
Sample records for single-stranded dna primers

  1. Programmable autonomous synthesis of single-stranded DNA (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng


    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  2. DNA single strand break in fibroblast from Down syndrome patients

    International Nuclear Information System (INIS)

    Rozga, B.


    The radiosensitivity of tree trisomic (trisomia +21) strains of human fibroblasts to gamma radiation has been investigated in vitro and the causes of induction and repair of single strand DNA breaks in these cells have been estimated. The single strand breaks in DNA of normal and trisomic cells have been found to be ameliorated with an approximately equal efficiency. Repair has been found to be three times slower in trisomic cells compared to their normal relevant, most likely due to their elevated sensitivity to ionizing radiation and the following mortality of trisomic cells, and/or the potential occurrence of a great number of chromosome aberrations in cells irradiated in vitro. (author). 28 refs, 4 figs, 1 tab

  3. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W


    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  4. Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides. (United States)

    Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M; Högberg, Björn


    Single-stranded oligonucleotides are important as research tools, as diagnostic probes, in gene therapy and in DNA nanotechnology. Oligonucleotides are typically produced via solid-phase synthesis, using polymer chemistries that are limited relative to what biological systems produce. The number of errors in synthetic DNA increases with oligonucleotide length, and the resulting diversity of sequences can be a problem. Here we present the 'monoclonal stoichiometric' (MOSIC) method for enzyme-mediated production of DNA oligonucleotides. We amplified oligonucleotides from clonal templates derived from single bacterial colonies and then digested cutter hairpins in the products, which released pools of oligonucleotides with precisely controlled relative stoichiometric ratios. We prepared 14-378-nucleotide MOSIC oligonucleotides either by in vitro rolling-circle amplification or by amplification of phagemid DNA in Escherichia coli. Analyses of the formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides.

  5. Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides (United States)

    Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M.; Högberg, Björn


    Single-stranded oligonucleotides are important as research tools as probes for diagnostics and gene therapy. Today, production of oligonucleotides is done via solid-phase synthesis. However, the capabilities of current polymer chemistry are limited in comparison to what can be produced in biological systems. The errors in synthetic DNA increases with oligonucleotide length, and sequence diversity can often be a problem. Here, we present the Monoclonal Stoichiometric (MOSIC) method for enzymatic DNA oligonucleotide production. Using this method, we amplify oligonucleotides from clonal templates followed by digestion of a cutter-hairpin, resulting in pools of monoclonal oligonucleotides with precisely controlled relative stoichiometric ratios. We present data where MOSIC oligonucleotides, 14–378 nt long, were prepared either by in vitro rolling-circle amplification, or by amplification in Escherichia coli in the form of phagemid DNA. The formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides. PMID:23727986

  6. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface. (United States)

    Akbari, Fahimeh; Foroutan, Masumeh


    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  7. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.


    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  8. Genetic analysis of RPA single-stranded DNA binding protein in Haloferax volcanii


    Stroud, A. L.


    Replication protein A (RPA) is a single-stranded DNA-binding protein that is present in all three domains of life. The roles of RPA include stabilising and protecting single- stranded DNA from nuclease degradation during DNA replication and repair. To achieve this, RPA uses an oligosaccharide-binding fold (OB fold) to bind single- stranded DNA. Haloferax volcanii encodes three RPAs – RPA1, RPA2 and RPA3, of which rpa1 and rpa3 are in operons with genes encoding associated proteins (APs). ...

  9. Single-strand breaks in supercoiled DNA induced by vacuum-UV radiation in aqueous solution

    Energy Technology Data Exchange (ETDEWEB)

    Takakura, Kaoru; Ishikawa, Mitsuo; Hieda, Kotaro; Kobayashi, Katsumi; Ito, Atsushi; Ito, Takashi


    The induction of single-strand breaks in the DNA of plasmid pBR 322 by vacuum-UV radiation above 145 nm in aqueous solutions was studied in relation to the production of OH-radicals in water. The similarity and dissimilarity were examined on the wavelength dependence between the two effects. The maximum of single strand breaks at 150 nm could be explained by the action of OH-radicals derived from direct water photolysis: the maximum at 180 nm remains unexplained. There was no indication that the direct absorption of photon by the DNA molecule plays an important role in the production of single-strand breaks.

  10. Single-strand breaks in supercoiled DNA induced by vacuum-UV radiation in aqueous solution

    International Nuclear Information System (INIS)

    Takakura, Kaoru; Ishikawa, Mitsuo; Hieda, Kotaro; Kobayashi, Katsumi; Ito, Atsushi; Ito, Takashi


    The induction of single-strand breaks in the DNA of plasmid pBR 322 by vacuum-UV radiation above 145 nm in aqueous solutions was studied in relation to the production of OH-radicals in water. The similarity and dissimilarity were examined on the wavelength dependence between the two effects. The maximum of single strand breaks at 150 nm could be explained by the action of OH-radicals derived from direct water photolysis: the maximum at 180 nm remains unexplained. There was no indication that the direct absorption of photon by the DNA molecule plays an important role in the production of single-strand breaks. (author)

  11. Mammalian DNA single-strand break repair: an X-ra(y)ted affair. (United States)

    Caldecott, K W


    The genetic stability of living cells is continuously threatened by the presence of endogenous reactive oxygen species and other genotoxic molecules. Of particular threat are the thousands of DNA single-strand breaks that arise in each cell, each day, both directly from disintegration of damaged sugars and indirectly from the excision repair of damaged bases. If un-repaired, single-strand breaks can be converted into double-strand breaks during DNA replication, potentially resulting in chromosomal rearrangement and genetic deletion. Consequently, cells have adopted multiple pathways to ensure the rapid and efficient removal of single-strand breaks. A general feature of these pathways appears to be the extensive employment of protein-protein interactions to stimulate both the individual component steps and the overall repair reaction. Our current understanding of DNA single-strand break repair is discussed, and testable models for the architectural coordination of this important process are presented. Copyright 2001 John Wiley & Sons, Inc.

  12. Mechanism of replication of ultraviolet-irradiated single-stranded DNA by DNA polymerase III holoenzyme of Escherichia coli. Implications for SOS mutagenesis

    International Nuclear Information System (INIS)

    Livneh, Z.


    Replication of UV-irradiated oligodeoxynucleotide-primed single-stranded phi X174 DNA with Escherichia coli DNA polymerase III holoenzyme in the presence of single-stranded DNA-binding protein was investigated. The extent of initiation of replication on the primed single-stranded DNA was not altered by the presence of UV-induced lesions in the DNA. The elongation step exhibited similar kinetics when either unirradiated or UV-irradiated templates were used. Inhibition of the 3'----5' proofreading exonucleolytic activity of the polymerase by dGMP or by a mutD mutation did not increase bypass of pyrimidine photodimers, and neither did purified RecA protein influence the extent of photodimer bypass as judged by the fraction of full length DNA synthesized. Single-stranded DNA-binding protein stimulated bypass since in its absence the fraction of full length DNA decreased 5-fold. Termination of replication at putative pyrimidine dimers involved dissociation of the polymerase from the DNA, which could then reinitiate replication at other available primer templates. Based on these observations a model for SOS-induced UV mutagenesis is proposed

  13. Solubilization of Single-walled Carbon Nanotubes with Single- stranded DNA Generated from Asymmetric PCR

    Directory of Open Access Journals (Sweden)

    Chunhai Fan


    Full Text Available Carbon nanotubes (CNTs can be effectively dispersed and functionalized bywrapping with long single-stranded DNA (ssDNA synthesized by asymmetric PCR. ThessDNA-CNTs attached on surface of glass carbon electrode made it possible forelectrochemical analysis and sensing, which was demonstrated by reduction of H2O2 onhemoglobin/ssDNA-CNTs modified electrodes. This research showed the potentialapplication of DNA-functionalised CNTs in construction of future electrochemicalbiosensors.

  14. Electron attachment to DNA single strands: gas phase and aqueous solution. (United States)

    Gu, Jiande; Xie, Yaoming; Schaefer, Henry F


    The 2'-deoxyguanosine-3',5'-diphosphate, 2'-deoxyadenosine-3',5'-diphosphate, 2'-deoxycytidine-3',5'-diphosphate and 2'-deoxythymidine-3',5'-diphosphate systems are the smallest units of a DNA single strand. Exploring these comprehensive subunits with reliable density functional methods enables one to approach reasonable predictions of the properties of DNA single strands. With these models, DNA single strands are found to have a strong tendency to capture low-energy electrons. The vertical attachment energies (VEAs) predicted for 3',5'-dTDP (0.17 eV) and 3',5'-dGDP (0.14 eV) indicate that both the thymine-rich and the guanine-rich DNA single strands have the ability to capture electrons. The adiabatic electron affinities (AEAs) of the nucleotides considered here range from 0.22 to 0.52 eV and follow the order 3',5'-dTDP > 3',5'-dCDP > 3',5'-dGDP > 3',5'-dADP. A substantial increase in the AEA is observed compared to that of the corresponding nucleic acid bases and the corresponding nucleosides. Furthermore, aqueous solution simulations dramatically increase the electron attracting properties of the DNA single strands. The present investigation illustrates that in the gas phase, the excess electron is situated both on the nucleobase and on the phosphate moiety for DNA single strands. However, the distribution of the extra negative charge is uneven. The attached electron favors the base moiety for the pyrimidine, while it prefers the 3'-phosphate subunit for the purine DNA single strands. In contrast, the attached electron is tightly bound to the base fragment for the cytidine, thymidine and adenosine nucleotides, while it almost exclusively resides in the vicinity of the 3'-phosphate group for the guanosine nucleotides due to the solvent effects. The comparatively low vertical detachment energies (VDEs) predicted for 3',5'-dADP(-) (0.26 eV) and 3',5'-dGDP(-) (0.32 eV) indicate that electron detachment might compete with reactions having high activation barriers

  15. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.


    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  16. RADX interacts with single-stranded DNA to promote replication fork stability

    DEFF Research Database (Denmark)

    Schubert, Lisa; Ho, Teresa; Hoffmann, Saskia


    Single-stranded DNA (ssDNA) regions form as an intermediate in many DNA-associated transactions. Multiple cellular proteins interact with ssDNA via the oligonucleotide/oligosaccharide-binding (OB) fold domain. The heterotrimeric, multi-OB fold domain-containing Replication Protein A (RPA) complex...... ssDNA-binding activities is critical for avoiding these defects. Our findings establish RADX as an important component of cellular pathways that promote DNA replication integrity under basal and stressful conditions by means of multiple ssDNA-binding proteins....

  17. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud


    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  18. Expression, purification and biochemical characterization of a single-stranded DNA binding protein from Herbaspirillum seropedicae. (United States)

    Vernal, Javier; Serpa, Viviane I; Tavares, Carolina; Souza, Emanuel M; Pedrosa, Fábio O; Terenzi, Hernán


    An open reading frame encoding a protein similar in size and sequence to the Escherichia coli single-stranded DNA binding protein (SSB protein) was identified in the Herbaspirillum seropedicae genome. This open reading frame was cloned into the expression plasmid pET14b. The SSB protein from H. seropedicae, named Hs_SSB, was overexpressed in E. coli strain BL21(DE3) and purified to homogeneity. Mass spectrometry data confirmed the identity of this protein. The apparent molecular mass of the native Hs_SSB was estimated by gel filtration, suggesting that the native protein is a tetramer made up of four similar subunits. The purified protein binds to single-stranded DNA (ssDNA) in a similar manner to other SSB proteins. The production of this recombinant protein in good yield opens up the possibility of obtaining its 3D-structure and will help further investigations into DNA metabolism.

  19. Temporary electron localization and scattering in disordered single strands of DNA

    International Nuclear Information System (INIS)

    Caron, Laurent; Sanche, Leon


    We present a theoretical study of the effect of structural and base sequence disorders on the transport properties of nonthermal electron scattering within and from single strands of DNA. The calculations are based on our recently developed formalism to treat multiple elastic scattering from simplified pseudomolecular DNA subunits. Structural disorder is shown to increase both the elastic scattering cross section and the attachment probability on the bases at low energy. Sequence disorder, however, has no significant effect

  20. Defective processing of methylated single-stranded DNA by E. coli alkB mutants (United States)

    Dinglay, Suneet; Trewick, Sarah C.; Lindahl, Tomas; Sedgwick, Barbara


    Escherichia coli alkB mutants are very sensitive to DNA methylating agents. Despite these mutants being the subject of many studies, no DNA repair or other function has been assigned to the AlkB protein or to its human homolog. Here, we report that reactivation of methylmethanesulfonate (MMS)-treated single-stranded DNA phages, M13, f1, and G4, was decreased dramatically in alkB mutants. No such decrease occurred when using methylated λ phage or M13 duplex DNA. These data show that alkB mutants have a marked defect in processing methylation damage in single-stranded DNA. Recombinant AlkB protein bound more efficiently to single- than double-stranded DNA. The single-strand damage processed by AlkB was primarily cytotoxic and not mutagenic and was induced by SN2 methylating agents, MMS, DMS, and MeI but not by SN1 agent N-methyl-N-nitrosourea or by γ irradiation. Strains lacking other DNA repair activities, alkA tag, xth nfo, uvrA, mutS, and umuC, were not defective in reactivation of methylated M13 phage and did not enhance the defect of an alkB mutant. A recA mutation caused a small but additive defect. Thus, AlkB functions in a novel pathway independent of these activities. We propose that AlkB acts on alkylated single-stranded DNA in replication forks or at transcribed regions. Consistent with this theory, stationary phase alkB cells were less MMS sensitive than rapidly growing cells. PMID:10950872

  1. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks. (United States)

    Pachkowski, Brian; Nakamura, Jun


    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  2. MEIOB targets single-strand DNA and is necessary for meiotic recombination.

    Directory of Open Access Journals (Sweden)

    Benoit Souquet

    Full Text Available Meiotic recombination is a mandatory process for sexual reproduction. We identified a protein specifically implicated in meiotic homologous recombination that we named: meiosis specific with OB domain (MEIOB. This protein is conserved among metazoan species and contains single-strand DNA binding sites similar to those of RPA1. Our studies in vitro revealed that both recombinant and endogenous MEIOB can be retained on single-strand DNA. Those in vivo demonstrated the specific expression of Meiob in early meiotic germ cells and the co-localization of MEIOB protein with RPA on chromosome axes. MEIOB localization in Dmc1 (-/- spermatocytes indicated that it accumulates on resected DNA. Homologous Meiob deletion in mice caused infertility in both sexes, due to a meiotic arrest at a zygotene/pachytene-like stage. DNA double strand break repair and homologous chromosome synapsis were impaired in Meiob (-/- meiocytes. Interestingly MEIOB appeared to be dispensable for the initial loading of recombinases but was required to maintain a proper number of RAD51 and DMC1 foci beyond the zygotene stage. In light of these findings, we propose that RPA and this new single-strand DNA binding protein MEIOB, are essential to ensure the proper stabilization of recombinases which is required for successful homology search and meiotic recombination.

  3. Viral interference with DNA repair by targeting of the single-stranded DNA binding protein RPA. (United States)

    Banerjee, Pubali; DeJesus, Rowena; Gjoerup, Ole; Schaffhausen, Brian S


    Correct repair of damaged DNA is critical for genomic integrity. Deficiencies in DNA repair are linked with human cancer. Here we report a novel mechanism by which a virus manipulates DNA damage responses. Infection with murine polyomavirus sensitizes cells to DNA damage by UV and etoposide. Polyomavirus large T antigen (LT) alone is sufficient to sensitize cells 100 fold to UV and other kinds of DNA damage. This results in activated stress responses and apoptosis. Genetic analysis shows that LT sensitizes via the binding of its origin-binding domain (OBD) to the single-stranded DNA binding protein replication protein A (RPA). Overexpression of RPA protects cells expressing OBD from damage, and knockdown of RPA mimics the LT phenotype. LT prevents recruitment of RPA to nuclear foci after DNA damage. This leads to failure to recruit repair proteins such as Rad51 or Rad9, explaining why LT prevents repair of double strand DNA breaks by homologous recombination. A targeted intervention directed at RPA based on this viral mechanism could be useful in circumventing the resistance of cancer cells to therapy.

  4. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux


    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  5. Genomic mapping of single-stranded DNA in hydroxyurea-challenged yeasts identifies origins of replication. (United States)

    Feng, Wenyi; Collingwood, David; Boeck, Max E; Fox, Lindsay A; Alvino, Gina M; Fangman, Walton L; Raghuraman, Mosur K; Brewer, Bonita J


    During DNA replication one or both strands transiently become single stranded: first at the sites where initiation of DNA synthesis occurs (known as origins of replication) and subsequently on the lagging strands of replication forks as discontinuous Okazaki fragments are generated. We report a genome-wide analysis of single-stranded DNA (ssDNA) formation in the presence of hydroxyurea during DNA replication in wild-type and checkpoint-deficient rad53 Saccharomyces cerevisiae cells. In wild-type cells, ssDNA was first observed at a subset of replication origins and later 'migrated' bi-directionally, suggesting that ssDNA formation is associated with continuously moving replication forks. In rad53 cells, ssDNA was observed at virtually every known origin, but remained there over time, suggesting that replication forks stall. Telomeric regions seemed to be particularly sensitive to the loss of Rad53 checkpoint function. Replication origins in Schizosaccharomyces pombe were also mapped using our method.

  6. The impact of base stacking on the conformations and electrostatics of single-stranded DNA. (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois


    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Purification of Single-Stranded cDNA Based on RNA Degradation Treatment and Adsorption Chromatography. (United States)

    Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M


    Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.

  8. Strand Displacement by DNA Polymerase III Occurs through a τ-ψ-χ Link to Single-stranded DNA-binding Protein Coating the Lagging Strand Template*


    Yuan, Quan; McHenry, Charles S.


    In addition to the well characterized processive replication reaction catalyzed by the DNA polymerase III holoenzyme on single-stranded DNA templates, the enzyme possesses an intrinsic strand displacement activity on flapped templates. The strand displacement activity is distinguished from the single-stranded DNA-templated reaction by a high dependence upon single-stranded DNA binding protein and an inability of γ-complex to support the reaction in the absence of τ. However, if γ-complex is p...

  9. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams


    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  10. Helical filaments of human Dmc1 protein on single-stranded DNA: a cautionary tale (United States)

    Yu, Xiong; Egelman, Edward H.


    Proteins in the RecA/Rad51/RadA family form nucleoprotein filaments on DNA that catalyze a strand exchange reaction as part of homologous genetic recombination. Because of the centrality of this system to many aspects of DNA repair, the generation of genetic diversity, and cancer when this system fails or is not properly regulated, these filaments have been the object of many biochemical and biophysical studies. A recent paper has argued that the human Dmc1 protein, a meiotic homolog of bacterial RecA and human Rad51, forms filaments on single stranded DNA with ∼ 9 subunits per turn in contrast to the filaments formed on double stranded DNA with ∼ 6.4 subunits per turn, and that the stoichiometry of DNA binding is different between these two filaments. We show using scanning transmission electron microscopy (STEM) that the Dmc1 filament formed on single stranded DNA has a mass per unit length expected from ∼ 6.5 subunits per turn. More generally, we show how ambiguities in helical symmetry determination can generate incorrect solutions, and why one sometimes must use other techniques, such as biochemistry, metal shadowing, or STEM to resolve these ambiguities. While three-dimensional reconstruction of helical filaments from EM images is a powerful tool, the intrinsic ambiguities that may be present with limited resolution are not sufficiently appreciated. PMID:20600108

  11. Influence of DNA conformation on radiation-induced single-strand breaks

    International Nuclear Information System (INIS)

    Barone, F.; Belli, M.; Mazzei, F.


    We performed experiments on two DNA fragments of about 300 bp having different conformation to test whether radiation-induced single-strand breakage is dependent on DNA conformation. Breakage analysis was carried out by denaturing polyacrylamide gel electrophoresis, which allows determination of the broken site at single nucleotide resolution. We found uniform cutting patterns in B-form regions. On the contrary, X- or γ-irradiation of curved fragments of kinetoplast DNA showed that the distribution of single-strand breaks was not uniform along the fragment, as the cleavage pattern was modulated in phase with the runs of A-T pairs. This modulation likely reflected the reduced accessibility of the sites which on hydroxyl-radical attack give rise to strand breaks. The cleavage pattern was phased with the runs of A-T pairs. Moreover, the overall yield of strand breaks was considerably lower in curved DNA fragments than in those with extended straight regions. The conformation effect found here indicates that the cleavage pattern reflects the fine structural features of DNA. (orig./MG)

  12. Biophysical characterization of the association of histones with single-stranded DNA. (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier


    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted


    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  14. Single-strand breaks induced in Bacillus subtilis DNA by ultraviolet light: action spectrum and properties

    International Nuclear Information System (INIS)

    Peak, M.J.; Peak, J.G.


    The induction of single-strand breaks (alkali-labile bonds plus frank breaks) in the DNA of Bacillus subtilis irradiated in vivo by monochromatic UV light at wavelengths from 254 to 434nm was measured. The spectrum consists of a major far-UV (below 320nm) component and a minor near-UV shoulder. A mutant deficient in DNA polymerase I accumulates breaks caused by near-UV (above 320nm) wavelengths faster than the wild-type strain proficient in polymerase I. Measurable breaks in extracted DNA are induced at a higher frequency than those induced in vivo. Anoxia, glycerol, and diazobicyclo (2.2.2.) octane inhibit break formation in extracted DNA. Alkali-labile bonds induced by 365-nm UV radiation are largely (78%) covalent bond chain breaks, the remainder consists of true alkali-labile bonds, probably apurinic and apyrimidinic sites. (author)

  15. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.


    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  16. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.


    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  17. Transcription blockage by homopurine DNA sequences: role of sequence composition and single-strand breaks (United States)

    Belotserkovskii, Boris P.; Neil, Alexander J.; Saleh, Syed Shayon; Shin, Jane Hae Soo; Mirkin, Sergei M.; Hanawalt, Philip C.


    The ability of DNA to adopt non-canonical structures can affect transcription and has broad implications for genome functioning. We have recently reported that guanine-rich (G-rich) homopurine-homopyrimidine sequences cause significant blockage of transcription in vitro in a strictly orientation-dependent manner: when the G-rich strand serves as the non-template strand [Belotserkovskii et al. (2010) Mechanisms and implications of transcription blockage by guanine-rich DNA sequences., Proc. Natl Acad. Sci. USA, 107, 12816–12821]. We have now systematically studied the effect of the sequence composition and single-stranded breaks on this blockage. Although substitution of guanine by any other base reduced the blockage, cytosine and thymine reduced the blockage more significantly than adenine substitutions, affirming the importance of both G-richness and the homopurine-homopyrimidine character of the sequence for this effect. A single-strand break in the non-template strand adjacent to the G-rich stretch dramatically increased the blockage. Breaks in the non-template strand result in much weaker blockage signals extending downstream from the break even in the absence of the G-rich stretch. Our combined data support the notion that transcription blockage at homopurine-homopyrimidine sequences is caused by R-loop formation. PMID:23275544

  18. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    Energy Technology Data Exchange (ETDEWEB)

    Meffert, H; Boehm, F; Soennichsen, N; Gens, J [Humboldt-Universitaet, Berlin (German Democratic Republic). Bereich Medizin (Charite)


    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization.

  19. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.


    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  20. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  1. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can


    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  2. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif. (United States)

    Zhu, Jie; Feng, Xiaolu; Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can


    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  3. Excess single-stranded DNA inhibits meiotic double-strand break repair.

    Directory of Open Access Journals (Sweden)

    Rebecca Johnson


    Full Text Available During meiosis, self-inflicted DNA double-strand breaks (DSBs are created by the protein Spo11 and repaired by homologous recombination leading to gene conversions and crossovers. Crossover formation is vital for the segregation of homologous chromosomes during the first meiotic division and requires the RecA orthologue, Dmc1. We analyzed repair during meiosis of site-specific DSBs created by another nuclease, VMA1-derived endonuclease (VDE, in cells lacking Dmc1 strand-exchange protein. Turnover and resection of the VDE-DSBs was assessed in two different reporter cassettes that can repair using flanking direct repeat sequences, thereby obviating the need for a Dmc1-dependent DNA strand invasion step. Access of the single-strand binding complex replication protein A, which is normally used in all modes of DSB repair, was checked in chromatin immunoprecipitation experiments, using antibody against Rfa1. Repair of the VDE-DSBs was severely inhibited in dmc1Delta cells, a defect that was associated with a reduction in the long tract resection required to initiate single-strand annealing between the flanking repeat sequences. Mutants that either reduce Spo11-DSB formation or abolish resection at Spo11-DSBs rescued the repair block. We also found that a replication protein A component, Rfa1, does not accumulate to expected levels at unrepaired single-stranded DNA (ssDNA in dmc1Delta cells. The requirement of Dmc1 for VDE-DSB repair using flanking repeats appears to be caused by the accumulation of large quantities of ssDNA that accumulate at Spo11-DSBs when Dmc1 is absent. We propose that these resected DSBs sequester both resection machinery and ssDNA binding proteins, which in wild-type cells would normally be recycled as Spo11-DSBs repair. The implication is that repair proteins are in limited supply, and this could reflect an underlying mechanism for regulating DSB repair in wild-type cells, providing protection from potentially harmful effects

  4. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos


    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  5. Cdc45-induced loading of human RPA onto single-stranded DNA. (United States)

    Szambowska, Anna; Tessmer, Ingrid; Prus, Piotr; Schlott, Bernhard; Pospiech, Helmut; Grosse, Frank


    Cell division cycle protein 45 (Cdc45) is an essential component of the eukaryotic replicative DNA helicase. We found that human Cdc45 forms a complex with the single-stranded DNA (ssDNA) binding protein RPA. Moreover, it actively loads RPA onto nascent ssDNA. Pull-down assays and surface plasmon resonance studies revealed that Cdc45-bound RPA complexed with ssDNA in the 8-10 nucleotide binding mode, but dissociated when RPA covered a 30-mer. Real-time analysis of RPA-ssDNA binding demonstrated that Cdc45 catalytically loaded RPA onto ssDNA. This placement reaction required physical contacts of Cdc45 with the RPA70A subdomain. Our results imply that Cdc45 controlled stabilization of the 8-nt RPA binding mode, the subsequent RPA transition into 30-mer mode and facilitated an ordered binding to ssDNA. We propose that a Cdc45-mediated loading guarantees a seamless deposition of RPA on newly emerging ssDNA at the nascent replication fork. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.


    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  7. A conserved MCM single-stranded DNA binding element is essential for replication initiation. (United States)

    Froelich, Clifford A; Kang, Sukhyun; Epling, Leslie B; Bell, Stephen P; Enemark, Eric J


    The ring-shaped MCM helicase is essential to all phases of DNA replication. The complex loads at replication origins as an inactive double-hexamer encircling duplex DNA. Helicase activation converts this species to two active single hexamers that encircle single-stranded DNA (ssDNA). The molecular details of MCM DNA interactions during these events are unknown. We determined the crystal structure of the Pyrococcus furiosus MCM N-terminal domain hexamer bound to ssDNA and define a conserved MCM-ssDNA binding motif (MSSB). Intriguingly, ssDNA binds the MCM ring interior perpendicular to the central channel with defined polarity. In eukaryotes, the MSSB is conserved in several Mcm2-7 subunits, and MSSB mutant combinations in S. cerevisiae Mcm2-7 are not viable. Mutant Mcm2-7 complexes assemble and are recruited to replication origins, but are defective in helicase loading and activation. Our findings identify an important MCM-ssDNA interaction and suggest it functions during helicase activation to select the strand for translocation. DOI:

  8. Mapping yeast origins of replication via single-stranded DNA detection. (United States)

    Feng, Wenyi; Raghuraman, M K; Brewer, Bonita J


    Studies in th Saccharomyces cerevisiae have provided a framework for understanding how eukaryotic cells replicate their chromosomal DNA to ensure faithful transmission of genetic information to their daughter cells. In particular, S. cerevisiae is the first eukaryote to have its origins of replication mapped on a genomic scale, by three independent groups using three different microarray-based approaches. Here we describe a new technique of origin mapping via detection of single-stranded DNA in yeast. This method not only identified the majority of previously discovered origins, but also detected new ones. We have also shown that this technique can identify origins in Schizosaccharomyces pombe, illustrating the utility of this method for origin mapping in other eukaryotes.

  9. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.


    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  10. Repair of single-strand breaks induced in the DNA of Proteus mirabilis by excision repair after UV-irradiation

    International Nuclear Information System (INIS)

    Stoerl, K.; Mund, C.


    Single-strand breaks have been produced in the DNA of P. mirabilis after UV-irradiation in dependence on the incident UV-doses. It has been found that there exists a discrepancy between the single-strand breaks estimated from sedimentation in alkaline sucrose gradients and the expected single-strand breaks approximated from measurements of dimer excision. The low number in incision breaks observed by sedimentation experiments is an indication that the cells are able to repair the excision-induced breaks as fast as they are formed. Toluenized cells have been used for investigation of the incision step independently of subsequent repair processes. In presence of NMN the appearance of more single-strand breaks in the DNA has been observed. Furthermore, the number of incision breaks in toluenized cells increased in presence of exogenous ATP. The completion of the excision repair process has been investigated by observing the rejoining of incision breaks. After irradiation with UV-doses higher than approximately 240 erg/mm 2 the number of single-strand breaks remaining unrepaired in the DNA increased. Studies of the influence of nutrition conditions on the repair process have shown approximately the same capacity for repair of single-strand breaks in growth medium as well as in buffer. Progress in the excision repair was also followed by investigation of the DNA synthesized at the template-DNA containing the pyrimidine dimers. In comparison with E. coli, P. mirabilis showed a somewhat lower efficiency for the repair of single-strand breaks during the excision repair. (author)

  11. RPA Stabilization of Single-Stranded DNA Is Critical for Break-Induced Replication. (United States)

    Ruff, Patrick; Donnianni, Roberto A; Glancy, Eleanor; Oh, Julyun; Symington, Lorraine S


    DNA double-strand breaks (DSBs) are cytotoxic lesions that must be accurately repaired to maintain genome stability. Replication protein A (RPA) plays an important role in homology-dependent repair of DSBs by protecting the single-stranded DNA (ssDNA) intermediates formed by end resection and by facilitating Rad51 loading. We found that hypomorphic mutants of RFA1 that support intra-chromosomal homologous recombination are profoundly defective for repair processes involving long tracts of DNA synthesis, in particular break-induced replication (BIR). The BIR defects of the rfa1 mutants could be partially suppressed by eliminating the Sgs1-Dna2 resection pathway, suggesting that Dna2 nuclease attacks the ssDNA formed during end resection when not fully protected by RPA. Overexpression of Rad51 was also found to suppress the rfa1 BIR defects. We suggest that Rad51 binding to the ssDNA formed by excessive end resection and during D-loop migration can partially compensate for dysfunctional RPA. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  12. Reconstitution of RPA-covered single-stranded DNA-activated ATR-Chk1 signaling. (United States)

    Choi, Jun-Hyuk; Lindsey-Boltz, Laura A; Kemp, Michael; Mason, Aaron C; Wold, Marc S; Sancar, Aziz


    ATR kinase is a critical upstream regulator of the checkpoint response to various forms of DNA damage. Previous studies have shown that ATR is recruited via its binding partner ATR-interacting protein (ATRIP) to replication protein A (RPA)-covered single-stranded DNA (RPA-ssDNA) generated at sites of DNA damage where ATR is then activated by TopBP1 to phosphorylate downstream targets including the Chk1 signal transducing kinase. However, this critical feature of the human ATR-initiated DNA damage checkpoint signaling has not been demonstrated in a defined system. Here we describe an in vitro checkpoint system in which RPA-ssDNA and TopBP1 are essential for phosphorylation of Chk1 by the purified ATR-ATRIP complex. Checkpoint defective RPA mutants fail to activate ATR kinase in this system, supporting the conclusion that this system is a faithful representation of the in vivo reaction. Interestingly, we find that an alternative form of RPA (aRPA), which does not support DNA replication, can substitute for the checkpoint function of RPA in vitro, thus revealing a potential role for aRPA in the activation of ATR kinase. We also find that TopBP1 is recruited to RPA-ssDNA in a manner dependent on ATRIP and that the N terminus of TopBP1 is required for efficient recruitment and activation of ATR kinase.

  13. Chemo-mechanical pushing of proteins along single-stranded DNA. (United States)

    Sokoloski, Joshua E; Kozlov, Alexander G; Galletto, Roberto; Lohman, Timothy M


    Single-stranded (ss)DNA binding (SSB) proteins bind with high affinity to ssDNA generated during DNA replication, recombination, and repair; however, these SSBs must eventually be displaced from or reorganized along the ssDNA. One potential mechanism for reorganization is for an ssDNA translocase (ATP-dependent motor) to push the SSB along ssDNA. Here we use single molecule total internal reflection fluorescence microscopy to detect such pushing events. When Cy5-labeled Escherichia coli (Ec) SSB is bound to surface-immobilized 3'-Cy3-labeled ssDNA, a fluctuating FRET signal is observed, consistent with random diffusion of SSB along the ssDNA. Addition of Saccharomyces cerevisiae Pif1, a 5' to 3' ssDNA translocase, results in the appearance of isolated, irregularly spaced saw-tooth FRET spikes only in the presence of ATP. These FRET spikes result from translocase-induced directional (5' to 3') pushing of the SSB toward the 3' ssDNA end, followed by displacement of the SSB from the DNA end. Similar ATP-dependent pushing events, but in the opposite (3' to 5') direction, are observed with EcRep and EcUvrD (both 3' to 5' ssDNA translocases). Simulations indicate that these events reflect active pushing by the translocase. The ability of translocases to chemo-mechanically push heterologous SSB proteins along ssDNA provides a potential mechanism for reorganization and clearance of tightly bound SSBs from ssDNA.

  14. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells. (United States)

    Hirsch, Matthew L; Fagan, B Matthew; Dumitru, Raluca; Bower, Jacquelyn J; Yadav, Swati; Porteus, Matthew H; Pevny, Larysa H; Samulski, R Jude


    Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  15. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  16. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.


    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  17. Automated methods for single-stranded DNA isolation and dideoxynucleotide DNA sequencing reactions on a robotic workstation

    International Nuclear Information System (INIS)

    Mardis, E.R.; Roe, B.A.


    Automated procedures have been developed for both the simultaneous isolation of 96 single-stranded M13 chimeric template DNAs in less than two hours, and for simultaneously pipetting 24 dideoxynucleotide sequencing reactions on a commercially available laboratory workstation. The DNA sequencing results obtained by either radiolabeled or fluorescent methods are consistent with the premise that automation of these portions of DNA sequencing projects will improve the reproducibility of the DNA isolation and the procedures for these normally labor-intensive steps provides an approach for rapid acquisition of large amounts of high quality, reproducible DNA sequence data

  18. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik


    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  19. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B


    for phosphotyrosine-containing proteins in Streptomyces griseus by immunoaffinity chromatography identified bacterial SSBs as a novel target of bacterial tyrosine kinases. Since genes encoding protein-tyrosine kinases (PTKs) have not been recognized in streptomycetes, and SSBs from Streptomyces coelicolor (Sc......SSB) and Bacillus subtilis (BsSSB) share 38.7% identity, we used a B.subtilis protein-tyrosine kinase YwqD to phosphorylate two cognate SSBs (BsSSB and YwpH) in vitro. We demonstrate that in vivo phosphorylation of B.subtilis SSB occurs on tyrosine residue 82, and this reaction is affected antagonistically...... by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  20. Novel Single-Stranded DNA Virus Genomes Recovered from Chimpanzee Feces Sampled from the Mambilla Plateau in Nigeria (United States)

    Walters, Matthew; Bawuro, Musa; Christopher, Alfred; Knight, Alexander; Kraberger, Simona; Stainton, Daisy; Chapman, Hazel


    ABSTRACT Metagenomic approaches are rapidly expanding our knowledge of the diversity of viruses. In the fecal matter of Nigerian chimpanzees we recovered three gokushovirus genomes, one circular replication-associated protein encoding single-stranded DNA virus (CRESS), and a CRESS DNA molecule. PMID:28254982

  1. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.


    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  2. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity. (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L


    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity* (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.


    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  4. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.


