vector of Leishmania braziliensis sensu stricto, buth this is based on circumstantial evidence because of the difficulties of identifying female sandflies wothin the series. The diagnostic probes were isolated from a library of Ps. wellcomei built by ligationg short fragments of Sau 3A-resistricted, genomic DNA into the plasmid vector PUC 18. Differential screening of 1316 library clones with total genomic DNA of Ps. Wellcomei and Ps. complexus identified 5 recombinants, with cross-hybridizing inserts of repetitive DNA, that showed strong specificity for Ps. wellcomei. As little as 0.4% of the DNA extracted from an individual sandfly (=ca. 0.5 namograms was specifically detected. The diagnostic probes were used to identify as Ps. wellcomei a wild-caught female sandfly found infected with L. braziliensis s.s., providing only the second positive association between these two species.

  13. DNA probe labeling with digoxigenin-dUTP and its application in gene diagnosis

    International Nuclear Information System (INIS)

    Liu Guoyang

    1992-01-01

    DNA probe labeling by the randomly primed incorporation of digoxigenin-dUTP is reported. The sensitivity of color reaction and hybridization were 32 fg and 200 fg, respectively, and both were specific for the target. Single-copy and multi-copy gene fragments among 2 μg human genomic DNA were detected by β IVS II, Fr 3-42 and 3'HVR labeled with digoxigenin-dUTP. The results were consistent with a radioactive control assay. This method has been successfully used in the gene diagnosis of adult polycystic kidney disease

  14. Ultrasensitive, rapid and inexpensive detection of DNA using paper based lateral flow assay

    Science.gov (United States)

    Jauset-Rubio, Miriam; Svobodová, Markéta; Mairal, Teresa; McNeil, Calum; Keegan, Neil; Saeed, Ayman; Abbas, Mohammad Nooredeen; El-Shahawi, Mohammad S.; Bashammakh, Abdulaziz S.; Alyoubi, Abdulrahman O.; O´Sullivan, Ciara K.

    2016-01-01

    Sensitive, specific, rapid, inexpensive and easy-to-use nucleic acid tests for use at the point-of-need are critical for the emerging field of personalised medicine for which companion diagnostics are essential, as well as for application in low resource settings. Here we report on the development of a point-of-care nucleic acid lateral flow test for the direct detection of isothermally amplified DNA. The recombinase polymerase amplification method is modified slightly to use tailed primers, resulting in an amplicon with a duplex flanked by two single stranded DNA tails. This tailed amplicon facilitates detection via hybridisation to a surface immobilised oligonucleotide capture probe and a gold nanoparticle labelled reporter probe. A detection limit of 1 × 10−11 M (190 amol), equivalent to 8.67 × 105 copies of DNA was achieved, with the entire assay, both amplification and detection, being completed in less than 15 minutes at a constant temperature of 37 °C. The use of the tailed primers obviates the need for hapten labelling and consequent use of capture and reporter antibodies, whilst also avoiding the need for any post-amplification processing for the generation of single stranded DNA, thus presenting an assay that can facilely find application at the point of need. PMID:27886248

  15. Pathotypes in the Entomophaga grylli species complex of grasshopper pathogens differentiated with random amplification of polymorphic DNA and cloned-DNA probes.

    Science.gov (United States)

    Bidochka, M J; Walsh, S R; Ramos, M E; Leger, R J; Silver, J C; Roberts, D W

    1995-01-01

    The zygomycetous fungus Entomophaga grylli is a pathogen that shows host-specific variance to grasshopper subfamilies. Three pathotypes of the E. grylli species complex were differentiated by three molecular techniques. In the first method, the three pathotypes showed different fragment patterns generated by random amplification of polymorphic DNA (RAPD). There was little or no interisolate variability in RAPD fragment patterns within each pathotype. Passage of an isolate of pathotype 3, originally from an Australian grasshopper (Praxibulus sp.), through a North America grasshopper resulted in no differences in the resultant RAPD fragment patterns. In the second method, polymorphic RAPD fragments were used to probe the genomic DNA from the three pathotypes, and pathotype-specific fragments were found. In the third method, restriction fragments from genomic DNA of the three pathotypes were cloned and screened for pathotype specificity. A genomic probe specific for each pathotype was isolated. These probes did not hybridize to DNA from Entomophaga aulicae or from grasshoppers. To facilitate the use of RAPD analysis and other molecular tools to identify pathotypes, a method for extracting DNA from resting spores from infected grasshoppers was developed. The DNA from the fractured resting spores was of sufficient integrity to be blotted and probed with the pathotype-specific DNA probes, thus validating the use of these probes for pathotype identification in field-collected grasshoppers. PMID:7574596

  16. DNA Structure Specificity Conferred on a Replicative Helicase by Its Loader*

    OpenAIRE

    Gupta, Milind K.; Atkinson, John; McGlynn, Peter

    2009-01-01

    Prokaryotic and eukaryotic replicative helicases can translocate along single-stranded and double-stranded DNA, with the central cavity of these multimeric ring helicases being able to accommodate both forms of DNA. Translocation by such helicases along single-stranded DNA results in the unwinding of forked DNA by steric exclusion and appears critical in unwinding of parental strands at the replication fork, whereas translocation over double-stranded DNA has no well-defined role. We have foun...

  17. Molecular studies of fibroblasts transfected with hepatitis B virus DNA

    International Nuclear Information System (INIS)

    Chen, M.L.; Hood, A.; Thung, S.N.; Gerber, M.A.

    1987-01-01

    Two subclones (D7 and F8) derived from an NIH 3T3 mouse fibroblast cell line after transfection with hepatitis B virus (HBV) genomes, secreted significantly different amounts of HBsAg and HBeAg. DNA extracted from the subclones revealed only integrated and no extrachromosomal HBV DNA sequences as determined by the Southern blot technique with a /sup 32/P-labeled full length HBV DNA probe. The amount and integration sites of HBV sequences were significantly different in the two subclones. HBV DNA sequences coding for HBsAg and HBcAg were detected by alkaline phosphatase-conjugated, single-stranded synthetic gene-specific oligonucleotide probes revealing a larger number of copies in D7 DNA than in F8 DNA. Using a biotinylated probe for in situ hybridization, HBV DNA was found in the nuclei of all D7 cells with predominant localization to a single chromsome, but only in 10-20% of F8 cells. These observations demonstrate different integration patterns of HBV and DNA in two subclones derived from a transfected cell line and suggest that the amount of integrated HBV DNA is proportional to the amount of HBV antigens produced

  18. DNA-based stable isotope probing: a link between community structure and function

    International Nuclear Information System (INIS)

    Uhlik, Ondrej; Jecna, Katerina; Leigh, Mary Beth; Mackova, Martina; Macek, Tomas

    2009-01-01

    DNA-based molecular techniques permit the comprehensive determination of microbial diversity but generally do not reveal the relationship between the identity and the function of microorganisms. The first direct molecular technique to enable the linkage of phylogeny with function is DNA-based stable isotope probing (DNA-SIP). Applying this method first helped describe the utilization of simple compounds, such as methane, methanol or glucose and has since been used to detect microbial communities active in the utilization of a wide variety of compounds, including various xenobiotics. The principle of the method lies in providing 13C-labeled substrate to a microbial community and subsequent analyses of the 13C-DNA isolated from the community. Isopycnic centrifugation permits separating 13C-labeled DNA of organisms that utilized the substrate from 12C-DNA of the inactive majority. As the whole metagenome of active populations is isolated, its follow-up analysis provides successful taxonomic identification as well as the potential for functional gene analyses. Because of its power, DNA-SIP has become one of the leading techniques of microbial ecology research. But from other point of view, it is a labor-intensive method that requires careful attention to detail during each experimental step in order to avoid misinterpretation of results.

  19. Probing transcription factor binding activity and downstream gene silencing in living cells with a DNA nanoswitch.

    Science.gov (United States)

    Bertucci, Alessandro; Guo, Junling; Oppmann, Nicolas; Glab, Agata; Ricci, Francesco; Caruso, Frank; Cavalieri, Francesca

    2018-01-25

    Transcription factor DNA binding activity is of pivotal importance in living systems because of its primary involvement in the regulation of genetic machinery. The analysis of transient expression levels of transcription factors in response to a certain cell status is a powerful means for investigating cellular dynamics at the biomolecular level. Herein, a DNA-based molecular switch that enables probing of transcription factor DNA binding activity is directly used in living cells. We demonstrate that the DNA nanoswitch allows for dynamic fluorescence imaging of NF-κB and quantification of downstream gene silencing in real time. The present strategy is based on a functional DNA nanodevice that transduces, through a binding-induced conformational change, the recognition of a specific transcription factor into a fluorescent signal. In addition, stochastic optical resolution microscopy, a super-resolution microscopy technique, is used to track the internalization and intracellular trafficking of the DNA nanodevice with high spatial resolution. Overall, it has been shown that a rationally designed DNA nanodevice can be used to achieve rapid, simple, and cost-effective real-time determination of transcription factor binding activity and downstream gene silencing.

  20. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Vrushali S. [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Gokhale, Suresh P.; Patil, Kashinath R. [Physical and Material Chemistry Division, National Chemical Laboratory, Pune (India); Haram, Santosh K., E-mail: haram@chem.unipune.ernet.i [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)

    2010-02-15

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 +- 2 mum and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, alpha-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k{sup 0}) and electron transfer coefficient (alpha) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  1. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    International Nuclear Information System (INIS)

    Joshi, Vrushali S.; Gokhale, Suresh P.; Patil, Kashinath R.; Haram, Santosh K.

    2010-01-01

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 ± 2 μm and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, α-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k 0 ) and electron transfer coefficient (α) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  2. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol

    2013-01-01

    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  3. A DNA Microarray-Based Assay to Detect Dual Infection with Two Dengue Virus Serotypes

    Science.gov (United States)

    Díaz-Badillo, Alvaro; de Lourdes Muñoz, María; Perez-Ramirez, Gerardo; Altuzar, Victor; Burgueño, Juan; Mendoza-Alvarez, Julio G.; Martínez-Muñoz, Jorge P.; Cisneros, Alejandro; Navarrete-Espinosa, Joel; Sanchez-Sinencio, Feliciano

    2014-01-01

    Here; we have described and tested a microarray based-method for the screening of dengue virus (DENV) serotypes. This DNA microarray assay is specific and sensitive and can detect dual infections with two dengue virus serotypes and single-serotype infections. Other methodologies may underestimate samples containing more than one serotype. This technology can be used to discriminate between the four DENV serotypes. Single-stranded DNA targets were covalently attached to glass slides and hybridised with specific labelled probes. DENV isolates and dengue samples were used to evaluate microarray performance. Our results demonstrate that the probes hybridized specifically to DENV serotypes; with no detection of unspecific signals. This finding provides evidence that specific probes can effectively identify single and double infections in DENV samples. PMID:24776933

  4. A DNA Microarray-Based Assay to Detect Dual Infection with Two Dengue Virus Serotypes

    Directory of Open Access Journals (Sweden)

    Alvaro Díaz-Badillo

    2014-04-01

    Full Text Available Here; we have described and tested a microarray based-method for the screening of dengue virus (DENV serotypes. This DNA microarray assay is specific and sensitive and can detect dual infections with two dengue virus serotypes and single-serotype infections. Other methodologies may underestimate samples containing more than one serotype. This technology can be used to discriminate between the four DENV serotypes. Single-stranded DNA targets were covalently attached to glass slides and hybridised with specific labelled probes. DENV isolates and dengue samples were used to evaluate microarray performance. Our results demonstrate that the probes hybridized specifically to DENV serotypes; with no detection of unspecific signals. This finding provides evidence that specific probes can effectively identify single and double infections in DENV samples.

  5. Doping Level of Boron-Doped Diamond Electrodes Controls the Grafting Density of Functional Groups for DNA Assays.

    Science.gov (United States)

    Švorc, Ĺubomír; Jambrec, Daliborka; Vojs, Marian; Barwe, Stefan; Clausmeyer, Jan; Michniak, Pavol; Marton, Marián; Schuhmann, Wolfgang

    2015-09-02

    The impact of different doping levels of boron-doped diamond on the surface functionalization was investigated by means of electrochemical reduction of aryldiazonium salts. The grafting efficiency of 4-nitrophenyl groups increased with the boron levels (B/C ratio from 0 to 20,000 ppm). Controlled grafting of nitrophenyldiazonium was used to adjust the amount of immobilized single-stranded DNA strands at the surface and further on the hybridization yield in dependence on the boron doping level. The grafted nitro functions were electrochemically reduced to the amine moieties. Subsequent functionalization with a succinic acid introduced carboxyl groups for subsequent binding of an amino-terminated DNA probe. DNA hybridization significantly depends on the probe density which is in turn dependent on the boron doping level. The proposed approach opens new insights for the design and control of doped diamond surface functionalization for the construction of DNA hybridization assays.