    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  5. Molecular dynamics simulation of a DNA containing a single strand break

    Energy Technology Data Exchange (ETDEWEB)

    Yamaguchi, H.; Siebers, G.; Furukawa, A.; Otagiri, N.; Osman, R


    Molecular dynamics simulations were performed for a dodecamer DNA containing a single strand break (SSB), which has been represented by a 3'-OH deoxyribose and 5'-OH phosphate in the middle of the strand. Molecular force field parameters of the 5'-OH phosphate region were determined from an ab initio calculation at the HF/6-31G level using the program package GAMESS. The DNA was placed in a periodic boundary box with water molecules and Na+ counter-ions to produce a neutralised system. After minimisation, the system was heated to 300 K, equilibrated and a production run at constant NTP was executed for 1 ns using AMBER 4.1. Snapshots of the SSB-containing DNA and a detailed analysis of the equilibriated average structure revealed surprisingly small conformational changes compared to normal DNA. However, dynamic properties calculated using the essential dynamics method showed some features that may be important for the recognition of this damage by repair enzymes. (author)

  6. DNA translocation by human uracil DNA glycosylase: the case of single-stranded DNA and clustered uracils. (United States)

    Schonhoft, Joseph D; Stivers, James T


    Human uracil DNA glycosylase (hUNG) plays a central role in DNA repair and programmed mutagenesis of Ig genes, requiring it to act on sparsely or densely spaced uracil bases located in a variety of contexts, including U/A and U/G base pairs, and potentially uracils within single-stranded DNA (ssDNA). An interesting question is whether the facilitated search mode of hUNG, which includes both DNA sliding and hopping, changes in these different contexts. Here we find that hUNG uses an enhanced local search mode when it acts on uracils in ssDNA, and also, in a context where uracils are densely clustered in duplex DNA. In the context of ssDNA, hUNG performs an enhanced local search by sliding with a mean sliding length larger than that of double-stranded DNA (dsDNA). In the context of duplex DNA, insertion of high-affinity abasic product sites between two uracil lesions serves to significantly extend the apparent sliding length on dsDNA from 4 to 20 bp and, in some cases, leads to directionally biased 3' → 5' sliding. The presence of intervening abasic product sites mimics the situation where hUNG acts iteratively on densely spaced uracils. The findings suggest that intervening product sites serve to increase the amount of time the enzyme remains associated with DNA as compared to nonspecific DNA, which in turn increases the likelihood of sliding as opposed to falling off the DNA. These findings illustrate how the search mechanism of hUNG is not predetermined but, instead, depends on the context in which the uracils are located.

  7. Interactive Roles of DNA Helicases and Translocases with the Single-Stranded DNA Binding Protein RPA in Nucleic Acid Metabolism. (United States)

    Awate, Sanket; Brosh, Robert M


    Helicases and translocases use the energy of nucleoside triphosphate binding and hydrolysis to unwind/resolve structured nucleic acids or move along a single-stranded or double-stranded polynucleotide chain, respectively. These molecular motors facilitate a variety of transactions including replication, DNA repair, recombination, and transcription. A key partner of eukaryotic DNA helicases/translocases is the single-stranded DNA binding protein Replication Protein A (RPA). Biochemical, genetic, and cell biological assays have demonstrated that RPA interacts with these human molecular motors physically and functionally, and their association is enriched in cells undergoing replication stress. The roles of DNA helicases/translocases are orchestrated with RPA in pathways of nucleic acid metabolism. RPA stimulates helicase-catalyzed DNA unwinding, enlists translocases to sites of action, and modulates their activities in DNA repair, fork remodeling, checkpoint activation, and telomere maintenance. The dynamic interplay between DNA helicases/translocases and RPA is just beginning to be understood at the molecular and cellular levels, and there is still much to be learned, which may inform potential therapeutic strategies.


    Quantitation of intracellular NAD(P)H in living cells can monitor an imbalance of DNA single strand break repair in real time.ABSTRACTDNA single strand breaks (SSBs) are one of the most frequent DNA lesions in genomic DNA generated either by oxidative stress or du...

  9. Selection and characterization of single stranded DNA aptamers recognizing fumonisin B1

    International Nuclear Information System (INIS)

    Chen, Xiujuan; Huang, Yukun; Duan, Nuo; Wu, Shijia; Xia, Yu; Ma, Xiaoyuan; Ding, Zhansheng; Wang, Zhouping; Zhu, Changqing; Jiang, Yuan


    We present an improved method for the selection of single-stranded DNA aptamers that can recognize fumonisin B 1 (FB 1 ). FB 1 is a carcinogenic mycotoxin mainly found in corn and corn-based food products worldwide, posing a global threat to feed and food safety. Selection was based on the mag-SELEX (magnetic bead systematic evolution of ligands by exponential enrichment) technology modified by adopting free analogs of targets rather than immobilized targets for counter selections. Firstly, aptamer candidates for FB 1 were selected from an 80 nt random DNA library after 13 rounds of selection. Next, binding assays were performed for affinity evaluation, and circular dichroism spectroscopy was used to investigate their conformation. A high-affinity aptamer designated as F10 (with a dissociation constant of 62 ± 5 nM) was identified and tested for its specificity by competitive binding assays. The results demonstrate that this improved mag-SELEX technology facilitates aptamer screening because it avoids the tedious immobilization of counter-selection molecules on magnetic beads. The aptamers obtained by this technique open new possibilities for the detection of FB 1 via aptasensors. (author)

  10. Selection and characterization of single stranded DNA aptamers recognizing fumonisin B{sub 1}

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Xiujuan; Huang, Yukun; Duan, Nuo; Wu, Shijia; Xia, Yu; Ma, Xiaoyuan; Ding, Zhansheng; Wang, Zhouping [State Key Laboratory of Food Science and Technology, Synergetic Innovation Center of Food Safety and Nutrition, School of Food Science and Technology, Jiangnan University, Wuxi, 214122 (China); Zhu, Changqing; Jiang, Yuan [Animal, Plant and Food Inspection Centre, Jiangsu Entry-Exit Inspection and Quarantine Bureau, Nanjing, 210001 (China)


    We present an improved method for the selection of single-stranded DNA aptamers that can recognize fumonisin B{sub 1} (FB{sub 1}). FB{sub 1} is a carcinogenic mycotoxin mainly found in corn and corn-based food products worldwide, posing a global threat to feed and food safety. Selection was based on the mag-SELEX (magnetic bead systematic evolution of ligands by exponential enrichment) technology modified by adopting free analogs of targets rather than immobilized targets for counter selections. Firstly, aptamer candidates for FB{sub 1} were selected from an 80 nt random DNA library after 13 rounds of selection. Next, binding assays were performed for affinity evaluation, and circular dichroism spectroscopy was used to investigate their conformation. A high-affinity aptamer designated as F10 (with a dissociation constant of 62 ± 5 nM) was identified and tested for its specificity by competitive binding assays. The results demonstrate that this improved mag-SELEX technology facilitates aptamer screening because it avoids the tedious immobilization of counter-selection molecules on magnetic beads. The aptamers obtained by this technique open new possibilities for the detection of FB{sub 1} via aptasensors. (author)

  11. Selection and Characterization of Single Stranded DNA Aptamers for the Hormone Abscisic Acid (United States)

    Gonzalez, Victor M.; Millo, Enrico; Sturla, Laura; Vigliarolo, Tiziana; Bagnasco, Luca; Guida, Lucrezia; D'Arrigo, Cristina; De Flora, Antonio; Salis, Annalisa; Martin, Elena M.; Bellotti, Marta; Zocchi, Elena


    The hormone abscisic acid (ABA) is a small molecule involved in pivotal physiological functions in higher plants. Recently, ABA has been also identified as an endogenous hormone in mammals, regulating different cell functions including inflammatory processes, stem cell expansion, insulin release, and glucose uptake. Aptamers are short, single-stranded (ss) oligonucleotidesable to recognize target molecules with high affinity. The small size of the ABA molecule represented a challenge for aptamer development and the aim of this study was to develop specific anti-ABA DNA aptamers. Biotinylated abscisic acid (bio-ABA) was immobilized on streptavidin-coated magnetic beads. DNA aptamers against bio-ABA were selected with 7 iterative rounds of the systematic evolution of ligands by exponential enrichment method (SELEX), each round comprising incubation of the ABA-binding beads with the ssDNA sequences, DNA elution, electrophoresis, and polymerase chain reaction (PCR) amplification. The PCR product was cloned and sequenced. The binding affinity of several clones was determined using bio-ABA immobilized on streptavidin-coated plates. Aptamer 2 and aptamer 9 showed the highest binding affinity, with dissociation constants values of 0.98±0.14 μM and 0.80±0.07 μM, respectively. Aptamers 2 and 9 were also able to bind free, unmodified ABA and to discriminate between different ABA enantiomers and isomers. Our findings indicate that ssDNA aptamers can selectively bind ABA and could be used for the development of ABA quantitation assays. PMID:23971905

  12. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.


    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  13. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.


    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  14. Kinetics of repair of DNA single-strand breaks in cultured mammalian cells

    International Nuclear Information System (INIS)

    Vexler, F.B.; Eidus, L.Kh.; Vexler, A.M.


    Postirradiation treatment of Chinese hamster cells with cysteamine (MEA), caffeine-benzoate (CB) and caffeine sharply inhibits the repair of DNA single-strand breaks in the first five minutes. This inhibition is reversible since removing of the agent leads immediately to the resumption of the repair. The rate of the repair is decreased with prolongation of treatment and increasing concentration of the modifying agent. The efficiency of the substances studied depends not only on their concentration in the medium. For MEA and CB, which are weak electrolytes, it is also pH-dependent. This is explained by the theory of dissociation of weak electrolytes and their distribution between the cell and medium. It is shown that intracellular concentration of the substances is the most important factor determining their efficiency. All the three substances exert practically the same effect when compared at equal intracellular concentration. The above presented data serve as evidence for the existence of an unspecific mechanism of the effect of the substances studied. (author)

  15. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.


    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  16. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia


    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  17. Explanation for excessive DNA single-strand breaks and endogenous repair foci in pluripotent mouse embryonic stem cells. (United States)

    Banáth, J P; Bañuelos, C A; Klokov, D; MacPhail, S M; Lansdorp, P M; Olive, P L


    Pluripotent mouse embryonic stem cells (mES cells) exhibit approximately 100 large gammaH2AX repair foci in the absence of measurable numbers of DNA double-strand breaks. Many of these cells also show excessive numbers of DNA single-strand breaks (>10,000 per cell) when analyzed using the alkaline comet assay. To understand the reasons for these unexpected observations, various methods for detecting DNA strand breaks were applied to wild-type mES cells and to mES cells lacking H2AX, ATM, or DNA-PKcs. H2AX phosphorylation and expression of other repair complexes were measured using flow and image analysis of antibody-stained cells. Results indicate that high numbers of endogenous gammaH2AX foci and single-strand breaks in pluripotent mES cells do not require ATM or DNA-PK kinase activity and appear to be associated with global chromatin decondensation rather than pre-existing DNA damage. This will limit applications of gammaH2AX foci analysis in mES cells to relatively high levels of initial or residual DNA damage. Excessive numbers of single-strand breaks in the alkaline comet assay can be explained by the vulnerability of replicating chromatin in mES cells to osmotic shock. This suggests that caution is needed in interpreting results with the alkaline comet assay when applied to certain cell types or after treatment with agents that make chromatin vulnerable to osmotic changes. Differentiation of mES cells caused a reduction in histone acetylation, gammaH2AX foci intensity, and DNA single-strand breakage, providing a link between chromatin structural organization, excessive gammaH2AX foci, and sensitivity of replicating mES cell chromatin to osmotic shock.

  18. Alterations in the nuclear matrix protein mass correlate with heat-induced inhibition of DNA single-strand-break repair

    International Nuclear Information System (INIS)

    Warters, R.L.; Brizgys, L.M.; Lyons, B.W.


    The total protein mass co-isolating with the nuclear matrix or nucleoid from Chinese hamster ovary (CHO) cells was observed to increase in heated cells as a function of increasing exposure temperature between 43 0 C and 45 0 C or of exposure time at any temperature. The sedimentation distance of the CHO cell nucleoid in sucrose gradients increased with increasing exposure time at 45 0 C. Both these nuclear alterations correlated in a log-linear manner with heat-induced inhibition of DNA strand break repair. A two-fold threshold increase in nuclear matrix protein mass preceded any substantial inhibition of repair of DNA single-strand breaks. When preheated cells were incubated at 37 0 C the nuclear matrix protein mass and nucleoid sedimentation recovered with a half-time of about 5 h, while DNA single-strand-break repair recovered with a half-time of about 2 h. When preheated cells were placed at 41 0 C a further increase was observed in the nuclear matrix protein mass and the half-time of DNA strand break repair, while nucleoid sedimentation recovered toward control values. These results implicate alterations in the protein mass of the nuclear matrix in heat-induced inhibition of repair of DNA single-strand breaks. (author)

  19. Yield of single-strand breaks in the DNA of E. coli 10 msec after irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Fox, R A; Fielden, E M; Sapora, O [Institute of Cancer Research, Sutton (UK). Surrey Branch


    The rapid mixing of 0.3M alkali with a suspension of E.coli B/r 6 +- 3 and 144 +- 3 msec after irradiation with electrons (4.3 MeV, 0 to 50 krad) has been used to make a comparison of the yields of single strand breaks in the presence and absence of oxygen. No significant difference was observed between the numbers of single strand breaks appearing at 6 and 144 msec after irradiation. Assuming that mixing with alkali inactivates the cellular repair enzymes within several milliseconds, these results indicate that enzymic repair does not operate within this time scale. It seems probable that radiation chemical processes are responsible for the initial oxygen effect on single strand breaks.

  20. RPA-coated single-stranded DNA as a platform for post-translational modifications in the DNA damage response. (United States)

    Maréchal, Alexandre; Zou, Lee


    The Replication Protein A (RPA) complex is an essential regulator of eukaryotic DNA metabolism. RPA avidly binds to single-stranded DNA (ssDNA) through multiple oligonucleotide/oligosaccharide-binding folds and coordinates the recruitment and exchange of genome maintenance factors to regulate DNA replication, recombination and repair. The RPA-ssDNA platform also constitutes a key physiological signal which activates the master ATR kinase to protect and repair stalled or collapsed replication forks during replication stress. In recent years, the RPA complex has emerged as a key target and an important regulator of post-translational modifications in response to DNA damage, which is critical for its genome guardian functions. Phosphorylation and SUMOylation of the RPA complex, and more recently RPA-regulated ubiquitination, have all been shown to control specific aspects of DNA damage signaling and repair by modulating the interactions between RPA and its partners. Here, we review our current understanding of the critical functions of the RPA-ssDNA platform in the maintenance of genome stability and its regulation through an elaborate network of covalent modifications.

  1. Overproduction of single-stranded-DNA-binding protein specifically inhibits recombination of UV-irradiated bacteriophage DNA in Escherichia coli

    International Nuclear Information System (INIS)

    Moreau, P.L.


    Overproduction of single-stranded DNA (ssDNA)-binding protein (SSB) in uvr Escherichia coli mutants results in a wide range of altered phenotypes. (i) Cell survival after UV irradiation is decreased; (ii) expression of the recA-lexA regulon is slightly reduced after UV irradiation, whereas it is increased without irradiation; and (iii) recombination of UV-damaged lambda DNA is inhibited, whereas recombination of nonirradiated DNA is unaffected. These results are consistent with the idea that in UV-damaged bacteria, SSB is first required to allow the formation of short complexes of RecA protein and ssDNA that mediate cleavage of the LexA protein. However, in a second stage, SSB should be displaced from ssDNA to permit the production of longer RecA-ssDNA nucleoprotein filaments that are required for strand pairing and, hence, recombinational repair. Since bacteria overproducing SSB appear identical in physiological respects to recF mutant bacteria, it is suggested that the RecF protein (alone or with other proteins of the RecF pathway) may help RecA protein to release SSB from ssDNA

  2. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.


    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  3. Molecular Genetic Characterization of Mutagenesis Using a Highly Sensitive Single-Stranded DNA Reporter System in Budding Yeast. (United States)

    Chan, Kin


    Mutations are permanent alterations to the coding content of DNA. They are starting material for the Darwinian evolution of species by natural selection, which has yielded an amazing diversity of life on Earth. Mutations can also be the fundamental basis of serious human maladies, most notably cancers. In this chapter, I describe a highly sensitive reporter system for the molecular genetic analysis of mutagenesis, featuring controlled generation of long stretches of single-stranded DNA in budding yeast cells. This system is ~100- to ~1000-fold more susceptible to mutation than conventional double-stranded DNA reporters, and is well suited for generating large mutational datasets to investigate the properties of mutagens.

  4. Electroporation and microinjection successfully deliver single-stranded and duplex DNA into live cells as detected by FRET measurements.

    Directory of Open Access Journals (Sweden)

    Rosemary A Bamford

    Full Text Available Förster resonance energy transfer (FRET technology relies on the close proximity of two compatible fluorophores for energy transfer. Tagged (Cy3 and Cy5 complementary DNA strands forming a stable duplex and a doubly-tagged single strand were shown to demonstrate FRET outside of a cellular environment. FRET was also observed after transfecting these DNA strands into fixed and live cells using methods such as microinjection and electroporation, but not when using lipid based transfection reagents, unless in the presence of the endosomal acidification inhibitor bafilomycin. Avoiding the endocytosis pathway is essential for efficient delivery of intact DNA probes into cells.

  5. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.


    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  6. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing. (United States)

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon


    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  7. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  8. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.


    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  9. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB). (United States)

    van Loon, Barbara; Samson, Leona D


    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  10. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.


    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  11. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail:; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki


    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  12. Strand displacement by DNA polymerase III occurs through a tau-psi-chi link to single-stranded DNA-binding protein coating the lagging strand template. (United States)

    Yuan, Quan; McHenry, Charles S


    In addition to the well characterized processive replication reaction catalyzed by the DNA polymerase III holoenzyme on single-stranded DNA templates, the enzyme possesses an intrinsic strand displacement activity on flapped templates. The strand displacement activity is distinguished from the single-stranded DNA-templated reaction by a high dependence upon single-stranded DNA binding protein and an inability of gamma-complex to support the reaction in the absence of tau. However, if gamma-complex is present to load beta(2), a truncated tau protein containing only domains III-V will suffice. This truncated protein is sufficient to bind both the alpha subunit of DNA polymerase (Pol) III and chipsi. This is reminiscent of the minimal requirements for Pol III to replicate short single-stranded DNA-binding protein (SSB)-coated templates where tau is only required to serve as a scaffold to hold Pol III and chi in the same complex (Glover, B., and McHenry, C. (1998) J. Biol. Chem. 273, 23476-23484). We propose a model in which strand displacement by DNA polymerase III holoenzyme depends upon a Pol III-tau-psi-chi-SSB binding network, where SSB is bound to the displaced strand, stabilizing the Pol III-template interaction. The same interaction network is probably important for stabilizing the leading strand polymerase interactions with authentic replication forks. The specificity constant (k(cat)/K(m)) for the strand displacement reaction is approximately 300-fold less favorable than reactions on single-stranded templates and proceeds with a slower rate (150 nucleotides/s) and only moderate processivity (approximately 300 nucleotides). PriA, the initiator of replication restart on collapsed or misassembled replication forks, blocks the strand displacement reaction, even if added to an ongoing reaction.

  13. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris


    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA......-binding proteins have previously been found to be phosphorylated on tyrosine and arginine residues. While tyrosine phosphorylation was shown to enhance the DNA-binding properties of SsbA, arginine phosphorylation was not functionally characterized.Materials and methods: We used mass spectrometry analysis to detect...... phosphorylation of SsbA purified from B. subtilis cells. The detected phosphorylation site was assessed for its influence on DNA-binding in vitro, using electrophoretic mobility shift assays. The ability of B. subtilis serine/threonine kinases to phosphorylate SsbA was assessed using in vitro phosphorylation...

  14. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.


    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  15. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.


    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  16. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  17. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.


    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  18. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.


    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  19. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii. (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten


    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  20. Structural Basis of Mec1-Ddc2-RPA Assembly and Activation on Single-Stranded DNA at Sites of Damage. (United States)

    Deshpande, Ishan; Seeber, Andrew; Shimada, Kenji; Keusch, Jeremy J; Gut, Heinz; Gasser, Susan M


    Mec1-Ddc2 (ATR-ATRIP) is a key DNA-damage-sensing kinase that is recruited through the single-stranded (ss) DNA-binding replication protein A (RPA) to initiate the DNA damage checkpoint response. Activation of ATR-ATRIP in the absence of DNA damage is lethal. Therefore, it is important that damage-specific recruitment precedes kinase activation, which is achieved at least in part by Mec1-Ddc2 homodimerization. Here, we report a structural, biochemical, and functional characterization of the yeast Mec1-Ddc2-RPA assembly. High-resolution co-crystal structures of Ddc2-Rfa1 and Ddc2-Rfa1-t11 (K45E mutant) N termini and of the Ddc2 coiled-coil domain (CCD) provide insight into Mec1-Ddc2 homodimerization and damage-site targeting. Based on our structural and functional findings, we present a Mec1-Ddc2-RPA-ssDNA composite structural model. By way of validation, we show that RPA-dependent recruitment of Mec1-Ddc2 is crucial for maintaining its homodimeric state at ssDNA and that Ddc2's recruitment domain and CCD are important for Mec1-dependent survival of UV-light-induced DNA damage. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. DNA single-strand breaks during repair of uv damage in human fibroblasts and abnormalities of repair in xeroderma pigmentosum

    International Nuclear Information System (INIS)

    Fornace, A.J. Jr.; Kohn, K.W.; Kann, H.E. Jr.


    The method of DNA alkaline elution was applied to a study of the formation and resealing of DNA single-strand breaks after irradiation of human fibroblasts with ultraviolet light (UV). The general features of the results were consistent with current concepts of DNA excision repair, in that breaks appeared rapidly after uv, and resealed slowly in normal fibroblasts, whereas breaks did not appear in those cells of patients with xeroderma pigmentosum (XP) that are known to have defects in DNA repair synthesis. The appearance of breaks required a short post-uv incubation, consistent with the expected action of an endonuclease. Cells of the variant form of XP characterized by normal DNA repair synthesis exhibited normal production of breaks after uv, but were slower than normal cells in resealing these breaks. This difference was enhanced by caffeine. A model is proposed to relate this finding with a previously described defect in post-replication repair in these XP variant cells. DNA crosslinking appears to cause an underestimate in the measurement of DNA breakage after uv

  2. Thermodynamic characterization of binding Oxytricha nova single strand telomere DNA with the alpha protein N-terminal domain. (United States)

    Buczek, Pawel; Horvath, Martin P


    The Oxytricha nova telemere binding protein alpha subunit binds single strand DNA and participates in a nucleoprotein complex that protects the very ends of chromosomes. To understand how the N-terminal, DNA binding domain of alpha interacts with DNA we measured the stoichiometry, enthalpy (DeltaH), entropy (DeltaS), and dissociation constant (K(D-DNA)) for binding telomere DNA fragments at different temperatures and salt concentrations using native gel electrophoresis and isothermal titration calorimetry (ITC). About 85% of the total free energy of binding corresponded with non-electrostatic interactions for all DNAs. Telomere DNA fragments d(T(2)G(4)), d(T(4)G(4)), d(G(3)T(4)G(4)), and d(G(4)T(4)G(4)) each formed monovalent protein complexes. In the case of d(T(4)G(4)T(4)G(4)), which has two tandemly repeated d(TTTTTGGGG) telomere motifs, two binding sites were observed. The high-affinity "A site" has a dissociation constant, K(D-DNA(A)) = 13(+/-4) nM, while the low-affinity "B site" is characterized by K(D-DNA(B)) = 5600(+/-600) nM at 25 degrees C. Nucleotide substitution variants verified that the A site corresponds principally with the 3'-terminal portion of d(T(4)G(4)T(4)G(4)). The relative contributions of entropy (DeltaS) and enthalpy (DeltaH) for binding reactions were DNA length-dependent as was heat capacity (DeltaCp). These trends with respect to DNA length likely reflect structural transitions in the DNA molecule that are coupled with DNA-protein association. Results presented here are important for understanding early intermediates and subsequent stages in the assembly of the full telomere nucleoprotein complex and how binding events can prepare the telomere DNA for extension by telomerase, a critical event in telomere biology.

  3. Effect of nalidixic acid on repair of single-strand breaks in DNA induced by ionizing irradiation in Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Francia, I [Debreceni Orvostudomanyi Egyetem (Hungary); Okos, A; Hernadi, F J [Institute of Pharmacology, Debrecen (Hungary)


    The incidence of DNA single-strand breaks induced by /sup 60/Co irradiation and their repair in E.coli K12 (AB 1157) rec/sup +/ cells were studied by the alkaline sucrose gradient sedimentation method described by McGrath and Williams. For the quantitative analysis of sedimentation profiles we used the s 1/2 values described by Veatch and Okada. The s 1/2 value of non-irradiated controls was 22.4, and after 20 krads irradiation it was found to be 11.7. A postirradiation incubation at 37 /sup 0/C for 60 min increasedthe s 1/2 value from 11.7 to 22.1. Nalidixic acid at low concentration (20-50 did not block, but at 100 extensively inhibited the above repair process, exhibiting an s 1/2 value of 14.4.

  4. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD


    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  5. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA. (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee


    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  6. Analysis of the substrate recognition state of TDP-43 to single-stranded DNA using fluorescence correlation spectroscopy

    Directory of Open Access Journals (Sweden)

    Akira Kitamura


    Full Text Available Normal function and abnormal aggregation of transactivation response (TAR DNA/RNA-binding protein 43 kDa (TDP-43 are directly associated with the lethal genetic diseases: cystic fibrosis, amyotrophic lateral sclerosis (ALS, and frontotemporal lobar degeneration (FTLD. The binding of TDP-43 to single-stranded DNA (ssDNA or RNA is involved in transcriptional repression, regulation of RNA splicing, and RNA stabilization. Equilibrium dissociation constants (Kd of TDP-43 and ssDNA or RNA have been determined using various methods; however, methods that can measure Kd with high sensitivity in a short time using a small amount of TDP-43 in solution would be advantageous. Here, in order to determine the Kd of TDP-43 and fluorescence-labeled ssDNA as well as the binding stoichiometry, we use fluorescence correlation spectroscopy (FCS, which detects the slowed diffusion of molecular interactions in solution with single-molecule sensitivity, in addition to electrophoretic mobility shift assay (EMSA. Using tandem affinity chromatography of TDP-43 dually tagged with glutathione-S-transferase and poly-histidine tags, highly purified protein was obtained. FCS successfully detected specific interaction between purified TDP-43 and TG ssDNA repeats, with a Kd in the nanomolar range. The Kd of the TDP-43 mutant was not different from the wild type, although mutant oligomers, which did not bind ssDNA, were observed. Analysis of the fluorescence brightness per dimerized TDP-43/ssDNA complex was used to evaluate their binding stoichiometry. The results suggest that an assay combining FCS and EMSA can precisely analyze ssDNA recognition mechanisms, and that FCS may be applied for the rapid and quantitative determination of the interaction strength between TDP-43 and ssDNA or RNA. These methods will aid in the elucidation of the substrate recognition mechanism of ALS- and FTLD-associated variants of TDP-43.

  7. DNA polymerase I-mediated repair of 365 nm-induced single-strand breaks in the DNA of Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Ley, R D; Sedita, B A; Boye, E [Argonne National Lab., Ill. (USA)


    Irradiation of closed circular phage lambda DNA in vivo at 365 nm results in the induction of single-strand breaks and alkali-labile lesions at rates of 1.1 x 10/sup -14/ and 0.2 x 10/sup -14//dalton/J/m/sup 2/, respectively. The sum of the induction rates is similar to the rate of induction of single-strand breaks plus alkali-labile lesions (1 x 10/sup -14//dalton/J/m/sup 2/) observed in the E. coli genome. Postirradiation incubation of wild-type cells in buffer results in rapid repair of the breaks (up to 80% repaired in 10 min). No repair was observed in a DNA polymerase I-deficient mutant of E.coli.

  8. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.


    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  9. Single-strand DNA-binding protein SSB1 facilitates TERT recruitment to telomeres and maintains telomere G-overhangs. (United States)

    Pandita, Raj K; Chow, Tracy T; Udayakumar, Durga; Bain, Amanda L; Cubeddu, Liza; Hunt, Clayton R; Shi, Wei; Horikoshi, Nobuo; Zhao, Yong; Wright, Woodring E; Khanna, Kum Kum; Shay, Jerry W; Pandita, Tej K


    Proliferating mammalian stem and cancer cells express telomerase [telomerase reverse transcriptase (TERT)] in an effort to extend chromosomal G-overhangs and maintain telomere ends. Telomerase-expressing cells also have higher levels of the single-stranded DNA-binding protein SSB1, which has a critical role in DNA double-strand break (DSB) repair. Here, we report that SSB1 binds specifically to G-strand telomeric DNA in vitro and associates with telomeres in vivo. SSB1 interacts with the TERT catalytic subunit and regulates its interaction with telomeres. Deletion of SSB1 reduces TERT interaction with telomeres and leads to G-overhang loss. Although SSB1 is recruited to DSB sites, we found no corresponding change in TERT levels at these sites, implying that SSB1-TERT interaction relies upon a specific chromatin structure or context. Our findings offer an explanation for how telomerase is recruited to telomeres to facilitate G-strand DNA extension, a critical step in maintaining telomere ends and cell viability in all cancer cells. Cancer Res; 75(5); 858-69. ©2015 AACR. ©2015 American Association for Cancer Research.

  10. Single-strand DNA binding protein SSB1 facilitates TERT recruitment to telomeres and maintains telomere G-overhangs (United States)

    Pandita, Raj K.; Chow, Tracy T.; Udayakumar, Durga; Bain, Amanda L.; Cubeddu, Liza; Hunt, Clayton R.; Shi, Wei; Horikoshi, Nobuo; Zhao, Yong; Wright, Woodring E.; Khanna, Kum Kum; Shay, Jerry W.; Pandita, Tej K.


    Proliferating mammalian stem and cancer cells express telomerase (TERT) in an effort to extend chromosomal G-overhangs and maintain telomere ends. Telomerase-expressing cells also have higher levels of the single-stranded DNA binding protein SSB1, which has a critical role in DNA double-strand break repair. Here we report that SSB1 binds specifically to G-strand telomeric DNA in vitro and associates with telomeres in vivo. SSB1 interacted with the TERT catalytic subunit and regulates its interaction with telomeres. Deletion of SSB1 reduced TERT interaction with telomeres and lead to G-overhang loss. While SSB1 was recruited to DSB sites, we found no corresponding change in TERT levels at these sites, implying that SSB1-TERT interaction relied upon a specific chromatin structure or context. Our findings offer an explanation for how telomerase is recruited to telomeres to facilitate G-strand DNA extension, a critical step in maintaining telomere ends and cell viability in all cancer cells. PMID:25589350

  11. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)


    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  12. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude


    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  13. All-atom molecular dynamics simulations of spin labelled double and single-strand DNA for EPR studies. (United States)

    Prior, C; Danilāne, L; Oganesyan, V S


    We report the first application of fully atomistic molecular dynamics (MD) simulations to the prediction of electron paramagnetic resonance (EPR) spectra of spin labelled DNA. Models for two structurally different DNA spin probes with either the rigid or flexible position of the nitroxide group in the base pair, employed in experimental studies previously, have been developed. By the application of the combined MD-EPR simulation methodology we aimed at the following. Firstly, to provide a test bed against a sensitive spectroscopic technique for the recently developed improved version of the parmbsc1 force field for MD modelling of DNA. The predicted EPR spectra show good agreement with the experimental ones available from the literature, thus confirming the accuracy of the currently employed DNA force fields. Secondly, to provide a quantitative interpretation of the motional contributions into the dynamics of spin probes in both duplex and single-strand DNA fragments and to analyse their perturbing effects on the local DNA structure. Finally, a combination of MD and EPR allowed us to test the validity of the application of the Model-Free (M-F) approach coupled with the partial averaging of magnetic tensors to the simulation of EPR spectra of DNA systems by comparing the resultant EPR spectra with those simulated directly from MD trajectories. The advantage of the M-F based EPR simulation approach over the direct propagation techniques is that it requires motional and order parameters that can be calculated from shorter MD trajectories. The reported MD-EPR methodology is transferable to the prediction and interpretation of EPR spectra of higher order DNA structures with novel types of spin labels.

  14. Evidence of pervasive biologically functional secondary structures within the genomes of eukaryotic single-stranded DNA viruses. (United States)

    Muhire, Brejnev Muhizi; Golden, Michael; Murrell, Ben; Lefeuvre, Pierre; Lett, Jean-Michel; Gray, Alistair; Poon, Art Y F; Ngandu, Nobubelo Kwanele; Semegni, Yves; Tanov, Emil Pavlov; Monjane, Adérito Luis; Harkins, Gordon William; Varsani, Arvind; Shepherd, Dionne Natalie; Martin, Darren Patrick


    Single-stranded DNA (ssDNA) viruses have genomes that are potentially capable of forming complex secondary structures through Watson-Crick base pairing between their constituent nucleotides. A few of the structural elements formed by such base pairings are, in fact, known to have important functions during the replication of many ssDNA viruses. Unknown, however, are (i) whether numerous additional ssDNA virus genomic structural elements predicted to exist by computational DNA folding methods actually exist and (ii) whether those structures that do exist have any biological relevance. We therefore computationally inferred lists of the most evolutionarily conserved structures within a diverse selection of animal- and plant-infecting ssDNA viruses drawn from the families Circoviridae, Anelloviridae, Parvoviridae, Nanoviridae, and Geminiviridae and analyzed these for evidence of natural selection favoring the maintenance of these structures. While we find evidence that is consistent with purifying selection being stronger at nucleotide sites that are predicted to be base paired than at sites predicted to be unpaired, we also find strong associations between sites that are predicted to pair with one another and site pairs that are apparently coevolving in a complementary fashion. Collectively, these results indicate that natural selection actively preserves much of the pervasive secondary structure that is evident within eukaryote-infecting ssDNA virus genomes and, therefore, that much of this structure is biologically functional. Lastly, we provide examples of various highly conserved but completely uncharacterized structural elements that likely have important functions within some of the ssDNA virus genomes analyzed here.

  15. Rolling replication of UV-irradiated duplex DNA in the phi X174 replicative-form----single-strand replication system in vitro

    International Nuclear Information System (INIS)

    Shavitt, O.; Livneh, Z.


    Cloning of the phi X174 viral origin of replication into phage M13mp8 produced an M13-phi X174 chimera, the DNA of which directed efficient replicative-form----single-strand rolling replication in vitro. This replication assay was performed with purified phi X174-encoded gene A protein, Escherichia coli rep helicase, single-stranded DNA-binding protein, and DNA polymerase III holoenzyme. The nicking of replicative-form I (RFI) DNA by gene A protein was essentially unaffected by the presence of UV lesions in the DNA. However, unwinding of UV-irradiated DNA by the rep helicase was inhibited twofold as compared with unwinding of the unirradiated substrate. UV irradiation of the substrate DNA caused a strong inhibition in its ability to direct DNA synthesis. However, even DNA preparations that contained as many as 10 photodimers per molecule still supported the synthesis of progeny full-length single-stranded DNA. The appearance of full-length radiolabeled products implied at least two full rounds of replication, since the first round released the unlabeled plus viral strand of the duplex DNA. Pretreatment of the UV-irradiated DNA substrate with purified pyrimidine dimer endonuclease from Micrococcus luteus, which converted photodimer-containing supercoiled RFI DNA into relaxed, nicked RFII DNA and thus prevented its replication, reduced DNA synthesis by 70%. Analysis of radiolabeled replication products by agarose gel electrophoresis followed by autoradiography revealed that this decrease was due to a reduction in the synthesis of progeny full-length single-stranded DNA. This implies that 70 to 80% of the full-length DNA products produced in this system were synthesized on molecules that carried photodimers

  16. Replication of UV-irradiated single-stranded DNA by DNA polymerase III holoenzyme of Escherichia coli: evidence for bypass of pyrimidine photodimers

    International Nuclear Information System (INIS)

    Livneh, Z.


    Replication of UV-irradiated circular single-stranded phage M13 DNA by Escherichia coli RNA polymerase (EC and DNA polymerase III holoenzyme (EC in the presence of single-stranded DNA binding protein yielded full-length as well as partially replicated products. A similar result was obtained with phage G4 DNA primed with E. coli DNA primase, and phage phi X174 DNA primed with a synthetic oligonucleotide. The fraction of full-length DNA was several orders of magnitude higher than predicted if pyrimidine photodimers were to constitute absolute blocks to DNA replication. Recent models have suggested that pyrimidine photodimers are absolute blocks to DNA replication and that SOS-induced proteins are required to allow their bypass. Our results demonstrate that, under in vitro replication conditions, E. coli DNA polymerase III holoenzyme can insert nucleotides opposite pyrimidine dimers to a significant extent, even in the absence of SOS-induced proteins

  17. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo


    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  18. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.


    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  19. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.


    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  20. DFT investigations of phosphotriesters hydrolysis in aqueous solution: a model for DNA single strand scission induced by N-nitrosoureas. (United States)

    Liu, Tingting; Zhao, Lijiao; Zhong, Rugang


    DNA phosphotriester adducts are common alkylation products of DNA phosphodiester moiety induced by N-nitrosoureas. The 2-hydroxyethyl phosphotriester was reported to hydrolyze more rapidly than other alkyl phosphotriesters both in neutral and in alkaline conditions, which can cause DNA single strand scission. In this work, DFT calculations have been employed to map out the four lowest activation free-energy profiles for neutral and alkaline hydrolysis of triethyl phosphate (TEP) and diethyl 2-hydroxyethyl phosphate (DEHEP). All the hydrolysis pathways were illuminated to be stepwise involving an acyclic or cyclic phosphorane intermediate for TEP or DEHEP, respectively. The rate-limiting step for all the hydrolysis reactions was found to be the formation of phosphorane intermediate, with the exception of DEHEP hydrolysis in alkaline conditions that the decomposition process turned out to be the rate-limiting step, owing to the extraordinary low formation barrier of cyclic phosphorane intermediate catalyzed by hydroxide. The rate-limiting barriers obtained for the four reactions are all consistent with the available experimental information concerning the corresponding hydrolysis reactions of phosphotriesters. Our calculations performed on the phosphate triesters hydrolysis predict that the lower formation barriers of cyclic phosphorane intermediates compared to its acyclic counter-part should be the dominant factor governing the hydrolysis rate enhancement of DEHEP relative to TEP both in neutral and in alkaline conditions.

  1. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate. (United States)

    Zhang, Xueru; McGown, Linda B


    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Ultra-fast repair of single-strand breaks in DNA of. gamma. -irradiated Chinese hamster cells

    Energy Technology Data Exchange (ETDEWEB)

    Leontjeva, G A; Mantzighin, Yu A; Gaziev, A I [AN SSSR, Pushchino-na-Oke. Inst. Biologicheskoj Fiziki


    Studies of the effect of thermal treatment of Chinese hamster cells on sedimentation of DNA in the alkaline sucrose gradient showed that heating the cells to 68/sup 0/C for 15 min caused the same degradation as ..gamma..-irradiation with 5 to 7 krad at 37/sup 0/C. The inhibition of cellular repair enzymes by heating was therefore unacceptable. The process of ultra-fast repair is essentially determined by the DNA-ligase reaction, which is activated in the presence of Mg ions, and inhibited in mammalian cells in the presence of EDTA and pyrophosphate. Sedimentation profiles were therefore measured for the DNA of Chinese hamster cells ..gamma..-irradiated (5 krad) at 0/sup 0/C or 22/sup 0/C in the presence of Mg/sup + +/, or EDTA and pyrophosphate, and the results demonstrated ultra-fast repair only at 20 to 37/sup 0/C, in contrast to bacteria. A study was made of the temperature dependence of the activity of the DNA ligases isolated from E.coli and rabbit bone marrow. The NAD-dependent bacterial DNA ligase was active at temperatures from 0 to 40/sup 0/C, whereas ATP-dependent DNA ligase of mammals only showed activity in the range 15 to 40/sup 0/C. The differing temperature dependences of ultra-fast repair in bacterial and mammalian cells are in agreement with the temperature dependences of the activities of isolated enzymes, and the results suggest that the process of ultra-fast repair of single-strand breaks of DNA takes place in both bacterial and mammalian cells.

  3. Electrical signatures of single-stranded DNA with single base mutations in a nanopore capacitor

    International Nuclear Information System (INIS)

    Gracheva, Maria E; Aksimentiev, Aleksei; Leburton, Jean-Pierre


    In this paper, we evaluate the magnitude of the electrical signals produced by DNA translocation through a 1 nm diameter nanopore in a capacitor membrane with a numerical multi-scale approach, and assess the possibility of resolving individual nucleotides as well as their types in the absence of conformational disorder. We show that the maximum recorded voltage caused by the DNA translocation is about 35 mV, while the maximum voltage signal due to the DNA backbone is about 30 mV, and the maximum voltage of a DNA base is about 8 mV. Signals from individual nucleotides can be identified in the recorded voltage traces, suggesting a 1 nm diameter pore in a capacitor can be used to accurately count the number of nucleotides in a DNA strand. Furthermore, we study the effect of a single base substitution on the voltage trace, and calculate the differences among the voltage traces due to a single base mutation for the sequences C 3 AC 7 , C 3 CC 7 , C 3 GC 7 and C 3 TC 7 . The calculated voltage differences are in the 5-10 mV range. The calculated maximum voltage caused by the translocation of individual bases varies from 2 to 9 mV, which is experimentally detectable

  4. Expansion during PCR of short single-stranded DNA fragments carrying nonselfcomplementary dinucleotide or trinucleotide repeats

    Czech Academy of Sciences Publication Activity Database

    Reichová, Naďa; Kypr, Jaroslav


    Roč. 30, č. 3 (2003), s. 155-163 ISSN 0301-4851 R&D Projects: GA ČR GA301/01/0590 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA * PCR * expansion Subject RIV: BO - Biophysics Impact factor: 0.565, year: 2003

  5. Replication protein A (RPA) hampers the processive action of APOBEC3G cytosine deaminase on single-stranded DNA. (United States)

    Lada, Artem G; Waisertreiger, Irina S-R; Grabow, Corinn E; Prakash, Aishwarya; Borgstahl, Gloria E O; Rogozin, Igor B; Pavlov, Youri I


    Editing deaminases have a pivotal role in cellular physiology. A notable member of this superfamily, APOBEC3G (A3G), restricts retroviruses, and Activation Induced Deaminase (AID) generates antibody diversity by localized deamination of cytosines in DNA. Unconstrained deaminase activity can cause genome-wide mutagenesis and cancer. The mechanisms that protect the genomic DNA from the undesired action of deaminases are unknown. Using the in vitro deamination assays and expression of A3G in yeast, we show that replication protein A (RPA), the eukaryotic single-stranded DNA (ssDNA) binding protein, severely inhibits the deamination activity and processivity of A3G. We found that mutations induced by A3G in the yeast genomic reporter are changes of a single nucleotide. This is unexpected because of the known property of A3G to catalyze multiple deaminations upon one substrate encounter event in vitro. The addition of recombinant RPA to the oligonucleotide deamination assay severely inhibited A3G activity. Additionally, we reveal the inverse correlation between RPA concentration and the number of deaminations induced by A3G in vitro on long ssDNA regions. This resembles the "hit and run" single base substitution events observed in yeast. Our data suggest that RPA is a plausible antimutator factor limiting the activity and processivity of editing deaminases in the model yeast system. Because of the similar antagonism of yeast RPA and human RPA with A3G in vitro, we propose that RPA plays a role in the protection of the human genome cell from A3G and other deaminases when they are inadvertently diverged from their natural targets. We propose a model where RPA serves as one of the guardians of the genome that protects ssDNA from the destructive processive activity of deaminases by non-specific steric hindrance.

  6. Replication protein A (RPA hampers the processive action of APOBEC3G cytosine deaminase on single-stranded DNA.

    Directory of Open Access Journals (Sweden)

    Artem G Lada

    Full Text Available Editing deaminases have a pivotal role in cellular physiology. A notable member of this superfamily, APOBEC3G (A3G, restricts retroviruses, and Activation Induced Deaminase (AID generates antibody diversity by localized deamination of cytosines in DNA. Unconstrained deaminase activity can cause genome-wide mutagenesis and cancer. The mechanisms that protect the genomic DNA from the undesired action of deaminases are unknown. Using the in vitro deamination assays and expression of A3G in yeast, we show that replication protein A (RPA, the eukaryotic single-stranded DNA (ssDNA binding protein, severely inhibits the deamination activity and processivity of A3G.We found that mutations induced by A3G in the yeast genomic reporter are changes of a single nucleotide. This is unexpected because of the known property of A3G to catalyze multiple deaminations upon one substrate encounter event in vitro. The addition of recombinant RPA to the oligonucleotide deamination assay severely inhibited A3G activity. Additionally, we reveal the inverse correlation between RPA concentration and the number of deaminations induced by A3G in vitro on long ssDNA regions. This resembles the "hit and run" single base substitution events observed in yeast.Our data suggest that RPA is a plausible antimutator factor limiting the activity and processivity of editing deaminases in the model yeast system. Because of the similar antagonism of yeast RPA and human RPA with A3G in vitro, we propose that RPA plays a role in the protection of the human genome cell from A3G and other deaminases when they are inadvertently diverged from their natural targets. We propose a model where RPA serves as one of the guardians of the genome that protects ssDNA from the destructive processive activity of deaminases by non-specific steric hindrance.

  7. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.


    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  8. Theoretical Study of the Transpore Velocity Control of Single-Stranded DNA

    Directory of Open Access Journals (Sweden)

    Weixin Qian


    Full Text Available The electrokinetic transport dynamics of deoxyribonucleic acid (DNA molecules have recently attracted significant attention in various fields of research. Our group is interested in the detailed examination of the behavior of DNA when confined in micro/nanofluidic channels. In the present study, the translocation mechanism of a DNA-like polymer chain in a nanofluidic channel was investigated using Langevin dynamics simulations. A coarse-grained bead-spring model was developed to simulate the dynamics of a long polymer chain passing through a rectangular cross-section nanopore embedded in a nanochannel, under the influence of a nonuniform electric field. Varying the cross-sectional area of the nanopore was found to allow optimization of the translocation process through modification of the electric field in the flow channel, since a drastic drop in the electric potential at the nanopore was induced by changing the cross-section. Furthermore, the configuration of the polymer chain in the nanopore was observed to determine its translocation velocity. The competition between the strength of the electric field and confinement in the small pore produces various transport mechanisms and the results of this study thus represent a means of optimizing the design of nanofluidic devices for single molecule detection.

  9. Viral recombination blurs taxonomic lines: examination of single-stranded DNA viruses in a wastewater treatment plant

    Directory of Open Access Journals (Sweden)

    Victoria M. Pearson


    Full Text Available Understanding the structure and dynamics of microbial communities, especially those of economic concern, is of paramount importance to maintaining healthy and efficient microbial communities at agricultural sites and large industrial cultures, including bioprocessors. Wastewater treatment plants are large bioprocessors which receive water from multiple sources, becoming reservoirs for the collection of many viral families that infect a broad range of hosts. To examine this complex collection of viruses, full-length genomes of circular ssDNA viruses were isolated from a wastewater treatment facility using a combination of sucrose-gradient size selection and rolling-circle amplification and sequenced on an Illumina MiSeq. Single-stranded DNA viruses are among the least understood groups of microbial pathogens due to genomic biases and culturing difficulties, particularly compared to the larger, more often studied dsDNA viruses. However, the group contains several notable well-studied examples, including agricultural pathogens which infect both livestock and crops (Circoviridae and Geminiviridae, and model organisms for genetics and evolution studies (Microviridae. Examination of the collected viral DNA provided evidence for 83 unique genotypic groupings, which were genetically dissimilar to known viral types and exhibited broad diversity within the community. Furthermore, although these genomes express similarities to known viral families, such as Circoviridae, Geminiviridae, and Microviridae, many are so divergent that they may represent new taxonomic groups. This study demonstrated the efficacy of the protocol for separating bacteria and large viruses from the sought after ssDNA viruses and the ability to use this protocol to obtain an in-depth analysis of the diversity within this group.

  10. Radiation-induced base substitution mutagenesis in single-stranded DNA phage M13

    International Nuclear Information System (INIS)

    Brandenburger, A.; Godson, G.N.; Glickman, B.W.; Sluis, C.A. van


    To elucidate the relative contributions of targeted and untargeted mutations to γ and UV radiation mutagenesis, the DNA sequences of 174 M13 revertant phages isolated from stocks of irradiated or unirradiated amber mutants grown in irradiated (SOS-induced) or unirradiated (non-induced) host bacteria, have been determined. Differences in the spectra of base change mutations induced in the various conditions were apparent, but no obvious specificity of mutagenesis was detected. In particular, under the present conditions, pyrimidine dimers did not seem to be the principal sites of UV-induced base substitution mutagenesis, suggesting that such mutagenesis occurs at the sites of lesions other than pyrimidine dimers, or is untargeted. (U.K.)

  11. Ion Density Analysis of Single-Stranded DNA in Liquid Crystal (United States)

    Iwabata, Kazuki; Seki, Yasutaka; Toizumi, Ryota; Shimada, Yuki; Furue, Hirokazu; Sakaguchi, Kengo


    With the widespread use of liquid crystals (LCs) in liquid crystal displays, we have looked into the application of liquid crystals in biotechnology. The purpose of the study described here is to investigate the physical properties of DNA using LCs. Synthetic oligonucleotide molecules were dispersed in MLC6884, the sample injected into antiparallel cells, and the amount of mobile ions was measured. The LC cell doped with oligonucleotide molecules showed a sequence-dependent, specific correlation between oligonucleotide concentration and the amount of mobile ions in the LC cells. In the framework of the Stokes model and polyacrylamide gel electrophoresis (PAGE) analysis, we speculate that this result arises from the difference in ion mobility, which is caused by the shape of the oligonucleotide molecule in the LC.

  12. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines. (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao


    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  13. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.


    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  14. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.


    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  15. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy


    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried


    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  16. Induction of single-strand DNA breaks in human cells by H2O2 formed in near-uv (black light)-irradiated medium

    International Nuclear Information System (INIS)

    Wang, R.J.; Ananthaswamy, H.N.; Nixon, B.T.; Hartman, P.S.; Eisenstark, A.


    When Dulbecco's modified Eagle's medium (depleted of phenol red) was irradiated for up to 3 h by 4 to 5 W/m 2 black light, hydrogen peroxide (H 2 O 2 ) was produced. Generation of H 2 O 2 resulted from riboflavin-sensitized photooxidation of tryptophan and tyrosine. Reagent H 2 O 2 , or hydrogen peroxide generated in black light-exposed aqueous solutions containing riboflavin and tryptophan, induced 2 x 10 4 single-strand breaks per 10 16 daltons of DNA in intact, physiologically viable human D98/AH 2 cells. Concomitant with the single-strand breaks in the cells was loss of cellular reproductive viability. Two classes of photoproducts were identified: H 2 O 2 and non-H 2 O 2 . The H 2 O 2 component of the photoproducts was responsible for all the single-strand break induction but for only partial loss of reproductive viability. The non-H 2 O 2 photoproducts, accountable for the remainder of cell lethality, caused no single-strand breaks

  17. Yield of single-strand breaks in the DNA of E.coli 10 msec after irradiation

    International Nuclear Information System (INIS)

    Fox, R.A.; Fielden, E.M.; Sapora, O.


    The rapid mixing of 0.3M alkali with a suspension of E.coli B/r 6 +- 3 and 144 +- 3 msec after irradiation with electrons (4.3 MeV, 0 to 50 krad) has been used to make a comparison of the yields of single strand breaks in the presence and absence of oxygen. No significant difference was observed between the numbers of single strand breaks appearing at 6 and 144 msec after irradiation. Assuming that mixing with alkali inactivates the cellular repair enzymes within several milliseconds, these results indicate that enzymic repair does not operate within this time scale. It seems probable that radiation chemical processes are responsible for the initial oxygen effect on single strand breaks. (U.K.)

  18. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.


    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  19. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.


    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  20. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.


    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  1. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr


    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single-stranded DNA-binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  2. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak


    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  3. SALP, a new single-stranded DNA library preparation method especially useful for the high-throughput characterization of chromatin openness states. (United States)

    Wu, Jian; Dai, Wei; Wu, Lin; Wang, Jinke


    Next-generation sequencing (NGS) is fundamental to the current biological and biomedical research. Construction of sequencing library is a key step of NGS. Therefore, various library construction methods have been explored. However, the current methods are still limited by some shortcomings. This study developed a new NGS library construction method, Single strand Adaptor Library Preparation (SALP), by using a novel single strand adaptor (SSA). SSA is a double-stranded oligonucleotide with a 3' overhang of 3 random nucleotides, which can be efficiently ligated to the 3' end of single strand DNA by T4 DNA ligase. SALP can be started with any denatured DNA fragments such as those sheared by Tn5 tagmentation, enzyme digestion and sonication. When started with Tn5-tagmented chromatin, SALP can overcome a key limitation of ATAC-seq and become a high-throughput NGS library construction method, SALP-seq, which can be used to comparatively characterize the chromatin openness state of multiple cells unbiasly. In this way, this study successfully characterized the comparative chromatin openness states of four different cell lines, including GM12878, HepG2, HeLa and 293T, with SALP-seq. Similarly, this study also successfully characterized the chromatin openness states of HepG2 cells with SALP-seq by using 10 5 to 500 cells. This study developed a new NGS library construction method, SALP, by using a novel kind of single strand adaptor (SSA), which should has wide applications in the future due to its unique performance.

  4. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)


    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  5. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H


    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  6. Construction of a microfluidic chip, using dried-down reagents, for LATE-PCR amplification and detection of single-stranded DNA. (United States)

    Jia, Yanwei; Mak, Pui-In; Massey, Conner; Martins, Rui P; Wangh, Lawrence J


    LATE-PCR is an advanced form of non-symmetric PCR that efficiently generates single-stranded DNA which can readily be characterized at the end of amplification by hybridization to low-temperature fluorescent probes. We demonstrate here for the first time that monoplex and duplex LATE-PCR amplification and probe target hybridization can be carried out in double layered PDMS microfluidics chips containing dried reagents. Addition of a set of reagents during dry down overcomes the common problem of single-stranded oligonucleotide binding to PDMS. These proof-of-principle results open the way to construction of inexpensive point-of-care devices that take full advantage of the analytical power of assays built using LATE-PCR and low-temperature probes.

  7. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.


    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  8. [Expression and purification of a novel thermophilic bacterial single-stranded DNA-binding protein and enhancement the synthesis of DNA and cDNA]. (United States)

    Jia, Xiao-Wei; Zhang, Guo-Hui; Shi, Hai-Yan


    Express a novel species of single-stranded DNA-binding protein (SSB) derived from Thermococcus kodakarensis KOD1, abbreviated kod-ssb. And evaluate the effect of kod-ssb on PCR-based DNA amplification and reverse transcription. We express kod-ssb with the Transrtta (DE3), and kod-ssb was purified by affinity chromatography on a Ni2+ Sepharose column, detected by SDS-PAGE. To evaluate the effect of kod-ssb on PCR-based DNA amplification, the human beta globin gene was used as template to amplify a 5-kb, 9-kb and 13-kb. And to detect the effect of kod-ssb on reverse transcription, we used RNA from flu cell culture supernatant extraction as templates to implement qRT-PCR reaction. The plasmid pET11a-kod was transformed into Transetta (DE3) and the recombinant strain Transetta (pET11 a-kod) was obtained. The kod-ssb was highly expressed when the recombinant strain Transetta(pET11a-kod) was induced by IPTG. The specific protein was detected by SDS-PAGE. To confirm that kod-ssb can enhance target DNA synthesis and reduce PCR by-products, 5-, 9-, and 13-kb human beta globin gene fragments were used as templates for PCR. When PCR reactions did not include SSB proteins, the specific PCR product was contaminated with non-specific products. When kod -ssb was added, kod-ssb significantly enhanced amplification of the 5-, 9-and 13-kb target product and minimised the non-specific PCR products. To confirm that kod-ssb can enhance target cDNA synthesis, RNA from flu cell culture supernatant extraction was used as templates for qRT-PCR reaction. The results was that when kod-ssb was added, kod-ssb significantly enhanced the synthesis of cDNA, average Ct value is 19.42, and the average Ct value without kod-ssb is 22.15. kod-ssb may in future be used to enhance DNA and cDNA amplification.

  9. Histone H3.3 promotes IgV gene diversification by?enhancing formation of AID?accessible single?stranded DNA


    Romanello, Marina; Schiavone, Davide; Frey, Alexander; Sale, Julian E


    Abstract Immunoglobulin diversification is driven by activation?induced deaminase (AID), which converts cytidine to uracil within the Ig variable (IgV) regions. Central to the recruitment of AID to the IgV genes are factors that regulate the generation of single?stranded DNA (ssDNA), the enzymatic substrate of AID. Here, we report that chicken DT40 cells lacking variant histone H3.3 exhibit reduced IgV sequence diversification. We show that this results from impairment of the ability of AID t...

  10. Reduction of spontaneous somatic mutation frequency by a low-dose X irradiation of Drosophila larvae and possible involvement of DNA single-strand damage repair. (United States)

    Koana, Takao; Takahashi, Takashi; Tsujimura, Hidenobu


    The third instar larvae of Drosophila were irradiated with X rays, and the somatic mutation frequency in their wings was measured after their eclosion. In the flies with normal DNA repair and apoptosis functions, 0.2 Gy irradiation at 0.05 Gy/min reduced the frequency of the so-called small spot (mutant cell clone with reduced reproductive activity) compared with that in the sham-irradiated flies. When apoptosis was suppressed using the baculovirus p35 gene, the small spot frequency increased four times in the sham-irradiated control group, but the reduction by the 0.2-Gy irradiation was still evident. In a non-homologous end joining-deficient mutant, the small spot frequency was also reduced by 0.2 Gy radiation. In a mutant deficient in single-strand break repair, no reduction in the small spot frequency by 0.2 Gy radiation was observed, and the small spot frequency increased with the radiation dose. Large spot (mutant cell clone with normal reproductive activity) frequency was not affected by suppression of apoptosis and increased monotonically with radiation dose in wild-type larvae and in mutants for single- or double-strand break repair. It is hypothesized that some of the small spots resulted from single-strand damage and, in wild-type larvae, 0.2 Gy radiation activated the normal single-strand break repair gene, which reduced the background somatic mutation frequency.

  11. Direct Binding to Replication Protein A (RPA)-coated Single-stranded DNA Allows Recruitment of the ATR Activator TopBP1 to Sites of DNA Damage* (United States)

    Acevedo, Julyana; Yan, Shan; Michael, W. Matthew


    A critical event for the ability of cells to tolerate DNA damage and replication stress is activation of the ATR kinase. ATR activation is dependent on the BRCT (BRCA1 C terminus) repeat-containing protein TopBP1. Previous work has shown that recruitment of TopBP1 to sites of DNA damage and stalled replication forks is necessary for downstream events in ATR activation; however, the mechanism for this recruitment was not known. Here, we use protein binding assays and functional studies in Xenopus egg extracts to show that TopBP1 makes a direct interaction, via its BRCT2 domain, with RPA-coated single-stranded DNA. We identify a point mutant that abrogates this interaction and show that this mutant fails to accumulate at sites of DNA damage and that the mutant cannot activate ATR. These data thus supply a mechanism for how the critical ATR activator, TopBP1, senses DNA damage and stalled replication forks to initiate assembly of checkpoint signaling complexes. PMID:27129245

  12. Histone H3.3 promotes IgV gene diversification by enhancing formation of AID-accessible single-stranded DNA. (United States)

    Romanello, Marina; Schiavone, Davide; Frey, Alexander; Sale, Julian E


    Immunoglobulin diversification is driven by activation-induced deaminase (AID), which converts cytidine to uracil within the Ig variable (IgV) regions. Central to the recruitment of AID to the IgV genes are factors that regulate the generation of single-stranded DNA (ssDNA), the enzymatic substrate of AID Here, we report that chicken DT40 cells lacking variant histone H3.3 exhibit reduced IgV sequence diversification. We show that this results from impairment of the ability of AID to access the IgV genes due to reduced formation of ssDNA during IgV transcription. Loss of H3.3 also diminishes IgV R-loop formation. However, reducing IgV R-loops by RNase HI overexpression in wild-type cells does not affect IgV diversification, showing that these structures are not necessary intermediates for AID access. Importantly, the reduction in the formation of AID-accessible ssDNA in cells lacking H3.3 is independent of any effect on the level of transcription or the kinetics of RNAPII elongation, suggesting the presence of H3.3 in the nucleosomes of the IgV genes increases the chances of the IgV DNA becoming single-stranded, thereby creating an effective AID substrate. © 2016 MRC Laboratory of Molecular Biology. Published under the terms of the CC BY 4.0 license.

  13. On-site detection of Phytophthora spp.—single-stranded target DNA as the limiting factor to improve on-chip hybridization

    International Nuclear Information System (INIS)

    Schwenkbier, Lydia; Pollok, Sibyll; Popp, Jürgen; Weber, Karina; König, Stephan; Wagner, Stefan; Werres, Sabine; Weber, Jörg; Hentschel, Martin


    We report on a lab-on-a-chip approach for on-site detection of Phytophthora species that allows visual signal readout. The results demonstrate the significance of single-stranded DNA (ssDNA) generation in terms of improving the intensity of the hybridization signal and to improve the reliability of the method. Conventional PCR with subsequent heat denaturation, sodium hydroxide-based denaturation, lambda exonuclease digestion and two asymmetric PCR methods were investigated for the species P. fragariae, P. kernoviae, and P. ramorum. The positioning of the capture probe within the amplified yeast GTP-binding protein (YPT1) target DNA was also of interest because it significantly influences the intensity of the signal. Statistical tests were used to validate the impact of the ssDNA generation methods and the capture-target probe position. The single-stranded target DNA generated by Linear-After-The-Exponential PCR (LATE-PCR) was found to produce signal intensities comparable to post-PCR exonuclease treatment. The LATE-PCR is the best method for the on-site detection of Phytophthora because the enzymatic digestion after PCR is more laborious and time-consuming. (author)

  14. Calibration of denaturing agarose gels for molecular weight estimation of DNA: size determination of the single-stranded genomes of parvoviruses

    Energy Technology Data Exchange (ETDEWEB)

    Snyder, C.E. (Oak Ridge National Lab., TN); Schmoyer, R.L.; Bates, R.C.; Mitra, S.


    Vertical slab gel electrophoresis of DNA with CH/sub 3/HgOH-containing agarose produces sharp bands whose mobilities are suitable for size estimation of single-stranded DNA containing 600 to 20,000 bases. The relationship of electrophoretic mobility to size of DNA over this range is a smooth, S-shaped function, and an empirical model was developed to express the relationship. The model involves terms in squared and reciprocal mobilities, and produced excellent fit of known standard markers to measured mobilities. It was used to estimate the sizes of six parvovirus DNAs: Kilham rat virus (KRV), H-1, LuIII, and minute virus of mice (MVM) DNAs had molecular weights of 1.66 to 1.70 x 10/sup 6/, while the molecular weight of bovine parvovirus (BPV) DNA was 1.84 x 10/sup 6/ and that of adenoassociated virus (AAV) DNA was 1.52 x 10/sup 6/.

  15. Cytogenetic Markers, DNA Single-Strand Breaks, Urinary Metabolites, and DNA Repair Rates in Styrene-Exposed Lamination Workers

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Tuimala, J.; Štětina, R.; Kumar, R.; Manini, P.; Naccarati, Alessio; Maestri, L.; Vodičková, L.; Kuricová, Miroslava; Jarventaus, H.; Majvalková, Z.; Hirvonen, A.; Imbriani, M.; Mutti, A.; Norppa, H.; Hemminki, K.


    Roč. 112, č. 8 (2004), s. 867-871 ISSN 0091-6765 R&D Projects: GA ČR GA310/03/0437; GA ČR GA310/01/0802 Institutional research plan: CEZ:AV0Z5039906 Keywords : DNA repair rates * genotoxicity Subject RIV: FM - Hygiene Impact factor: 3.929, year: 2004

  16. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  17. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  18. Single-strand conformation polymorphism (SSCP)-based mutation scanning approaches to fingerprint sequence variation in ribosomal DNA of ascaridoid nematodes. (United States)

    Zhu, X Q; Gasser, R B


    In this study, we assessed single-strand conformation polymorphism (SSCP)-based approaches for their capacity to fingerprint sequence variation in ribosomal DNA (rDNA) of ascaridoid nematodes of veterinary and/or human health significance. The second internal transcribed spacer region (ITS-2) of rDNA was utilised as the target region because it is known to provide species-specific markers for this group of parasites. ITS-2 was amplified by PCR from genomic DNA derived from individual parasites and subjected to analysis. Direct SSCP analysis of amplicons from seven taxa (Toxocara vitulorum, Toxocara cati, Toxocara canis, Toxascaris leonina, Baylisascaris procyonis, Ascaris suum and Parascaris equorum) showed that the single-strand (ss) ITS-2 patterns produced allowed their unequivocal identification to species. While no variation in SSCP patterns was detected in the ITS-2 within four species for which multiple samples were available, the method allowed the direct display of four distinct sequence types of ITS-2 among individual worms of T. cati. Comparison of SSCP/sequencing with the methods of dideoxy fingerprinting (ddF) and restriction endonuclease fingerprinting (REF) revealed that also ddF allowed the definition of the four sequence types, whereas REF displayed three of four. The findings indicate the usefulness of the SSCP-based approaches for the identification of ascaridoid nematodes to species, the direct display of sequence variation in rDNA and the detection of population variation. The ability to fingerprint microheterogeneity in ITS-2 rDNA using such approaches also has implications for studying fundamental aspects relating to mutational change in rDNA.

  19. Effect of vitamin E on cytotoxicity, DNA single strand breaks, chromosomal aberrations, and mutation in Chinese hamster V-79 cells exposed to ultraviolet-B light

    International Nuclear Information System (INIS)

    Sugiyama, M.; Tsuzuki, K.; Matsumoto, K.; Ogura, R.


    The effect of pretreatment with vitamin E on cytotoxicity, DNA single strand breaks, and chromosomal aberrations as well as on mutation induced by ultraviolet-B light (UV-B) was investigated in Chinese hamster V-79 cells. Cellular pretreatment with non-toxic levels of 25 μM α-tocopherol succinate (vitamin E) for 24h prior to exposure resulted in a 10-fold increase in cellular levels of α-tocopherol. Using a colony-forming assay, this pretreatment decreased the cytotoxicity of UV-B light. However, alkaline elution assays demonstrated that pretreatment with vitamin E did not affect the number of DNA single strand breaks caused by UV-B light. UV-B exposure produced a dose-dependent induction of chromosomal aberrations and mutations at the HGPRT locus, and neither of these actions of UV-B was influenced by pretreatment with the vitamin. These results suggest that vitamin E protects cells from UV-B-induced cytotoxicity, possibly through its ability to scavenge free radicals. The genotoxicity induced by UV-B light may not correlate directly with the cytotoxic action of this wavelength region in sunlight. (author)

  20. Molecular mechanisms of induced mutagenesis. Replication in vivo of bacteriophage phiX174 single-stranded, ultraviolet light-irradiated DNA in intact and irradiated host cells

    Energy Technology Data Exchange (ETDEWEB)

    Caillet-Fauquet, P; Defais, M; Radman, M [Brussels Univ. (Belgium)


    Genetic analysis has revealed that radiation and many chemical mutagens induce in bacteria an error-prone DNA repair process which is responsible for their mutagenic effect. The biochemical mechanism of this inducible error-prone repair has been studied by analysis of the first round of DNA synthesis on ultraviolet light-irradiated phiX174 DNA in both intact and ultraviolet light-irradiated host cells. Intracellular phiX174 DNA was extracted, subjected to isopycnic CsCl density-gradient analysis, hydroxylapatite chromatography and digestion by single-strand-specific endonuclease S/sub 1/. Ultraviolet light-induced photolesions in viral DNA cause a permanent blockage of DNA synthesis in intact Escherichia coli cells. However, when host cells were irradiated and incubated to induce fully the error-prone repair system, a significant fraction of irradiated phiX174 DNA molecules can be fully replicated. Thus, inducible error-prone repair in E.coli is manifested by an increased capacity for DNA synthesis on damaged phiX174 DNA. Chloramphenicol (100 g/ml), which is an inhibitor of the inducible error-prone DNA repair, is also an inhibitor of this particular inducible DNA synthesis.

  1. Localization of specific sequences and DNA single-strand breaks in individual UV-A-irradiated human lymphocytes by COMET FISH (United States)

    Bock, Claudia; Rapp, Alexander; Dittmar, Heike; Monajembashi, Shamci; Greulich, Karl-Otto


    The COMET assay, a single cell electrophoresis technique which allows to separate electrophoretically fractionated DNA according to size has been combined with fluorescence in situ hybridization (FISH) which allows to localize specific genes or gene regions. This combination (COMET FISH) allows the detection of DNA single strand breaks in specific regions of the genome of human lymphocytes at the single cell level. Various types of DNA probes, e.g. centromere-, (alpha) - satellite-, telomere-, whole chromosome-, single copy- and region specific DNA probes have been used to investigate whether the UV-A induced DNA single strand breaks are distributed randomly all over the human genome or induced at specific sites ('hot spots'). In the investigated human peripheral blood lymphocytes all but one centromere reveal low sensitivity for UV-A irradiation (500 kJ/m2), while telomeres are randomly distributed over COMET heads and tails. The human chromosome 1 is fractionated by irradiation, but remains in the COMET head, indicating an only moderate degree of fractionation. Among three tested single copy probes, c- myc, p53 and p58, the p53 gene located on chromosome 17p13.1 and the p58 gene (1p36) appear to be located in UV-A stable regions of the human genome in 95% of 65 investigated lymphocytes. In contrast, the c-myc proto-oncogene (8q24) is found in the COMET tail in 90% of the 27 investigated lymphocytes and thus appears to be more sensitive to UV-A irradiation.

  2. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha; Hamdan, Samir; Richardson, Charles C.


    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha


    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)


    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  5. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven


    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  6. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system. (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus


    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  7. Chemical shift changes provide evidence for overlapping single-stranded DNA and XPA binding sites on the 70 kDa subunit of human replication protein A

    Energy Technology Data Exchange (ETDEWEB)

    Daughdrill, Gary W.; Buchko, Garry W.; Botuyan, Maria V.; Arrowsmith, Cheryl H.; Wold, Marc S.; Kennedy, Michael A.; Lowry, David F.


    Replication protein A (RPA) is a heterotrimeric single-stranded DNA (ssDNA) binding protein that can form a complex with the xeroderma pigmentosum group A protein (XPA). This complex can preferentially recognize UV damaged DNA over undamaged DNA and has been implicated in the stabilization of open complex formation during nucleotide excision repair. In this report, NMR spectroscopy was used to investigate the interaction between a fragment of the 70 kDa subunit of human RPA, residues 1-326 (hRPA701-326), and a fragment of the human XPA protein, residues 98-219 (XPA-MBD). Intensity changes were observed for amide resonances in the 1H-15N correlation spectrum of uniformly 15N-labeled hRPA701-326 after the addition of unlabeled XPA-MBD. The intensity changes observed were restricted to an ssDNA binding domain that is between residues 183 and 296 of the hRPA701-326 fragment. The hRPA701-326 residues with the largest resonance intensity reductions were mapped onto the structure of the ssDNA binding domain to identify the binding surface with XPA-MBD. The XPA-MBD binding surface showed significant overlap with an ssDNA binding surface that was previously identified using NMR spectroscopy and X-ray crystallography.

  8. Effects of DNA double-strand and single-strand breaks on intrachromosomal recombination events in cell-cycle-arrested yeast cells

    International Nuclear Information System (INIS)

    Galli, A.; Schiestl, R.H.


    Intrachromosomal recombination between repeated elements can result in deletion (DEL recombination) events. We investigated the inducibility of such intrachromosomal recombination events at different stages of the cell cycle and the nature of the primary DNA lesions capable of initiating these events. Two genetic systems were constructed in Saccharomyces cerevisiae that select for DEL recombination events between duplicated alleles of CDC28 and TUB2. We determined effects of double-strand breaks (DSBs) and single-strand breaks (SSBs) between the duplicated alleles on DEL recombination when induced in dividing cells or cells arrested in G1 or G2. Site-specific DSBs and SSBs were produced by overexpression of the I-Sce I endonuclease and the gene II protein (gIIp), respectively. I-Sce I-induced DSBs caused an increase in DEL recombination frequencies in both dividing and cell-cycle-arrested cells, indicating that G1- and G2-arrested cells are capable of completing DSB repair. In contrast, gIIp-induced SSBs caused an increase in DEL recombination frequency only in dividing cells. To further examine these phenomena we used both γ-irradiation, inducing DSBs as its most relevant lesion, and UV, inducing other forms of DNA damage. UV irradiation did not increase DEL recombination frequencies in G1 or G2, whereas γ-rays increased DEL recombination frequencies in both phases. Both forms of radiation, however, induced DEL recombination in dividing cells. The results suggest that DSBsbut not SSBs induce DEL recombination, probably via the single-strand annealing pathway. Further, DSBs in dividing cells may result from the replication of a UV or SSB-damaged template. Alternatively, UV induced events may occur by replication slippage after DNA polymerase pausing in front of the damage. (author)

  9. Yeast Srs2 Helicase Promotes Redistribution of Single-Stranded DNA-Bound RPA and Rad52 in Homologous Recombination Regulation

    Directory of Open Access Journals (Sweden)

    Luisina De Tullio


    Full Text Available Srs2 is a super-family 1 helicase that promotes genome stability by dismantling toxic DNA recombination intermediates. However, the mechanisms by which Srs2 remodels or resolves recombination intermediates remain poorly understood. Here, single-molecule imaging is used to visualize Srs2 in real time as it acts on single-stranded DNA (ssDNA bound by protein factors that function in recombination. We demonstrate that Srs2 is highly processive and translocates rapidly (∼170 nt per second in the 3′→5′ direction along ssDNA saturated with replication protein A (RPA. We show that RPA is evicted from DNA during the passage of Srs2. Remarkably, Srs2 also readily removes the recombination mediator Rad52 from RPA-ssDNA and, in doing so, promotes rapid redistribution of both Rad52 and RPA. These findings have important mechanistic implications for understanding how Srs2 and related nucleic acid motor proteins resolve potentially pathogenic nucleoprotein intermediates.