  6. Mismatch discrimination of lipidated DNA and LNA-probes (LiNAs) in hybridization-controlled liposome assembly

    DEFF Research Database (Denmark)

    Jakobsen, Ulla; Vogel, Stefan

    2016-01-01

    nucleic acids) probe designs, including membrane-anchoring requirements, studies on different probes and target lengths (including overhangs), DNA and RNA targets (including sequences associated with pathogens) for lipidated nucleic acids (LiNAs). Advantages and limitations of the liposome assembly based...... assay in the context of mismatch discrimination and SNP detection are presented. The advantages of membrane-anchored LiNA-probes compared to chemically attached probes on solid nanoparticles (e.g. gold nanoparticles) are described. Key functionalities such as non-covalent attachment of LiNA probes...

  7. Gold nanoparticle-based 2'-O-methyl modified DNA probes for breast cancerous theranostics.

    Science.gov (United States)

    Li, Jing; Huang, Jin; Yang, Xiaohai; Yang, Yanjing; Quan, Ke; Xie, Nuli; Wu, Yanan; Ma, Changbei; Wang, Kemin

    2018-06-01

    MicroRNAs (miRNAs) are a class of small non-coding RNAs that regulated diverse cellular processes including differentiation, proliferation, apoptosis, metabolism and signal transduction pathways. An increasing number of data suggested that miRNA-21 could be identified as diagnostic and therapeutic biomarker for breast cancer. Meanwhile, inhibiting the function of miRNA-21, resulting in cells growth inhibition and apoptotic cells death. To realize miRNA-21detection and inhibition to diagnostic and therapeutic breast cancer cells, we developed gold nanoparticle-based 2'-O-methyl modified DNA probes (AuNP-2'-OMe-DNA probes) for diagnostic and therapeutic breast cancer. Gold nanoparticles were functionalized with chemically modified miRNA-21 inhibitor to suppress the function of miRNA-21 for the therapeutic breast cancer, at the same time, fluorophore-labeled DNA molecules were hybridized with antimiRNA-21 for diagnostic breast cancer. The results showed that the 2'-O-methyl modified DNA can improve stability, increase binding affinity to target strands and enhance the therapeutic effects. The experimental results also demonstrated that antimiR-21 were efficiently introduced into the cells and knocked down miRNA-21 to inhibit its function, leading to growth inhibition and apoptotic cells death. We prospected that chemically modified miRNA-21 inhibitor based on gold nanoparticles would be as a promising diagnostic and therapeutic platform for breast cancer clinically. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Simultaneous detection of DNA from 10 food allergens by ligation-dependent probe amplification.

    Science.gov (United States)

    Ehlert, Alexandra; Demmel, Anja; Hupfer, Christine; Busch, Ulrich; Engel, Karl-Heinz

    2009-04-01

    The simultaneous detection of DNA from different allergenic food ingredients by a ligation-dependent probe amplification (LPA) system is described. The approach allows detection of several targets in a one-tube assay. Synthetic oligonucleotides were designed to detect DNA from peanuts, cashews, pecans, pistachios, hazelnuts, sesame seeds, macadamia nuts, almonds, walnuts and brazil nuts. The specificity of the system was tested with DNA from more than 50 plant and animal species. The sensitivity of the method was suitable to detect allergenic ingredients in the low mg kg(-1) range. The limit of detection (LOD) for single allergens in different food matrices was 5 mg kg(-1). The novel analytical strategy represents a useful tool for the surveillance of established legislation on food allergens within the European Union.

  9. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes

    Czech Academy of Sciences Publication Activity Database

    Pietilä, M.K.; Roine, E.; Sencilo, Ana; Bamford, D.H.; Oksanen, H.M.

    2016-01-01

    Roč. 161, č. 1 (2016), s. 249-256 ISSN 0304-8608 R&D Projects: GA ČR(CZ) GAP302/11/ 1940 Institutional support: RVO:61388971 Keywords : VIRION ARCHITECTURE * HALOVIRUSES * SPINDLE Subject RIV: EE - Microbiology, Virology Impact factor: 2.058, year: 2016

  10. DNA-templated antibody conjugation for targeted drug delivery to cancer cells

    DEFF Research Database (Denmark)

    Liu, Tianqiang

    2016-01-01

    conjugation strategy. Recently, a site-selective antibody conjugation method called “DNA-templated protein conjugation (DTPC)” was developed by our group. The site-selective covalently attachment of single-stranded DNA (ssDNA) to proteins was achieved by using a metal-affinity DNA probe and DNA-templated...... state to get a good pharmacological performance. Recombinant antibody engineering with non-natural amino acids, or enzyme-mediated conjugation approaches (transglutaminase, Sortase A or endoglycosidase) have been reported for producing homogeneous antibody conjugates. However, these methods require...... organic synthesis due to the wide existence of the 3-histidine cluster in most wild-type proteins. In this thesis, three projects that relate to targeted drug delivery to cancer cells based on the DTPC method is described. The first project was a delivery system which uses transferrin as the targeting...

  11. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms.

    Science.gov (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A

    2012-05-01

    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Telomerase suppresses formation of ALT-associated single-stranded telomeric C-circles.

    Science.gov (United States)

    Plantinga, Matthew J; Pascarelli, Kara M; Merkel, Anna S; Lazar, Alexander J; von Mehren, Margaret; Lev, Dina; Broccoli, Dominique

    2013-06-01

    Telomere maintenance is an essential characteristic of cancer cells, most commonly achieved by activation of telomerase. Telomeres can also be maintained by a recombination-based mechanism, alternative lengthening of telomeres (ALT). Cells using ALT are characterized by the presence of ALT-associated promyelocytic leukemia (PML) bodies (APB), long, heterogeneously sized telomeres, extrachromosomal telomeric circular DNA, and elevated telomeric recombination. Consistent with other reports, we found that liposarcomas containing APBs, but lacking telomerase expression, always contained C-rich circles (C-circles), and these C-circles were never present in the absence of APBs, indicating a tight link between these features in ALT cells. However, a rare subgroup of tumors showing evidence of telomere maintenance by both telomerase and ALT did not contain C-circles. To test the hypothesis that telomerase expression disrupts the tight link between APBs and C-circles, we used ALT cell lines that were engineered to express telomerase. Introduction of telomerase activity in these ALT cells resulted in, on average, shorter telomeres with retention of APBs. However, at high passage, the level of C-circles was significantly reduced, which was paralleled by a switch from C-strand overhangs to G-strand overhangs. We propose that by extending critically short telomeres in these cells, telomerase is disrupting a key step in the ALT pathway necessary for production and/or maintenance of C-circles. ©2013 AACR.

  13. Method for detecting point mutations in DNA utilizing fluorescence energy transfer

    Science.gov (United States)

    Parkhurst, Lawrence J.; Parkhurst, Kay M.; Middendorf, Lyle

    2001-01-01

    A method for detecting point mutations in DNA using a fluorescently labeled oligomeric probe and Forster resonance energy transfer (FRET) is disclosed. The selected probe is initially labeled at each end with a fluorescence dye, which act together as a donor/acceptor pair for FRET. The fluorescence emission from the dyes changes dramatically from the duplex stage, wherein the probe is hybridized to the complementary strand of DNA, to the single strand stage, when the probe is melted to become detached from the DNA. The change in fluorescence is caused by the dyes coming into closer proximity after melting occurs and the probe becomes detached from the DNA strand. The change in fluorescence emission as a function of temperature is used to calculate the melting temperature of the complex or T.sub.m. In the case where there is a base mismatch between the probe and the DNA strand, indicating a point mutation, the T.sub.m has been found to be significantly lower than the T.sub.m for a perfectly match probelstand duplex. The present invention allows for the detection of the existence and magnitude of T.sub.m, which allows for the quick and accurate detection of a point mutation in the DNA strand and, in some applications, the determination of the approximate location of the mutation within the sequence.

  14. High-performance analysis of single interphase cells with custom DNA probes spanning translocation break points

    Science.gov (United States)

    Weier, Heinz-Ulli G.; Munne, S.; Lersch, Robert A.; Marquez, C.; Wu, J.; Pedersen, Roger A.; Fung, Jingly

    1999-06-01

    The chromatin organization of interphase cell nuclei, albeit an object of intense investigation, is only poorly understood. In the past, this has hampered the cytogenetic analysis of tissues derived from specimens where only few cells were actively proliferating or a significant number of metaphase cells could be obtained by induction of growth. Typical examples of such hard to analyze cell systems are solid tumors, germ cells and, to a certain extent, fetal cells such as amniocytes, blastomeres or cytotrophoblasts. Balanced reciprocal translocations that do not disrupt essential genes and thus do not led to disease symptoms exit in less than one percent of the general population. Since the presence of translocations interferes with homologue pairing in meiosis, many of these individuals experience problems in their reproduction, such as reduced fertility, infertility or a history of spontaneous abortions. The majority of translocation carriers enrolled in our in vitro fertilization (IVF) programs carry simple translocations involving only two autosomes. While most translocations are relatively easy to spot in metaphase cells, the majority of cells biopsied from embryos produced by IVF are in interphase and thus unsuitable for analysis by chromosome banding or FISH-painting. We therefore set out to analyze single interphase cells for presence or absence of specific translocations. Our assay, based on fluorescence in situ hybridization (FISH) of breakpoint-spanning DNA probes, detects translocations in interphase by visual microscopic inspection of hybridization domains. Probes are prepared so that they span a breakpoint and cover several hundred kb of DNA adjacent to the breakpoint. On normal chromosomes, such probes label a contiguous stretch of DNA and produce a single hybridization domain per chromosome in interphase cells. The translocation disrupts the hybridization domain and the resulting two fragments appear as physically separated hybridization domains in

  15. Determination of mutated genes in the presence of wild-type DNA by using molecular beacons as probe

    Science.gov (United States)

    Zhang, Yonghua; Ai, Junjie; Gu, Qiaorong; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao

    2017-03-01

    Low-abundance mutations in the presence of wild-type DNA can be determined using molecular beacon (MB) as probe. A MB is generally used as DNA probe because it can distinguish single-base mismatched target DNA from fully matched target DNA. However, the probe can not determine low-abundance mutations in the presence of wild-type DNA. In this study, this limitation is addressed by enhancing the stability of unpaired base-containing dsDNA with a hydrogen-bonding ligand, which was added after hybridization of the MB to the target DNA. The ligand formed hydrogen bonds with unpaired bases and stabilized the unpaired base-containing dsDNA if target DNA is mutated one. As a result, more MBs were opened by the mutant genes in the presence of the ligand and a further increase in the fluorescence intensity was obtained. By contrast, fluorescence intensity did not change if target DNA is wild-type one. Consequent increase in the fluorescence intensity of the MB was regarded as a signal derived from mutant genes. The proposed method was applied in synthetic template systems to determine point mutation in DNA obtained from PCR analysis. The method also allows rapid and simple discrimination of a signal if it is originated in the presence of mutant gene or alternatively by a lower concentration of wild gene.

  16. Efficiency of application of different DNA probes in identifying marker chromosomes

    Directory of Open Access Journals (Sweden)

    Tavokina L. V.

    2016-02-01

    Full Text Available The presence of marker chromosomes in the human karyotype always requires a special diagnostic approach. Determination of the marker chromosome type and structure is of great diagnostic and prognostic importance. There are several methods of marker chromosomes identification, which differ in their informative value. The paper presents the results of cytogenetic and FISH diagnostics of supernumerical marker chromosomes (SMC cases in patients’ karyotype. Aim. To analyze the results of the cytogenetic and molecular cytogenetic diagnostics for patients with marker chromosomes, and to evaluate and compare the efficiency of the methods used. Methods. Karyotyping was done according to the standard methods. GTG, CBG, QFQ and NOR-Ag methods of differential staining were used. FISH was performed according to the manufacturer’s instructions for CEP, LSI and WCP DNA-probes. Results. Marker chromosome was found in 15 of 7989 patients. Application of standard staining methods was effective in 66.6 % of cases. Combination of differential staining and FISH allowed identifying a marker chromosome in 83.3 %. 90 % of all marker chromosomes were identified as isochromosomes and 60 % of them were derivative from chromosome 15. Conclusions. The use of WCP probes is a main step in the marker chromosome identification with further application of CEP/LSI probes. If a marker chromosome has nonspecific DNA sequences more sensitive methods should be use..

  17. Development and Characterization of Complex DNA Fingerprinting Probes for the Infectious Yeast Candida dubliniensis

    Science.gov (United States)

    Joly, Sophie; Pujol, Claude; Rysz, Michal; Vargas, Kaaren; Soll, David R.

    1999-01-01

    Using a strategy to clone large genomic sequences containing repetitive elements from the infectious yeast Candida dubliniensis, the three unrelated sequences Cd1, Cd24, and Cd25, with respective molecular sizes of 15,500, 10,000, and 16,000 bp, were cloned and analyzed for their efficacy as DNA fingerprinting probes. Each generated a complex Southern blot hybridization pattern with endonuclease-digested genomic DNA. Cd1 generated an extremely variable pattern that contained all of the bands of the pattern generated by the repeat element RPS of Candida albicans. We demonstrated that Cd1 does not contain RPS but does contain a repeat element associated with RPS throughout the C. dubliniensis genome. The Cd1 pattern was the least stable over time both in vitro and in vivo and for that reason proved most effective in assessing microevolution. Cd24, which did not exhibit microevolution in vitro, was highly variable in vivo, suggesting in vivo-dependent microevolution. Cd25 was deemed the best probe for broad epidemiological studies, since it was the most stable over time, was the only truly C. dubliniensis-specific probe of the three, generated the most complex pattern, was distributed throughout all C. dubliniensis chromosomes, and separated a worldwide collection of 57 C. dubliniensis isolates into two distinct groups. The presence of a species-specific repetitive element in Cd25 adds weight to the already substantial evidence that C. dubliniensis represents a bona fide species. PMID:10074523

  18. Detection of Hepatitis B Virus M204I Mutation by Quantum Dot-Labeled DNA Probe

    Directory of Open Access Journals (Sweden)

    Cheng Zhang

    2017-04-01

    Full Text Available Quantum dots (QDs are semiconductor nanoparticles with a diameter of less than 10 nm, which have been widely used as fluorescent probes in biochemical analysis and vivo imaging because of their excellent optical properties. Sensitive and convenient detection of hepatitis B virus (HBV gene mutations is important in clinical diagnosis. Therefore, we developed a sensitive, low-cost and convenient QDs-mediated fluorescent method for the detection of HBV gene mutations in real serum samples from chronic hepatitis B (CHB patients who had received lamivudine or telbivudine antiviral therapy. We also evaluated the efficiency of this method for the detection of drug-resistant mutations compared with direct sequencing. In CHB, HBV DNA from the serum samples of patients with poor response or virological breakthrough can be hybridized to probes containing the M204I mutation to visualize fluorescence under fluorescence microscopy, where fluorescence intensity is related to the virus load, in our method. At present, the limits of the method used to detect HBV genetic variations by fluorescence quantum dots is 103 IU/mL. These results show that QDs can be used as fluorescent probes to detect viral HBV DNA polymerase gene variation, and is a simple readout system without complex and expensive instruments, which provides an attractive platform for the detection of HBV M204I mutation.

  19. Use of cell-SELEX to generate DNA aptamers as molecular probes of HPV-associated cervical cancer cells.

    Directory of Open Access Journals (Sweden)

    Jessica C Graham

    Full Text Available Disease-specific biomarkers are an important tool for the timely and effective management of pathological conditions, including determination of susceptibility, diagnosis, and monitoring efficacy of preventive or therapeutic strategies. Aptamers, comprising single-stranded or double-stranded DNA or RNA, can serve as biomarkers of disease or biological states. Aptamers can bind to specific epitopes on macromolecules by virtue of their three dimensional structures and, much like antibodies, aptamers can be used to target specific epitopes on the basis of their molecular shape. The Systematic Evolution of Ligands by EXponential enrichment (SELEX is the approach used to select high affinity aptamers for specific macromolecular targets from among the >10(13 oligomers comprising typical random oligomer libraries. In the present study, we used live cell-based SELEX to identify DNA aptamers which recognize cell surface differences between HPV-transformed cervical carcinoma cancer cells and isogenic, nontumorigenic, revertant cell lines.Whole-cell SELEX methodology was adapted for use with adherent cell lines (which we termed Adherent Cell-SELEX (AC-SELEX. Using this approach, we identified high affinity aptamers (nanomolar range K(d to epitopes specific to the cell surface of two nontumorigenic, nontumorigenic revertants derived from the human cervical cancer HeLa cell line, and demonstrated the loss of these epitopes in another human papillomavirus transformed cervical cancer cell line (SiHa. We also performed preliminary investigation of the aptamer epitopes and their binding characteristics.Using AC-SELEX we have generated several aptamers that have high affinity and specificity to the nontumorigenic, revertant of HPV-transformed cervical cancer cells. These aptamers can be used to identify new biomarkers that are related to carcinogenesis. Panels of aptamers, such as these may be useful in predicting the tumorigenic potential and properties of

  20. A DNA nanocapsule with aptamer-controlled open-closure function for targeted delivery

    DEFF Research Database (Denmark)

    Bentin, Thomas

    2012-01-01

    A DNA capsule fitted with aptamer controlled target sensing has been "woven" using a 7308-base single-stranded DNA "thread" and 196 staple oligonucleotides. The capsule enables logic-gated molecular cargo delivery to targeted cell surfaces.......A DNA capsule fitted with aptamer controlled target sensing has been "woven" using a 7308-base single-stranded DNA "thread" and 196 staple oligonucleotides. The capsule enables logic-gated molecular cargo delivery to targeted cell surfaces....

  1. Molecular definition of high-resolution multicolor banding probes: first within the human DNA sequence anchored FISH banding probe set.

    Science.gov (United States)

    Weise, Anja; Mrasek, Kristin; Fickelscher, Ina; Claussen, Uwe; Cheung, Sau Wai; Cai, Wei Wen; Liehr, Thomas; Kosyakova, Nadezda

    2008-05-01

    Fluorescence in situ hybridization (FISH) banding approaches are standard for the exact characterization of simple, complex, and even cryptic chromosomal aberrations within the human genome. The most frequently applied FISH banding technique is the multicolor banding approach, also abbreviated as m-band, MCB, or in its whole genomic variant multitude MCB (mMCB). MCB allows the differentiation of chromosome region-specific areas at the GTG band and sub-band level and is based on region-specific microdissection libraries, producing changing fluorescence intensity ratios along the chromosomes. The latter are used to assign different pseudocolors to specific chromosomal regions. Here we present the first bacterial artificial chromosome (BAC) array comparative genomic hybridization (aCGH) mapped, comprehensive, genome-wide human MCB probe set. All 169 region-specific microdissection libraries were characterized in detail for their size and the regions of overlap. In summary, the unique possibilities of the MCB technique to characterize chromosomal breakpoints in one FISH experiment are now complemented by the feature of being anchored within the human DNA sequence at the BAC level.

  2. Method for construction of normalized cDNA libraries

    Science.gov (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris

    1998-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

  3. Use of a D17Z1 oligonucleotide probe for human DNA quantitation prior to PCR analysis of polymorphic DNA markers

    Energy Technology Data Exchange (ETDEWEB)

    Walsh, S.; Alavaren, M.; Varlaro, J. [Roche Molecular Systems, Alameda, CA (United States)] [and others

    1994-09-01

    The alpha-satellite DNA locus D17Z1 contains primate-specific sequences which are repeated several hundred times per chromosome 17. A probe that was designed to hybridize to a subset of the D17Z1 sequence can be used for very sensitive and specific quantitation of human DNA. Sample human genomic DNA is immobilized on nylon membrane using a slot blot apparatus, and then hybridized with a biotinylated D17Z1 oligonucleotide probe. The subsequent binding of streptavidin-horseradish peroxidase to the bound probe allows for either calorimetric (TMB) or chemiluminescent (ECL) detection. Signals obtained for sample DNAs are then compared to the signals obtained for a series of human DNA standards. For either detection method, forty samples can be quantitated in less than two hours, with a sensitivity of 150 pg. As little as 20 pg of DNA can be quantitated when using chemiluminescent detection with longer film exposures. PCR analysis of several VNTR and STR markers has indicated that optimal typing results are generally obtained within a relatively narrow range of input DNA quantities. Too much input DNA can lead to PCR artifacts such as preferential amplification of smaller alleles, non-specific amplification products, and exaggeration of the DNA synthesis slippage products that are seen with STR markers. Careful quantitation of human genomic DNA prior to PCR can avoid or minimize these problems and ultimately give cleaner, more unambiguous PCR results.

  4. Nucleic acid-based fluorescent probes and their analytical potential.

    Science.gov (United States)

    Juskowiak, Bernard

    2011-03-01

    It is well known that nucleic acids play an essential role in living organisms because they store and transmit genetic information and use that information to direct the synthesis of proteins. However, less is known about the ability of nucleic acids to bind specific ligands and the application of oligonucleotides as molecular probes or biosensors. Oligonucleotide probes are single-stranded nucleic acid fragments that can be tailored to have high specificity and affinity for different targets including nucleic acids, proteins, small molecules, and ions. One can divide oligonucleotide-based probes into two main categories: hybridization probes that are based on the formation of complementary base-pairs, and aptamer probes that exploit selective recognition of nonnucleic acid analytes and may be compared with immunosensors. Design and construction of hybridization and aptamer probes are similar. Typically, oligonucleotide (DNA, RNA) with predefined base sequence and length is modified by covalent attachment of reporter groups (one or more fluorophores in fluorescence-based probes). The fluorescent labels act as transducers that transform biorecognition (hybridization, ligand binding) into a fluorescence signal. Fluorescent labels have several advantages, for example high sensitivity and multiple transduction approaches (fluorescence quenching or enhancement, fluorescence anisotropy, fluorescence lifetime, fluorescence resonance energy transfer (FRET), and excimer-monomer light switching). These multiple signaling options combined with the design flexibility of the recognition element (DNA, RNA, PNA, LNA) and various labeling strategies contribute to development of numerous selective and sensitive bioassays. This review covers fundamentals of the design and engineering of oligonucleotide probes, describes typical construction approaches, and discusses examples of probes used both in hybridization studies and in aptamer-based assays.

  5. The Modular Construction of DNA Double Helix

    Indian Academy of Sciences (India)

    DNA or the left-handed double helix,. Z- DNA. Construction of the Module .... 12. DNA, namely, replication and transcription. In the former case, Figure 3. 8 would represent a DNA single strand-generated by splitting of the mother duplex ...

  6. Multiplex Ligation-Dependent Probe Amplification Technique for Copy Number Analysis on Small Amounts of DNA Material

    DEFF Research Database (Denmark)

    Sørensen, Karina; Andersen, Paal; Larsen, Lars

    2008-01-01

    The multiplex ligation-dependent probe amplification (MLPA) technique is a sensitive technique for relative quantification of up to 50 different nucleic acid sequences in a single reaction, and the technique is routinely used for copy number analysis in various syndromes and diseases. The aim...... of the study was to exploit the potential of MLPA when the DNA material is limited. The DNA concentration required in standard MLPA analysis is not attainable from dried blood spot samples (DBSS) often used in neonatal screening programs. A novel design of MLPA probes has been developed to permit for MLPA...... analysis on small amounts of DNA. Six patients with congenital adrenal hyperplasia (CAH) were used in this study. DNA was extracted from both whole blood and DBSS and subjected to MLPA analysis using normal and modified probes. Results were analyzed using GeneMarker and manual Excel analysis. A total...

  7. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA

    Science.gov (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana

    2009-04-01

    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  8. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))

    1993-03-01

    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  9. Pyrrolo-dC modified duplex DNA as a novel probe for the sensitive assay of base excision repair enzyme activity.