  10. Yeast Srs2 Helicase Promotes Redistribution of Single-Stranded DNA-Bound RPA and Rad52 in Homologous Recombination Regulation. (United States)

    De Tullio, Luisina; Kaniecki, Kyle; Kwon, Youngho; Crickard, J Brooks; Sung, Patrick; Greene, Eric C


    Srs2 is a super-family 1 helicase that promotes genome stability by dismantling toxic DNA recombination intermediates. However, the mechanisms by which Srs2 remodels or resolves recombination intermediates remain poorly understood. Here, single-molecule imaging is used to visualize Srs2 in real time as it acts on single-stranded DNA (ssDNA) bound by protein factors that function in recombination. We demonstrate that Srs2 is highly processive and translocates rapidly (∼170 nt per second) in the 3'→5' direction along ssDNA saturated with replication protein A (RPA). We show that RPA is evicted from DNA during the passage of Srs2. Remarkably, Srs2 also readily removes the recombination mediator Rad52 from RPA-ssDNA and, in doing so, promotes rapid redistribution of both Rad52 and RPA. These findings have important mechanistic implications for understanding how Srs2 and related nucleic acid motor proteins resolve potentially pathogenic nucleoprotein intermediates. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  11. Replication stress-induced chromosome breakage is correlated with replication fork progression and is preceded by single-stranded DNA formation. (United States)

    Feng, Wenyi; Di Rienzi, Sara C; Raghuraman, M K; Brewer, Bonita J


    Chromosome breakage as a result of replication stress has been hypothesized to be the direct consequence of defective replication fork progression, or "collapsed" replication forks. However, direct and genome-wide evidence that collapsed replication forks give rise to chromosome breakage is still lacking. Previously we showed that a yeast replication checkpoint mutant mec1-1, after transient exposure to replication impediment imposed by hydroxyurea (HU), failed to complete DNA replication, accumulated single-stranded DNA (ssDNA) at the replication forks, and fragmented its chromosomes. In this study, by following replication fork progression genome-wide via ssDNA detection and by direct mapping of chromosome breakage after HU exposure, we have tested the hypothesis that the chromosome breakage in mec1 cells occurs at collapsed replication forks. We demonstrate that sites of chromosome breakage indeed correlate with replication fork locations. Moreover, ssDNA can be detected prior to chromosome breakage, suggesting that ssDNA accumulation is the common precursor to double strand breaks at collapsed replication forks.

  12. The influence of inhibitors on dimer removal and repair of single-strand breaks in normal and bromodeoxyuridine substituted DNA of HeLa cells

    International Nuclear Information System (INIS)

    Cornelis, J.J.


    The elimination of cyclobutane pyrimidine dimers from the nuclear DNA of ultraviolet irradiated HeLa cells has been examined by means of chromatography and immunoautoradiography. The extent and duration of the process was similar when dimers were assayed by both methods, proving that the antisera recognized pyrimidine dimers. The rate of dimer excision did not differ through the cell cycle with the exception of mitosis during which no dimers were removed. Dimer excision is a relatively fast process which is terminated within a few hours, but it leaves many dimers in the DNA. Excision is depressed by inhibitors of semiconservative DNA synthesis that affect the DNA precursor pool or DNA polymerases. Cells whose DNA is partly substituted with bromodeoxyuridine instead of thymidine, repair single-strand breaks and remove dimers at the same rate but to different extents. On the other hand, inhibitors limit repair of breaks and removal of dimers to the same degree suggesting that the repair of the two types of lesion is coordinated. (Auth.)

  13. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB)


    van Loon, Barbara; Samson, Leona D.


    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known...

  14. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.


    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  15. C-terminal phenylalanine of bacteriophage T7 single-stranded DNA-binding protein is essential for strand displacement synthesis by T7 DNA polymerase at a nick in DNA. (United States)

    Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C


    Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5'-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations.

  16. C-terminal Phenylalanine of Bacteriophage T7 Single-stranded DNA-binding Protein Is Essential for Strand Displacement Synthesis by T7 DNA Polymerase at a Nick in DNA* (United States)

    Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C.


    Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5′-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations. PMID:19726688

  17. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Boye, E.; Johansen, I.; Brustad, T.


    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 2 0 C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 2 0 C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  18. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA. (United States)

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S


    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Potentiometric sensing of nuclease activities and oxidative damage of single-stranded DNA using a polycation-sensitive membrane electrode. (United States)

    Ding, Jiawang; Qin, Wei


    A simple, general and label-free potentiometric method to measure nuclease activities and oxidative DNA damage in a homogeneous solution using a polycation-sensitive membrane electrode is reported. Protamine, a linear polyionic species, is used as an indicator to report the cleavage of DNA by nucleases such as restriction and nonspecific nucleases, and the damage of DNA induced by hydroxyl radicals. Measurements can be done with a titration mode or a direct detection mode. For the potentiometric titration mode, the enzymatic cleavage dramatically affects the electrostatical interaction between DNA and protamine and thus shifts the response curve for the potentiometric titration of the DNA with protamine. Under the optimized conditions, the enzyme activities can be sensed potentiometrically with detection limits of 2.7×10(-4)U/µL for S1 nuclease, and of 3.9×10(-4)U/µL for DNase I. For the direct detection mode, a biocomplex between protamine and DNA is used as a substrate. The nuclease of interest cleaves the DNA from the protamine/DNA complex into smaller fragments, so that free protamine is generated and can be detected potentiometrically via the polycation-sensitive membrane electrode. Using a direct measurement, the nuclease activities could be rapidly detected with detection limits of 3.2×10(-4)U/µL for S1 nuclease, and of 4.5×10(-4)U/µL for DNase I. Moreover, the proposed potentiometric assays demonstrate the potential applications in the detection of hydroxyl radicals. It is anticipated that the present potentiometric strategy will provide a promising platform for high-throughput screening of nucleases, reactive oxygen species and the drugs with potential inhibition abilities. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS

    Energy Technology Data Exchange (ETDEWEB)

    Pachkowski, Brian F. [Department of Environmental Sciences and Engineering, University of North Carolina, Chapel Hill, NC (United States); Tano, Keizo [Research Reactor Institute, Kyoto University, Kumatori (Japan); Afonin, Valeriy [Department of Environmental Sciences and Engineering, University of North Carolina, Chapel Hill, NC (United States); Elder, Rhoderick H. [School of Environment and Life Sciences, University of Salford, Greater Manchester (United Kingdom); Takeda, Shunichi [Department of Radiation Genetics, Kyoto University Graduate School of Medicine, Sakyo-ku, Kyoto (Japan); Watanabe, Masami [Research Reactor Institute, Kyoto University, Kumatori (Japan); Swenberg, James A. [Department of Environmental Sciences and Engineering, University of North Carolina, Chapel Hill, NC (United States); Nakamura, Jun, E-mail: [Department of Environmental Sciences and Engineering, University of North Carolina, Chapel Hill, NC (United States)


    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase {beta}.

  1. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS. (United States)

    Pachkowski, Brian F; Tano, Keizo; Afonin, Valeriy; Elder, Rhoderick H; Takeda, Shunichi; Watanabe, Masami; Swenberg, James A; Nakamura, Jun


    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase beta.

  2. Single-strand breaks in the DNA of the uvrA and uvrB strains of Escherichia coli K-12 after ultraviolet irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Youngs, D A; Smith, K C [Stanford Univ., Calif. (USA). Dept. of Radiology


    DNA single-strand breaks were produced in uvrA and uvrB strains of E.coli K-12 after UV (254 nm) irradiation. These breaks appeared to be produced both directly by photochemical events, and by a temperature-dependent process. Cyclobutane-type pyrimidine dimers are probably not the photoproducts that lead to the temperature-dependent breaks, since photoreactivation had no detectable effect on the final yield of breaks. The DNA strand breaks appeared to be repairable by a process that requires DNA polymerase I and polynucleotide ligase, but not the recA, recB, recF, lexA101 or uvrD gene products. It is hypothesized that these temperature-dependent breaks occur either as a result of breakdown of a thermolabile photoproduct, or as the initial endonucleolytic event of a uvrA, uvrB-independent excision repair process that acts on a UV photoproduct other than the cyclobutane-type pyrimidine dimer.

  3. Crystal structure of APOBEC3A bound to single-stranded DNA reveals structural basis for cytidine deamination and specificity. (United States)

    Kouno, Takahide; Silvas, Tania V; Hilbert, Brendan J; Shandilya, Shivender M D; Bohn, Markus F; Kelch, Brian A; Royer, William E; Somasundaran, Mohan; Kurt Yilmaz, Nese; Matsuo, Hiroshi; Schiffer, Celia A


    Nucleic acid editing enzymes are essential components of the immune system that lethally mutate viral pathogens and somatically mutate immunoglobulins, and contribute to the diversification and lethality of cancers. Among these enzymes are the seven human APOBEC3 deoxycytidine deaminases, each with unique target sequence specificity and subcellular localization. While the enzymology and biological consequences have been extensively studied, the mechanism by which APOBEC3s recognize and edit DNA remains elusive. Here we present the crystal structure of a complex of a cytidine deaminase with ssDNA bound in the active site at 2.2 Å. This structure not only visualizes the active site poised for catalysis of APOBEC3A, but pinpoints the residues that confer specificity towards CC/TC motifs. The APOBEC3A-ssDNA complex defines the 5'-3' directionality and subtle conformational changes that clench the ssDNA within the binding groove, revealing the architecture and mechanism of ssDNA recognition that is likely conserved among all polynucleotide deaminases, thereby opening the door for the design of mechanistic-based therapeutics.

  4. Direct imaging of hexaamine-ruthenium(III) in domain boundaries in monolayers of single-stranded DNA

    DEFF Research Database (Denmark)

    Grubb, Mikala; Wackerbarth, Hainer; Wengel, J.


    We describe adsorption and identification of the binding sites of [Ru(NH3)(6)](3+) (RuHex) molecules in a closely packed monolayer of a 13-base ss-DNA on Au(111) electrodes by electrochemical in situ scanning tunneling microscopy (STM), cyclic voltammetry and interfacial capacitance data. In situ...

  5. Gauging the Nanotoxicity of h2D-C2N toward Single-Stranded DNA: An in Silico Molecular Simulation Approach. (United States)

    Mukhopadhyay, Titas Kumar; Bhattacharyya, Kalishankar; Datta, Ayan


    Recent toxicological assessments of graphene, graphene oxides, and some other two-dimensional (2D) materials have shown them to be substantially toxic at the nanoscale, where they inhibit and eventually disrupt biological processes. These shortfalls of graphene and analogs have resulted in a quest for novel biocompatible 2D materials with minimum cytotoxicity. In this article, we demonstrate C 2 N (h2D-C 2 N), a newly synthesized 2D porous graphene analog, to be non-nanotoxic toward genetic materials from an "in-silico" point of view through sequence-dependent binding of different polynucleotide single-stranded DNA (ssDNA) onto it. The calculated binding energy of nucleobases and the free energy of binding of polynucleotides follow the common trait, cytosine > guanine > adenine > thymine, and are well within the limits of physisorption. Ab-initio simulations completely exclude the possibility of any chemical reaction, demonstrating purely noncovalent binding of nucleobases with C 2 N through a crucial interplay between hydrogen bonding and π-stacking interactions with the surface. Further, we show that the extent of distortion inflicted upon ssDNA by C 2 N is negligible. Analysis of the density of states of the nucleobase-C 2 N hybrids confirms minimum electronic perturbation of the bases after adsorption. Most importantly, we demonstrate the potency of C 2 N in nucleic acid transportation via reversible binding of ssDNA. The plausible use of C 2 N as a template for DNA repair is illustrated through an example of C 2 N-assisted complementary ssDNA winding.

  6. Restriction map of the single-stranded DNA genome of Kilham rat virus strain 171, a nondefective parvovirus

    International Nuclear Information System (INIS)

    Banerjee, P.T.; Rathrock, R.; Mitra, S.


    A physical map of Kilham rat virus strain 171 DNA was constructed by analyzing the sizes and locations of restriction endonuclease-generated fragments of the replicative-form viral DNA synthesized in vitro. BglI, KpnI, BamHI, SmaI, XhoI, and XorII did not appear to have any cleavage sites, whereas 11 other enzymes cleaved the genome at one to eight sites, and AluI generated more than 12 distinct fragments. The 30 restriction sites that were mapped were distributed randomly in the viral genome. A comparison of the restriction fragments of in vivo- and in vitro-replicated replicative-form DNAs showed that these DNAs were identical except in the size or configuration of the terminal fragments

  7. In Vitro Selection of Single-Stranded DNA Molecular Recognition Elements against S. aureus Alpha Toxin and Sensitive Detection in Human Serum

    Directory of Open Access Journals (Sweden)

    Ka L. Hong


    Full Text Available Alpha toxin is one of the major virulence factors secreted by Staphylococcus aureus, a bacterium that is responsible for a wide variety of infections in both community and hospital settings. Due to the prevalence of S. aureus related infections and the emergence of methicillin-resistant S. aureus, rapid and accurate diagnosis of S. aureus infections is crucial in benefiting patient health outcomes. In this study, a rigorous Systematic Evolution of Ligands by Exponential Enrichment (SELEX variant previously developed by our laboratory was utilized to select a single-stranded DNA molecular recognition element (MRE targeting alpha toxin with high affinity and specificity. At the end of the 12-round selection, the selected MRE had an equilibrium dissociation constant (Kd of 93.7 ± 7.0 nM. Additionally, a modified sandwich enzyme-linked immunosorbent assay (ELISA was developed by using the selected ssDNA MRE as the toxin-capturing element and a sensitive detection of 200 nM alpha toxin in undiluted human serum samples was achieved.

  8. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA. (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S


    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  9. Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody: a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody. (United States)

    Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua


    Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.

  10. The UNG2 Arg88Cys variant abrogates RPA-mediated recruitment of UNG2 to single-stranded DNA. (United States)

    Torseth, Kathrin; Doseth, Berit; Hagen, Lars; Olaisen, Camilla; Liabakk, Nina-Beate; Græsmann, Heidi; Durandy, Anne; Otterlei, Marit; Krokan, Hans E; Kavli, Bodil; Slupphaug, Geir


    In human cell nuclei, UNG2 is the major uracil-DNA glycosylase initiating DNA base excision repair of uracil. In activated B cells it has an additional role in facilitating mutagenic processing of AID-induced uracil at Ig loci and UNG-deficient patients develop hyper-IgM syndrome characterized by impaired class-switch recombination and disturbed somatic hypermutation. How UNG2 is recruited to either error-free or mutagenic uracil processing remains obscure, but likely involves regulated interactions with other proteins. The UNG2 N-terminal domain contains binding motifs for both proliferating cell nuclear antigen (PCNA) and replication protein A (RPA), but the relative contribution of these interactions to genomic uracil processing is not understood. Interestingly, a heterozygous germline single-nucleotide variant leading to Arg88Cys (R88C) substitution in the RPA-interaction motif of UNG2 has been observed in humans, but with unknown functional relevance. Here we demonstrate that UNG2-R88C protein is expressed from the variant allele in a lymphoblastoid cell line derived from a heterozygous germ line carrier. Enzyme activity as well as localization in replication foci of UNG2-R88C was similar to that of WT. However, binding to RPA was essentially abolished by the R88C substitution, whereas binding to PCNA was unaffected. Moreover, we show that disruption of the PCNA-binding motif impaired recruitment of UNG2 to S-phase replication foci, demonstrating that PCNA is a major factor for recruitment of UNG2 to unperturbed replication forks. Conversely, in cells treated with hydroxyurea, RPA mediated recruitment of UNG2 to stalled replication forks independently of functional PCNA binding. Modulation of PCNA- versus RPA-binding may thus constitute a functional switch for UNG2 in cells subsequent to genotoxic stress and potentially also during the processing of uracil at the immunoglobulin locus in antigen-stimulated B cells. Copyright © 2012 Elsevier B.V. All rights

  11. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes. (United States)

    Pietilä, Maija K; Roine, Elina; Sencilo, Ana; Bamford, Dennis H; Oksanen, Hanna M


    Viruses infecting archaea show a variety of virion morphotypes, and they are currently classified into more than ten viral families or corresponding groups. A pleomorphic virus morphotype is very common among haloarchaeal viruses, and to date, several such viruses have been isolated. Here, we propose the classification of eight such viruses and formation of a new family, Pleolipoviridae (from the Greek pleo for more or many and lipos for lipid), containing three genera, Alpha-, Beta-, and Gammapleolipovirus. The proposal is currently under review by the International Committee on Taxonomy of Viruses (ICTV). The members of the proposed family Pleolipoviridae infect halophilic archaea and are nonlytic. They share structural and genomic features and differ from any other classified virus. The virion of pleolipoviruses is composed of a pleomorphic membrane vesicle enclosing the genome. All pleolipoviruses have two major structural protein species, internal membrane and spike proteins. Although the genomes of the pleolipoviruses are single- or double-stranded, linear or circular DNA molecules, they share the same genome organization and gene synteny and show significant similarity at the amino acid level. The canonical features common to all members of the proposed family Pleolipoviridae show that they are closely related and thus form a new viral family.

  12. A biomarker model of sublethal genotoxicity (DNA single-strand breaks and adducts) using the sentinel organism Aporrectodea longa in spiked soil

    International Nuclear Information System (INIS)

    Martin, Francis L.; Piearce, Trevor G.; Hewer, Alan; Phillips, David H.; Semple, Kirk T.


    There is a need to develop risk biomarkers during the remediation of contaminated land. We employed the earthworm, Aporrectodea longa (Ude), to determine whether genotoxicity measures could be applied to this organism's intestinal tissues. Earthworms were added, for 24 h or 7 days, to soil samples spiked with benzo[a]pyrene (B[a]P) and/or lindane. After exposure, intestinal tissues (crop/gizzard or intestine) were removed prior to the measurement in disaggregated cells of DNA single-strand breaks (SSBs) by the alkaline comet assay. Damage was quantified by comet tail length (CTL, μm). B[a]P 24-h exposure induced dose-related increases (P 32 P-postlabelling, showed a two-adduct-spot pattern. This preliminary investigation suggests that earthworm tissues may be incorporated into genotoxicity assays to facilitate hazard identification within terrestrial ecosystems. - Sublethal genotoxicity in the sentinel organism A. longa can be used to monitor the effects of contaminants in soil

  13. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy


    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  14. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray. (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino


    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  15. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino


    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  16. Genetic polymorphisms in DNA repair genes and possible links with DNA repair rates, chromosomal aberrations and single-strand breaks in DNA

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Kumar, R.; Štětina, R.; Sanyal, S.; Souček, P.; Haufroid, V.; Dušinská, M.; Kuricová, M.; Zámečníková, M.; Musak, L.; Buchancová, J.; Norppa, H.; Hirvonen, A.; Vodičková, L.; Naccarati, Alessio; Matoušů, Zora; Hemminki, K.


    Roč. 25, č. 5 (2004), s. 757-763 ISSN 0143-3334 R&D Projects: GA ČR GA310/03/0437; GA ČR GA310/01/0802 Institutional research plan: CEZ:AV0Z5039906 Keywords : DNA repair rates * genotoxicity Subject RIV: FM - Hygiene Impact factor: 5.375, year: 2004

  17. RPA physically interacts with the human DNA glycosylase NEIL1 to regulate excision of oxidative DNA base damage in primer-template structures. (United States)

    Theriot, Corey A; Hegde, Muralidhar L; Hazra, Tapas K; Mitra, Sankar


    The human DNA glycosylase NEIL1, activated during the S-phase, has been shown to excise oxidized base lesions in single-strand DNA substrates. Furthermore, our previous work demonstrating functional interaction of NEIL1 with PCNA and flap endonuclease 1 (FEN1) suggested its involvement in replication-associated repair. Here we show interaction of NEIL1 with replication protein A (RPA), the heterotrimeric single-strand DNA binding protein that is essential for replication and other DNA transactions. The NEIL1 immunocomplex isolated from human cells contains RPA, and its abundance in the complex increases after exposure to oxidative stress. NEIL1 directly interacts with the large subunit of RPA (K(d) approximately 20 nM) via the common interacting interface (residues 312-349) in NEIL1's disordered C-terminal region. RPA inhibits the base excision activity of both wild-type NEIL1 (389 residues) and its C-terminal deletion CDelta78 mutant (lacking the interaction domain) for repairing 5-hydroxyuracil (5-OHU) in a primer-template structure mimicking the DNA replication fork. This inhibition is reduced when the damage is located near the primer-template junction. Contrarily, RPA moderately stimulates wild-type NEIL1 but not the CDelta78 mutant when 5-OHU is located within the duplex region. While NEIL1 is inhibited by both RPA and Escherichia coli single-strand DNA binding protein, only inhibition by RPA is relieved by PCNA. These results showing modulation of NEIL1's activity on single-stranded DNA substrate by RPA and PCNA support NEIL1's involvement in repairing the replicating genome. Copyright 2010 Elsevier B.V. All rights reserved.

  18. OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

    Directory of Open Access Journals (Sweden)

    Kevin M. Bradley


    Full Text Available Synthetic biologists wishing to self-assemble large DNA (L-DNA constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson–Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS, and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting" software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

  19. Contribution of single-strand breaks and alkali-labile bonds to the loss of infectivity of γ-irradiated phiX174 RF-DNA in E. coli cells mutant in various repair functions

    International Nuclear Information System (INIS)

    McKee, R.H.


    Twenty-one radiation sensitive mutants have been examined for their capacity to support gamma-irradiated phiX174 RF-DNA. The survival of phiX174 RF-DNA was reduced in essentially all of the sensitive mutants. The irradiated phiX174 RF-DNA was then separated into populations containing either single-strand breaks or alkali-labile bonds to examine the capacity of the mutants to repair each of the classes of lesions. It was found that all E. coli strains are unable to repair 22 percent of the single-strand breaks and all sensitive mutants are unable to repair an additional 10 percent of the breaks. All the repair functions examined are involved in single-strand break repair and none are more or less necessary than any of the others. PhiX174 RF-DNA is also inactivated by alkali-labile bonds. In the normal strains the inactivation efficiency is 0.16 lethal events per lesion with a threshold dose of 15 to 20 krads. The mutants are divided into two classes by their sensitivity to alkali-labile bonds. Both classes of mutants are also inactivated by alkali-labile bonds with efficiencies of about 0.17 and 0.29 lethal events per lesion, respectively. It is proposed that the differences seen in survival curves of phiX174 measured in the sensitive mutants is due to this difference. Although in normal cells the efficiency of inactivation of phiX174 by single-strand breaks is 50 percent greater than by alkali-labile bonds, alkali-labile bonds are produced at approximately twice the rate of single-strand breaks so alkali-labile bonds account for about 61 percent of the overall inactivation. In the mutants of least sensitivity alkali-labile bonds account for about 54 percent of the inactivating events and in the most sensitive about 67 percent

  20. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family. (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław


    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  1. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)


    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ► To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ► ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ► PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ► The findings

  2. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)


    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  3. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)


    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  4. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee


    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  5. Formation of DNA single-strand breaks by near-ultraviolet and gamma-rays in normal and Bloom's syndrome skin fibroblasts

    International Nuclear Information System (INIS)

    Hirschi, M.; Netrawali, M.S.; Remsen, J.F.; Cerutti, P.A.


    The formation of single-strand breaks by near-ultraviolet light at 313 nm and by aerobic gamma-rays was compared for skin fibroblast monolayer cultures from 4 normal donors (NF) and 8 patients with Bloom's syndrome (BS) by the alkaline elution method. In 6 of 8 BS strains, the number of breaks induced by near-ultraviolet light, 2.25 kJ/sq m, at 0 degrees was comparable to NF, while elevated breakage was observed in BS strains HG 369 and HG 916. Breakage frequencies were increased substantially in 6 of 8 BS strains relative to NF when the near-ultraviolet light exposure was at 37 degrees. BS strain GM 2520 represents an exception since normal breakage frequencies were induced both at 0 degrees and 37 degrees. Aerobic gamma-rays (75 R) induced comparable numbers of single-strand breaks in BS and NF strains at 0 degrees. The breakage frequencies were reduced an average of 17% in NF when the same dose was given at 30 degrees followed by 6 min incubation. Under the same conditions, the breakage frequencies were on the average reduced by 42% relative to 0 degrees in the BS strains, indicating that they possess normal or possibly slightly increased capacities for the rejoining of gamma-ray-induced breaks

  6. Reparation in unicellular green algae during chronic exposure to the action of mutagenic factors. II. Restoration of single-stranded DNA breaks following exposure of Chlamydomonas reinchardii to gamma-irradiation

    International Nuclear Information System (INIS)

    Sergeeva, S.A.; Ptitsina, S.N.; Shevchenko, V.A.


    The restoration of single-stranded breaks in the DNA in different strains of unicellular green algae (chlamydomonads) during chronic exposure to the action of mutagenic factors following γ-irradiation was investigated. It was shown that the restoration of DNA breaks was most effective in the case of strain M γ/sup mt + /, which is resistant to radiation. Strains, that were sensitive to UV irradiation showed a similar order of DNA break restoration as the wild-type strain. Strain UVS-1 showed a higher level of restoration than the wild-type strain. The data indicated that chlamydomonads have different pathways of reparation, which lead to the restoration of breaks induced by γ-irradiation and UV-rays

  7. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries. (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan


    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  8. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.


    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  9. Repair of γ-irradiation-induced DNA single-strand breaks in human bone marrow cells. Analysis of unfractionated and CD34+ cells using single-cell gel electrophoresis

    International Nuclear Information System (INIS)

    Lankinen, Maarit H.; Vilpo, Juhani A.


    Human bone marrow mononuclear cells (BMMNCs) were separated by density gradient centrifugation, and a subpopulation of progenitor cells was further isolated using anti-CD34-coated magnetic beads. The cells were irradiated with γ-rays (0.93-5.43 Gy) from a 137 Cs source. The extent of DNA damage, i.e., single-strand breaks (SSBs) and alkali-labile lesions of individual cells, was investigated using the alkaline single-cell gel electrophoresis technique. The irradiation resulted in a dose-dependent increase in DNA migration, reflecting the number of detectable DNA lesions. An approximately similar extent of SSB formation was observed in BMMNCs and CD34+ cells. Damage was repaired when the cells were incubated at 37C: a fast initial repair phase was followed by a slower rejoining of SSBs in both BMMNC and CD34+ cell populations. A significantly longer time was required to repair the lesions caused by 5.43 Gy than those caused by 0.93 Gy. In the present work we report, for the first time, the induction and repair of DNA SSBs at the level of single human bone marrow cells when exposed to ionizing radiation at clinically relevant doses. These data, together with our previous results with human blood granulocytes and lymphocytes, indicate an approximately similar extent of formation and repair of γ-irradiation-induced DNA SSBs in immature and mature human hematopoietic cells

  10. Correlation between cell survival and DNA single-strand break repair proficiency in the Chinese hamster ovary cell lines AA8 and EM9 irradiated with 365-nm ultraviolet-A radiation

    Energy Technology Data Exchange (ETDEWEB)

    Churchill, M.E.; Peak, J.G.; Peak, M.J. (Argonne National Lab., IL (USA))


    Cell survival parameters and the induction and repair of DNA single-strand breaks were measured in two Chinese hamster ovary cell lines after irradiation with monochromatic UVA radiation of wavelength 365 nm. The radiosensitive mutant cell line EM9 is known to repair ionizing-radiation-induced single-strand breaks (SSB) more slowly than the parent line AA8. EM9 was determined to be 1.7-fold more sensitive to killing by 365-nm radiation than AA8 at the 10% survival level, and EM9 had a smaller shoulder region on the survival curve ({alpha} = 1.76) than AA8 ({alpha} = 0.62). No significant differences were found between the cell lines in the initial yields of SSB induced either by {gamma}-radiation (as determined by alkaline sucrose gradient sedimentation) or by 365-nm UVA (as determined by alkaline elution). For measurement of initial SSB, cells were irradiated at 0.5{sup o}C to minimize DNA repair processes. Rejoining of 365-nm induced SSB was measured by irradiating cells at 0.5{sup o}C, allowing them to repair at 37{sup o}C in full culture medium, and then quantitating the remaining SSB by alkaline elution. The repair of these breaks followed biphasic kinetics in both cell lines. EM9 repaired the breaks more slowly (T{sub 1/2} values of 1.3 and 61.3 min) than did AA8 (T{sub 1/2} values of 0.9 and 53.3 min), and EM9 also left more breaks unrepaired 90 min after irradiation (24% vs 8% for AA8). Thus, the sensitivity of EM9 to 365-nm radiation correlated with its deficiency in repairing DNA lesions revealed as SSB in alkaline elution. These results suggest that DNA may be a critical target in 365-nm induced cellular lethality and that the ability of AA8 and EM9 cells to repair DNA strand breaks may be related to their ability to survive 365-nm radiation. (author).

  11. The Rev1 interacting region (RIR) motif in the scaffold protein XRCC1 mediates a low-affinity interaction with polynucleotide kinase/phosphatase (PNKP) during DNA single-strand break repair. (United States)

    Breslin, Claire; Mani, Rajam S; Fanta, Mesfin; Hoch, Nicolas; Weinfeld, Michael; Caldecott, Keith W


    The scaffold protein X-ray repair cross-complementing 1 (XRCC1) interacts with multiple enzymes involved in DNA base excision repair and single-strand break repair (SSBR) and is important for genetic integrity and normal neurological function. One of the most important interactions of XRCC1 is that with polynucleotide kinase/phosphatase (PNKP), a dual-function DNA kinase/phosphatase that processes damaged DNA termini and that, if mutated, results in ataxia with oculomotor apraxia 4 (AOA4) and microcephaly with early-onset seizures and developmental delay (MCSZ). XRCC1 and PNKP interact via a high-affinity phosphorylation-dependent interaction site in XRCC1 and a forkhead-associated domain in PNKP. Here, we identified using biochemical and biophysical approaches a second PNKP interaction site in XRCC1 that binds PNKP with lower affinity and independently of XRCC1 phosphorylation. However, this interaction nevertheless stimulated PNKP activity and promoted SSBR and cell survival. The low-affinity interaction site required the highly conserved Rev1-interacting region (RIR) motif in XRCC1 and included three critical and evolutionarily invariant phenylalanine residues. We propose a bipartite interaction model in which the previously identified high-affinity interaction acts as a molecular tether, holding XRCC1 and PNKP together and thereby promoting the low-affinity interaction identified here, which then stimulates PNKP directly. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Correlation of MFOLD-predicted DNA secondary structures with separation patterns obtained by capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis. (United States)

    Glavac, Damjan; Potocnik, Uros; Podpecnik, Darja; Zizek, Teofil; Smerkolj, Sava; Ravnik-Glavac, Metka


    We have studied 57 different mutations within three beta-globin gene promoter fragments with sizes 52 bp, 77 bp, and 193 bp by fluorescent capillary electrophoresis CE-SSCP analysis. For each mutation and wild type, energetically most-favorable predicted secondary structures were calculated for sense and antisense strands using the MFOLD DNA-folding algorithm in order to investigate if any correlation exists between predicted DNA structures and actual CE migration time shifts. The overall CE-SSCP detection rate was 100% for all mutations in three studied DNA fragments. For shorter 52 bp and 77 bp DNA fragments we obtained a positive correlation between the migration time shifts and difference in free energy values of predicted secondary structures at all temperatures. For longer 193 bp beta-globin gene fragments with 46 mutations MFOLD predicted different secondary structures for 89% of mutated strands at 25 degrees C and 40 degrees C. However, the magnitude of the mobility shifts did not necessarily correlate with their secondary structures and free energy values except for the sense strand at 40 degrees C where this correlation was statistically significant (r = 0.312, p = 0.033). Results of this study provided more direct insight into the mechanism of CE-SSCP and showed that MFOLD prediction could be helpful in making decisions about the running temperatures and in prediction of CE-SSCP data patterns, especially for shorter (50-100 bp) DNA fragments. Copyright 2002 Wiley-Liss, Inc.

  13. Conformationally locked aryl C-nucleosides: synthesis of phosphoramidite monomers and incorporation into single-stranded DNA and LNA (locked nucleic acid)

    DEFF Research Database (Denmark)

    Babu, B. Ravindra; Prasad, Ashok K.; Trikha, Smriti


    . The phosphoramidite approach was used for automated incorporation of the LNA-type beta-configured C-aryl monomers 17a-17e into short DNA and 2'-OMe-RNA/LNA strands. It is shown that universal hybridization can be obtained with a conformationally restricted monomer as demonstrated most convincingly for the pyrene LNA...... monomer 17d, both in a DNA context and in an RNA-like context. Increased binding affinity of oligonucleotide probes for universal hybridization can be induced by combining the pyrene LNA monomer 17d with affinity-enhancing 2'-OMe-RNA/LNA monomers....

  14. Random, double- and single-strand DNA breaks can be differentiated in the method of Comet assay by the shape of the comet image. (United States)

    Georgieva, Milena; Zagorchev, Plamen; Miloshev, George


    Comet assay is an invaluable tool in DNA research. It is widely used to detect DNA damage as an indicator of exposure to genotoxic stress. A canonical set of parameters and specialized software programs exist for Comet assay data quantification and analysis. None of them so far has proven its potential to employ a computer-based algorithm for assessment of the shape of the comet as an indicator of the exact mechanism by which the studied genotoxins cut in the molecule of DNA. Here, we present 14 unique measurements of the comet image based on the comet morphology. Their mathematical derivation and statistical analysis allowed precise description of the shape of the comet image which in turn discriminated the cause of genotoxic stress. This algorithm led to the development of the "CometShape" software which allowed easy discrimination among different genotoxins depending on the type of DNA damage they induce. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H; Frykholm, Karolin; Reymer, Anna; Renodon-Corniè re, Axelle; Takahashi, Masayuki; Nordé n, Bengt


    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated

  16. Interaction of Ddc1 and RPA with single-stranded/double-stranded DNA junctions in yeast whole cell extracts: Proteolytic degradation of the large subunit of replication protein A in ddc1Δ strains. (United States)

    Sukhanova, Maria V; D'Herin, Claudine; Boiteux, Serge; Lavrik, Olga I


    To characterize proteins that interact with single-stranded/double-stranded (ss/ds) DNA junctions in whole cell free extracts of Saccharomyces cerevisiae, we used [(32)P]-labeled photoreactive partial DNA duplexes containing a 3'-ss/ds-junction (3'-junction) or a 5'-ss/ds-junction (5'-junction). Identification of labeled proteins was achieved by MALDI-TOF mass spectrometry peptide mass fingerprinting and genetic analysis. In wild-type extract, one of the components of the Ddc1-Rad17-Mec3 complex, Ddc1, was found to be preferentially photocrosslinked at a 3'-junction. On the other hand, RPAp70, the large subunit of the replication protein A (RPA), was the predominant crosslinking product at a 5'-junction. Interestingly, ddc1Δ extracts did not display photocrosslinking of RPAp70 at a 5'-junction. The results show that RPAp70 crosslinked to DNA with a 5'-junction is subject to limited proteolysis in ddc1Δ extracts, whereas it is stable in WT, rad17Δ, mec3Δ and mec1Δ extracts. The degradation of the RPAp70-DNA adduct in ddc1Δ extract is strongly reduced in the presence of the proteasome inhibitor MG 132. We also addressed the question of the stability of free RPA, using anti-RPA antibodies. The results show that RPAp70 is also subject to proteolysis without photocrosslinking to DNA upon incubation in ddc1Δ extract. The data point to a novel property of Ddc1, modulating the turnover of DNA binding proteins such as RPAp70 by the proteasome. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. A Eu(III) doped metal-organic framework conjugated with fluorescein-labeled single-stranded DNA for detection of Cu(II) and sulfide. (United States)

    Weng, Han; Yan, Bing


    In this paper, Bio-MOF-1 is prepared as reported and then Eu 3+ is introduced into it via cation exchange method. A FAM-labeled ssDNA is chosen to fabricate with the obtained Eu 3+ @Bio-MOF-1. A luminescent hybrid material is assembled, which can exhibit the fluorescence of Eu 3+ and FAM simultaneously by adjusting the ratio of FAM-ssDNA and Eu 3+ @Bio-MOF-1. The sample is then used for the detecting of metal ions, results shows which has good selectively for Cu 2+ (LOD = 0.14 μM, 0-250 μM). The introduction of Cu 2+ can quench the fluorescence of FAM while the luminescent intensity of Eu 3+ enhancing. After the detection of Cu 2+ , the Cu 2+ involved hybrid system can then be further employed for the detection of S 2- (LOD = 1.3 μM, 0-50 μM). Low concentration of S 2- can make the luminescent intensity of Eu 3+ decrease gradually while high concentration of S 2- can further recover the luminescent of FAM, which is quenched by Cu 2+ . Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi


    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)


    NARCIS (Netherlands)



    The single-strand origin (SSO) of the rolling-circle (RC), broad-host-range lactococcal plasmid pWVO1 was functionally characterized. The activity of this SSO in the conversion of single-stranded DNA to double-stranded DNA was tested both in vivo and in vitro. In addition, the effect of this SSO on

  20. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms. (United States)

    Swanson, Colby A; Sliwinski, Marek K


    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  1. Mapping of gene transcripts by nuclease protection assays and cDNA primer extension

    International Nuclear Information System (INIS)

    Calzone, F.J.; Britten, R.J.; Davidson, E.J.


    An important problem often faced in the molecular characterization of genes is the precise mapping of those genomic sequences transcribed into RNA. This requires identification of the genomic site initiating gene transcription, the location of genomic sequences removed from the primary gene transcript during RNA processing, and knowledge of sequences terminating the processed gene transcript. The objective of the protocols described here is the generation of transcription maps utilizing relatively uncharacterized gene fragments. The basic approach is hybridization of a single-stranded DNA probe with cellular RNA, followed by treatment with a single-strand-specific nuclease that does not attack DNA-RNA hybrids, in order to destroy any unreacted probe sequences. Thus the probe sequences included in the hybrid duplexes are protected from nuclease digestion. The sizes of the protected probe fragments determined by gel electrophoresis correspond to the lengths of the hybridized sequence elements

  2. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska


    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  3. DNA degradation, UV sensitivity and SOS-mediated mutagenesis in strains of Escherichia coli deficient in single-strand DNA binding protein: Effects of mutations and treatments that alter levels of exonuclease V or RecA protein

    International Nuclear Information System (INIS)

    Lieberman, H.B.; Witkin, E.M.


    Certain strains suppress the temperature-sensitivity caused by ssb-1, which encodes a mutant ssDNA binding protein (SSB). At 42 0 C, such strains are extremely UV-sensitive, degrade their DNA extensively after UV irradiation, and are defficient in UV mutability and UV induction of recA protein synthesis. We transduced recC22, which eliminates Exonuclease V activity, and recAo281, which causes operator-constitutive synthesis of recA protein, into such an ssb-1 strain. Both double mutants degraded their DNA extensively at 42 0 C after UV irradiation, and both were even more UV-sensitive than the ssb-1 single mutant. We conclude that one or more nucleases other than Exonuclease V degrades DNA in the ssb recC strain, and that recA protein, even if synthesized copiously, can function efficiently in recombinational DNA repair and in control of post-UV DNA degradation only if normal SSB is also present. Pretreatment with nalidixic acid at 30 0 C restored normal UV mutability at 42 0 C, but did not increase UV resistance, in an ssb-1 strain. Another ssb allele, ssb-113, which blocks SOS induction at 30 0 C, increases spontaneous mutability more than tenfold. The ssb-113 allele was transduced into the SOS-constitutive recA730 strain SC30. This double mutant expressed the same elevated spontaneous and UV-induced mutability at 30 0 C as the ssb + recA730 strain, and was three times more UV-resistant than its ssb-113 recA + parent. We conclude that ssb-1 at 42 0 C and ssb-113 at 30 0 C block UV-induced activation of recA protease, but that neither allele interferes with subsequent steps in SOS-mediated mutagenesis. (orig.)

  4. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.


    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  5. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)


    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  6. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.


    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  7. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.


    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  8. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.


    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  9. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati. (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y


    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  10. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication. (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J


    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  11. Transformation of Saccharomyces cerevisiae with UV-irradiated single-stranded plasmid. (United States)

    Zgaga, Z


    UV-irradiated single-stranded replicative plasmids were used to transform different yeast strains. The low doses of UV used in this study (10-75 J/m2) caused a significant decrease in the transforming efficiency of plasmid DNA in the Rad+ strain, while they had no effect on transformation with double-stranded plasmids of comparable size. Neither the rev3 mutation, nor the rad18 or rad52 mutations influenced the efficiency of transformation with irradiated single-stranded plasmid. However, it was found to be decreased in the double rev3 rad52 mutant. Extracellular irradiation of plasmid that contains both URA3 and LEU2 genes (psLU) gave rise to up to 5% Leu- transformants among selected Ura+ ones in the repair-proficient strain. Induction of Leu- transformants was dose-dependent and only partially depressed in the rev3 mutant. These results suggest that both mutagenic and recombinational repair processes operate on UV-damaged single-stranded DNA in yeast.

  12. A Heterogeneous Nuclear Ribonucleoprotein A/B-Related Protein Binds to Single-Stranded DNA near the 5′ End or within the Genome of Feline Parvovirus and Can Modify Virus Replication (United States)

    Wang, Dai; Parrish, Colin R.


    Phage display of cDNA clones prepared from feline cells was used to identify host cell proteins that bound to DNA-containing feline panleukopenia virus (FPV) capsids but not to empty capsids. One gene found in several clones encoded a heterogeneous nuclear ribonucleoprotein (hnRNP)-related protein (DBP40) that was very similar in sequence to the A/B-type hnRNP proteins. DBP40 bound specifically to oligonucleotides representing a sequence near the 5′ end of the genome which is exposed on the outside of the full capsid but did not bind most other terminal sequences. Adding purified DBP40 to an in vitro fill-in reaction using viral DNA as a template inhibited the production of the second strand after nucleotide (nt) 289 but prior to nt 469. DBP40 bound to various regions of the viral genome, including a region between nt 295 and 330 of the viral genome which has been associated with transcriptional attenuation of the parvovirus minute virus of mice, which is mediated by a stem-loop structure of the DNA and cellular proteins. Overexpression of the protein in feline cells from a plasmid vector made them largely resistant to FPV infection. Mutagenesis of the protein binding site within the 5′ end viral genome did not affect replication of the virus. PMID:10438866

  13. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth


    Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells....... We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices...

  14. A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. (United States)

    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan


    The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

  15. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  16. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong


    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  17. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan


    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  18. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers. (United States)

    Caetano-Anollés, G; Gresshoff, P M


    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  19. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.


    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  20. Absolute determination of single-stranded and self-complementary adeno-associated viral vector genome titers by droplet digital PCR. (United States)

    Lock, Martin; Alvira, Mauricio R; Chen, Shu-Jen; Wilson, James M


    Accurate titration of adeno-associated viral (AAV) vector genome copies is critical for ensuring correct and reproducible dosing in both preclinical and clinical settings. Quantitative PCR (qPCR) is the current method of choice for titrating AAV genomes because of the simplicity, accuracy, and robustness of the assay. However, issues with qPCR-based determination of self-complementary AAV vector genome titers, due to primer-probe exclusion through genome self-annealing or through packaging of prematurely terminated defective interfering (DI) genomes, have been reported. Alternative qPCR, gel-based, or Southern blotting titering methods have been designed to overcome these issues but may represent a backward step from standard qPCR methods in terms of simplicity, robustness, and precision. Droplet digital PCR (ddPCR) is a new PCR technique that directly quantifies DNA copies with an unparalleled degree of precision and without the need for a standard curve or for a high degree of amplification efficiency; all properties that lend themselves to the accurate quantification of both single-stranded and self-complementary AAV genomes. Here we compare a ddPCR-based AAV genome titer assay with a standard and an optimized qPCR assay for the titration of both single-stranded and self-complementary AAV genomes. We demonstrate absolute quantification of single-stranded AAV vector genomes by ddPCR with up to 4-fold increases in titer over a standard qPCR titration but with equivalent readout to an optimized qPCR assay. In the case of self-complementary vectors, ddPCR titers were on average 5-, 1.9-, and 2.3-fold higher than those determined by standard qPCR, optimized qPCR, and agarose gel assays, respectively. Droplet digital PCR-based genome titering was superior to qPCR in terms of both intra- and interassay precision and is more resistant to PCR inhibitors, a desirable feature for in-process monitoring of early-stage vector production and for vector genome biodistribution

  1. [Design of primers to DNA of lactic acid bacteria]. (United States)

    Lashchevskiĭ, V V; Kovalenko, N K


    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  2. N-terminal domains of human DNA polymerase lambda promote primer realignment during translesion DNA synthesis (United States)

    Taggart, David J.; Dayeh, Daniel M.; Fredrickson, Saul W.; Suo, Zucai


    The X-family DNA polymerases λ (Polλ) and β (Polβ) possess similar 5′-2-deoxyribose-5-phosphatelyase (dRPase) and polymerase domains. Besides these domains, Polλ also possesses a BRCA1 C-terminal (BRCT) domain and a proline-rich domain at its N terminus. However, it is unclear how these non-enzymatic domains contribute to the unique biological functions of Polλ. Here, we used primer extension assays and a newly developed high-throughput short oligonucleotide sequencing assay (HT-SOSA) to compare the efficiency of lesion bypass and fidelity of human Polβ, Polλ and two N-terminal deletion constructs of Polλ during the bypass of either an abasic site or a 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG) lesion. We demonstrate that the BRCT domain of Polλ enhances the efficiency of abasic site bypass by approximately 1.6-fold. In contrast, deletion of the N-terminal domains of Polλ did not affect the efficiency of 8-oxodG bypass relative to nucleotide incorporations opposite undamaged dG. HT-SOSA analysis demonstrated that Polλ and Polβ preferentially generated −1 or −2 frameshift mutations when bypassing an abasic site and the single or double base deletion frequency was highly sequence dependent. Interestingly, the BRCT and proline-rich domains of Polλ cooperatively promoted the generation of −2 frameshift mutations when the abasic site was situated within a sequence context that was susceptible to homology-driven primer realignment. Furthermore, both N-terminal domains of Polλ increased the generation of −1 frameshift mutations during 8-oxodG bypass and influenced the frequency of substitution mutations produced by Polλ opposite the 8-oxodG lesion. Overall, our data support a model wherein the BRCT and proline-rich domains of Polλ act cooperatively to promote primer/template realignment between DNA strands of limited sequence homology. This function of the N-terminal domains may facilitate the role of Polλ as a gap-filling polymerase

  3. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries. (United States)

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong


    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  4. Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs. (United States)

    Rockne, Karl J; Strand, Stuart E


    Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

  5. Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Nigel C. Brissett


    Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

  6. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.


    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  7. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony


    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  8. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode. (United States)

    Françoso, E; Arias, M C


    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  9. Identification of a Single Strand Origin of Replication in the Integrative and Conjugative Element ICEBs1 of Bacillus subtilis.

    Directory of Open Access Journals (Sweden)

    Laurel D Wright


    Full Text Available We identified a functional single strand origin of replication (sso in the integrative and conjugative element ICEBs1 of Bacillus subtilis. Integrative and conjugative elements (ICEs, also known as conjugative transposons are DNA elements typically found integrated into a bacterial chromosome where they are transmitted to daughter cells by chromosomal replication and cell division. Under certain conditions, ICEs become activated and excise from the host chromosome and can transfer to neighboring cells via the element-encoded conjugation machinery. Activated ICEBs1 undergoes autonomous rolling circle replication that is needed for the maintenance of the excised element in growing and dividing cells. Rolling circle replication, used by many plasmids and phages, generates single-stranded DNA (ssDNA. In many cases, the presence of an sso enhances the conversion of the ssDNA to double-stranded DNA (dsDNA by enabling priming of synthesis of the second DNA strand. We initially identified sso1 in ICEBs1 based on sequence similarity to the sso of an RCR plasmid. Several functional assays confirmed Sso activity. Genetic analyses indicated that ICEBs1 uses sso1 and at least one other region for second strand DNA synthesis. We found that Sso activity was important for two key aspects of the ICEBs1 lifecycle: 1 maintenance of the plasmid form of ICEBs1 in cells after excision from the chromosome, and 2 stable acquisition of ICEBs1 following transfer to a new host. We identified sequences similar to known plasmid sso's in several other ICEs. Together, our results indicate that many other ICEs contain at least one single strand origin of replication, that these ICEs likely undergo autonomous replication, and that replication contributes to the stability and spread of these elements.

  10. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen


    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  11. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes. (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V


    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  12. Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products (United States)

    Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam


    This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

  13. Primer-Independent DNA Synthesis by a Family B DNA Polymerase from Self-Replicating Mobile Genetic Elements

    Directory of Open Access Journals (Sweden)

    Modesto Redrejo-Rodríguez


    Full Text Available Family B DNA polymerases (PolBs play a central role during replication of viral and cellular chromosomes. Here, we report the discovery of a third major group of PolBs, which we denote primer-independent PolB (piPolB, that might be a link between the previously known protein-primed and RNA/DNA-primed PolBs. PiPolBs are encoded by highly diverse mobile genetic elements, pipolins, integrated in the genomes of diverse bacteria and also present as circular plasmids in mitochondria. Biochemical characterization showed that piPolB displays efficient DNA polymerization activity that can use undamaged and damaged templates and is endowed with proofreading and strand displacement capacities. Remarkably, the protein is also capable of template-dependent de novo DNA synthesis, i.e., DNA-priming activity, thereby breaking the long-standing dogma that replicative DNA polymerases require a pre-existing primer for DNA synthesis. We suggest that piPolBs are involved in self-replication of pipolins and may also contribute to bacterial DNA damage tolerance.

  14. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan


    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  15. Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA. (United States)

    Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki


    A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

    NARCIS (Netherlands)

    RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.


    We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

  17. Systematic Identification of Determinants for Single-Strand Annealing-Mediated Deletion Formation in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Maia Segura-Wang


    Full Text Available To ensure genomic integrity, living organisms have evolved diverse molecular processes for sensing and repairing damaged DNA. If improperly repaired, DNA damage can give rise to different types of mutations, an important class of which are genomic structural variants (SVs. In spite of their importance for phenotypic variation and genome evolution, potential contributors to SV formation in Saccharomyces cerevisiae (budding yeast, a highly tractable model organism, are not fully recognized. Here, we developed and applied a genome-wide assay to identify yeast gene knockout mutants associated with de novo deletion formation, in particular single-strand annealing (SSA-mediated deletion formation, in a systematic manner. In addition to genes previously linked to genome instability, our approach implicates novel genes involved in chromatin remodeling and meiosis in affecting the rate of SSA-mediated deletion formation in the presence or absence of stress conditions induced by DNA-damaging agents. We closely examined two candidate genes, the chromatin remodeling gene IOC4 and the meiosis-related gene MSH4, which when knocked-out resulted in gene expression alterations affecting genes involved in cell division and chromosome organization, as well as DNA repair and recombination, respectively. Our high-throughput approach facilitates the systematic identification of processes linked to the formation of a major class of genetic variation.

  18. A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species. (United States)

    Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E


    Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

  19. Second-strand cDNA synthesis: classical method

    International Nuclear Information System (INIS)

    Gubler, U.


    The classical scheme for the synthesis of double-stranded cDNA as it was reported in 1976 is described. Reverse transcription of mRNA with oligo(dT) as the primer generates first strands with a small loop at the 3' end of the cDNA (the end that corresponds to the 5' end of the mRNA). Subsequent removal of the mRNA by alkaline hydrolysis leaves single-stranded cDNA molecules again with a small 3' loop. This loop can be used by either reverse transcriptase or Klenow fragment of DNA polymerase I as a primer for second-strand synthesis. The resulting products are double-stranded cDNA molecules that are covalently closed at the end corresponding to the 5' end of the original mRNA. Subsequent cleavage of the short piece of single-stranded cDNA within the loop with the single-strand-specific S 1 nuclease generate open double-stranded molecules that can be used for molecular cloning in plasmids or in phage. Useful variations of this scheme have been described

  20. Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition. (United States)

    Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M


    Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

  1. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.


    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  2. Toxin MqsR Cleaves Single-Stranded mRNA with Various 5 Ends (United States)


    either protein ORIGINAL RESEARCH Toxin MqsR cleaves single- stranded mRNA with various 5’ ends Nityananda Chowdhury1,*, Brian W. Kwan1,*, Louise which a single 5′- GCU site was predicted to be single- stranded (ssRNA), double- stranded (dsRNA), in the loop of a stem - loop (slRNA), or in a...single- stranded 5′- GCU sites since cleavage was approximately 20- fold higher than cleavage seen with the 5′- GCU site in the stem - loop and

  3. Using long ssDNA polynucleotides to amplify STRs loci in degraded DNA samples (United States)

    Pérez Santángelo, Agustín; Corti Bielsa, Rodrigo M.; Sala, Andrea; Ginart, Santiago; Corach, Daniel


    Obtaining informative short tandem repeat (STR) profiles from degraded DNA samples is a challenging task usually undermined by locus or allele dropouts and peak-high imbalances observed in capillary electrophoresis (CE) electropherograms, especially for those markers with large amplicon sizes. We hereby show that the current STR assays may be greatly improved for the detection of genetic markers in degraded DNA samples by using long single stranded DNA polynucleotides (ssDNA polynucleotides) as surrogates for PCR primers. These long primers allow a closer annealing to the repeat sequences, thereby reducing the length of the template required for the amplification in fragmented DNA samples, while at the same time rendering amplicons of larger sizes suitable for multiplex assays. We also demonstrate that the annealing of long ssDNA polynucleotides does not need to be fully complementary in the 5’ region of the primers, thus allowing for the design of practically any long primer sequence for developing new multiplex assays. Furthermore, genotyping of intact DNA samples could also benefit from utilizing long primers since their close annealing to the target STR sequences may overcome wrong profiling generated by insertions/deletions present between the STR region and the annealing site of the primers. Additionally, long ssDNA polynucleotides might be utilized in multiplex PCR assays for other types of degraded or fragmented DNA, e.g. circulating, cell-free DNA (ccfDNA). PMID:29099837

  4. Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification (United States)

    Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo


    Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

  5. Fanconi anemia complementation group A (FANCA) protein has intrinsic affinity for nucleic acids with preference for single-stranded forms. (United States)

    Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin


    The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5'-flap or 5'-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772-1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found.

  6. Fanconi Anemia Complementation Group A (FANCA) Protein Has Intrinsic Affinity for Nucleic Acids with Preference for Single-stranded Forms* (United States)

    Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y.; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin


    The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5′-flap or 5′-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772–1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found. PMID:22194614

  7. Back to basics – the influence of DNA extraction and primer choice on phylogenetic analysis in activated sludge communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    intensity and primer choice on the observed community using 16S rDNA amplicon sequencing. Quantitative fluorescence in situ hybridization (qFISH) was used as a DNA extraction independent method to evaluate the results. The bead beating intensity correlated with cell-wall strength and showed...... that the manufacture recommended settings were insufficient to retrieve a large part of the community. In addition, the in silico “best” primer set was found to greatly underestimate a number of important phyla when compared to qFISH results. The findings underline the need for sample specific and DNA extraction...

  8. A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera. (United States)

    Cheng, Yunjiang; de Vicente, M Carmen; Meng, Haijun; Guo, Wenwu; Tao, Nengguo; Deng, Xiuxin


    Chloroplast simple sequence repeat (cpSSR) markers in Citrus were developed and used to analyze chloroplast diversity of Citrus and closely related genera. Fourteen cpSSR primer pairs from the chloroplast genomes of tobacco (Nicotiana tabacum L.) and Arabidopsis were found useful for analyzing the Citrus chloroplast genome (cpDNA) and recoded with the prefix SPCC (SSR Primers for Citrus Chloroplast). Eleven of the 14 primer pairs revealed some degree of polymorphism among 34 genotypes of Citrus, Fortunella, Poncirus and some of their hybrids, with polymorphism information content (PIC) values ranging from 0.057 to 0.732, and 18 haplotypes were identified. The cpSSR data were analyzed with NTSYS-pc software, and the genetic relationships suggested by the unweighted pair group method based on arithmetic means (UPGMA) dendrogram were congruent with previous taxonomic investigations: the results showed that all samples fell into seven major clusters, i.e., Citrus medica L., Poncirus, Fortunella, C. ichangensis Blanco, C. reticulata Swingle, C. aurantifolia (Christm.) Swingle and C. grandis (L.) Osbeck. The results of previous studies combined with our cpSSR analyses revealed that: (1) Calamondin (C. madurensis Swingle) is the result of hybridization between kumquat (Fortunella) and mandarin (C. reticulata), where kumquat acted as the female parent; (2) Ichang papeda (C. ichangensis) has a unique taxonomic status; and (3) although Bendiguangju mandarin (C. reticulata) and Satsuma mandarin (C. reticulata) are similar in fruit shape and leaf morphology, they have different maternal parents. Bendiguangju mandarin has the same cytoplasm as sweet orange (C. sinensis), whereas Satsuma mandarin has the cytoplasm of C. reticulata. Seventeen PCR products from SPCC1 and 21 from SPCC11 were cloned and sequenced. The results revealed that mononucleotide repeats as well as insertions and deletions of small segments of DNA were associated with SPCC1 polymorphism, whereas polymorphism

  9. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics. (United States)

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas


    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

  10. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27. (United States)

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki


    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  11. Back to Basics – The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth


    the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated throughmetagenomics...... and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead...

  12. Site-specifically modified oligodeoxyribonucleotides as templates for Escherichia coli DNA polymerase I

    International Nuclear Information System (INIS)

    O'Connor, D.; Stoehrer, G.


    Oligodeoxyribonucleotides with site-specific modifications have been used as substrates for Escherichia coli DNA polymerase I holoenzyme and Klenow fragment. Modifications included the bulky guanine-8-aminofluorene adduct and a guanine oxidation product resembling the product of photosensitized DNA oxidation. By a combination of primers and nick-mers, conditions of single-strand-directed DNA synthesis and nick-translation could be created. The results show that the polymerase can bypass both types of lesions. Bypass occurs on a single-stranded template but is facilitated on a nicked, double-stranded template. Only purines, with guanine more favored than adenine, are incorporated across both lesions. The results indicate that site-specifically modified oligonucleotides can be sensitive probes for the action of polymerases on damaged templates. They also suggest a function for polymerase I, in its nick-translation capacity, during DNA repair and mutagenesis

  13. A high throughput system for the preparation of single stranded templates grown in microculture. (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M


    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  14. Enzymatic primer-extension with glycerol-nucleoside triphosphates on DNA templates.

    Directory of Open Access Journals (Sweden)

    Jesse J Chen

    Full Text Available BACKGROUND: Glycerol nucleic acid (GNA has an acyclic phosphoglycerol backbone repeat-unit, but forms stable duplexes based on Watson-Crick base-pairing. Because of its structural simplicity, GNA is of particular interest with respect to the possibility of evolving functional polymers by in vitro selection. Template-dependent GNA synthesis is essential to any GNA-based selection system. PRINCIPAL FINDINGS: In this study, we investigated the ability of various DNA polymerases to use glycerol-nucleoside triphosphates (gNTPs as substrates for GNA synthesis on DNA templates. Therminator DNA polymerase catalyzes quantitative primer-extension by the incorporation of two glyceronucleotides, with much less efficient extension up to five glyceronucleotides. Steady-state kinetic experiments suggested that GNA synthesis by Therminator was affected by both decreased catalytic rates and weakened substrate binding, especially for pyrimidines. In an attempt to improve pyrimidine incorporation by providing additional stacking interactions, we synthesized two new gNTP analogs with 5-propynyl substituted pyrimidine nucleobases. This led to more efficient incorporation of gC, but not gT. CONCLUSIONS: We suggest that directed evolution of Therminator might lead to mutants with improved substrate binding and catalytic efficiency.

  15. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong; Qian, Pei-Yuan


    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions

  16. Inhibition of non-templated nucleotide addition by DNA polymerases in primer extension using twisted intercalating nucleic acid modified templates

    Czech Academy of Sciences Publication Activity Database

    Güixens-Gallardo, Pedro; Hocek, Michal; Perlíková, Pavla


    Roč. 26, č. 2 (2016), s. 288-291 ISSN 0960-894X R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : DNA polymerases * nucleotide addition * primer extension * oligonucleotides * twisted intercalating nucleic acid Subject RIV: CC - Organic Chemistry Impact factor: 2.454, year: 2016

  17. Single-stranded nucleic acids promote SAMHD1 complex formation. (United States)

    Tüngler, Victoria; Staroske, Wolfgang; Kind, Barbara; Dobrick, Manuela; Kretschmer, Stefanie; Schmidt, Franziska; Krug, Claudia; Lorenz, Mike; Chara, Osvaldo; Schwille, Petra; Lee-Kirsch, Min Ae


    SAM domain and HD domain-containing protein 1 (SAMHD1) is a dGTP-dependent triphosphohydrolase that degrades deoxyribonucleoside triphosphates (dNTPs) thereby limiting the intracellular dNTP pool. Mutations in SAMHD1 cause Aicardi-Goutières syndrome (AGS), an inflammatory encephalopathy that mimics congenital viral infection and that phenotypically overlaps with the autoimmune disease systemic lupus erythematosus. Both disorders are characterized by activation of the antiviral cytokine interferon-α initiated by immune recognition of self nucleic acids. Here we provide first direct evidence that SAMHD1 associates with endogenous nucleic acids in situ. Using fluorescence cross-correlation spectroscopy, we demonstrate that SAMHD1 specifically interacts with ssRNA and ssDNA and establish that nucleic acid-binding and formation of SAMHD1 complexes are mutually dependent. Interaction with nucleic acids and complex formation do not require the SAM domain, but are dependent on the HD domain and the C-terminal region of SAMHD1. We finally demonstrate that mutations associated with AGS exhibit both impaired nucleic acid-binding and complex formation implicating that interaction with nucleic acids is an integral aspect of SAMHD1 function.

  18. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.


    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  19. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP


    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to


    NARCIS (Netherlands)



    In this paper we describe the isolation and characterization of single strand origins (SSOs) of several cryptic Bacillus subtilis plasmids which use the rolling-circle mechanism of replication, The plasmids used in this study involved pTA1015, pTA1020, pTA1030, pTA1040, pTA1050 and pTA1060, The SSO

  1. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong


    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  2. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast. (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A


    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  3. Intracellular generation of single-strand template increases the knock-in efficiency by combining CRISPR/Cas9 with AAV. (United States)

    Xiao, Qing; Min, Taishan; Ma, Shuangping; Hu, Lingna; Chen, Hongyan; Lu, Daru


    Targeted integration of transgenes facilitates functional genomic research and holds prospect for gene therapy. The established microhomology-mediated end-joining (MMEJ)-based strategy leads to the precise gene knock-in with easily constructed donor, yet the limited efficiency remains to be further improved. Here, we show that single-strand DNA (ssDNA) donor contributes to efficient increase of knock-in efficiency and establishes a method to achieve the intracellular linearization of long ssDNA donor. We identified that the CRISPR/Cas9 system is responsible for breaking double-strand DNA (dsDNA) of palindromic structure in inverted terminal repeats (ITRs) region of recombinant adeno-associated virus (AAV), leading to the inhibition of viral second-strand DNA synthesis. Combing Cas9 plasmids targeting genome and ITR with AAV donor delivery, the precise knock-in of gene cassette was achieved, with 13-14% of the donor insertion events being mediated by MMEJ in HEK 293T cells. This study describes a novel method to integrate large single-strand transgene cassettes into the genomes, increasing knock-in efficiency by 13.6-19.5-fold relative to conventional AAV-mediated method. It also provides a comprehensive solution to the challenges of complicated production and difficult delivery with large exogenous fragments.

  4. Normalized cDNA libraries (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris


    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  5. Termination of DNA synthesis in vitro at apurinic sites but not at ethyl adducts of the template

    Energy Technology Data Exchange (ETDEWEB)

    Lockhart, M.L.; Deutsch, J.F.; Yamaura, I.; Cavalieri, L.F.; Rosenberg, B.H.


    The effects of DNA lesions produced by the carcinogenic alkylating agents ethylnitrosourea and diethylsulfate on the extent of DNA synthesis have been studied in a system utilizing circular single-stranded phi X174 DNA as template and a 392-base restriction fragment as primer with E. coli polymerase I (Klenow fragment). Apurinic sites produced by loss of unstable ethylated bases from the template terminate DNA synthesis at the first such site encountered, but ethyl adducts at most, if not all, locations permit readthrough. 22 references, 3 figures, 1 table.

  6. Universal and blocking primer mismatches limit the use of high-throughput DNA sequencing for the quantitative metabarcoding of arthropods. (United States)

    Piñol, J; Mir, G; Gomez-Polo, P; Agustí, N


    The quantification of the biological diversity in environmental samples using high-throughput DNA sequencing is hindered by the PCR bias caused by variable primer-template mismatches of the individual species. In some dietary studies, there is the added problem that samples are enriched with predator DNA, so often a predator-specific blocking oligonucleotide is used to alleviate the problem. However, specific blocking oligonucleotides could coblock nontarget species to some degree. Here, we accurately estimate the extent of the PCR biases induced by universal and blocking primers on a mock community prepared with DNA of twelve species of terrestrial arthropods. We also compare universal and blocking primer biases with those induced by variable annealing temperature and number of PCR cycles. The results show that reads of all species were recovered after PCR enrichment at our control conditions (no blocking oligonucleotide, 45 °C annealing temperature and 40 cycles) and high-throughput sequencing. They also show that the four factors considered biased the final proportions of the species to some degree. Among these factors, the number of primer-template mismatches of each species had a disproportionate effect (up to five orders of magnitude) on the amplification efficiency. In particular, the number of primer-template mismatches explained most of the variation (~3/4) in the amplification efficiency of the species. The effect of blocking oligonucleotide concentration on nontarget species relative abundance was also significant, but less important (below one order of magnitude). Considering the results reported here, the quantitative potential of the technique is limited, and only qualitative results (the species list) are reliable, at least when targeting the barcoding COI region. © 2014 John Wiley & Sons Ltd.

  7. Single-Stranded Nucleic Acids Bind to the Tetramer Interface of SAMHD1 and Prevent Formation of the Catalytic Homotetramer. (United States)

    Seamon, Kyle J; Bumpus, Namandjé N; Stivers, James T


    Sterile alpha motif and HD domain protein 1 (SAMHD1) is a unique enzyme that plays important roles in nucleic acid metabolism, viral restriction, and the pathogenesis of autoimmune diseases and cancer. Although much attention has been focused on its dNTP triphosphohydrolase activity in viral restriction and disease, SAMHD1 also binds to single-stranded RNA and DNA. Here we utilize a UV cross-linking method using 5-bromodeoxyuridine-substituted oligonucleotides coupled with high-resolution mass spectrometry to identify the binding site for single-stranded nucleic acids (ssNAs) on SAMHD1. Mapping cross-linked amino acids on the surface of existing crystal structures demonstrated that the ssNA binding site lies largely along the dimer-dimer interface, sterically blocking the formation of the homotetramer required for dNTPase activity. Surprisingly, the disordered C-terminus of SAMHD1 (residues 583-626) was also implicated in ssNA binding. An interaction between this region and ssNA was confirmed in binding studies using the purified SAMHD1 583-626 peptide. Despite a recent report that SAMHD1 possesses polyribonucleotide phosphorylase activity, we did not detect any such activity in the presence of inorganic phosphate, indicating that nucleic acid binding is unrelated to this proposed activity. These data suggest an antagonistic regulatory mechanism in which the mutually exclusive oligomeric state requirements for ssNA binding and dNTP hydrolase activity modulate these two functions of SAMHD1 within the cell.


    Directory of Open Access Journals (Sweden)

    Veronika Lancíková


    Full Text Available Trehalose-based (TBT-PAR additive was tested in order to optimize PCR amplification for DNA isolated from recalcitrant plants. Retrotransposon-based inter-primer binding site reactions were significantly improved with TBT-PAR solution using genomic DNA isolated from flax (Linum usitatissimum L., genotypes Kyivskyi, Bethune grown in radio-contaminated and non-radioactive remediated Chernobyl experimental fields. Additionally, similar improvements were observed using 19 recalcitrant genotypes of maize (Zea mays L. and three genotypes of yacon (Smallanthus sonchifolius, Poepp. et Endl., genotypes PER05, ECU45, BOL22 grown in standard field conditions.

  9. Chromosomal aberrations and deoxyribonucleic acid single-strand breaks in adipose-derived stem cells during long-term expansion in vitro. (United States)

    Froelich, Katrin; Mickler, Johannes; Steusloff, Gudrun; Technau, Antje; Ramos Tirado, Mario; Scherzed, Agmal; Hackenberg, Stephan; Radeloff, Andreas; Hagen, Rudolf; Kleinsasser, Norbert


    Adipose-derived stem cells (ASCs) are a promising mesenchymal cell source for tissue engineering approaches. To obtain an adequate cell amount, in vitro expansion of the cells may be required in some cases. To monitor potential contraindications for therapeutic applications in humans, DNA strand breaks and chromosomal aberrations in ASCs during in vitro expansion were examined. After isolation of ASC from human lipoaspirates of seven patients, in vitro expansion over 10 passages was performed. Cells from passages 1, 2, 3, 5 and 10 were used for the alkaline single-cell microgel electrophoresis (comet) assay to detect DNA single-strand breaks and alkali labile as well as incomplete excision repair sites. Chromosomal changes were examined by means of the chromosomal aberration test. During in vitro expansion, ASC showed no DNA single-strand breaks in the comet assay. With the chromosomal aberration test, however, a significant increase in chromosomal aberrations were detected. The study showed that although no DNA fragmentation could be determined, the safety of ASC cannot be ensured with respect to chromosome stability during in vitro expansion. Thus, reliable analyses for detecting ASC populations, which accumulate chromosomal aberrations or even undergo malignant transformation during extensive in vitro expansion, must be implemented as part of the safety evaluation of these cells for stem cell-based therapy. Copyright © 2013 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  10. Fluorescent quenching-based quantitative detection of specific DNA/RNA using a BODIPY® FL-labeled probe or primer (United States)

    Kurata, Shinya; Kanagawa, Takahiro; Yamada, Kazutaka; Torimura, Masaki; Yokomaku, Toyokazu; Kamagata, Yoichi; Kurane, Ryuichiro


    We have developed a simple method for the quantitative detection of specific DNA or RNA molecules based on the finding that BODIPY® FL fluorescence was quenched by its interaction with a uniquely positioned guanine. This approach makes use of an oligonucleotide probe or primer containing a BODIPY® FL-modified cytosine at its 5′-end. When such a probe was hybridized with a target DNA, its fluorescence was quenched by the guanine in the target, complementary to the modified cytosine, and the quench rate was proportional to the amount of target DNA. This widely applicable technique will be used directly with larger samples or in conjunction with the polymerase chain reaction to quantify small DNA samples. PMID:11239011

  11. The Globular State of the Single-Stranded RNA: Effect of the Secondary Structure Rearrangements (United States)

    Grigoryan, Zareh A.; Karapetian, Armen T.


    The mutual influence of the slow rearrangements of secondary structure and fast collapse of the long single-stranded RNA (ssRNA) in approximation of coarse-grained model is studied with analytic calculations. It is assumed that the characteristic time of the secondary structure rearrangement is much longer than that for the formation of the tertiary structure. A nonequilibrium phase transition of the 2nd order has been observed. PMID:26345143

  12. The Globular State of the Single-Stranded RNA: Effect of the Secondary Structure Rearrangements

    Directory of Open Access Journals (Sweden)

    Zareh A. Grigoryan


    Full Text Available The mutual influence of the slow rearrangements of secondary structure and fast collapse of the long single-stranded RNA (ssRNA in approximation of coarse-grained model is studied with analytic calculations. It is assumed that the characteristic time of the secondary structure rearrangement is much longer than that for the formation of the tertiary structure. A nonequilibrium phase transition of the 2nd order has been observed.

  13. Bacillus subtilis DNA polymerases, PolC and DnaE, are required for both leading and lagging strand synthesis in SPP1 origin-dependent DNA replication (United States)

    Seco, Elena M.