    Science.gov (United States)

    Lee, Chang Yeol; Park, Ki Soo; Park, Hyun Gyu

    2017-12-15

    We develop a novel approach to determine formamidopyrimidine DNA glycosylase (Fpg) activity by taking advantage of the unique fluorescence property of pyrrolo-dC (PdC) positioned opposite to 8-oxoguanine (8-oxoG) in duplex DNA. In its initial state, PdC in duplex DNA undergoes the efficient stacking and collisional quenching interactions, showing the low fluorescence signal. In contrast, the presence of Fpg, which specifically removes 8-oxoG and incises resulting apurinic (AP) site, transforms duplex DNA into single-stranded (ss) DNAs. As a result, the intrinsic fluorescence signal of PdC in ssDNA is recovered to exhibit the significantly enhanced fluorescence signal. Based on this Fpg-dependent fluorescence response of PdC, we could reliably determine Fpg activity down to 1.25U/ml with a linear response from 0 to 50U/ml. In addition, the diagnostic capability of this strategy was successfully demonstrated by reliably assaying Fpg activity in human blood serum, showing its great potential in the practical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Detection of supercoiled hepatitis B virus DNA and related forms by means of molecular hybridization to an oligonucleotide probe

    International Nuclear Information System (INIS)

    Lin, H.J.; Chung, H.T.; Lai, C.L.; Leong, S.; Tam, O.S.

    1989-01-01

    A novel assay for supercoiled and other fully double-stranded forms of hepatitis B virus (HBV) DNA in blood is presented that utilizes molecular hybridisation to a radiophosphorous-labeled oligonucleotide probe. The probe [5'-d(ACGTGCAGAGGTGAAGCGA)] is complementary to the S(+)-strand sequence furthest downstream, at the end of the gap. We examined blood specimens from 137 healthy HBsAg-positive individuals, applying the probe to dots representing 2-3.5 ml serum or plasma. We found that supercoiled HBV is present in many HBV DNA-positive blood specimens albeit in small quantities. Of the 104 specimens that were positive for HBV DNA of any form, 53 annealed to the probe. Serial specimens from the same subject taken over a period of months showed that the proportion of supercoil to other HBV DNA forms was variable. The presence of supercoil HBV DNA was not closely correlated with the level of serum HBV DNA polymerase. The supercoil is an HBV DNA form that can persist in the liver in the presence or absence of other replicative intermediates. This assay may enable further characterization of the status of HBV infection

  11. Methylation effect on the ohmic resistance of a poly-GC DNA-like chain

    Energy Technology Data Exchange (ETDEWEB)

    Moura, F.A.B.F. de, E-mail: fidelis@fis.ufal.br [Instituto de Física, Universidade Federal de Alagoas, Maceió AL 57072-970 (Brazil); Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, Maceió AL 57072-970 (Brazil); Almeida, M.L. de; Ourique, G.S.; Fulco, U.L.; Albuquerque, E.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil)

    2016-10-14

    We determine, by using a tight-binding model Hamiltonian, the characteristic current–voltage (IxV) curves of a 5-methylated cytosine single strand poly-GC DNA-like finite segment, considering the methyl groups attached laterally to a random fraction of the cytosine basis. Striking, we found that the methylation significantly impacts the ohmic resistance (R) of the DNA-like segments, indicating that measurements of R can be used as a biosensor tool to probe the presence of anomalous methylation. - Highlights: • Ohmic resistance of finite segments of poly-CG DNA-like segments. • Possibility for the development of biosensor devices. • Methylation effect and electronic transport in DNA-like segments.

  12. An ultrasensitive supersandwich electrochemical DNA biosensor based on gold nanoparticles decorated reduced graphene oxide.

    Science.gov (United States)

    Wang, Jiao; Shi, Anqi; Fang, Xian; Han, Xiaowei; Zhang, Yuzhong

    2015-01-15

    In this article, a supersandwich-type electrochemical biosensor for sequence-specific DNA detection is described. In design, single-strand DNA labeled with methylene blue (MB) was used as signal probe, and auxiliary probe was designed to hybridize with two different regions of signal probe. The biosensor construction contained three steps: (i) capture DNA labeled with thiol was immobilized on the surface of gold nanoparticles decorated reduced graphene oxide (Au NPs/rGO); (ii) the sandwich structure formation contained "capture-target-signal probe"; and (iii) auxiliary probe was introduced to produce long concatamers containing signal molecule MB. Differential pulse voltammetry (DPV) was used to monitor the DNA hybridization event using peak current changes of MB in phosphate-buffered saline (PBS) containing 1.0M NaClO4. Under optimal conditions, the peak currents of MB were linear with the logarithm of the concentration of target DNA in the range of 0.1μM to 0.1fM with a detection limit of 35aM (signal/noise=3). In addition, this biosensor exhibited good selectivity even for single-base mismatched target DNA detection. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Genetic effect of A-bomb radiation- Analysis of minisatellite regions detected by DNA fingerprint probe

    International Nuclear Information System (INIS)

    Kodaira, Mieko

    1999-01-01

    In author's laboratory, screening of mutation in germ cells of A-bomb survivors is under investigation with use of 8 single-locus minisatellite probes and no increase in mutation rate has been detected hitherto. This paper reported results of screening on the minisatellite region, which consisting of short repeated base sequence, using a DNA fingerprint probe for 33.15 core sequence. Subjects were 50 A-bomb survivor families exposed to mean dose of 1.9 Sv (exposed group) or 0 Gy (control), having 64 or 60 children, respectively. DNA was extracted from their B cells established by EB virus and subjected to agarose-gel electrophoresis followed by southern blotting with some improvements for fingerprinting. On the fingerprints, numbers of the band detected in regions of >3.5 kb were 1080 in children of the exposed group (16.9/child) and 1024 (17.1) in the control group, indicating no detectable effect of exposure on the germ cell mutation rate in the region.(K.H.)

  14. An inexpensive and simple method for thermally stable immobilization of DNA on an unmodified glass surface: UV linking of poly(T)10-poly(C)10-tagged DNA probes

    DEFF Research Database (Denmark)

    Guðnason, Haukur; Dufva, Hans Martin; Bang, Dang Duong

    2008-01-01

    the hybridization performance of the immobilized probes on the amino-silane surface, indicating a general benefit of adding a TC tag to DNA probes. In conclusion, our results show that using TC-tagged DNA probes immobilized on an unmodified glass surface is a robust, heat-stable, very simple, and inexpensive method...

  15. Pi30 DNA probe may be useful for the identification of Prevotella intermedia at the species or strain level.

    Science.gov (United States)

    Shin, Yong Kook; Jeong, Seung-U; Yoo, So Young; Kim, Mi-Kwang; Kim, Hwa-Sook; Kim, Byung-Ock; Kim, Do Kyung; Hwang, Ho-Keel; Kook, Joong-Ki

    2004-01-01

    Recently, we introduced a new method for the rapid screening of bacterial species-or subspecies-specific DNA probes, named the "inverted dot blot hybridization screening method." This method has subsequently been then applied to develop species-or strain-specific DNA probes for Prevotella intermedia and Prevotella nigrescens. In a previous study, the inverted dot blot hybridization data showed that a probe, Pi30, was specific for P. intermedia. In this study, the DNA probe Pi30 was evaluated by Southern blot analysis to determine if it could distinguish P. intermedia from P. nigrescens. The data showed that the probe Pi30 reacted with the genomic DNAs from the reference strains and clinical isolates of both P. intermedia and P. nigrescens, but the size of the signal bands was different. In addition, the probe Pi30 reacted with a 1.4 kbp fragment from the genomic DNAs digested with Pst I of the P. intermedia strains but not with any fragments of P. nigrescens strains. The result indicates that the probe Pi30 could be useful for the identification of P. intermedia by restriction fragment length polymorphism (RFLP) at the species or strain level.

  16. Electrogenerated chemiluminescence detection for deoxyribonucleic acid hybridization based on gold nanoparticles carrying multiple probes

    International Nuclear Information System (INIS)

    Wang Hui; Zhang Chengxiao; Li Yan; Qi Honglan

    2006-01-01

    A novel sensitive electrogenerated chemiluminescence (ECL) method for the detection deoxyribonucleic acid (DNA) hybridization based on gold nanoparticles carrying multiple probes was developed. Ruthenium bis(2,2'-bipyridine)(2,2'-bipyridine-4,4'-dicarboxylic acid)-N-hydroxysuccinimide ester (Ru(bpy) 2 (dcbpy)NHS) was used as a ECL label and gold nanoparticle as a carrier. Probe single strand DNA (ss-DNA) was self-assembled at the 3'-terminal with a thiol group to the surface of gold nanoparticle and covalently labeled at the 5'-terminal of a phosphate group with Ru(bpy) 2 (dcbpy)NHS and the resulting conjugate (Ru(bpy) 2 (dcbpy)NHS)-ss-DNA-Au, was taken as a ECL probe. When target analyte ss-DNA was immobilized on a gold electrode by self-assembled monolayer technique and then hybridized with the ECL probe to form a double-stranded DNA (ds-DNA), a strong ECL response was electrochemically generated. The ECL intensity was linearly related to the concentration of the complementary sequence (target ss-DNA) in the range from 1.0 x 10 -11 to 1.0 x 10 -8 mol L -1 , and the linear regression equation was S = 57301 + 4579.6 lg C (unit of C is mol L -1 ). A detection limit of 5.0 x 10 -12 mol L -1 for target ss-DNA was achieved. The ECL signal generated from many reporters of ECL probe prepared is greatly amplified, compared to the convention scheme which is based on one reporter per hybridization event

  17. Phosphate-methylated DNA aimed at HIV-1 RNA loops and integrated DNA inhibits viral infectivity

    NARCIS (Netherlands)

    Buck, H. M.; Koole, L. H.; van Genderen, M. H.; Smit, L.; Geelen, J. L.; Jurriaans, S.; Goudsmit, J.

    1990-01-01

    Phosphate-methylated DNA hybridizes strongly and specifically to natural DNA and RNA. Hybridization to single-stranded and double-stranded DNA leads to site-selective blocking of replication and transcription. Phosphate-methylated DNA was used to interrupt the life cycle of the human

  18. The interaction of taurine-salicylaldehyde Schiff base copper(II) complex with DNA and the determination of DNA using the complex as a fluorescence probe

    Science.gov (United States)

    Zhang, Xiaoyan; Wang, Yong; Zhang, Qianru; Yang, Zhousheng

    2010-09-01

    The interaction of taurine-salicylaldehyde Schiff base copper(II) (Cu(TSSB) 22+) complex with DNA was explored by using UV-vis, fluorescence spectrophotometry, and voltammetry. In pH 7.4 Tris-HCl buffer solution, the binding constant of the Cu(TSSB) 22+ complex interaction with DNA was 3.49 × 10 4 L mol -1. Moreover, due to the fluorescence enhancing of Cu(TSSB) 22+ complex in the presence of DNA, a method for determination of DNA with Cu(TSSB) 22+ complex as a fluorescence probe was developed. The fluorescence spectra indicated that the maximum excitation and emission wavelength were 389 nm and 512 nm, respectively. Under optimal conditions, the calibration graphs are linear over the range of 0.03-9.03 μg mL -1 for calf thymus DNA (CT-DNA), 0.10-36 μg mL -1 for yeast DNA and 0.01-10.01 μg mL -1 for salmon DNA (SM-DNA), respectively. The corresponding detection limits are 7 ng mL -1 for CT-DNA, 3 ng mL -1 for yeast DNA and 3 ng mL -1 for SM-DNA. Using this method, DNA in synthetic samples was determined with satisfactory results.

  19. The interaction of taurine-salicylaldehyde Schiff base copper(II) complex with DNA and the determination of DNA using the complex as a fluorescence probe.

    Science.gov (United States)

    Zhang, Xiaoyan; Wang, Yong; Zhang, Qianru; Yang, Zhousheng

    2010-09-15

    The interaction of taurine-salicylaldehyde Schiff base copper(II) (Cu(TSSB)2(2+)) complex with DNA was explored by using UV-vis, fluorescence spectrophotometry, and voltammetry. In pH 7.4 Tris-HCl buffer solution, the binding constant of the Cu(TSSB)2(2+) complex interaction with DNA was 3.49 x 10(4) L mol(-1). Moreover, due to the fluorescence enhancing of Cu(TSSB)2(2+) complex in the presence of DNA, a method for determination of DNA with Cu(TSSB)2(2+) complex as a fluorescence probe was developed. The fluorescence spectra indicated that the maximum excitation and emission wavelength were 389 nm and 512 nm, respectively. Under optimal conditions, the calibration graphs are linear over the range of 0.03-9.03 microg mL(-1) for calf thymus DNA (CT-DNA), 0.10-36 microg mL(-1) for yeast DNA and 0.01-10.01 microg mL(-1) for salmon DNA (SM-DNA), respectively. The corresponding detection limits are 7 ng mL(-1) for CT-DNA, 3 ng mL(-1) for yeast DNA and 3 ng mL(-1) for SM-DNA. Using this method, DNA in synthetic samples was determined with satisfactory results.

  20. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    Science.gov (United States)

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  1. Facile synthesis of Graphene Oxide/Double-stranded DNA ...

    Indian Academy of Sciences (India)

    DNA to single-stranded DNA. The GO/dsDNA hydrogels have shown controlled porosity by changing the concentration of the components. The strong binding between dsDNA and graphene is proved by Raman spectroscopy. Keywords. Graphene oxide; DNA; hydrogels; liquid crystals; self-assembly. 1. Introduction.

  2. LEGO-like DNA Structures

    DEFF Research Database (Denmark)

    Gothelf, Kurt Vesterager

    2012-01-01

    -dimensional (3D) DNA structures by self-assembly of single-stranded DNA “bricks.” The method opens a new route to complex self-assembled (3D) nanostructures that may serve as addressable templates for placing guest molecules with high precision, with possible applications in biophysics, medicine...

  3. Direct fluorescence in situ hybridization on human metaphase chromosomes using quantum dot-platinum labeled DNA probes

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Gyoyeon [Chemical Kinomics Research Center, Future Convergence Research Division, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 136-791 (Korea, Republic of); Biological Chemistry, Korea University of Science and Technology, 217, Gajeong-ro, Yuseong-gu, Deajeon (Korea, Republic of); Lee, Hansol [Chemical Kinomics Research Center, Future Convergence Research Division, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 136-791 (Korea, Republic of); Lee, Jiyeon, E-mail: jylee@kist.re.kr [Chemical Kinomics Research Center, Future Convergence Research Division, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 136-791 (Korea, Republic of); Biological Chemistry, Korea University of Science and Technology, 217, Gajeong-ro, Yuseong-gu, Deajeon (Korea, Republic of)

    2015-11-13

    The telomere shortening in chromosomes implies the senescence, apoptosis, or oncogenic transformation of cells. Since detecting telomeres in aging and diseases like cancer, is important, the direct detection of telomeres has been a very useful biomarker. We propose a telomere detection method using a newly synthesized quantum dot (QD) based probe with oligonucleotide conjugation and direct fluorescence in situ hybridization (FISH). QD-oligonucleotides were prepared with metal coordination bonding based on platinum-guanine binding reported in our previous work. The QD-oligonucleotide conjugation method has an advantage where any sequence containing guanine at the end can be easily bound to the starting QD-Pt conjugate. A synthesized telomeric oligonucleotide was bound to the QD-Pt conjugate successfully and this probe hybridized specifically on the telomere of fabricated MV-4-11 and MOLT-4 chromosomes. Additionally, the QD-telomeric oligonucleotide probe successfully detected the telomeres on the CGH metaphase slide. Due to the excellent photostability and high quantum yield of QDs, the QD-oligonucleotide probe has high fluorescence intensity when compared to the organic dye-oligonucleotide probe. Our QD-oligonucleotide probe, conjugation method of this QD probe, and hybridization protocol with the chromosomes can be a useful tool for chromosome painting and FISH. - Highlights: • We prepared a probe linked between QD and telomeric oligonucleotide with platinum-guanine bonding. • Telomeres were detected by our new telomere probes successfully in three different human metaphase chromosomes. • QDPt-DNA probe has high fluorescence intensity in comparison with organic dye-DNA probe.

  4. A probe-based quantitative PCR assay for detecting Tetracapsuloides bryosalmonae in fish tissue and environmental DNA water samples

    Science.gov (United States)

    Hutchins, Patrick; Sepulveda, Adam; Martin, Renee; Hopper, Lacey

    2017-01-01

    A probe-based quantitative real-time PCR assay was developed to detect Tetracapsuloides bryosalmonae, which causes proliferative kidney disease in salmonid fish, in kidney tissue and environmental DNA (eDNA) water samples. The limits of detection and quantification were 7 and 100 DNA copies for calibration standards and T. bryosalmonae was reliably detected down to 100 copies in tissue and eDNA samples. The assay presented here is a highly sensitive and quantitative tool for detecting T. bryosalmonae with potential applications for tissue diagnostics and environmental detection.

  5. Identification of the autotrophic denitrifying community in nitrate removal reactors by DNA-stable isotope probing.

    Science.gov (United States)

    Xing, Wei; Li, Jinlong; Cong, Yuan; Gao, Wei; Jia, Zhongjun; Li, Desheng

    2017-04-01

    Autotrophic denitrification has attracted increasing attention for wastewater with insufficient organic carbon sources. Nevertheless, in situ identification of autotrophic denitrifying communities in reactors remains challenging. Here, a process combining micro-electrolysis and autotrophic denitrification with high nitrate removal efficiency was presented. Two batch reactors were fed organic-free nitrate influent, with H 13 CO 3 - and H 12 CO 3 - as inorganic carbon sources. DNA-based stable-isotope probing (DNA-SIP) was used to obtain molecular evidence for autotrophic denitrifying communities. The results showed that the nirS gene was strongly labeled by H 13 CO 3 - , demonstrating that the inorganic carbon source was assimilated by autotrophic denitrifiers. High-throughput sequencing and clone library analysis identified Thiobacillus-like bacteria as the most dominant autotrophic denitrifiers. However, 88% of nirS genes cloned from the 13 C-labeled "heavy" DNA fraction showed low similarity with all culturable denitrifiers. These findings provided functional and taxonomical identification of autotrophic denitrifying communities, facilitating application of autotrophic denitrification process for wastewater treatment. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Identity of active methanotrophs in landfill cover soil as revealed by DNA-stable isotope probing.

    Science.gov (United States)

    Cébron, Aurélie; Bodrossy, Levente; Chen, Yin; Singer, Andrew C; Thompson, Ian P; Prosser, James I; Murrell, J Colin

    2007-10-01

    A considerable amount of methane produced during decomposition of landfill waste can be oxidized in landfill cover soil by methane-oxidizing bacteria (methanotrophs) thus reducing greenhouse gas emissions to the atmosphere. The identity of active methanotrophs in Roscommon landfill cover soil, a slightly acidic peat soil, was assessed by DNA-stable isotope probing (SIP). Landfill cover soil slurries were incubated with (13)C-labelled methane and under either nutrient-rich nitrate mineral salt medium or water. The identity of active methanotrophs was revealed by analysis of (13)C-labelled DNA fractions. The diversity of functional genes (pmoA and mmoX) and 16S rRNA genes was analyzed using clone libraries, microarrays and denaturing gradient gel electrophoresis. 16S rRNA gene analysis revealed that the cover soil was mainly dominated by Type II methanotrophs closely related to the genera Methylocella and Methylocapsa and to Methylocystis species. These results were supported by analysis of mmoX genes in (13)C-DNA. Analysis of pmoA gene diversity indicated that a significant proportion of active bacteria were also closely related to the Type I methanotrophs, Methylobacter and Methylomonas species. Environmental conditions in the slightly acidic peat soil from Roscommon landfill cover allow establishment of both Type I and Type II methanotrophs.

  7. Assessing single-stranded oligonucleotide drug-induced effects in vitro reveals key risk factors for thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Sabine Sewing

    Full Text Available Single-stranded oligonucleotides (ON comprise a promising therapeutic platform that enables selective modulation of currently undruggable targets. The development of novel ON drug candidates has demonstrated excellent efficacy, but in certain cases also some safety liabilities were reported. Among them are events of thrombocytopenia, which have recently been evident in late stage trials with ON drugs. The underlying mechanisms are poorly understood and the risk for ON candidates causing such events cannot be sufficiently assessed pre-clinically. We investigated potential thrombocytopenia risk factors of ONs and implemented a set of in vitro assays to assess these risks. Our findings support previous observations that phosphorothioate (PS-ONs can bind to platelet proteins such as platelet collagen receptor glycoprotein VI (GPVI and activate human platelets in vitro to various extents. We also show that these PS-ONs can bind to platelet factor 4 (PF4. Binding to platelet proteins and subsequent activation correlates with ON length and connected to this, the number of PS in the backbone of the molecule. Moreover, we demonstrate that locked nucleic acid (LNA ribosyl modifications in the wings of the PS-ONs strongly suppress binding to GPVI and PF4, paralleled by markedly reduced platelet activation. In addition, we provide evidence that PS-ONs do not directly affect hematopoietic cell differentiation in culture but at higher concentrations show a pro-inflammatory potential, which might contribute to platelet activation. Overall, our data confirm that certain molecular attributes of ONs are associated with a higher risk for thrombocytopenia. We propose that applying the in vitro assays discussed here during the lead optimization phase may aid in deprioritizing ONs with a potential to induce thrombocytopenia.

  8. Nanoprobe-Initiated Enzymatic Polymerization for Highly Sensitive Electrochemical DNA Detection.

    Science.gov (United States)

    Wan, Ying; Wang, Pengjuan; Su, Yan; Wang, Lihua; Pan, Dun; Aldalbahi, Ali; Yang, Shulin; Zuo, Xiaolei

    2015-11-25

    Electrochemical DNA (E-DNA) sensors have been greatly developed and play an important role in early diagnosis of different diseases. To determine the extremely low abundance of DNA biomarkers in clinical samples, scientists are making unremitting efforts toward achieving highly sensitive and selective E-DNA sensors. Here, a novel E-DNA sensor was developed taking advantage of the signal amplification efficiency of nanoprobe-initiated enzymatic polymerization (NIEP). In the NIEP based E-DNA sensor, the capture probe DNA was thiolated at its 3'-terminal to be immobilized onto gold electrode, and the nanoprobe was fabricated by 5'-thiol-terminated signal probe DNA conjugated gold nanoparticles (AuNPs). Both of the probes could simultaneously hybridize with the target DNA to form a "sandwich" structure followed by the terminal deoxynucleotidyl transferase (TdT)-catalyzed elongation of the free 3'-terminal of DNA on the nanoprobe. During the DNA elongation, biotin labels were incorporated into the NIEP-generated long single-stranded DNA (ssDNA) tentacles, leading to specific binding of avidin modified horseradish peroxidase (Av-HRP). Since there are hundreds of DNA probes on the nanoprobe, one hybridization event would generate hundreds of long ssDNA tentacles, resulting in tens of thousands of HRP catalyzed reduction of hydrogen peroxide and sharply increasing electrochemical signals. By employing nanoprobe and TdT, it is demonstrated that the NIEP amplified E-DNA sensor has a detection limit of 10 fM and excellent differentiation ability for even single-base mismatch.

  9. Comparison of peroxidase-labeled DNA probes with radioactive RNA probes for detection of human papillomaviruses by in situ hybridization in paraffin sections

    Energy Technology Data Exchange (ETDEWEB)

    Park, J.S.; Kurman, R.J.; Kessis, T.D.; Shah, K.V. (Johns Hopkins Medical Institutions, Baltimore, MD (USA))

    1991-01-01

    A study comparing in situ hybridization using nonradioactive DNA probes directly conjugated with horseradish peroxidase (HRP), and {sup 35}S-labeled antisense RNA probes for human papillomavirus (HPV) types 6/11, 16, and 18 was performed on formalin-fixed, paraffin-embedded tissue from 34 lesions of the cervix and vulva. These lesions included exophytic condylomas and intraepithelial and invasive neoplasms. HPV 6/11 was detected in two of four condylomata acuminata by both in situ techniques. HPV 16 was detected in 13 of 30 cases of intraepithelial and invasive neoplasms by both methods. Discordance between the two methods occurred in two instances. The radiolabeled probe but not the HRP probe detected HPV 16 in one case of cervical intraepithelial neoplasia (CIN 3), whereas the converse occurred in one case of vulvar intraepithelial neoplasia (VIN 3). HPV 18 was not detected in any of the specimens by either method. This study demonstrates that nonradioactive HRP-labeled probes for the detection of specific HPV types are as sensitive as the more laborious and potentially hazardous radioactive probes.