    Abstract Firmicutes have two distinct replicative DNA polymerases, the PolC leading strand polymerase, and PolC and DnaE synthesizing the lagging strand. We have reconstituted in vitro Bacillus subtilis bacteriophage SPP1 θ-type DNA replication, which initiates unidirectionally at oriL. With this system we show that DnaE is not only restricted to lagging strand synthesis as previously suggested. DnaG primase and DnaE polymerase are required for initiation of DNA replication on both strands. DnaE and DnaG synthesize in concert a hybrid RNA/DNA ‘initiation primer’ on both leading and lagging strands at the SPP1 oriL region, as it does the eukaryotic Pol α complex. DnaE, as a RNA-primed DNA polymerase, extends this initial primer in a reaction modulated by DnaG and one single-strand binding protein (SSB, SsbA or G36P), and hands off the initiation primer to PolC, a DNA-primed DNA polymerase. Then, PolC, stimulated by DnaG and the SSBs, performs the bulk of DNA chain elongation at both leading and lagging strands. Overall, these modulations by the SSBs and DnaG may contribute to the mechanism of polymerase switch at Firmicutes replisomes. PMID:28575448

  14. Procedure for normalization of cDNA libraries (United States)

    Bonaldo, Maria DeFatima; Soares, Marcelo Bento


    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

  15. mtSSB may sequester UNG1 at mitochondrial ssDNA and delay uracil processing until the dsDNA conformation is restored

    DEFF Research Database (Denmark)

    Wollen Steen, Kristian; Doseth, Berit; westbye, Marianne


    Single-strand DNA binding proteins protect DNA from nucleolytic damage, prevent formation of secondary structures and prevent premature reannealing of DNA in DNA metabolic transactions. In eukaryotes, the nuclear single-strand DNA binding protein RPA is essential for chromosomal DNA replication...

  16. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek


    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  17. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus. (United States)

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R


    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  18. PCNA mono-ubiquitination and activation of translesion DNA polymerases by DNA polymerase {alpha}. (United States)

    Suzuki, Motoshi; Niimi, Atsuko; Limsirichaikul, Siripan; Tomida, Shuta; Miao Huang, Qin; Izuta, Shunji; Usukura, Jiro; Itoh, Yasutomo; Hishida, Takashi; Akashi, Tomohiro; Nakagawa, Yoshiyuki; Kikuchi, Akihiko; Pavlov, Youri; Murate, Takashi; Takahashi, Takashi


    Translesion DNA synthesis (TLS) involves PCNA mono-ubiquitination and TLS DNA polymerases (pols). Recent evidence has shown that the mono-ubiquitination is induced not only by DNA damage but also by other factors that induce stalling of the DNA replication fork. We studied the effect of spontaneous DNA replication errors on PCNA mono-ubiquitination and TLS induction. In the pol1L868F strain, which expressed an error-prone pol alpha, PCNA was spontaneously mono-ubiquitinated. Pol alpha L868F had a rate-limiting step at the extension from mismatched primer termini. Electron microscopic observation showed the accumulation of a single-stranded region at the DNA replication fork in yeast cells. For pol alpha errors, pol zeta participated in a generation of +1 frameshifts. Furthermore, in the pol1L868F strain, UV-induced mutations were lower than in the wild-type and a pol delta mutant strain (pol3-5DV), and deletion of the RAD30 gene (pol eta) suppressed this defect. These data suggest that nucleotide misincorporation by pol alpha induces exposure of single-stranded DNA, PCNA mono-ubiquitination and activates TLS pols.

  19. Optimized mtDNA Control Region Primer Extension Capture Analysis for Forensically Relevant Samples and Highly Compromised mtDNA of Different Age and Origin

    Directory of Open Access Journals (Sweden)

    Mayra Eduardoff


    Full Text Available The analysis of mitochondrial DNA (mtDNA has proven useful in forensic genetics and ancient DNA (aDNA studies, where specimens are often highly compromised and DNA quality and quantity are low. In forensic genetics, the mtDNA control region (CR is commonly sequenced using established Sanger-type Sequencing (STS protocols involving fragment sizes down to approximately 150 base pairs (bp. Recent developments include Massively Parallel Sequencing (MPS of (multiplex PCR-generated libraries using the same amplicon sizes. Molecular genetic studies on archaeological remains that harbor more degraded aDNA have pioneered alternative approaches to target mtDNA, such as capture hybridization and primer extension capture (PEC methods followed by MPS. These assays target smaller mtDNA fragment sizes (down to 50 bp or less, and have proven to be substantially more successful in obtaining useful mtDNA sequences from these samples compared to electrophoretic methods. Here, we present the modification and optimization of a PEC method, earlier developed for sequencing the Neanderthal mitochondrial genome, with forensic applications in mind. Our approach was designed for a more sensitive enrichment of the mtDNA CR in a single tube assay and short laboratory turnaround times, thus complying with forensic practices. We characterized the method using sheared, high quantity mtDNA (six samples, and tested challenging forensic samples (n = 2 as well as compromised solid tissue samples (n = 15 up to 8 kyrs of age. The PEC MPS method produced reliable and plausible mtDNA haplotypes that were useful in the forensic context. It yielded plausible data in samples that did not provide results with STS and other MPS techniques. We addressed the issue of contamination by including four generations of negative controls, and discuss the results in the forensic context. We finally offer perspectives for future research to enable the validation and accreditation of the PEC MPS

  20. Novel primer specific false terminations during DNA sequencing reactions: danger of inaccuracy of mutation analysis in molecular diagnostics (United States)

    Anwar, R; Booth, A; Churchill, A J; Markham, A F


    The determination of nucleotide sequence is fundamental to the identification and molecular analysis of genes. Direct sequencing of PCR products is now becoming a commonplace procedure for haplotype analysis, and for defining mutations and polymorphism within genes, particularly for diagnostic purposes. A previously unrecognised phenomenon, primer related variability, observed in sequence data generated using Taq cycle sequencing and T7 Sequenase sequencing, is reported. This suggests that caution is necessary when interpreting DNA sequence data. This is particularly important in situations where treatment may be dependent on the accuracy of the molecular diagnosis. Images PMID:16696096

  1. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman


    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  2. PARP inhibition versus PARP-1 silencing: different outcomes in terms of single-strand break repair and radiation susceptibility

    International Nuclear Information System (INIS)

    Godon, C.; Cordelieres, F.P.; Giocanti, N.; Megnin-Chanet, F.; Hall, J.; Favaudon, V.; Godon, C.; Giocanti, N.; Megnin-Chanet, F.; Hall, J.; Favaudon, V.; Cordelieres, F.P.; Cordelieres, F.P.; Biard, D.


    The consequences of PARP-1 disruption or inhibition on DNA single-strand break repair (SSBR) and radio-induced lethality were determined in synchronized, iso-genic HeLa cells stably silenced or not for poly(ADP-ribose) polymerase-1 (PARP-1) (PARP-1(KD)) or XRCC1 (XRCC1(KD)). PARP-1 inhibition prevented XRCC1-YFP recruitment at sites of 405 nm laser micro irradiation, slowed SSBR 10-fold and triggered the accumulation of large persistent foci of GFP-PARP-1 and GFP-PCNA at photo damaged sites. These aggregates are presumed to hinder the recruitment of other effectors of the base excision repair (BER) pathway.PARP-1 silencing also prevented XRCC1-YFP recruitment but did not lengthen the lifetime of GFP-PCNA foci. Moreover, PARP-1(KD) and XRCC1(KD) cells in S phase completed SSBR as rapidly as controls, while SSBR was delayed in G1. Taken together, the data demonstrate that a PARP-1- and XRCC1-independent SSBR pathway operates when the short patch repair branch of the BER is deficient. Long patch repair is the likely mechanism, as GFP-PCNA recruitment at photo-damaged sites was normal in PARP-1(KD) cells. PARP-1 silencing elicited hyper-radiosensitivity, while radiosensitization by a PARP inhibitor reportedly occurs only in those cells treated in S phase. PARP-1 inhibition and deletion thus have different outcomes in terms of SSBR and radiosensitivity. (authors)

  3. Distinct spatio temporal patterns and PARP dependence of XRCC1 recruitment to single-strand break and base excision repair

    International Nuclear Information System (INIS)

    Campalans, Anna; Kortulewski, Thierry; Amouroux, Rachel; Radicella, J. Pablo; Menoni, Herve; Vermeulen, Wim


    Single-strand break repair (SSBR) and base excision repair (BER) of modified bases and abasic sites share several players. Among them is XRCC1, an essential scaffold protein with no enzymatic activity, required for the coordination of both pathways. XRCC1 is recruited to SSBR by PARP-1, responsible for the initial recognition of the break. The recruitment of XRCC1 to BER is still poorly understood. Here we show by using both local and global induction of oxidative DNA base damage that XRCC1 participation in BER complexes can be distinguished from that in SSBR by several criteria. We show first that XRCC1 recruitment to BER is independent of PARP. Second, unlike SSBR complexes that are assembled within minutes after global damage induction, XRCC1 is detected later in BER patches, with kinetics consistent with the repair of oxidized bases. Third, while XRCC1-containing foci associated with SSBR are formed both in eu- and heterochromatin domains, BER complexes are assembled in patches that are essentially excluded from heterochromatin and where the oxidized bases are detected. (authors)

  4. Primer and barcode gap identification and DNA barcode generation for species discrimination in plants


    Deepu Mathew


    This book chapter details the protocols for DNA barcoding in plants, starting from DNA isolation, sequencing, sequence annotation using MEGA, till identification of barcode gaps. A good chapter for beginners in plant taxonomy

  5. Absorption by DNA single strands of adenine isolated in vacuo: The role of multiple chromophores

    DEFF Research Database (Denmark)

    Nielsen, L.M.; Pedersen, S.O.; Kirketerp, M.-B.S.


    to that for the adenine molecule and the dAMP mononucleotide. Desolvation has little effect on the bandwidth, which implies that inhomogenous broadening of the absorption bands in aqueous solution is of minor importance compared to, e.g., conformational disorder. Finally, at high photon energies, internal conversion...

  6. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.


    and does not represent a recent acquirement of the phage. The P1 and E. coli SSB proteins are fully functionally interchangeable. SSB-P1 is nonessential for phage growth in an exponentially growing E. coli host, and it is sufficient to promote bacterial growth in the absence of the E. coli SSB protein....... Expression studies showed that the P1 ssb gene is transcribed only, in an rpoS-independent fashion, during stationary-phase growth in E. coli. Mixed infection experiments demonstrated that a wild-type phage has a selective advantage over an ssb-null mutant when exposed to a bacterial host in the stationary...


    Arsenic (As) is a carcinogen whose most important target organs include the skin and lungs. Exposure can occur via water ingestion, or inhalation, as As is a by-product of fossil fuel combustion and other industrial activities. The carcinogenic mechanism of action for As remains ...

  8. PolyA Single Strand DNA Translocation Through an Alpha-Hemolysin Pore Stem (United States)

    OKeeffe, James; Cozmuta, Ioana; Stolc, Viktor


    A new model for the polymer-pore interaction energy is introduced, based on an atomic-scale description of coulombic polymer-pore interaction. The enhanced drift velocity, experimentally observed for short polymers, is successfully accounted for, using this interaction energy model. For R/R(sub 0)>4 (R(sub 0)=7 angstroms) the translocation velocity approaches the free space drift velocity v(sub 0). This motivates the need to appropriately derivatize artificial nanopores, where R>R(sub 0).

  9. A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B. (United States)

    DeGrasse, Jeffrey A


    The bacterium Staphylococcus aureus is a common foodborne pathogen capable of secreting a cocktail of small, stable, and strain-specific, staphylococcal enterotoxins (SEs). Staphylococcal food poisoning (SFP) results when improperly handled food contaminated with SEs is consumed. Gastrointestinal symptoms of SFP include emesis, diarrhea and severe abdominal pain, which manifest within hours of ingesting contaminated food. Immuno-affinity based methods directly detect, identify, and quantify several SEs within a food or clinical sample. However, the success of these assays depends upon the availability of a monoclonal antibody, the development of which is non-trivial and costly. The current scope of the available immuno-affinity based methods is limited to the classical SEs and does not encompass all of the known or emergent SEs. In contrast to antibodies, aptamers are short nucleic acids that exhibit high affinity and specificity for their targets without the high-costs and ethical concerns of animal husbandry. Further, researchers may choose to freely distribute aptamers and develop assays without the proprietary issues that increase the per-sample cost of immuno-affinity assays. This study describes a novel aptamer, selected in vitro, with affinity to staphylococcal enterotoxin B (SEB) that may be used in lieu of antibodies in SE detection assays. The aptamer, designated APT(SEB1), successfully isolates SEB from a complex mixture of SEs with extremely high discrimination. This work sets the foundation for future aptamer and assay development towards the entire family of SEs. The rapid, robust, and low-cost identification and quantification of all of the SEs in S. aureus contaminated food is essential for food safety and epidemiological efforts. An in vitro generated library of SE aptamers could potentially allow for the comprehensive and cost-effective analysis of food samples that immuno-affinity assays currently cannot provide.

  10. A Single-Stranded DNA Aptamer That Selectively Binds to Staphylococcus aureus Enterotoxin B


    DeGrasse, Jeffrey A.


    The bacterium Staphylococcus aureus is a common foodborne pathogen capable of secreting a cocktail of small, stable, and strain-specific, staphylococcal enterotoxins (SEs). Staphylococcal food poisoning (SFP) results when improperly handled food contaminated with SEs is consumed. Gastrointestinal symptoms of SFP include emesis, diarrhea and severe abdominal pain, which manifest within hours of ingesting contaminated food. Immuno-affinity based methods directly detect, identify, and quantify s...

  11. A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B.

    Directory of Open Access Journals (Sweden)

    Jeffrey A DeGrasse

    Full Text Available The bacterium Staphylococcus aureus is a common foodborne pathogen capable of secreting a cocktail of small, stable, and strain-specific, staphylococcal enterotoxins (SEs. Staphylococcal food poisoning (SFP results when improperly handled food contaminated with SEs is consumed. Gastrointestinal symptoms of SFP include emesis, diarrhea and severe abdominal pain, which manifest within hours of ingesting contaminated food. Immuno-affinity based methods directly detect, identify, and quantify several SEs within a food or clinical sample. However, the success of these assays depends upon the availability of a monoclonal antibody, the development of which is non-trivial and costly. The current scope of the available immuno-affinity based methods is limited to the classical SEs and does not encompass all of the known or emergent SEs. In contrast to antibodies, aptamers are short nucleic acids that exhibit high affinity and specificity for their targets without the high-costs and ethical concerns of animal husbandry. Further, researchers may choose to freely distribute aptamers and develop assays without the proprietary issues that increase the per-sample cost of immuno-affinity assays. This study describes a novel aptamer, selected in vitro, with affinity to staphylococcal enterotoxin B (SEB that may be used in lieu of antibodies in SE detection assays. The aptamer, designated APT(SEB1, successfully isolates SEB from a complex mixture of SEs with extremely high discrimination. This work sets the foundation for future aptamer and assay development towards the entire family of SEs. The rapid, robust, and low-cost identification and quantification of all of the SEs in S. aureus contaminated food is essential for food safety and epidemiological efforts. An in vitro generated library of SE aptamers could potentially allow for the comprehensive and cost-effective analysis of food samples that immuno-affinity assays currently cannot provide.

  12. Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.

    Directory of Open Access Journals (Sweden)

    Indhu Kanakaraj

    Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.

  13. Kinetics of end-to-end collision in short single-stranded nucleic acids. (United States)

    Wang, Xiaojuan; Nau, Werner M


    A novel fluorescence-based method, which entails contact quenching of the long-lived fluorescent state of 2,3-diazabicyclo[2.2.2]-oct-2-ene (DBO), was employed to measure the kinetics of end-to-end collision in short single-stranded oligodeoxyribonucleotides of the type 5'-DBO-(X)n-dG with X = dA, dC, dT, or dU and n = 2 or 4. The fluorophore was covalently attached to the 5' end and dG was introduced as an efficient intrinsic quencher at the 3' terminus. The end-to-end collision rates, which can be directly related to the efficiency of intramolecular fluorescence quenching, ranged from 0.1 to 9.0 x 10(6) s(-1). They were strongly dependent on the strand length, the base sequence, as well as the temperature. Oligonucleotides containing dA in the backbone displayed much slower collision rates and significantly higher positive activation energies than strands composed of pyrimidine bases, suggesting a higher intrinsic rigidity of oligoadenylate. Comparison of the measured collision rates in short single-stranded oligodeoxyribonucleotides with the previously reported kinetics of hairpin formation indicates that the intramolecular collision is significantly faster than the nucleation step of hairpin closing. This is consistent with the configurational diffusion model suggested by Ansari et al. (Ansari, A.; Kuznetsov, S. V.; Shen, Y. Proc.Natl. Acad. Sci. USA 2001, 98, 7771-7776), in which the formation of misfolded loops is thought to slow hairpin formation.

  14. DNA repair in mutagen-injured higher plants

    International Nuclear Information System (INIS)

    Veleminsky, J.; Gichner, T.


    Data are summarized proving the occurrence of photoreactivation of UV-induced pyrimidine dimers in cells of Nicotiana tabucum, Gingko and carrot, the excision of dimers in cells of Nicotiana tabacum, Gingko and carrot, the excision of dimers in protoplasts of carrot and in embryos of Lathyrus sativus, and the repair of DNA single-strand breaks induced in carrot protoplasts and barley embryonic cells by ionizing radiation. In irradiated barley embryos the unscheduled DNA synthesis and higher accessibility of induced primers to DNA polymerase I of E. coli were observed preferentially in G 1 cells with diffused chromatin. These reactions were inhibited by caffeine and EDTA. Unscheduled DNA synthesis was also observed in synchronized irradiated root cuttings of Vicia faba and in barley embryos treated with 4-nitroquinoline oxide, the latter being inhibited by caffeine and hydroxyurea. Repair synthesis was also established in barley embryos treated with mutagenic N-methyl-N-nitrosourea under conditions that postponed the onset of germination after the treatment. The same conditions enhanced the repair of DNA single-strand breaks induced by this mutagen and several other monofunctional alkylating compounds. From tissues of barley and of Phaseolus multiflorus, endonucleases for apurinic sites were isolated and characterized. Some of them are located in chromatin, others in chloroplasts. The relation between DNA repair and genetic effects of mutagens in higher plants is also discussed. (Auth.)

  15. Reverse transcription using random pentadecamer primers increases yield and quality of resulting cDNA

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Dufva, I.H.; Dufva, Hans Martin


    oligonucleotides (pentadecamers) consistently, yielded at least 2 fold as much cDNA as did random hexamers using either-poly(A) RNA or an amplified version of messenger RNA (aRNA) as a template. The cDNA generated using pentadecamers did not differ in size distribution or the amount of incorporated label compared...... with cDNA generated with random hexamers. The increased efficiency of priming using random pentadecamers resulted in reverse transcription of > 80% of the template aRNA, while random hexamers induced reverse transcription of only 40% of the template aRNA. This suggests a better coverage...... that random pentadecamers can replace random hexamers in reverse transcription reactions on both poly(A) RNA and amplified RNA, resulting in higher cDNA yields and quality....

  16. Torsional regulation of hRPA-induced unwinding of double-stranded DNA

    NARCIS (Netherlands)

    De Vlaminck, I.; Vidic, I.; Van Loenhout, M.T.J.; Kanaar, R.; Lebbink, J.H.G.; Dekker, C.


    All cellular single-stranded (ss) DNA is rapidly bound and stabilized by single stranded DNA-binding proteins (SSBs). Replication protein A, the main eukaryotic SSB, is able to unwind double-stranded (ds) DNA by binding and stabilizing transiently forming bubbles of ssDNA. Here, we study the

  17. DNA-binding proteins essential for protein-primed bacteriophage ø29 DNA replication

    Directory of Open Access Journals (Sweden)

    Margarita Salas


    Full Text Available Bacillus subtilis phage Φ29 has a linear, double-stranded DNA 19 kb long with an inverted terminal repeat of 6 nucleotides and a protein covalently linked to the 5’ ends of the DNA. This protein, called terminal protein (TP, is the primer for the initiation of replication, a reaction catalyzed by the viral DNA polymerase at the two DNA ends. The DNA polymerase further elongates the nascent DNA chain in a processive manner, coupling strand displacement with elongation. The viral protein p5 is a single-stranded DNA binding protein (SSB that binds to the single strands generated by strand displacement during the elongation process. Viral protein p6 is a double-stranded DNA binding protein (DBP that preferentially binds to the origins of replication at the Φ29 DNA ends and is required for the initiation of replication. Both SSB and DBP are essential for Φ29 DNA amplification. This review focuses on the role of these phage DNA-binding proteins in Φ29 DNA replication both in vitro and in vivo, as well as on the implication of several B. subtilis DNA-binding proteins in different processes of the viral cycle. We will revise the enzymatic activities of the Φ29 DNA polymerase: TP-deoxynucleotidylation, processive DNA polymerization coupled to strand displacement, 3’-5’ exonucleolysis and pyrophosphorolysis. The resolution of the Φ29 DNA polymerase structure has shed light on the translocation mechanism and the determinants responsible for processivity and strand displacement. These two properties have made Φ29 DNA polymerase one of the main enzymes used in the current DNA amplification technologies. The determination of the structure of Φ29 TP revealed the existence of three domains: the priming domain, where the primer residue Ser232, as well as Phe230, involved in the determination of the initiating nucleotide, are located, the intermediate domain, involved in DNA polymerase binding, and the N-terminal domain, responsible for DNA binding

  18. An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection (United States)

    Elkins, Kelly M.; Kadunc, Raelynn E.


    In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

  19. A need for standardization in drinking water analysis – an investigation of DNA extraction procedure, primer choice and detection limit of 16S rRNA amplicon sequencing

    DEFF Research Database (Denmark)

    Brandt, Jakob; Nielsen, Per Halkjær; Albertsen, Mads

    have been made to illuminate the effects specifically related to bacterial communities in drinking water. In this study, we investigated the impact of the DNA extraction and primer choice on the observed community structure, and we also estimated the detection limit of the 16S rRNA amplicon sequencing...

  20. Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples (United States)

    Su, Lei; Zhang, Qianqian; Gong, Jun


    Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

  1. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotylenons

    DEFF Research Database (Denmark)

    Scarcelli, Nora; Bernaud, Adeline; Eiserhardt, Wolf L.


    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we...... anticipate that it will also be useful for phylogeny and bar-coding studies....

  2. Characterization of a novel single-stranded RNA mycovirus in pleurotus ostreatus

    International Nuclear Information System (INIS)

    Yu, Hyun Jae; Lim, Dongbin; Lee, Hyun-Sook


    A mycovirus, named oyster mushroom spherical virus (OMSV), was isolated from cultivated oyster mushrooms with a severe epidemic of oyster mushroom Die-back disease. OMSV was a 27-nm spherical virus encapsidating a single-stranded RNA (ssRNA) of 5.784 kb with a coat protein of approximately 28.5 kDa. The nucleotide sequence of the virus revealed that its genomic RNA was positive strand, containing 5784 bases with seven open reading frames (ORF). ORF1 had the motifs of RNA-dependent RNA polymerases (RdRp) and helicase. ORF2 encoded a coat protein. ORF3 to 7 could encode putative polypeptides of approximately 12, 12.5, 21, 14.5, and 23 kDa, respectively, but none of them showed significant similarity to any other known polypeptides. The 5' end of the viral RNA was uncapped and the 3' end was polyadenylated with 74 bases. Genomic structure and organization and the derived amino acid sequence of RdRp and helicase domain were similar to those of tymoviruses, a plant virus group

  3. Fragment-based modelling of single stranded RNA bound to RNA recognition motif containing proteins (United States)

    de Beauchene, Isaure Chauvot; de Vries, Sjoerd J.; Zacharias, Martin


    Abstract Protein-RNA complexes are important for many biological processes. However, structural modeling of such complexes is hampered by the high flexibility of RNA. Particularly challenging is the docking of single-stranded RNA (ssRNA). We have developed a fragment-based approach to model the structure of ssRNA bound to a protein, based on only the protein structure, the RNA sequence and conserved contacts. The conformational diversity of each RNA fragment is sampled by an exhaustive library of trinucleotides extracted from all known experimental protein–RNA complexes. The method was applied to ssRNA with up to 12 nucleotides which bind to dimers of the RNA recognition motifs (RRMs), a highly abundant eukaryotic RNA-binding domain. The fragment based docking allows a precise de novo atomic modeling of protein-bound ssRNA chains. On a benchmark of seven experimental ssRNA–RRM complexes, near-native models (with a mean heavy-atom deviation of <3 Å from experiment) were generated for six out of seven bound RNA chains, and even more precise models (deviation < 2 Å) were obtained for five out of seven cases, a significant improvement compared to the state of the art. The method is not restricted to RRMs but was also successfully applied to Pumilio RNA binding proteins. PMID:27131381

  4. Packaging signals in single-stranded RNA viruses: nature's alternative to a purely electrostatic assembly mechanism. (United States)

    Stockley, Peter G; Twarock, Reidun; Bakker, Saskia E; Barker, Amy M; Borodavka, Alexander; Dykeman, Eric; Ford, Robert J; Pearson, Arwen R; Phillips, Simon E V; Ranson, Neil A; Tuma, Roman


    The formation of a protective protein container is an essential step in the life-cycle of most viruses. In the case of single-stranded (ss)RNA viruses, this step occurs in parallel with genome packaging in a co-assembly process. Previously, it had been thought that this process can be explained entirely by electrostatics. Inspired by recent single-molecule fluorescence experiments that recapitulate the RNA packaging specificity seen in vivo for two model viruses, we present an alternative theory, which recognizes the important cooperative roles played by RNA-coat protein interactions, at sites we have termed packaging signals. The hypothesis is that multiple copies of packaging signals, repeated according to capsid symmetry, aid formation of the required capsid protein conformers at defined positions, resulting in significantly enhanced assembly efficiency. The precise mechanistic roles of packaging signal interactions may vary between viruses, as we have demonstrated for MS2 and STNV. We quantify the impact of packaging signals on capsid assembly efficiency using a dodecahedral model system, showing that heterogeneous affinity distributions of packaging signals for capsid protein out-compete those of homogeneous affinities. These insights pave the way to a new anti-viral therapy, reducing capsid assembly efficiency by targeting of the vital roles of the packaging signals, and opens up new avenues for the efficient construction of protein nanocontainers in bionanotechnology.

  5. Precise gene modification mediated by TALEN and single-stranded oligodeoxynucleotides in human cells.

    Directory of Open Access Journals (Sweden)

    Xiaoling Wang

    Full Text Available The development of human embryonic stem cells (ESCs and induced pluripotent stem cells (iPSCs facilitates in vitro studies of human disease mechanisms, speeds up the process of drug screening, and raises the feasibility of using cell replacement therapy in clinics. However, the study of genotype-phenotype relationships in ESCs or iPSCs is hampered by the low efficiency of site-specific gene editing. Transcription activator-like effector nucleases (TALENs spurred interest due to the ease of assembly, high efficiency and faithful gene targeting. In this study, we optimized the TALEN design to maximize its genomic cutting efficiency. We showed that using optimized TALENs in conjunction with single-strand oligodeoxynucleotide (ssODN allowed efficient gene editing in human cells. Gene mutations and gene deletions for up to 7.8 kb can be accomplished at high efficiencies. We established human tumor cell lines and H9 ESC lines with homozygous deletion of the microRNA-21 (miR-21 gene and miR-9-2 gene. These cell lines provide a robust platform to dissect the roles these genes play during cell differentiation and tumorigenesis. We also observed that the endogenous homologous chromosome can serve as a donor template for gene editing. Overall, our studies demonstrate the versatility of using ssODN and TALEN to establish genetically modified cells for research and therapeutic application.

  6. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong


    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  7. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks. (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P


    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  8. The Mini-Chromosome Maintenance (Mcm) Complexes Interact with DNA Polymerase α-Primase and Stimulate Its Ability to Synthesize RNA Primers (United States)

    You, Zhiying; De Falco, Mariarosaria; Kamada, Katsuhiko; Pisani, Francesca M.; Masai, Hisao


    The Mini-chromosome maintenance (Mcm) proteins are essential as central components for the DNA unwinding machinery during eukaryotic DNA replication. DNA primase activity is required at the DNA replication fork to synthesize short RNA primers for DNA chain elongation on the lagging strand. Although direct physical and functional interactions between helicase and primase have been known in many prokaryotic and viral systems, potential interactions between helicase and primase have not been explored in eukaryotes. Using purified Mcm and DNA primase complexes, a direct physical interaction is detected in pull-down assays between the Mcm2∼7 complex and the hetero-dimeric DNA primase composed of the p48 and p58 subunits. The Mcm4/6/7 complex co-sediments with the primase and the DNA polymerase α-primase complex in glycerol gradient centrifugation and forms a Mcm4/6/7-primase-DNA ternary complex in gel-shift assays. Both the Mcm4/6/7 and Mcm2∼7 complexes stimulate RNA primer synthesis by DNA primase in vitro. However, primase inhibits the Mcm4/6/7 helicase activity and this inhibition is abolished by the addition of competitor DNA. In contrast, the ATP hydrolysis activity of Mcm4/6/7 complex is not affected by primase. Mcm and primase proteins mutually stimulate their DNA-binding activities. Our findings indicate that a direct physical interaction between primase and Mcm proteins may facilitate priming reaction by the former protein, suggesting that efficient DNA synthesis through helicase-primase interactions may be conserved in eukaryotic chromosomes. PMID:23977294

  9. The mini-chromosome maintenance (Mcm complexes interact with DNA polymerase α-primase and stimulate its ability to synthesize RNA primers.

    Directory of Open Access Journals (Sweden)

    Zhiying You

    Full Text Available The Mini-chromosome maintenance (Mcm proteins are essential as central components for the DNA unwinding machinery during eukaryotic DNA replication. DNA primase activity is required at the DNA replication fork to synthesize short RNA primers for DNA chain elongation on the lagging strand. Although direct physical and functional interactions between helicase and primase have been known in many prokaryotic and viral systems, potential interactions between helicase and primase have not been explored in eukaryotes. Using purified Mcm and DNA primase complexes, a direct physical interaction is detected in pull-down assays between the Mcm2~7 complex and the hetero-dimeric DNA primase composed of the p48 and p58 subunits. The Mcm4/6/7 complex co-sediments with the primase and the DNA polymerase α-primase complex in glycerol gradient centrifugation and forms a Mcm4/6/7-primase-DNA ternary complex in gel-shift assays. Both the Mcm4/6/7 and Mcm2~7 complexes stimulate RNA primer synthesis by DNA primase in vitro. However, primase inhibits the Mcm4/6/7 helicase activity and this inhibition is abolished by the addition of competitor DNA. In contrast, the ATP hydrolysis activity of Mcm4/6/7 complex is not affected by primase. Mcm and primase proteins mutually stimulate their DNA-binding activities. Our findings indicate that a direct physical interaction between primase and Mcm proteins may facilitate priming reaction by the former protein, suggesting that efficient DNA synthesis through helicase-primase interactions may be conserved in eukaryotic chromosomes.

  10. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D


    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  11. Phylogenetic Analysis and Molecular Characterization of Xanthium sibiricum Using DNA Barcoding, PCR-RFLP, and Specific Primers. (United States)

    Tomasello, Salvatore; Heubl, Günther


    The fruits of Xanthium sibiricum have been widely used in traditional Chinese medicine for the treatment of nasal sinusitis and headaches. The genus Xanthium (cocklebur) is a taxonomically complex genus. Different taxonomic concepts have been proposed, some including several species, others lumping the different taxa in a few extremely polymorphic species. Due to the morphological similarities between species, the correct authentication of X. sibiricum is very difficult. Therefore, we established a polymerase chain reaction-restriction fragment length polymorphism method and diagnostic PCR based on nuclear internal transcribed spacer and chloroplast trnQ-rps16 barcodes to differentiate X. sibirium from related species.Results from the phylogenetic analyses based on sequence information from four marker regions (plastidal psbA-trnH and trnQ-rps16 and nuclear ITS and D35 ) support those taxonomic concepts accepting a reduced number of species, as four to five major clades are revealed in the phylogenetic reconstructions. X. sibiricum , together with some accessions from closely related taxa, is always supported as monophyletic, constituting a well-defined genetic entity. Allele-specific primer pairs for ITS and trnQ-rps16 were designed to amplify diagnostic products from the genomic DNA of X. sibiricum . Specific PCR in combination with digestion using the restriction enzyme Mse I allowed for the identification of X. sibiricum by producing specific restriction patterns. The results demonstrate that the applied techniques provide effective and accurate authentication of X. sibiricum . Georg Thieme Verlag KG Stuttgart · New York.

  12. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses. (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn


    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  13. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide


    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  14. Preparation of Phi29 DNA polymerase free of amplifiable DNA using ethidium monoazide, an ultraviolet-free light-emitting diode lamp and trehalose.

    Directory of Open Access Journals (Sweden)

    Hirokazu Takahashi

    Full Text Available We previously reported that multiply-primed rolling circle amplification (MRPCA using modified random RNA primers can amplify tiny amounts of circular DNA without producing any byproducts. However, contaminating DNA in recombinant Phi29 DNA polymerase adversely affects the outcome of MPRCA, especially for negative controls such as non-template controls. The amplified DNA in negative control casts doubt on the result of DNA amplification. Since Phi29 DNA polymerase has high affinity for both single-strand and double-stranded DNA, some amount of host DNA will always remain in the recombinant polymerase. Here we describe a procedure for preparing Phi29 DNA polymerase which is essentially free of amplifiable DNA. This procedure is realized by a combination of host DNA removal using appropriate salt concentrations, inactivation of amplifiable DNA using ethidium monoazide, and irradiation with visible light from a light-emitting diode lamp. Any remaining DNA, which likely exists as oligonucleotides captured by the Phi29 DNA polymerase, is degraded by the 3'-5' exonuclease activity of the polymerase itself in the presence of trehalose, used as an anti-aggregation reagent. Phi29 DNA polymerase purified by this procedure has little amplifiable DNA, resulting in reproducible amplification of at least ten copies of plasmid DNA without any byproducts and reducing reaction volume. This procedure could aid the amplification of tiny amounts DNA, thereby providing clear evidence of contamination from laboratory environments, tools and reagents.

  15. Lingering single-strand breaks trigger Rad51-independent homology-directed repair of collapsed replication forks in the polynucleotide kinase/phosphatase mutant of fission yeast.

    Directory of Open Access Journals (Sweden)

    Arancha Sanchez


    Full Text Available The DNA repair enzyme polynucleotide kinase/phosphatase (PNKP protects genome integrity by restoring ligatable 5'-phosphate and 3'-hydroxyl termini at single-strand breaks (SSBs. In humans, PNKP mutations underlie the neurological disease known as MCSZ, but these individuals are not predisposed for cancer, implying effective alternative repair pathways in dividing cells. Homology-directed repair (HDR of collapsed replication forks was proposed to repair SSBs in PNKP-deficient cells, but the critical HDR protein Rad51 is not required in PNKP-null (pnk1Δ cells of Schizosaccharomyces pombe. Here, we report that pnk1Δ cells have enhanced requirements for Rad3 (ATR/Mec1 and Chk1 checkpoint kinases, and the multi-BRCT domain protein Brc1 that binds phospho-histone H2A (γH2A at damaged replication forks. The viability of pnk1Δ cells depends on Mre11 and Ctp1 (CtIP/Sae2 double-strand break (DSB resection proteins, Rad52 DNA strand annealing protein, Mus81-Eme1 Holliday junction resolvase, and Rqh1 (BLM/WRN/Sgs1 DNA helicase. Coupled with increased sister chromatid recombination and Rad52 repair foci in pnk1Δ cells, these findings indicate that lingering SSBs in pnk1Δ cells trigger Rad51-independent homology-directed repair of collapsed replication forks. From these data, we propose models for HDR-mediated tolerance of persistent SSBs with 3' phosphate in pnk1Δ cells.

  16. Opening the treasure chest: A DNA-barcoding primer set for most higher taxa of Central European birds and mammals from museum collections.

    Directory of Open Access Journals (Sweden)

    Sylvia Schäffer

    Full Text Available DNA-barcoding is a rapidly developing method for efficiently identifying samples to species level by means of short standard DNA sequences. However, reliable species assignment requires the availability of a comprehensive DNA barcode reference library, and hence numerous initiatives aim at generating such barcode databases for particular taxa or geographic regions. Historical museum collections represent a potentially invaluable source for the DNA-barcoding of many taxa. This is particularly true for birds and mammals, for which collecting fresh (voucher material is often very difficult to (nearly impossible due to the special animal welfare and conservation regulations that apply to vertebrates in general, and birds and mammals in particular. Moreover, even great efforts might not guarantee sufficiently complete sampling of fresh material in a short period of time. DNA extracted from historical samples is usually degraded, such that only short fragments can be amplified, rendering the recovery of the barcoding region as a single fragment impossible. Here, we present a new set of primers that allows the efficient amplification and sequencing of the entire barcoding region in most higher taxa of Central European birds and mammals in six overlapping fragments, thus greatly increasing the value of historical museum collections for generating DNA barcode reference libraries. Applying our new primer set in recently established NGS protocols promises to further increase the efficiency of barcoding old bird and mammal specimens.

  17. Near-Complete Genome Sequence of a Novel Single-Stranded RNA Virus Discovered in Indoor Air. (United States)

    Rosario, Karyna; Fierer, Noah; Breitbart, Mya


    Viral metagenomic analysis of heating, ventilation, and air conditioning (HVAC) filters recovered the near-complete genome sequence of a novel virus, named HVAC-associated R NA v irus 1 (HVAC-RV1). The HVAC-RV1 genome is most similar to those of picorna-like viruses identified in arthropods but encodes a small domain observed only in negative-sense single-stranded RNA viruses. Copyright © 2018 Rosario et al.

  18. Normal formation and repair of γ-radiation-induced single and double strand DNA breaks in Down syndrome fibroblasts

    International Nuclear Information System (INIS)

    Steiner, M.E.; Woods, W.G.


    Fibroblasts from patients with Down syndrome (Trisomy 21) were examined for repair capability of γ-radiation-induced single strand and double strand DNA breaks. Formation and repair of DNA breaks were determined by DNA alkaline and non-denaturing elution techniques. Down syndrome fibroblasts were found to repair single strand and double strand breaks as well as fibroblasts from normal controls. (orig.)

  19. Conformational Diversity of Single-Stranded DNA from Bacterial Repetitive Extragenic Palindromes: Implications for the DNA Recognition Elements of Transposases

    Czech Academy of Sciences Publication Activity Database

    Charnavets, Tatsiana; Nunvář, Jaroslav; Nečasová, Iva; Voelker, J.; Breslauer, K.J.; Schneider, Bohdan


    Roč. 103, č. 10 (2015), s. 585-596 ISSN 0006-3525 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109; GA ČR GAP305/12/1801; GA MŠk(CZ) EE2.3.30.0020 Institutional support: RVO:86652036 Keywords : bacterial repetitive extragenic palindromes (REP) * circular dichroism spectroscopy * REP associated tyrosine transposases (RAYTs) Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.248, year: 2015

  20. Role of electrostatics in the assembly pathway of a single-stranded RNA virus. (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M


    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  1. S1-sensitive sites in DNA after γ-irradiation

    International Nuclear Information System (INIS)

    Martin-Bertram, H.


    DNA from γ-irradiated T 1 bacteriophages was analyzed for 'single-stranded' sites by cleavage with S1 nuclease from Aspergillus oryzae as lesion probe. The ratio of 'S1-sensitive sites' to the amount of radiation-induced single-strand breaks was about one. Presumably these 'denatured' sites were associated with single-strand breaks. The subsequent check for the persistence of 'single-stranded' sites within the DNA molecule by thermokinetics demonstrated a strong affinity of the nuclease to its substrate, the single-stranded lesion, and a perfect excision. It is assumed that the direct absorption of radiation energy in the DNA gives rise to the formation of such bulky lesions. (Auth.)

  2. Faulty DNA repair following ultraviolet irradiation in Fanconi's anemia

    International Nuclear Information System (INIS)

    Poon, P.K.; Parker, J.W.; O'Brien, R.L.


    Fibroblasts from a patient with Fanconi's anemia were deficient in their ability to excise uv-induced pyrimidine dimers from their DNA but were capable of single-strand break production and unscheduled DNA synthesis

  3. MethPrimer: designing primers for methylation PCRs. (United States)

    Li, Long-Cheng; Dahiya, Rajvir


    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  4. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)


    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  5. Can DNA-Based Ecosystem Assessments Quantify Species Abundance? Testing Primer Bias and Biomass--Sequence Relationships with an Innovative Metabarcoding Protocol.

    Directory of Open Access Journals (Sweden)

    Vasco Elbrecht

    Full Text Available Metabarcoding is an emerging genetic tool to rapidly assess biodiversity in ecosystems. It involves high-throughput sequencing of a standard gene from an environmental sample and comparison to a reference database. However, no consensus has emerged regarding laboratory pipelines to screen species diversity and infer species abundances from environmental samples. In particular, the effect of primer bias and the detection limit for specimens with a low biomass has not been systematically examined, when processing samples in bulk. We developed and tested a DNA metabarcoding protocol that utilises the standard cytochrome c oxidase subunit I (COI barcoding fragment to detect freshwater macroinvertebrate taxa. DNA was extracted in bulk, amplified in a single PCR step, and purified, and the libraries were directly sequenced in two independent MiSeq runs (300-bp paired-end reads. Specifically, we assessed the influence of specimen biomass on sequence read abundance by sequencing 31 specimens of a stonefly species with known haplotypes spanning three orders of magnitude in biomass (experiment I. Then, we tested the recovery of 52 different freshwater invertebrate taxa of similar biomass using the same standard barcoding primers (experiment II. Each experiment was replicated ten times to maximise statistical power. The results of both experiments were consistent across replicates. We found a distinct positive correlation between species biomass and resulting numbers of MiSeq reads. Furthermore, we reliably recovered 83% of the 52 taxa used to test primer bias. However, sequence abundance varied by four orders of magnitudes between taxa despite the use of similar amounts of biomass. Our metabarcoding approach yielded reliable results for high-throughput assessments. However, the results indicated that primer efficiency is highly species-specific, which would prevent straightforward assessments of species abundance and biomass in a sample. Thus, PCR

  6. First large-scale DNA barcoding assessment of reptiles in the biodiversity hotspot of Madagascar, based on newly designed COI primers. (United States)

    Nagy, Zoltán T; Sonet, Gontran; Glaw, Frank; Vences, Miguel


    DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7-100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41-48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade without specialized expert knowledge.

  7. First Large-Scale DNA Barcoding Assessment of Reptiles in the Biodiversity Hotspot of Madagascar, Based on Newly Designed COI Primers (United States)

    Nagy, Zoltán T.; Sonet, Gontran; Glaw, Frank; Vences, Miguel


    Background DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Methodology/Principal Findings Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7–100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41–48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. Conclusions/Significance The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade

  8. Packaging signals in single-stranded RNA viruses: nature?s alternative to a purely electrostatic assembly mechanism


    Stockley, Peter G.; Twarock, Reidun; Bakker, Saskia E.; Barker, Amy M.; Borodavka, Alexander; Dykeman, Eric; Ford, Robert J.; Pearson, Arwen R.; Phillips, Simon E. V.; Ranson, Neil A.; Tuma, Roman


    The formation of a protective protein container is an essential step in the life-cycle of most viruses. In the case of single-stranded (ss)RNA viruses, this step occurs in parallel with genome packaging in a co-assembly process. Previously, it had been thought that this process can be explained entirely by electrostatics. Inspired by recent single-molecule fluorescence experiments that recapitulate the RNA packaging specificity seen in vivo for two model viruses, we present an alternative the...

  9. Expression of human DNA polymerase β in Escherichia coli and characterization of the recombinant enzyme

    International Nuclear Information System (INIS)

    Abbotts, J.; SenGupta, D.N.; Zmudzka, B.; Widen, S.G.; Notario, V.; Wilson, S.H.


    The coding region of a human β-polymerase cDNA, predicting a 335 amino acid protein, was subcloned in the Escherichia coli expression plasmid pRC23. After induction of transformed cells, the crude soluble extract was found to contain a new protein immunoreactive with β-polymerase antibody and corresponding in size to the protein deduced from the cDNA. This protein was purified in a yield of 1-2 mg/50 g of cells. The recombinant protein had about the same DNA polymerase specific activity as β-polymerase purified from mammalian tissues, and template-primer specificity and immunological properties of the recombinant polymerase were similar to those of natural β-polymerases. The purified enzyme was free of nuclease activity. The authors studied detailed catalytic properties of the recombinant β-polymerase using defined template-primer systems. The results indicate that this β-polymerase is essentially identical with natural β-polymerases. The recombinant enzyme is distributive in mode of synthesis and is capable of detecting changes in the integrity of the single-stranded template, such as methylated bases and a double-stranded region. The enzyme recognizes a template region four to seven bases downstream of the primer 3' end and utilizes alternative primers if this downstream template region is double stranded. The enzyme is unable to synthesize past methylated bases N 3 -methyl-dT or O 6 -methyl-dG

  10. Specific functions of the Rep and Rep׳ proteins of porcine circovirus during copy-release and rolling-circle DNA replication. (United States)

    Cheung, Andrew K


    The roles of two porcine circovirus replication initiator proteins, Rep and Rep׳, in generating copy-release and rolling-circle DNA replication intermediates were determined. Rep uses the supercoiled closed-circular genome (ccc) to initiate leading-strand synthesis (identical to copy-release replication) and generates the single-stranded circular (ssc) genome from the displaced DNA strand. In the process, a minus-genome primer (MGP) necessary for complementary-strand synthesis, from ssc to ccc, is synthesized. Rep׳ cleaves the growing nascent-strand to regenerate the parent ccc molecule. In the process, a Rep׳-DNA hybrid containing the right palindromic sequence (at the origin of DNA replication) is generated. Analysis of the virus particle showed that it is composed of four components: ssc, MGP, capsid protein and a novel Rep-related protein (designated Protein-3). Copyright © 2015. Published by Elsevier Inc.

  11. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus


    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

  12. Use of reiterative primer extension methodology to map UV-induced photoproducts at the nucleotide level in the laci gene from genomic DNA

    International Nuclear Information System (INIS)

    Chandrasekhar, D.; Houten, B. Van


    A newly developed reiterative primer extension assay has been employed to examine photoproduct formation and repair at the nucleotide level. Analysis of UV-induced DNA photoproduct hotspots in the first 184 base pairs of the laci genes of genomic E. coli DNA has revealed that photoproducts are formed linearly with dose and display a sequence-dependent increase. Generally, pyrimdine dimers were twice as frequent as all other UV-induced photoproducts. However, specific sites showed differing distributions. A post-irradiation recovery period revealed differences in the repair efficiency at individual nucleotides. Repair of photoproducts on the transcribed strand was generally twice as efficient as repair of photoproducts on the nontranscribed strand, indicating that strand-specific DNA repair occurs in the constitutively transcribed laci gene of E. coli. The UV-induced DNA photoproduct distribution following repair was well correlated with an established UV-induced mutation spectrum for wild-type E. coli cells. This analysis revealed that photoproduct hotspots on the efficiently repaired transcribed strand did not correlate with mutagenic hotspots. These data strongly support the hypothesis that mutations arise at inefficiently repaired sites on the nontranscribed strand

  13. Packaging signals in two single-stranded RNA viruses imply a conserved assembly mechanism and geometry of the packaged genome. (United States)

    Dykeman, Eric C; Stockley, Peter G; Twarock, Reidun


    The current paradigm for assembly of single-stranded RNA viruses is based on a mechanism involving non-sequence-specific packaging of genomic RNA driven by electrostatic interactions. Recent experiments, however, provide compelling evidence for sequence specificity in this process both in vitro and in vivo. The existence of multiple RNA packaging signals (PSs) within viral genomes has been proposed, which facilitates assembly by binding coat proteins in such a way that they promote the protein-protein contacts needed to build the capsid. The binding energy from these interactions enables the confinement or compaction of the genomic RNAs. Identifying the nature of such PSs is crucial for a full understanding of assembly, which is an as yet untapped potential drug target for this important class of pathogens. Here, for two related bacterial viruses, we determine the sequences and locations of their PSs using Hamiltonian paths, a concept from graph theory, in combination with bioinformatics and structural studies. Their PSs have a common secondary structure motif but distinct consensus sequences and positions within the respective genomes. Despite these differences, the distributions of PSs in both viruses imply defined conformations for the packaged RNA genomes in contact with the protein shell in the capsid, consistent with a recent asymmetric structure determination of the MS2 virion. The PS distributions identified moreover imply a preferred, evolutionarily conserved assembly pathway with respect to the RNA sequence with potentially profound implications for other single-stranded RNA viruses known to have RNA PSs, including many animal and human pathogens. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Structural features of single-stranded integron cassette attC sites and their role in strand selection.

    Directory of Open Access Journals (Sweden)

    Marie Bouvier


    Full Text Available We recently showed that cassette integration and deletion in integron platforms were occurring through unconventional site-specific recombination reactions involving only the bottom strand of attC sites. The lack of sequence conservation among attC sites led us to hypothesize that sequence-independent structural recognition determinants must exist within attC sites. The structural data obtained from a synaptic complex of the Vibrio cholerae integrase with the bottom strand of an attC site has shown the importance of extra helical bases (EHB inside the stem-loop structure formed from the bottom strand. Here, we systematically determined the contribution of three structural elements common to all known single-stranded attC site recombination substrates (the EHBs, the unpaired central spacer (UCS, and the variable terminal structure (VTS to strand choice and recombination. Their roles have been evaluated in vivo in the attIxattC reaction context using the suicide conjugation assay we previously developed, but also in an attCxattC reaction using a deletion assay. Conjugation was used to deliver the attC sites in single-stranded form. Our results show that strand choice is primarily directed by the first EHB, but the presence of the two other EHBs also serves to increase this strand selection. We found that the structure of the central spacer is essential to achieve high level recombination of the bottom strand, suggesting a dual role for this structure in active site exclusion and for hindering the reverse reaction after the first strand exchange. Moreover, we have shown that the VTS has apparently no role in strand selectivity.

  15. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes

    Czech Academy of Sciences Publication Activity Database

    Pietilä, M.K.; Roine, E.; Sencilo, Ana; Bamford, D.H.; Oksanen, H.M.


    Roč. 161, č. 1 (2016), s. 249-256 ISSN 0304-8608 R&D Projects: GA ČR(CZ) GAP302/11/1940 Institutional support: RVO:61388971 Keywords : VIRION ARCHITECTURE * HALOVIRUSES * SPINDLE Subject RIV: EE - Microbiology, Virology Impact factor: 2.058, year: 2016

  16. Single-Molecule Kinetics Reveal Cation-Promoted DNA Duplex Formation Through Ordering of Single-Stranded Helices (United States)

    Dupuis, Nicholas F.; Holmstrom, Erik D.; Nesbitt, David J.


    In this work, the kinetics of short, fully complementary oligonucleotides are investigated at the single-molecule level. Constructs 6–9 bp in length exhibit single exponential kinetics over 2 orders of magnitude time for both forward (kon, association) and reverse (koff, dissociation) processes. Bimolecular rate constants for association are weakly sensitive to the number of basepairs in the duplex, with a 2.5-fold increase between 9 bp (k′on = 2.1(1) × 106 M−1 s−1) and 6 bp (k′on = 5.0(1) × 106 M−1 s−1) sequences. In sharp contrast, however, dissociation rate constants prove to be exponentially sensitive to sequence length, varying by nearly 600-fold over the same 9 bp (koff = 0.024 s−1) to 6 bp (koff = 14 s−1) range. The 8 bp sequence is explored in more detail, and the NaCl dependence of kon and koff is measured. Interestingly, konincreases by >40-fold (kon = 0.10(1) s−1 to 4.0(4) s−1 between [NaCl] = 25 mM and 1 M), whereas in contrast, koffdecreases by fourfold (0.72(3) s−1 to 0.17(7) s−1) over the same range of conditions. Thus, the equilibrium constant (Keq) increases by ≈160, largely due to changes in the association rate, kon. Finally, temperature-dependent measurements reveal that increased [NaCl] reduces the overall exothermicity (ΔΔH° > 0) of duplex formation, albeit by an amount smaller than the reduction in entropic penalty (−TΔΔS° duplex formation. PMID:23931323

  17. Optimal conditions to use Pfu exo(-) DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols. (United States)

    Angers, M; Cloutier, J F; Castonguay, A; Drouin, R


    Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.

  18. Identification of fungal DNA barcode targets and PCR primers based on Pfam protein families and taxonomic hierarchy

    NARCIS (Netherlands)

    Lewis, C.T.; Bilkhu, S.; Robert, V.; Eberhardt, U.; Szoke, S.; Seifert, K.A.; Lévesque, C.A.


    Abstract: DNA barcoding is the application of DNA sequences of standardized genetic markers for the identification of eukaryotic organisms. We attempted to identify alternative candidate barcode gene targets for the fungal biota from available fungal genomes using a taxonomy-aware processing

  19. Method for construction of normalized cDNA libraries (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris


    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

  20. Use of arbitrary DNA primers, polyacrylamide gel electrophoresis and silver staining for identity testing, gene discovery and analysis of gene expression

    International Nuclear Information System (INIS)

    Gresshoff, P.


    To understand chemically-induced genomic differences in soybean mutants differing in their ability to enter the nitrogen-fixing symbiosis involving Bradyrhizobium japonicum, molecular techniques were developed to aid the map-based, or positional, cloning. DNA marker technology involving single arbitrary primers was used to enrich regional RFLP linkage data. Molecular techniques, including two-dimensional pulse field gel electrophoresis, were developed to ascertain the first physical mapping in soybean, leading to the conclusion that in the region of marker pA-36 on linkage group H, 1 cM equals about 500 cM. High molecular weight DNA was isolated and cloned into yeast or bacterial artificial chromosomes (YACs/ BACs). YACs were used to analyze soybean genome structure, revealing that over half of the genome contains repetitive DNA. Genetic and molecular tools are now available to facilitate the isolation of plant genes directly involved in symbiosis. The further characterization of these genes, along with the determination of the mechanisms that lead to the mutation, will be of value to other plants and induced mutation research. (author)

  1. Accessibility of. gamma. -ray induced primer toward DNA polymerase I of Escherichia coli during soaking of barley seed

    Energy Technology Data Exchange (ETDEWEB)

    Yamaguchi, H; Tatara, A; Naito, T [Tokyo Univ. (Japan). Faculty of Agriculture


    After dry barley seeds were irradiated with ..gamma..-rays and soaked for various times, the squashed preparations were made of the first leaf meristems and incubated with E.coli DNA polymerase I with appropriate substrates. The incorporation of nucleotides with DNA polymerase occurred in the cells fixed at late G/sub 1/ after 15 kR and at middle and late G/sub 1/ after 30 kR, respectively. There was an interrelation between the incorporation of nucleotides by DNA polymerase and the chromatin diffusion throughout a nucleus. The observations were interpreted in terms of the accessibility of 3'-0H groups of DNA breaks which accompanies the change of the conformation of chromatin fibres.

  2. Enzymes involved in organellar DNA replication in photosynthetic eukaryotes. (United States)

    Moriyama, Takashi; Sato, Naoki


    Plastids and mitochondria possess their own genomes. Although the replication mechanisms of these organellar genomes remain unclear in photosynthetic eukaryotes, several organelle-localized enzymes related to genome replication, including DNA polymerase, DNA primase, DNA helicase, DNA topoisomerase, single-stranded DNA maintenance protein, DNA ligase, primer removal enzyme, and several DNA recombination-related enzymes, have been identified. In the reference Eudicot plant Arabidopsis thaliana, the replication-related enzymes of plastids and mitochondria are similar because many of them are dual targeted to both organelles, whereas in the red alga Cyanidioschyzon merolae, plastids and mitochondria contain different replication machinery components. The enzymes involved in organellar genome replication in green plants and red algae were derived from different origins, including proteobacterial, cyanobacterial, and eukaryotic lineages. In the present review, we summarize the available data for enzymes related to organellar genome replication in green plants and red algae. In addition, based on the type and distribution of replication enzymes in photosynthetic eukaryotes, we discuss the transitional history of replication enzymes in the organelles of plants.

  3. Phosphate-methylated DNA aimed at HIV-1 RNA loops and integrated DNA inhibits viral infectivity

    NARCIS (Netherlands)

    Buck, H. M.; Koole, L. H.; van Genderen, M. H.; Smit, L.; Geelen, J. L.; Jurriaans, S.; Goudsmit, J.


    Phosphate-methylated DNA hybridizes strongly and specifically to natural DNA and RNA. Hybridization to single-stranded and double-stranded DNA leads to site-selective blocking of replication and transcription. Phosphate-methylated DNA was used to interrupt the life cycle of the human

  4. LEGO-like DNA Structures

    DEFF Research Database (Denmark)

    Gothelf, Kurt Vesterager


    -dimensional (3D) DNA structures by self-assembly of single-stranded DNA “bricks.” The method opens a new route to complex self-assembled (3D) nanostructures that may serve as addressable templates for placing guest molecules with high precision, with possible applications in biophysics, medicine...

  5. Electron microscopic comparison of the sequences of single-stranded genomes of mammalian parvoviruses by heteroduplex mapping

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, P.T.; Olson, W.H.; Allison, D.P.; Bates, R.C.; Snyder, C.E.; Mitra, S.


    The sequence homologies among the linear single-stranded genomes of several mammalian parvoviruses have been studied by electron microscopic analysis of tthe heteroduplexes produced by reannealing the complementary strands of their DNAs. The genomes of Kilham rat virus, H-1, minute virus of ice and LuIII, which are antigenically distinct non-defective parvoviruses, have considerable homology: about 70% of their sequences are conserved. The homologous regions map at similar locations in the left halves (from the 3' ends) of the genomes. No sequence homology, however, is observed between the DNAs of these nondefective parvoviruses and that of bovine parvovirus, another non-defective virus, or that of defective adenoassociated virus, nor between the genomes of bovine parvovirus and adenoassociated virus. This suggests that only very short, if any, homologous regions are present. From these results, an evolutionary relationship among Kilham rat virus, H-1, minute virus of mice and LuIII is predicted. It is interesting to note that, although LuIII was originally isolated from a human cell line and is specific for human cells in vitro, its genome has sequences in common only with the rodent viruses Kilham rat virus, minute virus of mice and H-1, and not with the other two mammalian parvoviruses tested.

  6. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana


    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  7. A Novel Single-Strand RNAi Therapeutic Agent Targeting the (Pro)renin Receptor Suppresses Ocular Inflammation. (United States)

    Kanda, Atsuhiro; Ishizuka, Erdal Tan; Shibata, Atsushi; Matsumoto, Takahiro; Toyofuku, Hidekazu; Noda, Kousuke; Namba, Kenichi; Ishida, Susumu


    The receptor-associated prorenin system (RAPS) refers to the pathogenic mechanism whereby prorenin binding to the (pro)renin receptor [(P)RR] dually activates the tissue renin-angiotensin system (RAS) and RAS-independent intracellular signaling. Here we revealed significant upregulation of prorenin and soluble (P)RR levels in the vitreous fluid of patients with uveitis compared to non-inflammatory controls, together with a positive correlation between these RAPS components and monocyte chemotactic protein-1 among several upregulated cytokines. Moreover, we developed a novel single-strand RNAi agent, proline-modified short hairpin RNA directed against human and mouse (P)RR [(P)RR-PshRNA], and we determined its safety and efficacy in vitro and in vivo. Application of (P)RR-PshRNA in mice caused significant amelioration of acute (uveitic) and chronic (diabetic) models of ocular inflammation with no apparent adverse effects. Our findings demonstrate the significant implication of RAPS in the pathogenesis of human uveitis and the potential usefulness of (P)RR-PshRNA as a therapeutic agent to reduce ocular inflammation. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Role of radiation chemical and enzymatic processes on single-strand breaks at short times after irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Sapora, O; Loverock, P S; Fielden, E M [Institute of Cancer Research, Sutton (UK). Surrey Branch


    A rapid mixing lysis technique has been used to study the effects of irradiation at different temperatures on two strains of E.coli K12, one lacking in the polymerase I activity (W3110), and the other carrying a ligase temperature-sensitive mutation (DY179), which had full ligase activity at 30/sup 0/C and none at 46/sup 0/C. The results provided direct evidence for the absence of any ligase-dependent repair of SSB at short times. The addition of 5 x 10/sup -3/M cysteine to heat-treated W3110 cells before irradiation in anoxic conditions practically removed the increase in yield of SSB per single strand genome shown by the heat-treated cells; the response was very close to that of normal cells in anoxia. The important contribution of sulphydryl compounds to the anoxic radio-biological response is thereby demonstrated. The basic difference in damage obtained by irradiation under oxic or anoxic conditions is due not to preferential enzymic (ligase) repair but to differences in radiation chemical events.

  9. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads


    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  10. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam


    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  11. Next-Generation DNA Sequencing of VH/VL Repertoires: A Primer and Guide to Applications in Single-Domain Antibody Discovery. (United States)

    Henry, Kevin A


    Immunogenetic analyses of expressed antibody repertoires are becoming increasingly common experimental investigations and are critical to furthering our understanding of autoimmunity, infectious disease, and cancer. Next-generation DNA sequencing (NGS) technologies have now made it possible to interrogate antibody repertoires to unprecedented depths, typically by sequencing of cDNAs encoding immunoglobulin variable domains. In this chapter, we describe simple, fast, and reliable methods for producing and sequencing multiplex PCR amplicons derived from the variable regions (V H , V H H or V L ) of rearranged immunoglobulin heavy and light chain genes using the Illumina MiSeq platform. We include complete protocols and primer sets for amplicon sequencing of V H /V H H/V L repertoires directly from human, mouse, and llama lymphocytes as well as from phage-displayed V H /V H H/V L libraries; these can be easily be adapted to other types of amplicons with little modification. The resulting amplicons are diverse and representative, even using as few as 10 3 input B cells, and their generation is relatively inexpensive, requiring no special equipment and only a limited set of primers. In the absence of heavy-light chain pairing, single-domain antibodies are uniquely amenable to NGS analyses. We present a number of applications of NGS technology useful in discovery of single-domain antibodies from phage display libraries, including: (i) assessment of library functionality; (ii) confirmation of desired library randomization; (iii) estimation of library diversity; and (iv) monitoring the progress of panning experiments. While the case studies presented here are of phage-displayed single-domain antibody libraries, the principles extend to other types of in vitro display libraries.

  12. Caulobacter crescentus Cell Cycle-Regulated DNA Methyltransferase Uses a Novel Mechanism for Substrate Recognition. (United States)

    Woodcock, Clayton B; Yakubov, Aziz B; Reich, Norbert O


    Caulobacter crescentus relies on DNA methylation by the cell cycle-regulated methyltransferase (CcrM) in addition to key transcription factors to control the cell cycle and direct cellular differentiation. CcrM is shown here to efficiently methylate its cognate recognition site 5'-GANTC-3' in single-stranded and hemimethylated double-stranded DNA. We report the K m , k cat , k methylation , and K d for single-stranded and hemimethylated substrates, revealing discrimination of 10 7 -fold for noncognate sequences. The enzyme also shows a similar discrimination against single-stranded RNA. Two independent assays clearly show that CcrM is highly processive with single-stranded and hemimethylated DNA. Collectively, the data provide evidence that CcrM and other DNA-modifying enzymes may use a new mechanism to recognize DNA in a key epigenetic process.

  13. Programmed Switching of Single Polymer Conformation on DNA Origami

    DEFF Research Database (Denmark)

    Krissanaprasit, Abhichart; Madsen, Mikael; Knudsen, Jakob Bach


    -molecule conjugated polymer. The polymer is functionalized with short single-stranded (ss) DNA strands that extend from the backbone of the polymer and serve as handles. The DNA polymer conjugate can be aligned on DNA origami in three well-defined geometries (straight line, left-turned, and right-turned pattern......) by DNA hybridization directed by single-stranded guiding strands and ssDNA tracks extending from the origami surface and polymer handle. We demonstrate switching of a conjugated organic polymer conformation between left- and right-turned conformations of the polymer on DNA origami based on toehold...

  14. Defibrotide, a polydisperse mixture of single-stranded phosphodiester oligonucleotides with lifesaving activity in severe hepatic veno-occlusive disease: clinical outcomes and potential mechanisms of action. (United States)

    Kornblum, Noah; Ayyanar, Kanyalakshmi; Benimetskaya, Luba; Richardson, Paul; Iacobelli, Massimo; Stein, C A


    Veno-occlusive disease of the liver (VOD) remains a troubling and potentially fatal complication of high-dose chemotherapy and hematopoietic stem cell transplantation conditioning regimens. No effective therapy has been available for these patients to date, and the best supportive care measures remain woefully inadequate. Defibrotide (DF) (Gentium, S.p.A., Como, Italy), a polydisperse mixture of all the single-stranded phosphodiester oligodeoxyribonucleotides that can be obtained from the controlled depolymerization of porcine intestinal mucosal genomic DNA, seems to offer a safe and effective treatment for some patients suffering from severe VOD, a condition for which no accepted standard therapy currently exists. Early clinical studies evaluating the efficacy of DF for the treatment of severe VOD in patients undergoing hematopoietic stem cell transplantation have been very encouraging. Approximately 45% of the patients treated in multiple initial phase II clinical trials achieved a complete response at day +100, demonstrating normalization of serum bilirubin and resolution of the clinical syndrome. However, although multi-institutional, these represented single arm studies. A large, FDA-approved, pivotal, prospective, multi-institutional, global phase III trial of DF vs. historical controls (best available therapy) commenced in the first quarter of 2006 and should provide further validation of DF's efficacy. The drug seems to have few significant side effects, and almost all test subjects who have received this treatment have tolerated it well. Although the mechanism of action remains unclear, the drug exerts minimal systemic anticoagulant effects yet appears to induce numerous antithrombotic and profibrinolytic effects both in vitro and in vivo. It may function as an adenosine receptor agonist and causes increased concentrations of endogenous prostaglandins, which modulate thrombomodulin, platelets, and fibrinolysis. It also appears to block lipopolysaccharide

  15. Is photocleavage of DNA by YOYO-1 using a synchrotron radiation light source sequence dependent?

    DEFF Research Database (Denmark)

    Gilroy, Emma L.; Hoffmann, Søren Vrønning; Jones, Nykola C.


    ) throughout the irradiation period. The dependence of LD signals on DNA sequences and on time in the intense light beam was explored and quantified for single-stranded poly(dA), poly[(dA-dT)2], calf thymus DNA (ctDNA) and Micrococcus luteus DNA (mlDNA). The DNA and ligand regions of the spectrum showed...

  16. Electron microscopic visualization of the RecA protein-mediated pairing and branch migration phases of DNA strand exchange

    DEFF Research Database (Denmark)

    Register, JC; Christiansen, Gunna; Griffith, J


    examined by electron microscopy: supertwisted double-stranded (ds) DNA and linear single-stranded (ss) DNA, linear dsDNA and circular ssDNA, and linear dsDNA and colinear ssDNA. Several major observations were: (i) with RecA protein bound to the DNA, plectonemic joints were ultrastructurally...

  17. Two DNA polymerase sliding clamps from the thermophilic archaeon Sulfolobus solfataricus. (United States)

    De Felice, M; Sensen, C W; Charlebois, R L; Rossi, M; Pisani, F M


    Herein, we report the identification and characterization of two DNA polymerase processivity factors from the thermoacidophilic archaeon Sulfolobus solfataricus. They, referred to as 039p (244 amino acid residues, 27 kDa) and 048p (249 amino acid residues, 27 kDa), present significant primary structure similarity to eukaryotic proliferating cell nuclear antigen (PCNA). We demonstrate that both 039p and 048p form oligomers in solution and are able to substantially activate the synthetic activity of the single-subunit family B DNA polymerase from S. solfataricus (Sso DNA pol B1) on poly(dA)-oligo(dT) as a primer-template. This stimulatory effect is the result of enhanced DNA polymerase processivity, as indicated by the analysis of the elongation products on polyacrylamide gels. Activation of Sso DNA pol B1 synthetic activity was also observed on linear primed single-stranded M13 mp18 DNA as a template. By immunoblot analysis using specific rabbit antisera, 039p and 048p were both detected in the logarithmic and stationary phases of S. solfataricus growth curve. This is the first report of the identification and biochemical characterization of two distinct DNA polymerase processivity factors from the same organism. The significance of these findings for the understanding of the DNA replication process in Archaea is discussed. Copyright 1999 Academic Press.

  18. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis. (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J


    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  19. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça


    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  20. Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1. (United States)

    Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A


    In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.

  1. Binding of radiation-induced phenylalanine radicals to DNA

    International Nuclear Information System (INIS)

    Schans, G.P. van der; Rijn, C.J.S. van; Bleichrodt, J.F.


    When an aqueous solution of double-stranded DNA of bacteriophage PM2 containing phenylalanine and saturated with N 2 O is irradiated with γ-rays, radiation-induced phenylalanine radicals are bound covalently. Under the conditions used about 25 phenylalanine molecules may be bound per lethal hit. Also for single-stranded PM2 DNA, most of the phenylalanine radicals bound are non-lethal. Evidence is presented that in double-stranded DNA an appreciable fraction of the single-strand breaks is induced by phenylalanine radicals. Radiation products of phenylalanine and the phenylalanine bound to the DNA decrease the sensitivity of the DNA to the induction of single-strand breaks. There are indications that the high efficiency of protection by radiation products of phenylalanine is due to their positive charge, which will result in a relatively high concentration of these compounds in the vicinity of the negatively charged DNA molecules

  2. Coordinated leading and lagging strand DNA synthesis by using the herpes simplex virus 1 replication complex and minicircle DNA templates. (United States)

    Stengel, Gudrun; Kuchta, Robert D


    The origin-specific replication of the herpes simplex virus 1 genome requires seven proteins: the helicase-primase (UL5-UL8-UL52), the DNA polymerase (UL30-UL42), the single-strand DNA binding protein (ICP8), and the origin-binding protein (UL9). We reconstituted these proteins, excluding UL9, on synthetic minicircular DNA templates and monitored leading and lagging strand DNA synthesis using the strand-specific incorporation of dTMP and dAMP. Critical features of the assays that led to efficient leading and lagging stand synthesis included high helicase-primase concentrations and a lagging strand template whose sequence resembled that of the viral DNA. Depending on the nature of the minicircle template, the replication complex synthesized leading and lagging strand products at molar ratios varying between 1:1 and 3:1. Lagging strand products (∼0.2 to 0.6 kb) were significantly shorter than leading strand products (∼2 to 10 kb), and conditions that stimulated primer synthesis led to shorter lagging strand products. ICP8 was not essential; however, its presence stimulated DNA synthesis and increased the length of both leading and lagging strand products. Curiously, human DNA polymerase α (p70-p180 or p49-p58-p70-p180), which improves the utilization of RNA primers synthesized by herpesvirus primase on linear DNA templates, had no effect on the replication of the minicircles. The lack of stimulation by polymerase α suggests the existence of a macromolecular assembly that enhances the utilization of RNA primers and may functionally couple leading and lagging strand synthesis. Evidence for functional coupling is further provided by our observations that (i) leading and lagging strand synthesis produce equal amounts of DNA, (ii) leading strand synthesis proceeds faster under conditions that disable primer synthesis on the lagging strand, and (iii) conditions that accelerate helicase-catalyzed DNA unwinding stimulate decoupled leading strand synthesis but not

  3. Biotechnological mass production of DNA origami (United States)

    Praetorius, Florian; Kick, Benjamin; Behler, Karl L.; Honemann, Maximilian N.; Weuster-Botz, Dirk; Dietz, Hendrik


    DNA nanotechnology, in particular DNA origami, enables the bottom-up self-assembly of micrometre-scale, three-dimensional structures with nanometre-precise features. These structures are customizable in that they can be site-specifically functionalized or constructed to exhibit machine-like or logic-gating behaviour. Their use has been limited to applications that require only small amounts of material (of the order of micrograms), owing to the limitations of current production methods. But many proposed applications, for example as therapeutic agents or in complex materials, could be realized if more material could be used. In DNA origami, a nanostructure is assembled from a very long single-stranded scaffold molecule held in place by many short single-stranded staple oligonucleotides. Only the bacteriophage-derived scaffold molecules are amenable to scalable and efficient mass production; the shorter staple strands are obtained through costly solid-phase synthesis or enzymatic processes. Here we show that single strands of DNA of virtually arbitrary length and with virtually arbitrary sequences can be produced in a scalable and cost-efficient manner by using bacteriophages to generate single-stranded precursor DNA that contains target strand sequences interleaved with self-excising ‘cassettes’, with each cassette comprising two Zn2+-dependent DNA-cleaving DNA enzymes. We produce all of the necessary single strands of DNA for several DNA origami using shaker-flask cultures, and demonstrate end-to-end production of macroscopic amounts of a DNA origami nanorod in a litre-scale stirred-tank bioreactor. Our method is compatible with existing DNA origami design frameworks and retains the modularity and addressability of DNA origami objects that are necessary for implementing custom modifications using functional groups. With all of the production and purification steps amenable to scaling, we expect that our method will expand the scope of DNA nanotechnology in

  4. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly


    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  5. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.