  10. Radioactively labelled DNA probes for crop improvement. Proceedings of a final research co-ordination meeting

    International Nuclear Information System (INIS)

    2001-11-01

    With the advent of DNA molecular marker technology in the 1980s plant breeding had a new and powerful tool with which to increase its efficacy. Such markers are abundant and directly reveal information about the genotype and therefore are more useful than simple phenotypic markers. In plant breeding applications, molecular markers reveal information about variability and genetic relationships, and enable genetic mapping, which greatly assists the breeder in selection of parents and progeny, as well as in management of breeding strategies. Furthermore, molecular markers linked to phenotypic traits permit very early selection of superior progenies from breeding populations, therefore significantly reducing the need for field testing and greatly increasing efficiency of plant breeding programmes. For this to occur the oligonucleotide probes for labelling genetic markers and/or the primers for polymerase chain reactions to amplify genetic markers needed to be also accessible to scientists in developing Member States. In addition, technical information, training and troubleshooting were needed to support the utilization of DNA markers. In the early 1990s there was a dramatic increase in requests for access to this technology. This co-ordinated research project (CRP) facilitated the transfer of molecular marker technology, in terms of both material and information, from advanced laboratories to assist breeding programmes in developing countries. Two other CRPs were conducted concurrently in order to assist developing Member States to utilise molecular markers - Application of DNA Based Marker Mutations for Improvement of Cereals and other Sexually Reproduced Crop Plants, and Use of Novel DNA Fingerprinting Techniques for the Detection and Characterisation of Genetic Variation in Vegetatively Propagated Crops (IAEA-TECDOC-1010 and IAEA-TECDOC-1047, respectively). The present CRP built upon the success of the former projects by ensuring the availability of probes

  11. Effect of a Dual Charge on the DNA-Conjugated Redox Probe on DNA Sensing by Short Hairpin Beacons Tethered to Gold Electrodes.

    Science.gov (United States)

    Kékedy-Nagy, László; Shipovskov, Stepan; Ferapontova, Elena E

    2016-08-16

    Charges of redox species can critically affect both the interfacial state of DNA and electrochemistry of DNA-conjugated redox labels and, as a result, the electroanalytical performance of those systems. Here, we show that the kinetics of electron transfer (ET) between the gold electrode and methylene blue (MB) label conjugated to a double-stranded (ds) DNA tethered to gold strongly depend on the charge of the MB molecule, and that affects the performance of genosensors exploiting MB-labeled hairpin DNA beacons. Positively charged MB binds to dsDNA via electrostatic and intercalative/groove binding, and this binding allows the DNA-mediated electrochemistry of MB intercalated into the duplex and, as a result, a complex mode of the electrochemical signal change upon hairpin hybridization to the target DNA, dominated by the "on-off" signal change mode at nanomolar levels of the analyzed DNA. When MB bears an additional carboxylic group, the negative charge provided by this group prevents intimate interactions between MB and DNA, and then the ET in duplexes is limited by the diffusion of the MB-conjugated dsDNA (the phenomenon first shown in Farjami , E. ; Clima , L. ; Gothelf , K. ; Ferapontova , E. E. Anal. Chem. 2011 , 83 , 1594 ) providing the robust "off-on" nanomolar DNA sensing. Those results can be extended to other intercalating redox probes and are of strategic importance for design and development of electrochemical hybridization sensors exploiting DNA nanoswitchable architectures.

  12. Use of DNA probes for the diagnosis of infections caused by Mycoplasma pneumoniae and legionellae--a review.

    Science.gov (United States)

    Edelstein, P H

    1990-01-01

    Specific DNA probes have been made for both M. pneumoniae and Legionella species. Dot blot methods have been used in research laboratories to test culture isolates of both organisms, and also to test animal tissues with a L. pneumophila-specific probe. Commercial kits are also available for direct specimen testing for these two organisms. The commercial kits are made by a single manufacturer, Gen-Probe, Inc. (San Diego, CA), and use a novel in-solution rapid hybridization assay, using 125I-labeled cDNA to rRNAs of the organisms. The Gen-Probe M. pneumoniae probe appears to be 80% to 100% sensitive, and 97% to 100% specific, based on analysis of two clinical studies using positive culture as the diagnostic criterion. The Gen-Probe legionella probe appears to be 33% to 71% sensitive (mean 57%), and 98.9% to 99.7% specific (mean 99.7%), based on analysis of four prospective clinical studies, using positive culture as the definition of disease, with a total sample size of 3,243 patients, 49 of which were culture-positive. Both Gen-Probe direct tests appear to be clinically useful, although the poor performance of the legionella test in one major university laboratory, and the expense of performing these tests, mandate that thorough evaluations be carried out in each laboratory anticipating using the test. Culture must always be performed for legionella whether or not the DNA probe test is used. It is likely that the use of the M. pneumoniae kit would greatly speed diagnosis, but whether this would alter medical practice or result in lower morbidity and health care costs is unknown.

  13. From DNA Bases to Ultracold Atoms: Probing Ensembles Using Supersonic Beams

    Science.gov (United States)

    Smith, Valoris Reid

    This thesis discusses two ensembles, the study of which was dependent upon the controllable production of cold gas-phase samples using supersonic beams. The experiments on DNA bases and base clusters were carried out in Germany at the Max Born Institute. The experiments anticipating the construction of a molecular beam slower were carried out in the United States at the University of Texas at Austin. Femtosecond pump-probe techniques were employed to study the dynamics and electronic character of DNA bases, pairs and clusters in the gas phase. Experimentsnon DNA base monomers confirmed the dominance of a particular relaxation pathway, the npi* state. Competition between this state and another proposed relaxation pathway was demonstrated through observations of the DNA base pairs and base-water clusters, settling a recent controversy. Further, it was determined that the excited state dynamics in base pairs is due to intramolecular processes rather than intermolecular processes. Finally, results from base-water clusters confirm that microsolvation permits comparison with biologically relevant liquid phase experiments and with ab initio calculations, bridging a long-standing gap. A purely mechanical technique that does not rely upon quantum or electronic properties to produce very cold, very slow atoms and molecules would be more generally applicable than current approaches. The approach described here uses supersonic beam methods to produce a very cold beam of particles and a rotating paddle-wheel, or rotor, to slow the cold beam. Initial experiments testing the possibility of elastic scattering from a single crystal surface were conducted and the implications of these experiments are discussed.

  14. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis.

    Science.gov (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J

    2012-01-01

    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  15. Combined Triplex/Duplex Invasion of Double-Stranded DNA by "Tail-Clamp" Peptide Nucleic Acid

    DEFF Research Database (Denmark)

    Bentin, Thomas; Larsen, H. J.; Nielsen, Peter E.

    2003-01-01

    "Tail-clamp" PNAs composed of a short (hexamer) homopyrimidine triplex forming domain and a (decamer) mixed sequence duplex forming extension have been designed. Tail-clamp PNAs display significantly increased binding to single-stranded DNA compared with PNAs lacking a duplex-forming extension...... as determined by T-m measurements. Binding to double-stranded (ds) DNA occurred by combined triplex and duplex invasion as analyzed by permanganate probing. Furthermore, C-50 measurements revealed that tail-clamp PNAs consistently bound the dsDNA target more efficiently, and kinetics experiments revealed...... to five residues was feasible, but four bases were not sufficient to yield detectable dsDNA binding. The results validate the tail-clamp PNA concept and expand the applications of the P-loop technology....

  16. Correlation of Free Radical Yields with Strand Break Yields Produced in Plasmid DNA by the Direct Effect of Ionizing Radiation

    OpenAIRE

    Purkayastha, Shubhadeep; Milligan, Jamie R.; Bernhard, William A.

    2005-01-01

    The purpose of this study was to determine how free radical formation (fr) correlates with single strand break (ssb) and double strand break (dsb) formation in DNA exposed to the direct effects of ionizing radiation. Chemical yields have been determined of (i) total radicals trapped on DNA at 4 K, G(∑fr), (ii) radicals trapped on the DNA sugar, Gsugar(fr), (iii) prompt single strand breaks, Gprompt(ssb), (iv) total single strand breaks, Gtotal(ssb), and (v) double strand breaks, G(dsb). These...

  17. Mitochondrial DNA variation in the grasshopper Sinipta dalmani: application of long-PCR to the development of a homologous probe.

    Science.gov (United States)

    Pensel, S M; Vilardi, J C; Remis, M I

    2005-12-01

    RFLP analysis of mtDNA in natural populations is a valuable tool for phylogeographic and population genetic studies. The amplification of long DNA fragments using universal primers may contribute to the development of novel homologous probes in species for which no previous genomic information is available. Here we report how we obtained the complete mtDNA genome of Sinipta dalmani (Orthoptera) in 2 fragments (7 and 9 kb) using primers of conserved regions. The specificity of the PCR reactions was ultimately confirmed by several lines of evidence. These fragments were used as a probe for a mtDNA RFLP study in S. dalmani that analyzed the pattern of haplotype distribution and nucleotide diversity within and among chromosomally differentiated natural populations. Our results suggest that the restriction in gene flow detected at the molecular level may explain the chromosome differentiation detected previously and the maintenance of chromosome polymorphism in some areas of S. dalmani geographic distribution.

  18. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  19. Synthesis of a gene for the HIV transactivator protein TAT by a novel single stranded approach involving in vivo gap repair.

    OpenAIRE

    Adams, S E; Johnson, I D; Braddock, M; Kingsman, A J; Kingsman, S M; Edwards, R M

    1988-01-01

    The synthesis of a gene for the HIV TAT protein is described using a novel approach that capitalises on the ability to synthesise oligonucleotides of greater than 100 bp in length. It involves the synthesis of large oligomers covering one strand of the desired gene in its entirety and the use of small complementary bridging and adapter oligonucleotides to direct the assembly and cloning of the large oligomers. After ligation to the cloning vector the partially single stranded intermediate is ...

  20. DNA-mediated strand displacement facilitates sensitive electronic detection of antibodies in human serums.

    Science.gov (United States)

    Dou, Baoting; Yang, Jianmei; Shi, Kai; Yuan, Ruo; Xiang, Yun

    2016-09-15

    We describe here the development of a sensitive and convenient electronic sensor for the detection of antibodies in human serums. The sensor is constructed by self-assembly formation of a mixed monolayer containing the small molecule epitope conjugated double stranded DNA probes on gold electrode. The target antibody binds the epitope on the dsDNA probe and lowers the melting temperature of the duplex, which facilitates the displacement of the antibody-linked strand of the duplex probe by an invading methylene blue-tagged single stranded DNA (MB-ssDNA) through the strand displacement reaction and leads to the capture of many MB-ssDNA on the sensor surface. Subsequent electrochemical oxidation of the methylene blue labels results in amplified current response for sensitive monitoring of the antibodies. The antibody assay conditions are optimized and the sensor exhibits a linear range between 1.0 and 25.0nM with a detection limit of 0.67nM for the target antibody. The sensor is also selective and can be employed to detect the target antibodies in human serum samples. With the advantages of using small molecule epitope as the antibody recognition element over traditional antigen, the versatile manipulability of the DNA probes and the unique properties of the electrochemical transduction technique, the developed sensor thus hold great potential for simple and sensitive detection of different antibodies and other proteins in real samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Direct estimation of biofilm density on different pipe material coupons using a specific DNA-probe.

    Science.gov (United States)

    Chang, Young C; Le Puil, Michael; Biggerstaff, John; Randall, Andrew A; Schulte, Alfons; Taylor, James S

    2003-10-01

    A variety of approaches to quantify biomass in biofilms without disruption due to detachment have been developed over the years. One basic approach is the combination of advanced microscopy with molecular staining. However, many stains (e.g. 4',6-diamino-2-phenylindole, acridine orange or live-dead stains) can be non-specific when corrosion products, precipitates, and pipe material are present. In addition, some pipe materials cause high background when using epifluorescent microscopy. The new refinement discussed in this presentation used fluorescence spectroscopy to obtain the spectra from four common distribution system pipe materials: PVC, 'concrete' lined cast iron, cast iron, and galvanized steel. The emission maximum for all four materials was between 500 and 550 nm, but emissions radically decreased around 575-600 nm. A molecular probe, BO-PRO-3 (Molecular Probes, Inc., Eugene, OR, USA) was identified which has an emission intensity maximum at 599 nm (red), with emission intensity 200 times greater when it is bound to DNA. The BO-PRO-3 has greatly reduced non-specific staining and background problems. In the preliminary experiment, using diluted waste water, a significant exponential relationship was found between stained surface area/total area ratio and fixed biofilm inventory measurements from scraping heterotrophic plate counts (SHPC) on R2A medium. In addition, the biofilm inventory on different pipe material coupons from pilot distribution systems was also correlated to the stained surface area fraction and SHPC.

  2. A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

    Science.gov (United States)

    Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

    2014-09-01

    Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology.

  3. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  4. Effect of oxygen and misonidazole on radiation damage in biologically active DNA dissolved in a bacterial extract. Influence of cytochrome c

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Pluijmackers-Westmijze, E.J.; Loman, H.

    1982-01-01

    The effect of radiation on biologically active DNA, dissolved in a bacterial extract was studied. The results show that oxygen affects DNA inactivation for both double-stranded (RF) and single-stranded phiX174 DNA. Misonidazole induces an increased radiosensitivity in this system as found for single-stranded DNA. These effects disappear with ageing of the extract, but can be recovered by the addition of 10 -6 M cytochrome c. (author)

  5. The DNA hybridization assay using single-walled carbon nanotubes as ultrasensitive, long-term optical labels

    International Nuclear Information System (INIS)

    Hwang, Eung-Soo; Cao, Chengfan; Hong, Sanghyun; Jung, Hye-Jin; Cha, Chang-Yong; Choi, Jae-Boong; Kim, Young-Jin; Baik, Seunghyun

    2006-01-01

    Single walled carbon nanotubes (SWNTs) exhibit strong Raman signals as well as fluorescence emissions in the near infrared region. Such signals do not blink or photobleach under prolonged excitation, which is an advantage in optical nano-biomarker applications. In this paper, we present single-stranded DNA conjugated SWNT probes to locate a particular sequence of DNA within a complex genome. Chromosomal DNAs of human fibroblasts and Escherichia coli are used as a target and a control, respectively. Southern blotting, which uses photostable Raman signals of nanotubes instead of fluorescent dyes, demonstrates excellent sensitivity and specificity of the probes. The results show that SWNTs may be used as generic nano-biomarkers for the precise detection of specific kinds of genes

  6. Detection of short repeated genomic sequences on metaphase chromosomes using padlock probes and target primed rolling circle DNA synthesis

    Directory of Open Access Journals (Sweden)

    Stougaard Magnus

    2007-11-01

    Full Text Available Abstract Background In situ detection of short sequence elements in genomic DNA requires short probes with high molecular resolution and powerful specific signal amplification. Padlock probes can differentiate single base variations. Ligated padlock probes can be amplified in situ by rolling circle DNA synthesis and detected by fluorescence microscopy, thus enhancing PRINS type reactions, where localized DNA synthesis reports on the position of hybridization targets, to potentially reveal the binding of single oligonucleotide-size probe molecules. Such a system has been presented for the detection of mitochondrial DNA in fixed cells, whereas attempts to apply rolling circle detection to metaphase chromosomes have previously failed, according to the literature. Methods Synchronized cultured cells were fixed with methanol/acetic acid to prepare chromosome spreads in teflon-coated diagnostic well-slides. Apart from the slide format and the chromosome spreading everything was done essentially according to standard protocols. Hybridization targets were detected in situ with padlock probes, which were ligated and amplified using target primed rolling circle DNA synthesis, and detected by fluorescence labeling. Results An optimized protocol for the spreading of condensed metaphase chromosomes in teflon-coated diagnostic well-slides was developed. Applying this protocol we generated specimens for target primed rolling circle DNA synthesis of padlock probes recognizing a 40 nucleotide sequence in the male specific repetitive satellite I sequence (DYZ1 on the Y-chromosome and a 32 nucleotide sequence in the repetitive kringle IV domain in the apolipoprotein(a gene positioned on the long arm of chromosome 6. These targets were detected with good efficiency, but the efficiency on other target sites was unsatisfactory. Conclusion Our aim was to test the applicability of the method used on mitochondrial DNA to the analysis of nuclear genomes, in particular as

  7. Hybridization properties of long nucleic acid probes for detection of variable target sequences, and development of a hybridization prediction algorithm

    Science.gov (United States)

    Öhrmalm, Christina; Jobs, Magnus; Eriksson, Ronnie; Golbob, Sultan; Elfaitouri, Amal; Benachenhou, Farid; Strømme, Maria; Blomberg, Jonas

    2010-01-01

    One of the main problems in nucleic acid-based techniques for detection of infectious agents, such as influenza viruses, is that of nucleic acid sequence variation. DNA probes, 70-nt long, some including the nucleotide analog deoxyribose-Inosine (dInosine), were analyzed for hybridization tolerance to different amounts and distributions of mismatching bases, e.g. synonymous mutations, in target DNA. Microsphere-linked 70-mer probes were hybridized in 3M TMAC buffer to biotinylated single-stranded (ss) DNA for subsequent analysis in a Luminex® system. When mismatches interrupted contiguous matching stretches of 6 nt or longer, it had a strong impact on hybridization. Contiguous matching stretches are more important than the same number of matching nucleotides separated by mismatches into several regions. dInosine, but not 5-nitroindole, substitutions at mismatching positions stabilized hybridization remarkably well, comparable to N (4-fold) wobbles in the same positions. In contrast to shorter probes, 70-nt probes with judiciously placed dInosine substitutions and/or wobble positions were remarkably mismatch tolerant, with preserved specificity. An algorithm, NucZip, was constructed to model the nucleation and zipping phases of hybridization, integrating both local and distant binding contributions. It predicted hybridization more exactly than previous algorithms, and has the potential to guide the design of variation-tolerant yet specific probes. PMID:20864443

  8. Intravital imaging of fluorescent markers and FRET probes by DNA tattooing

    Directory of Open Access Journals (Sweden)

    Spencer David M

    2007-01-01

    Full Text Available Abstract Background Advances in fluorescence microscopy and mouse transgenesis have made it possible to image molecular events in living animals. However, the generation of transgenic mice is a lengthy process and intravital imaging requires specialized knowledge and equipment. Here, we report a rapid and undemanding intravital imaging method using generally available equipment. Results By DNA tattooing we transfect keratinocytes of living mice with DNA encoding fluorescent biosensors. Subsequently, the behavior of individual cells expressing these biosensors can be visualized within hours and using conventional microscopy equipment. Using this "instant transgenic" model in combination with a corrected coordinate system, we followed the in vivo behavior of individual cells expressing either FRET- or location-based biosensors for several days. The utility of this approach was demonstrated by assessment of in vivo caspase-3 activation upon induction of apoptosis. Conclusion This "instant skin transgenic" model can be used to follow the in vivo behavior of individual cells expressing either FRET- or location-based probes for several days after tattooing and provides a rapid and inexpensive method for intravital imaging in murine skin.

  9. Accurate and visual discrimination of single-base mismatch by utilization of binary DNA probes in gold nanoparticles-based biosensing strategy.

    Science.gov (United States)

    Zhou, Weijun; Ren, Jiangtao; Zhu, Jinbo; Zhou, Zhixue; Dong, Shaojun

    2016-12-01

    Herein we report a colorimetric biosensing strategy to discriminate single-nucleotide mutation in DNA with high selectivity using unmodified gold nanoparticles (AuNPs) as indicators. In the AuNPs-based colorimetric strategy, binary DNA probes were produced by splitting a long DNA probe in the middle for sensitive differentiation of single-base mismatch. The detection limit of this method toward target DNA was 5nM. The developed system has superior advantages of utilization of inexpensive materials, simplicity and visualization. Moreover, binary DNA probes not only can distinguish single-base mutation in the target DNA very well, as compared to long DNA probe, but also can construct "AND" logic gate using two distinct target DNAs as inputs, which holds great potential for increasing the accuracy of disease diagnosis in clinical applications. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Rapid colorimetric assay for detection of Listeria monocytogenes in food samples using LAMP formation of DNA concatemers and gold nanoparticle-DNA probe complex

    Science.gov (United States)

    Wachiralurpan, Sirirat; Sriyapai, Thayat; Areekit, Supatra; Sriyapai, Pichapak; Augkarawaritsawong, Suphitcha; Santiwatanakul, Somchai; Chansiri, Kosum

    2018-04-01

    ABSTRACT Listeria monocytogenes is a major foodborne pathogen of global health concern. Herein, the rapid diagnosis of L. monocytogenes has been achieved using loop-mediated isothermal amplification (LAMP) based on the phosphatidylcholine-phospholipase C gene (plcB). Colorimetric detection was then performed through the formation of DNA concatemers and a gold nanoparticle/DNA probe complex (GNP/DNA probe). The overall detection process was accomplished within approximately 1 h with no need for complicated equipment. The limits of detection for L. monocytogenes in the forms of purified genomic DNA and pure culture were 800 fg and 2.82 CFU mL-1, respectively. No cross reactions were observed from closely related bacteria species. The LAMP-GNP/DNA probe assay was applied to the detection of 200 raw chicken meat samples and compared to routine standard methods. The data revealed that the specificity, sensitivity and accuracy were 100%, 90.20% and 97.50%, respectively. The present assay was 100% in conformity with LAMP-agarose gel electrophoresis assay. Five samples that were negative by both assays appeared to have the pathogen at below the level of detection. The assay can be applied as a rapid direct screening method for L. monocytogenes.

  11. GENETIC DIVERSITY OF TYPHA LATIFOLIA (TYPHACEAE) AND THE IMPACT OF POLLUTANTS EXAMINED WITH TANDEM-REPETITIVE DNA PROBES

    Science.gov (United States)

    Genetic diversity at variable-number-tandem-repeat (VNTR) loci was examined in the common cattail, Typha latifolia (Typhaceae), using three synthetic DNA probes composed of tandemly repeated "core" sequences (GACA, GATA, and GCAC). The principal objectives of this investigation w...

  12. Specific detection of neuronal cell bodies: in situ hybridization with a biotin-labelled neurofilament cDNA probe.

    NARCIS (Netherlands)

    P. Liesi; J-P. Julien (Jean-Pierre); P. Vilja; F.G. Grosveld (Frank); L. Rechardt

    1986-01-01

    textabstractWe have used a biotinylated, 300-nucleotide cDNA probe which encodes the 68,000 MW neurofilament protein to detect neurofilament-specific mRNA in situ. The neurofilament message specifically demonstrates the neuronal cell bodies, in contrast to the usual antibody staining which detects

  13. The colorimetric determination of selectively cleaved adenosines and guanosines in DNA oligomers using bicinchoninic acid and copper.

    Science.gov (United States)

    Thomas, Elizabeth M; Testa, Stephen M

    2017-01-01

    Colorimetric methods combined with color-changing chemical probes are widely used as simple yet effective tools for identifying and quantifying a wide variety of molecules in solution. For nucleic acids (DNA and RNA), perhaps the most commonly used colorimetric probe is potassium permanganate, which can be used to identify single-stranded pyrimidines (thymine and cytosine) in polymers. Unfortunately, permanganate is not an effective probe for identifying purines (adenine and guanine), especially in the presence of the more reactive pyrimidines. Therefore, robust methods for discriminating between the purines remain elusive, thereby creating a barrier toward developing more complex colorimetric applications. In this proof-of-principle study, we demonstrate that bicinchoninic acid (BCA) and copper, when combined with purine-specific chemical cleavage reactions, can be a colorimetric probe for the identification and quantification of adenosines and/or guanosines in single-stranded DNA oligomers, even in the presence of pyrimidines. Furthermore, the reactions are stoichiometric, which allows for the quantification of the number of adenosines and/or guanosines in these oligomers. Because the BCA/copper reagent detects the reducing sugar, 2-deoxyribose, that results from the chemical cleavage of a given nucleotide's N-glycosidic bond, these colorimetric assays are effectively detecting apurinic sites in DNA oligomers, which are known to occur via DNA damage in biological systems. We demonstrate that simple digital analysis of the color-changing chromophore (BCA/copper) is all that is necessary to obtain quantifiable and reproducible data, which indicates that these assays should be broadly accessible.

  14. Development of a Fluorescence Resonance Energy Transfer (FRET-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense

    Directory of Open Access Journals (Sweden)

    Noremylia Mohd Bakhori

    2013-12-01

    Full Text Available An optical DNA biosensor based on fluorescence resonance energy transfer (FRET utilizing synthesized quantum dot (QD has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10−9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  15. Identification of a premature termination of DNA polymerization in ...

    Indian Academy of Sciences (India)

    2013-04-25

    Apr 25, 2013 ... DNA polymerases have been widely used as sophisticated powerful tools in molecular biology for DNA cloning and genetic diagnosis (Raymond et al. 2010). Using parental single-stranded DNA as template and oligonucleo- tide as primer, these DNA polymerases can extend daughter strands to the 5′ ...

  16. Triplet repeat DNA structures and human genetic disease: dynamic ...

    Indian Academy of Sciences (India)

    Unknown

    alternative to double-stranded DNA (table 2). These include single-stranded hairpins, triplex and quadruplex. DNA, and slipped-strand DNA. Studies have also con- firmed that the formation of alternative structures occurs in trinucleotide repeat sequences. Linear DNA molecules containing triplet repeats have unusual ...

  17. Facile synthesis of Graphene Oxide/Double-stranded DNA ...

    Indian Academy of Sciences (India)

    assembled liquid crystals and three-dimensional hydrogels of graphene oxidewith double-stranded DNA by simple mixing in an aqueous buffer media without unwinding double-strandedDNA to single-stranded DNA. The GO/dsDNA hydrogels have ...

  18. Development of an electrochemical DNA biosensor for detection of ...

    Indian Academy of Sciences (India)

    long oligonucleotides related to DNA sequence of Mycobacterium tuberculosis in optimal condition. Keywords. Poly(L-glutamic acid); DNA .... (TBS) (pH 7.0) containing 20 mM MDB.12,13 Then, the biosensors were immersed in washing ... signal when interacting with single strand DNA since this kind of DNA does not have ...

  19. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    DEFF Research Database (Denmark)

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie

    2014-01-01

    sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5'-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections...

  20. Carbon nanostructures as immobilization platform for DNA: A review on current progress in electrochemical DNA sensors.

    Science.gov (United States)

    Rasheed, P Abdul; Sandhyarani, N

    2017-11-15

    Development of a sensitive, specific and cost-effective DNA detection method is motivated by increasing demand for the early stage diagnosis of genetic diseases. Recent developments in the design and fabrication of efficient sensor platforms based on nanostructures make the highly sensitive sensors which could indicate very low detection limit to the level of few molecules, a realistic possibility. Electrochemical detection methods are widely used in DNA diagnostics as it provide simple, accurate and inexpensive platform for DNA detection. In addition, the electrochemical DNA sensors provide direct electronic signal without the use of expensive signal transduction equipment and facilitates the immobilization of single stranded DNA (ssDNA) probe sequences on a wide variety of electrode substrates. It has been found that a range of nanomaterials such as metal nanoparticles (MNPs), carbon based nanomaterials, quantum dots (QDs), magnetic nanoparticles and polymeric NPs have been introduced in the sensor design to enhance the sensing performance of electrochemical DNA sensor. In this review, we discuss recent progress in the design and fabrication of efficient electrochemical genosensors based on carbon nanostructures such as carbon nanotubes, graphene, graphene oxide and nanodiamonds. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Radioactive probes as diagnostic tools for rice tungro viruses

    International Nuclear Information System (INIS)

    Azzam, O.; Arboleda, M.; Reyes. J. de los

    1996-01-01

    Rice tungro bacilliform (RTBV) and rice tungro spherical viruses (RTSV) are the two viral components responsible for rice tungro disease which has seriously affected the irrigated rice ecosystem in Southeast Asia for the last 30 years. RTBV has an 8 Kb double-stranded DNA circular genome, and it is primarily responsible for induction of symptoms in infected plants. RTSV has a 12 kb single-stranded RNA genome. It does not induce any apparent symptoms in the infected plant, and it is transmitted by greenleafhopper. RTBV depends upon RTSV for its own transmission. The two viruses are limited to the vascular tissue of the rice plant and are present at a low titer. Most of the detection methods used for the identification of these viruses have relied on the virus protein properties and therefore, early detection of the virus activity was not possible. We were interested in evaluating tissue printing, dot blot, and southern techniques for early detection of virus nucleic acids in rice plant using radioactive and non radioactive probes. 32 P-labeled T7 or SP6 RNA polymerase transcripts complementary to the RTBV genome and RTSV coat protein genes were used as probes of the positive stand of both viruses. For nonradioactive probes, RTBV DNA genome was labeled using the ECL detection kit (Amersham). Preliminary results show that viral nucleic acids of RTBV and RTSV could be detected using both labelling systems. Non radioactive probes were comparable in their sensitivity to the radioactive probes. Less than 100 pg of viral DNA was detected in the dot-blot assays. More data will be presented to compare the efficiency and reliability of these two techniques in detecting early virus activity in the rice plant. (author)

  2. Hg(2+) detection using a phosphorothioate RNA probe adsorbed on graphene oxide and a comparison with thymine-rich DNA.

    Science.gov (United States)

    Huang, Po-Jung Jimmy; van Ballegooie, Courtney; Liu, Juewen

    2016-06-07

    Mercury is a highly toxic heavy metal and many DNA-based biosensors have been recently developed for Hg(2+) detection in water. Among them, thymine-rich DNA is the most commonly used for designing Hg(2+) sensors. However, the thymine-Hg(2+) interaction is strongly affected by the buffer conditions. We recently reported a molecular beacon containing phosphorothioate (PS)-modified RNA linkages that can be cleaved by Hg(2+). In this work, the fluorescence quenching and DNA adsorption properties of nano-sized graphene oxide (NGO) were used to develop a new sensor using the PS-RNA chemistry. Three DNA probes, containing one, three and five PS-RNA linkages, respectively, were tested. Finally, a fluorophore-labeled poly-A DNA with five PS-RNA linkages was selected and adsorbed by NGO. In the presence of Hg(2+), the fluorophore was released from NGO due to the cleavage reaction, resulting in a fluorescence enhancement. This sensor is highly selective for Hg(2+) with a detection limit of 8.5 nM Hg(2+). For comparison, a fluorophore-labeled poly-T DNA was also tested, which responded to Hg(2+) more slowly and was inhibited by high NaCl concentrations, while the PS-RNA probe was more tolerant to different buffer conditions. This work indicates a new method for interfacing DNA with NGO for Hg(2+) detection.

  3. Label-free fluorescence strategy for sensitive detection of adenosine triphosphate using a loop DNA probe with low background noise.

    Science.gov (United States)

    Lin, Chunshui; Cai, Zhixiong; Wang, Yiru; Zhu, Zhi; Yang, Chaoyong James; Chen, Xi

    2014-07-15

    A simple, rapid, label-free, and ultrasensitive fluorescence strategy for adenosine triphosphate (ATP) detection was developed using a loop DNA probe with low background noise. In this strategy, a loop DNA probe, which is the substrate for both ligation and digestion enzyme reaction, was designed. SYBR green I (SG I), a double-stranded specific dye, was applied for the readout fluorescence signal. Exonuclease I (Exo I) and exonuclease III (Exo III), sequence-independent nucleases, were selected to digest the loop DNA probe in order to minimize the background fluorescence signal. As a result, in the absence of ATP, the loop DNA was completely digested by Exo I and Exo III, leading to low background fluorescence owing to the weak electrostatic interaction between SG I and mononucleotides. On the other hand, ATP induced the ligation of the nicking site, and the sealed loop DNA resisted the digestion of Exo I and ExoIII, resulting in a remarkable increase of fluorescence response. Upon background noise reduction, the sensitivity of the ATP determination was improved significantly, and the detection limitation was found to be 1.2 pM, which is much lower than that in almost all the previously reported methods. This strategy has promise for wide application in the determination of ATP.

  4. Spectroscopic quantification of 5-hydroxymethylcytosine in genomic DNA using boric acid-functionalized nano-microsphere fluorescent probes.

    Science.gov (United States)

    Chen, Hua-Yan; Wei, Jing-Ru; Pan, Jiong-Xiu; Zhang, Wei; Dang, Fu-Quan; Zhang, Zhi-Qi; Zhang, Jing

    2017-05-15

    5-hydroxymethylcytosine (5hmC) is the sixth base of DNA. It is involved in active DNA demethylation and can be a marker of diseases such as cancer. In this study, we developed a simple and sensitive 2-(4-boronophenyl)quinoline-4-carboxylic acid modified poly (glycidyl methacrylate (PBAQA-PGMA) fluorescent probe to detect the 5hmC content of genomic DNA based on T4 β-glucosyltransferase-catalyzed glucosylation of 5hmC. The fluorescence-enhanced intensity recorded from the DNA sample was proportional to its 5-hydroxymethylcytosine content and could be quantified by fluorescence spectrophotometry. The developed probe showed good detection sensitivity and selectivity and a good linear relationship between the fluorescence intensity and the concentration of 5 hmC within a 0-100nM range. Compared with other fluorescence detection methods, this method not only could determine trace amounts of 5 hmC from genomic DNA but also could eliminate the interference of fluorescent dyes and the need for purification. It also could avoid multiple labeling. Because the PBAQA-PGMA probe could enrich the content of glycosyl-5-hydroxymethyl-2-deoxycytidine from a complex ground substance, it will broaden the linear detection range and improve sensitivity. The limit of detection was calculated to be 0.167nM after enrichment. Furthermore, the method was successfully used to detect 5-hydroxymethylcytosine from mouse tissues. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Characterization of a Novel Megabirnavirus from Sclerotinia sclerotiorum Reveals Horizontal Gene Transfer from Single-Stranded RNA Virus to Double-Stranded RNA Virus.

    Science.gov (United States)

    Wang, Minghong; Wang, Yong; Sun, Xiangzhong; Cheng, Jiasen; Fu, Yanping; Liu, Huiquan; Jiang, Daohong; Ghabrial, Said A; Xie, Jiatao

    2015-08-01

    Mycoviruses have been detected in all major groups of filamentous fungi, and their study represents an important branch of virology. Here, we characterized a novel double-stranded RNA (dsRNA) mycovirus, Sclerotinia sclerotiorum megabirnavirus 1 (SsMBV1), in an apparently hypovirulent strain (SX466) of Sclerotinia sclerotiorum. Two similarly sized dsRNA segments (L1- and L2-dsRNA), the genome of SsMBV1, are packaged in rigid spherical particles purified from strain SX466. The full-length cDNA sequence of L1-dsRNA/SsMBV1 comprises two large open reading frames (ORF1 and ORF2), which encode a putative coat protein and an RNA-dependent RNA polymerase (RdRp), respectively. Phylogenetic analysis of the RdRp domain clearly indicates that SsMBV1 is related to Rosellinia necatrix megabirnavirus 1 (RnMBV1). L2-dsRNA/SsMBV1 comprises two nonoverlapping ORFs (ORFA and ORFB) encoding two hypothetical proteins with unknown functions. The 5'-terminal regions of L1- and L2-dsRNA/SsMBV1 share strictly conserved sequences and form stable stem-loop structures. Although L2-dsRNA/SsMBV1 is dispensable for replication, genome packaging, and pathogenicity of SsMBV1, it enhances transcript accumulation of L1-dsRNA/SsMBV1 and stability of virus-like particles (VLPs). Interestingly, a conserved papain-like protease domain similar to a multifunctional protein (p29) of Cryphonectria hypovirus 1 was detected in the ORFA-encoded protein of L2-dsRNA/SsMBV1. Phylogenetic analysis based on the protease domain suggests that horizontal gene transfer may have occurred from a single-stranded RNA (ssRNA) virus (hypovirus) to a dsRNA virus, SsMBV1. Our results reveal that SsMBV1 has a slight impact on the fundamental biological characteristics of its host regardless of the presence or absence of L2-dsRNA/SsMBV1. Mycoviruses are widespread in all major fungal groups, and they possess diverse genomes of mostly ssRNA and dsRNA and, recently, circular ssDNA. Here, we have characterized a novel dsRNA virus