    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  6. Superimposed Code Theorectic Analysis of DNA Codes and DNA Computing (United States)


    that the hybridization that occurs between a DNA strand and its Watson - Crick complement can be used to perform mathematical computation. This research...ssDNA single stranded DNA WC Watson – Crick A Adenine C Cytosine G Guanine T Thymine ... Watson - Crick (WC) duplex, e.g., TCGCA TCGCA . Note that non-WC duplexes can form and such a formation is called a cross-hybridization. Cross

  7. Alpha-Helical Fragaceatoxin C Nanopore Engineered for Double-Stranded and Single-Stranded Nucleic Acid Analysis

    NARCIS (Netherlands)

    Wloka, Carsten; Mutter, Natalie Lisa; Soskine, Misha; Maglia, Giovanni


    Nanopores are used in single-molecule DNA analysis and sequencing. Herein, we show that Fragaceatoxin C (FraC), an α-helical pore-forming toxin from an actinoporin protein family, can be reconstituted in sphingomyelin-free standard planar lipid bilayers. We engineered FraC for DNA analysis and show

  8. A G-C-rich palindromic structural motif and a stretch of single-stranded purines are required for optimal packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA. (United States)

    Jaballah, Soumeya Ali; Aktar, Suriya J; Ali, Jahabar; Phillip, Pretty Susan; Al Dhaheri, Noura Salem; Jabeen, Aayesha; Rizvi, Tahir A


    During retroviral RNA packaging, two copies of genomic RNA are preferentially packaged into the budding virus particles whereas the spliced viral RNAs and the cellular RNAs are excluded during this process. Specificity towards retroviral RNA packaging is dependent upon sequences at the 5' end of the viral genome, which at times extend into Gag sequences. It has earlier been suggested that the Mason-Pfizer monkey virus (MPMV) contains packaging sequences within the 5' untranslated region (UTR) and Gag. These studies have also suggested that the packaging determinants of MPMV that lie in the UTR are bipartite and are divided into two regions both upstream and downstream of the major splice donor. However, the precise boundaries of these discontinuous regions within the UTR and the role of the intervening sequences between these dipartite sequences towards MPMV packaging have not been investigated. Employing a combination of genetic and structural prediction analyses, we have shown that region "A", immediately downstream of the primer binding site, is composed of 50 nt, whereas region "B" is composed of the last 23 nt of UTR, and the intervening 55 nt between these two discontinuous regions do not contribute towards MPMV RNA packaging. In addition, we have identified a 14-nt G-C-rich palindromic sequence (with 100% autocomplementarity) within region A that has been predicted to fold into a structural motif and is essential for optimal MPMV RNA packaging. Furthermore, we have also identified a stretch of single-stranded purines (ssPurines) within the UTR and 8 nt of these ssPurines are duplicated in region B. The native ssPurines or its repeat in region B when predicted to refold as ssPurines has been shown to be essential for RNA packaging, possibly functioning as a potential nucleocapsid binding site. Findings from this study should enhance our understanding of the steps involved in MPMV replication including RNA encapsidation process. Copyright (c) 2010 Elsevier Ltd

  9. Repetitious nature of repaired DNA in mammalian cells

    International Nuclear Information System (INIS)


    The report consists of three appendices, as follows: summary of preliminary studies of the comparative DNA repair in normal lymphoblastoid and Burkitt's lymphoma cell lines; nonuniform reassociation of human lymphoblastoid cell DNA repair replicated following methyl methane sulfonate treatment; and preliminary DNA single-strand breakage studies in the L5178Y cell line

  10. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine


    ) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

  11. Variation in extragenic repetitive DNA sequences in Pseudomonas syringae and potential use of modified REP primers in the identification of closely related isolates

    Directory of Open Access Journals (Sweden)

    Elif Çepni


    Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.

  12. Radiation and DNA

    Energy Technology Data Exchange (ETDEWEB)

    Riabchenko, N I


    Consideration is given to the effects of ionizing radiation on the structure of DNA. Physical and chemical methods of determining radiation damage to the primary (polynucleotide chain and nitrogenous base) and secondary (helical) structure of DNA are discussed, and the effects of ionizing radiation on deoxyribonucleoprotein complexes are considered. The radiolysis of DNA in vitro and in bacterial and mammalian cells is examined and cellular mechanisms for the repair of radiation-damaged DNA are considered, taking into account single-strand and double-strand breaks, gamma-radiation damage and deoxyribonucleoprotein-membrane complex damage. Postradiation DNA degradation in bacteria and lymphatic cells is also discussed.

  13. Master equation approach to DNA breathing in heteropolymer DNA

    DEFF Research Database (Denmark)

    Ambjörnsson, Tobias; Banik, Suman K; Lomholt, Michael A


    After crossing an initial barrier to break the first base-pair (bp) in double-stranded DNA, the disruption of further bps is characterized by free energies up to a few k(B)T. Thermal motion within the DNA double strand therefore causes the opening of intermittent single-stranded denaturation zones......, the DNA bubbles. The unzipping and zipping dynamics of bps at the two zipper forks of a bubble, where the single strand of the denatured zone joins the still intact double strand, can be monitored by single molecule fluorescence or NMR methods. We here establish a dynamic description of this DNA breathing...... in a heteropolymer DNA with given sequence in terms of a master equation that governs the time evolution of the joint probability distribution for the bubble size and position along the sequence. The transfer coefficients are based on the Poland-Scheraga free energy model. We derive the autocorrelation function...

  14. Studies on the mechanism of replication of adenovirus DNA. III. Electron microscopy of replicating DNA

    NARCIS (Netherlands)

    Ellens, D.J.; Sussenbach, J.S.; Jansz, H.S.


    Replicating Ad5 DNA was isolated from nuclei of infected KB cells and studied by electron microscopy. Branched as well as unbranched linear intermediates were observed containing extended regions of single-stranded DNA. The relationship between the branched and unbranched structures was studied

  15. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta


    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  16. Atomic force spectroscopic and SPR kinetic analysis of long circular and short ssDNA molecules interacting with single-stranded DNA-binding protein

    Czech Academy of Sciences Publication Activity Database

    Horáčková, V.; Hlaváček, Antonín; Čundlerová, V.; Pastucha, M.; Skládal, P.


    Roč. 148, č. 11 (2017), s. 2011-2018 ISSN 0026-9247 Institutional support: RVO:68081715 Keywords : microscopy * biology * specificity * surface Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 1.282, year: 2016

  17. Ap/sub 4/A interactions with a multiprotein form of DNA polymerase. cap alpha. - primase from HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Baril, E F; Owen, M W; Vishwanatha, J K; Zamecnik, P C


    In previous studies, it was shown that Ap/sub 4/A can function as a primer for in vitro DNA synthesis by the multiprotein form of DNA polymerase ..cap alpha.. with single-stranded DNA and an octadecamer double-stranded DNA template. In these studies, the authors show that Ap/sub 4/A that is greater than 99% pure by high performance liquid chromatography also stimulates the incorporation of (..cap alpha../sup 32/P)ATP into the 10-15 oligoribonucleotide primer with poly(dT) template by the primase that is resolved from the polymerase ..cap alpha.. core enzyme. Other dinucleotides or dinucleotide polyphosphates (e.g. ApA, Ap/sub 2/A or Ap/sub 3/A) do not enhance the incorporation of (..cap alpha../sup 32/P)ATP in this reaction. The results from phosphate transfer experiments demonstrate a covalent linkage between (/sup 3/H)Ap/sub 4/A and the /sup 32/P-labeled oligoriboadenylate that is synthesized by the primase.

  18. Replicating animal mitochondrial DNA

    Directory of Open Access Journals (Sweden)

    Emily A. McKinney


    Full Text Available The field of mitochondrial DNA (mtDNA replication has been experiencing incredible progress in recent years, and yet little is certain about the mechanism(s used by animal cells to replicate this plasmid-like genome. The long-standing strand-displacement model of mammalian mtDNA replication (for which single-stranded DNA intermediates are a hallmark has been intensively challenged by a new set of data, which suggests that replication proceeds via coupled leading-and lagging-strand synthesis (resembling bacterial genome replication and/or via long stretches of RNA intermediates laid on the mtDNA lagging-strand (the so called RITOLS. The set of proteins required for mtDNA replication is small and includes the catalytic and accessory subunits of DNA polymerase y, the mtDNA helicase Twinkle, the mitochondrial single-stranded DNA-binding protein, and the mitochondrial RNA polymerase (which most likely functions as the mtDNA primase. Mutations in the genes coding for the first three proteins are associated with human diseases and premature aging, justifying the research interest in the genetic, biochemical and structural properties of the mtDNA replication machinery. Here we summarize these properties and discuss the current models of mtDNA replication in animal cells.

  19. Primer3_masker: integrating masking of template sequence with primer design software. (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido


    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at (standalone version for Linux and macOS) and at (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at Supplementary data are available at Bioinformatics online.

  20. Analysis of DNA vulnerability to damage, repair and degradation in tissues of irradiated animals

    International Nuclear Information System (INIS)

    Ryabchenko, N.I.; Ivannik, B.P.


    Single-strand and paired ruptures of DNA were found to result in appearance of locally denaturated areas in its secondary structure and to disordered protein-DNA interaction. It was shown with the use of the viscosimeter method of measuring the molecular mass of single stranded high-polymeric DNA that cells of various tissues by the intensity of DNA repair can be divided into two groups, rapid- and slow-repair ones. Tissue specificity of enzyme function of the repair systems and systems responsible for post-irradiation DNA degradation depends on the activity of endonucleases synthesized by the cells both in health and in their irradiation-induced synthesis

  1. Cuprolinic Blue: a specific dye for single-stranded RNA in the presence of magnesium chloride. I. Fundamental aspects

    NARCIS (Netherlands)

    Tas, J.; MENDELSON, D.; NOORDEN, C. J. F.


    Qualitative and quantitative aspects of the cationic dye Cuprolinic Blue were investigated with model films of polyacrylamide gel in which RNA, DNA and other biological polyanionic compounds had been incorporated. In the presence of 1 M MgCl2, Curpolinic Blue was found to bind specifically to

  2. Interaction of Zn2+ Ions with Single-Stranded PolyU and PolyC in Neutral Solutions

    Czech Academy of Sciences Publication Activity Database

    Sorokin, V. A.; Usenko, E. L.; Valeev, V. A.; Berezniak, E. G.; Andrushchenko, Valery


    Roč. 119, č. 12 (2015), s. 4409-4416 ISSN 1520-6106 R&D Projects: GA ČR GAP208/11/0105; GA ČR GA15-09072S Institutional support: RVO:61388963 Keywords : metal ions * polyU * polyC * metallized DNA * differential UV spectroscopy * thermal denaturation * phase diagram Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.187, year: 2015

  3. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei


    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  4. Development of SCAR marker specific to non-toxic Jatropha curcas L. and designing a novel multiplexing PCR along with nrDNA ITS primers to circumvent the false negative detection

    KAUST Repository

    Mastan, Shaik G.


    Jatropha curcas L., a multipurpose shrub, has acquired significant economic importance for its seed oil which can be converted to biodiesel an emerging alternative to petro-diesel. In addition to the commercial value, it is also having medicinal and even high nutritional value to use as animal fodder which is limited due to the toxicity. Development of molecular marker will enable to differentiate non-toxic from toxic variety of J. curcas in a mixed population and also for quality control since the toxic components of J. curcas has deleterious effect on animals. In the present study, the efforts were made to generate the specific SCAR marker for toxic and/or non-toxic J. curcas from RAPD markers. Among the markers specific for toxic and non-toxic varieties, four were selected, purified, cloned, sequenced, and designed primers out of which one set of primers NT-JC/SCAR I/OPQ15-F and R could able to discriminate the non-toxic with toxic Jatropha by giving expected 430 bp size amplification in non-toxic variety. Furthermore, novel multiplex PCR was designed using the nrDNA ITS primers to overcome the false negatives. Present work also demonstrates utility of the conserved regions of nrDNA coding genes in ruling out the artifacts in PCR-like false negatives frequently occur in SCAR due to various reasons. The specific SCAR markers generated in the present investigation will help to distinguish non-toxic from toxic varieties of J. curcas or vice versa, and isolated marker along with designed multiplex protocol has applications in quality control for selective cultivation of non-toxic variety and will also assist in breeding and molecular mapping studies. © 2011 Springer Science+Business Media, LLC.

  5. Theory of high-force DNA stretching and overstretching

    NARCIS (Netherlands)

    Storm, C.; Nelson, P.


    Single-molecule experiments on single- and double-stranded DNA have sparked a renewed interest in the force versus extension of polymers. The extensible freely jointed chain (FJC) model is frequently invoked to explain the observed behavior of single-stranded DNA, but this model does not

  6. Porcine circovirus: transcription and rolling-circle DNA replication (United States)

    This review summarizes the molecular studies pertaining to porcine circovirus (PCV) transcription and DNA replication. The genome of PCV is circular, single-stranded DNA and contains 1759-1768 nucleotides. Both the genome-strand (packaged in the virus particle) and the complementary-strand (synthesi...

  7. Probing the DNA Structural Requirements for Facilitated Diffusion (United States)


    DNA glycosylases perform a genome-wide search to locate damaged nucleotides among a great excess of undamaged nucleotides. Many glycosylases are capable of facilitated diffusion, whereby multiple sites along the DNA are sampled during a single binding encounter. Electrostatic interactions between positively charged amino acids and the negatively charged phosphate backbone are crucial for facilitated diffusion, but the extent to which diffusing proteins rely on the double-helical structure DNA is not known. Kinetic assays were used to probe the DNA searching mechanism of human alkyladenine DNA glycosylase (AAG) and to test the extent to which diffusion requires B-form duplex DNA. Although AAG excises εA lesions from single-stranded DNA, it is not processive on single-stranded DNA because dissociation is faster than N-glycosidic bond cleavage. However, the AAG complex with single-stranded DNA is sufficiently stable to allow for DNA annealing when a complementary strand is added. This observation provides evidence of nonspecific association of AAG with single-stranded DNA. Single-strand gaps, bubbles, and bent structures do not impede the search by AAG. Instead, these flexible or bent structures lead to the capture of a nearby site of damage that is more efficient than that of a continuous B-form duplex. The ability of AAG to negotiate these helix discontinuities is inconsistent with a sliding mode of diffusion but can be readily explained by a hopping mode that involves microscopic dissociation and reassociation. These experiments provide evidence of relatively long-range hops that allow a searching protein to navigate around DNA binding proteins that would serve as obstacles to a sliding protein. PMID:25495964

  8. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    NARCIS (Netherlands)

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.


    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  9. Synthesis of a wild-type and three mutant Cucurbita maxima trypsin inhibitor-encoding genes by a single-strand approach. (United States)

    Botes, D P; Qobose, M D; Corfield, V A


    A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.

  10. Inhibition of human Chk1 causes increased initiation of DNA replication, phosphorylation of ATR targets, and DNA breakage

    DEFF Research Database (Denmark)

    Syljuåsen, Randi G; Sørensen, Claus Storgaard; Hansen, Lasse Tengbjerg


    by increased amounts of nonextractable RPA protein, formation of single-stranded DNA, and induction of DNA strand breaks. Moreover, these responses were prevented by siRNA-mediated downregulation of Cdk2 or the replication initiation protein Cdc45, or by addition of the CDK inhibitor roscovitine. We propose...

  11. Effect of temperature and ionic strength on the dissociation kinetics and lifetime of PNA-DNA triplexes

    DEFF Research Database (Denmark)

    Kosaganov, Y N; Stetsenko, D A; Lubyako, E N


    Dissociation kinetics of triplexes formed by molecules of peptide nucleic acid (PNA) and DNA have been studied. The complexes consisted of oligomeric PNA containing 10 thymine bases and the dA(10) target incorporated in single-stranded (ssDNA) or double-stranded DNA (dsDNA). Their dissociation wa...

  12. Effect of radiation and freezing on (/sup 3/H)DNA of Yersinia enterocolitica

    Energy Technology Data Exchange (ETDEWEB)

    Grecz, N.; El-zawahry, Y.A.


    Freezing of the enteropathogenic bacterium Yersinia enterocolitica to -18 and -75/sup 0/C caused 7 and 42% cell death, respectively, and 0.329 and 0.588 single-strand breaks per 10/sup 8/ daltons of DNA, respectively, while radiation to one D/sub 10/ dose (10% cell survival) combined with freezing to 2 to 0, -18 and -75/sup 0/C induces 0.05, 0.75, and 5.04 single-strand breaks, respectively. The increase in the effectiveness of radiation with respect to the yield of single-strand breaks at -18 to -75/sup 0/C is contrary to expectation and seems to be due to arrest of repair of single-strand breaks by these low temperatures. 27 references.

  13. Effect of radiation and freezing on [3H]DNA of Yersinia enterocolitica

    International Nuclear Information System (INIS)

    Grecz, N.; El-zawahry, Y.A.


    Freezing of the enteropathogenic bacterium Yersinia enterocolitica to -18 and -75 0 C caused 7 and 42% cell death, respectively, and 0.329 and 0.588 single-strand breaks per 10 8 daltons of DNA, respectively, while radiation to one D 10 dose (10% cell survival) combined with freezing to 2 to 0, -18 and -75 0 C induces 0.05, 0.75, and 5.04 single-strand breaks, respectively. The increase in the effectiveness of radiation with respect to the yield of single-strand breaks at -18 to -75 0 C is contrary to expectation and seems to be due to arrest of repair of single-strand breaks by these low temperatures. 27 references

  14. DNA Repair Mechanisms and the Bypass of DNA Damage in Saccharomyces cerevisiae (United States)

    Boiteux, Serge; Jinks-Robertson, Sue


    DNA repair mechanisms are critical for maintaining the integrity of genomic DNA, and their loss is associated with cancer predisposition syndromes. Studies in Saccharomyces cerevisiae have played a central role in elucidating the highly conserved mechanisms that promote eukaryotic genome stability. This review will focus on repair mechanisms that involve excision of a single strand from duplex DNA with the intact, complementary strand serving as a template to fill the resulting gap. These mechanisms are of two general types: those that remove damage from DNA and those that repair errors made during DNA synthesis. The major DNA-damage repair pathways are base excision repair and nucleotide excision repair, which, in the most simple terms, are distinguished by the extent of single-strand DNA removed together with the lesion. Mistakes made by DNA polymerases are corrected by the mismatch repair pathway, which also corrects mismatches generated when single strands of non-identical duplexes are exchanged during homologous recombination. In addition to the true repair pathways, the postreplication repair pathway allows lesions or structural aberrations that block replicative DNA polymerases to be tolerated. There are two bypass mechanisms: an error-free mechanism that involves a switch to an undamaged template for synthesis past the lesion and an error-prone mechanism that utilizes specialized translesion synthesis DNA polymerases to directly synthesize DNA across the lesion. A high level of functional redundancy exists among the pathways that deal with lesions, which minimizes the detrimental effects of endogenous and exogenous DNA damage. PMID:23547164

  15. Domain structure of a NHEJ DNA repair ligase from Mycobacterium tuberculosis. (United States)

    Pitcher, Robert S; Tonkin, Louise M; Green, Andrew J; Doherty, Aidan J


    A prokaryotic non-homologous end-joining (NHEJ) system for the repair of DNA double-strand breaks (DSBs), composed of a Ku homodimer (Mt-Ku) and a multidomain multifunctional ATP-dependent DNA ligase (Mt-Lig), has been described recently in Mycobacterium tuberculosis. Mt-Lig exhibits polymerase and nuclease activity in addition to DNA ligation activity. These functions were ascribed to putative polymerase, nuclease and ligase domains that together constitute a monomeric protein. Here, the separate polymerase, nuclease and ligase domains of Mt-Lig were cloned individually, over-expressed and the soluble proteins purified to homogeneity. The polymerase domain demonstrated DNA-dependent RNA primase activity, catalysing the synthesis of unprimed oligoribonucleotides on single-stranded DNA templates. The polymerase domain can also extend DNA in a template-dependent manner. This activity was eliminated when the catalytic aspartate residues were replaced with alanine. The ligase domain catalysed the sealing of nicked double-stranded DNA designed to mimic a DSB, consistent with the role of Mt-Lig in NHEJ. Deletion of the active-site lysine residue prevented the formation of an adenylated ligase complex and consequently thwarted ligation. The nuclease domain did not function independently as a 3'-5' exonuclease. DNA-binding assays revealed that both the polymerase and ligase domains bind DNA in vitro, the latter with considerably higher affinity. Mt-Ku directly stimulated the polymerase and nuclease activities of Mt-Lig. The polymerase domain bound Mt-Ku in vitro, suggesting it may recruit Mt-Lig to Ku-bound DNA in vivo. Consistent with these data, Mt-Ku stimulated the primer extension activity of the polymerase domain, suggestive of a functional interaction relevant to NHEJ-mediated DSB repair processes.

  16. Structure of a Novel DNA-binding Domain of Helicase-like Transcription Factor (HLTF) and Its Functional Implication in DNA Damage Tolerance. (United States)

    Hishiki, Asami; Hara, Kodai; Ikegaya, Yuzu; Yokoyama, Hideshi; Shimizu, Toshiyuki; Sato, Mamoru; Hashimoto, Hiroshi


    HLTF (helicase-like transcription factor) is a yeast RAD5 homolog found in mammals. HLTF has E3 ubiquitin ligase and DNA helicase activities, and plays a pivotal role in the template-switching pathway of DNA damage tolerance. HLTF has an N-terminal domain that has been designated the HIRAN (HIP116 and RAD5 N-terminal) domain. The HIRAN domain has been hypothesized to play a role in DNA binding; however, the structural basis of, and functional evidence for, the HIRAN domain in DNA binding has remained unclear. Here we show for the first time the crystal structure of the HIRAN domain of human HLTF in complex with DNA. The HIRAN domain is composed of six β-strands and two α-helices, forming an OB-fold structure frequently found in ssDNA-binding proteins, including in replication factor A (RPA). Interestingly, this study reveals that the HIRAN domain interacts with not only with a single-stranded DNA but also with a duplex DNA. Furthermore, the structure unexpectedly clarifies that the HIRAN domain specifically recognizes the 3'-end of DNA. These results suggest that the HIRAN domain functions as a sensor to the 3'-end of the primer strand at the stalled replication fork and that the domain facilitates fork regression. HLTF is recruited to a damaged site through the HIRAN domain at the stalled replication fork. Furthermore, our results have implications for the mechanism of template switching. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Programmed self-assembly of DNA/RNA for biomedical applications (United States)

    Wang, Pengfei

    Three self-assembly strategies were utilized for assembly of novel functional DNA/RNA nanostructures. RNA-DNA hybrid origami method was developed to fabricate nano-objects (ribbon, rectangle, and triangle) with precisely controlled geometry. Unlike conventional DNA origami which use long DNA single strand as scaffold, a long RNA single strand was used instead, which was folded by short DNA single strands (staples) into prescribed objects through sequence specific hybridization between RNA and DNA. Single stranded tiles (SST) and RNA-DNA hybrid origami were utilized to fabricate a variety of barcode-like nanostructures with unique patterns by expanding a plain rectangle via introducing spacers (10-bp dsDNA segment) between parallel duplexes. Finally, complex 2D array and 3D polyhedrons with multiple patterns within one structure were assembled from simple DNA motifs. Two demonstrations of biomedical applications of DNA nanotechnology were presented. Firstly, lambda-DNA was used as template to direct the fabrication of multi-component magnetic nanoparticle chains. Nuclear magnetic relaxation (NMR) characterization showed superb magnetic relaxativity of the nanoparticle chains which have large potential to be utilized as MRI contrast agents. Secondly, DNA nanotechnology was introduced into the conformational study of a routinely used catalytic DNAzyme, the RNA-cleaving 10-23 DNAzyme. The relative angle between two flanking duplexes of the catalytic core was determined (94.8°), which shall be able to provide a clue to further understanding of the cleaving mechanism of this DNAzyme from a conformational perspective.

  18. Multicolour probes for sequence-specific DNA detection based on graphene oxide. (United States)

    Zhu, Qing; Xiang, Dongshan; Zhang, Cuiling; Ji, Xinghu; He, Zhike


    The bifunctionality of graphene oxide (GO) which can highly adsorb single-stranded DNA (ssDNA) and effectively quench the emission of organic dyes is reasonably utilized in a multiplexed DNA detection system, achieving sensitive and selective detection of HIV, VV and EV, respectively.

  19. Ex vivo gene editing of the dystrophin gene in muscle stem cells mediated by peptide nucleic acid single stranded oligodeoxynucleotides induces stable expression of dystrophin in a mouse model for Duchenne muscular dystrophy. (United States)

    Nik-Ahd, Farnoosh; Bertoni, Carmen


    Duchenne muscular dystrophy (DMD) is a fatal disease caused by mutations in the dystrophin gene, which result in the complete absence of dystrophin protein throughout the body. Gene correction strategies hold promise to treating DMD. Our laboratory has previously demonstrated the ability of peptide nucleic acid single-stranded oligodeoxynucleotides (PNA-ssODNs) to permanently correct single-point mutations at the genomic level. In this study, we show that PNA-ssODNs can target and correct muscle satellite cells (SCs), a population of stem cells capable of self-renewing and differentiating into muscle fibers. When transplanted into skeletal muscles, SCs transfected with correcting PNA-ssODNs were able to engraft and to restore dystrophin expression. The number of dystrophin-positive fibers was shown to significantly increase over time. Expression was confirmed to be the result of the activation of a subpopulation of SCs that had undergone repair as demonstrated by immunofluorescence analyses of engrafted muscles using antibodies specific to full-length dystrophin transcripts and by genomic DNA analysis of dystrophin-positive fibers. Furthermore, the increase in dystrophin expression detected over time resulted in a significant improvement in muscle morphology. The ability of transplanted cells to return into quiescence and to activate upon demand was confirmed in all engrafted muscles following injury. These results demonstrate the feasibility of using gene editing strategies to target and correct SCs and further establish the therapeutic potential of this approach to permanently restore dystrophin expression into muscle of DMD patients. © 2014 AlphaMed Press.

  20. Radiobiology of DNA strand breakage

    International Nuclear Information System (INIS)

    Johansen, I.


    The yield of single-strand breaks in lambda DNA within lysogenic host bacteria was measured after exposure to 4-MeV electrons (50 msec) and rapid transfer (45 msec) to alkaline detergent. In nitrogen anoxia the yield was 1.2 x 10 -12 DNA single-strand breaks per rad per dalton, and under full oxygenation the yield increased to 5 x 10 -12 breaks per rad per dalton. A search for the presence of fast repair mechanisms failed to demonstrate the presence of any mechanism for repair of strand breaks operating within a fraction of a second. Strand breaks produced in the presence of oxygen were repaired in 30--40 sec, while breaks produced under anoxia were rejoined even slower. A functional product from the polAl gene was needed for the rejoining of the broken molecules. Intermediate levels of DNA strand breakage seen at low concentrations of oxygen are dependent on the concentration of cellular sulfhydryl compounds, suggesting that in strand breakage oxygen and hydrogen donors compete for reactions with radiation-induced transients in the DNA. Intercomparisons of data on radiation-induced lethality of cells and single-strand breaks in episomal DNA allow the distinction between two classes of radiation-induced radicals, R 1 and R 2 , with different chemical properties; R 1 reacts readily with oxygen and N-oxyls under formation of potentially lethal products. The reactivity of oxygen in this reaction is 30--40 times higher than that of TMPN. R 2 reacts 16 times more readily than R 1 with oxygen under formation of single-strand breaks in the DNA. R 2 does not react with N-oxyls

  1. Breaks in plasmid DNA strand induced by laser radiation at a wavelength of 193 nm

    International Nuclear Information System (INIS)

    Gurzadyan, G.G.; Shul'te Frolinde, D.


    DNA of plasmid pB322 irradiated with laser at a wavelength of 193 nm was treated with an extract containing proteins from E.coli K12 AB1157 (wild-type). The enzymes were found to produce single- and double-strand DNA breaks, which was interpreted as a transformation of a portion of cyclobutane pyrimidine dimers and (6-4) photoproducts into nonrepairable single-strand DNA breaks. The products resulted from ionization of DNA, in particular, single-strand breaks, transform to double-strand breaks. A comparison of these data with the data on survival of plasmid upon transformation of E.coli K12 AB1157 enables one to assess the biological significance of single- and double-strand breaks. The inactivation of the plasmid is mainly determined by the number of directly formed laser-induced single-strand breaks. 26 refs.; 2 figs

  2. Effect of DNA type on response of DNA biosensor for carcinogens (United States)

    Sani, Nor Diyana bt. Md.; Heng, Lee Yook; Surif, Salmijah; Lazim, Azwani Mat


    Carcinogens are cancer causing chemicals that can bind to DNA and cause damage to the DNA. These chemicals are available everywhere including in water, air, soil and food. Therefore, a sensor that can detect the presence of these chemicals will be a very useful tool. Since carcinogens bind to DNA, DNA can be used as the biological element in a biosensor. This study has utilized different types of DNA in a biosensor for carcinogen detection. The DNAs include double stranded calf thymus DNA, single stranded calf thymus DNA and guanine rich single stranded DNA. The modified SPE was exposed to a carcinogen followed by interaction with methylene blue which acts as the electroactive indicator. The SPE was then analysed using differential pulse voltammetry (DPV). Optimization studies were conducted for MB concentration and accumulation time, DNA concentration, as well as effect of buffer concentration, buffer pH and ionic strength. The performance of the biosensor was tested on a group 1 carcinogen, formaldehyde. The results indicated that the usage of guanine rich single stranded DNA also gives higher response as carcinogens prefer to bind with guanine compared to other bases.

  3. Polyacid macromolecule primers (United States)

    Sugama, Toshifumi.


    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  4. Analysis of DNA strand break induction and repair in plants from the vicinity of Chernobyl

    International Nuclear Information System (INIS)

    Syomov, A.B.; Ptitsyna, S.N.; Sergeeva, S.A.


    For 3 years following the Chernobyl accident DNA repair efficiency was studied in irradiated and control populations of various plan species. Compared with the control populations, some irradiated populations exhibited increases in the yield of DNA single-strand breaks per unit dose of challenge radiation. The effect was registered in low-dose-rate alpha-irradiated populations, but was absent in plant populations growing in conditions of low-dose-rate beta-irradiation. The efficiency of single-strand DNA repair was identical in control and irradiated populations and approximated 100%. (author). 12 refs.; 1 fig.; 2 tabs

  5. An iterative method for selecting degenerate multiplex PCR primers. (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong


    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  6. In Vitro Selection of Single-Stranded DNA Molecular Recognition Elements against S. aureus Alpha Toxin and Sensitive Detection in Human Serum


    Hong, Ka L.; Battistella, Luisa; Salva, Alysia D.; Williams, Ryan M.; Sooter, Letha J.


    Alpha toxin is one of the major virulence factors secreted by Staphylococcus aureus, a bacterium that is responsible for a wide variety of infections in both community and hospital settings. Due to the prevalence of S. aureus related infections and the emergence of methicillin-resistant S. aureus, rapid and accurate diagnosis of S. aureus infections is crucial in benefiting patient health outcomes. In this study, a rigorous Systematic Evolution of Ligands by Exponential Enrichment (SELEX) var...

  7. Lethal effects of 32P decay on transfecting activity of Bacillus subtillis phage phie DNA

    International Nuclear Information System (INIS)

    Loveday, K.S.


    Disintegration of 32 P present in the DNA of Bacillus subtilis phage phie (a phage containing double-strand DNA) results in the loss of viability of intact phage as well as transfecting activity of isolated DNA. Only 1/12 of the 32 P disintegrations per phage DNA equivalent inactivities the intact phage while nearly every disintegration inactivates the transfecting DNA. This result provides evidence for a single-strand intermediate in the transfection of B. subtilis by phie DNA

  8. Effects of the ssb-1 and ssb-113 mutations on survival and DNA repair in UV-irradiated delta uvrB strains of Escherichia coli K-12.


    Wang, T C; Smith, K C


    The molecular defect in DNA repair caused by ssb mutations (single-strand binding protein) was studied by analyzing DNA synthesis and DNA double-strand break production in UV-irradiated Escherichia coli delta uvrB strains. The presence of the ssb-113 mutation produced a large inhibition of DNA synthesis and led to the formation of double-strand breaks, whereas the ssb-1 mutation produced much less inhibition of DNA synthesis and fewer double-strand breaks. We suggest that the single-strand bi...

  9. Reaction of misonidazole with DNA radicals and its effect on the template activity of DNA

    International Nuclear Information System (INIS)

    Endoh, Daiji; Kuwabara, Mikinori; Sato, Fumiaki; Yoshii, Giichi.


    After calf thymus DNA was gamma-irradiated in the solid state in vacuo and subsequently dissolved in aqueous solution containing misonidazole (3 mM) under hypoxic condition, the frequency of single-strand breaks and alkali-labile sites in DNA and the amount of misonidazole bound to DNA were measured. The presence of misonidazole converted the precursor radicals, which otherwise results in single-strand breaks, to alkali-labile sites, and the amount of alkali-labile sites increased linearly with increasing radiation dose. The amount of misonidazole bound to DNA also increased linearly with increasing radiation dose. The biological meaning of the changes in the frequency of single-strand breaks and alkali-labile sites by the reaction of misonidazole with DNA radicals and of binding misonidazole with DNA was examined using a model system to measure the template activity of DNA for RNA synthesis in vitro. The conversion of DNA radicals to alkali-labile sites protected the radiation-induced decrease in the template activity of DNA, while the adduct formation of misonidazole had no effect on it. (author)

  10. MRX protects fork integrity at protein–DNA barriers, and its absence causes checkpoint activation dependent on chromatin context

    DEFF Research Database (Denmark)

    Bentsen, Iben Bach; Nielsen, Ida; Lisby, Michael


    location within the rDNA. We discover a pivotal role for the MRX (Mre11, Rad50, Xrs2) complex for fork integrity at RFBs, which differs from its acknowledged function in double-strand break processing. Consequently, in the absence of the MRX complex, single-stranded DNA (ssDNA) accumulates at the r...

  11. Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Krzysztof Lepek


    Full Text Available Monitoring and control of infections are key parts of surveillance systems and epidemiological risk prevention. In the case of influenza A viruses (IAVs, which show high variability, a wide range of hosts, and a potential of reassortment between different strains, it is essential to study not only people, but also animals living in the immediate surroundings. If understated, the animals might become a source of newly formed infectious strains with a pandemic potential. Special attention should be focused on pigs, because of the receptors specific for virus strains originating from different species, localized in their respiratory tract. Pigs are prone to mixed infections and may constitute a reservoir of potentially dangerous IAV strains resulting from genetic reassortment. It has been reported that a quadruple reassortant, A(H1N1pdm09, can be easily transmitted from humans to pigs and serve as a donor of genetic segments for new strains capable of infecting humans. Therefore, it is highly desirable to develop a simple, cost-effective, and rapid method for evaluation of IAV genetic variability. We describe a method based on multitemperature single-strand conformational polymorphism (MSSCP, using a fragment of the hemagglutinin (HA gene, for detection of coinfections and differentiation of genetic variants of the virus, difficult to identify by conventional diagnostic.

  12. Combining Single Strand Oligodeoxynucleotides and CRISPR/Cas9 to Correct Gene Mutations in β-Thalassemia-induced Pluripotent Stem Cells. (United States)

    Niu, Xiaohua; He, Wenyin; Song, Bing; Ou, Zhanhui; Fan, Di; Chen, Yuchang; Fan, Yong; Sun, Xiaofang


    β-Thalassemia (β-Thal) is one of the most common genetic diseases in the world. The generation of patient-specific β-Thal-induced pluripotent stem cells (iPSCs), correction of the disease-causing mutations in those cells, and then differentiation into hematopoietic stem cells offers a new therapeutic strategy for this disease. Here, we designed a CRISPR/Cas9 to specifically target the Homo sapiens hemoglobin β (HBB) gene CD41/42(-CTTT) mutation. We demonstrated that the combination of single strand oligodeoxynucleotides with CRISPR/Cas9 was capable of correcting the HBB gene CD41/42 mutation in β-Thal iPSCs. After applying a correction-specific PCR assay to purify the corrected clones followed by sequencing to confirm mutation correction, we verified that the purified clones retained full pluripotency and exhibited normal karyotyping. Additionally, whole-exome sequencing showed that the mutation load to the exomes was minimal after CRISPR/Cas9 targeting. Furthermore, the corrected iPSCs were selected for erythroblast differentiation and restored the expression of HBB protein compared with the parental iPSCs. This method provides an efficient and safe strategy to correct the HBB gene mutation in β-Thal iPSCs. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Development of techniques using DNA analysis method for detection/analysis of radiation-induced mutation. Development of an useful probe/primer and improvement of detection efficacy

    International Nuclear Information System (INIS)

    Maekawa, Hideaki; Tsuchida, Kozo; Hashido, Kazuo; Takada, Naoko; Kameoka, Yosuke; Hirata, Makoto


    Previously, it was demonstrated that detection of centromere became easy and reliable through fluorescent staining by FISH method using a probe of the sequence preserved in α-satelite DNA. Since it was, however, found inappropriate to detect dicentrics based on the relative amount of DNA probe on each chromosome. A prove which allows homogeneous detection of α-satelite DNA for each chromosome was constructed. A presumed sequence specific to kinetochore, CENP-B box was amplified by PCR method and the product DNA was used as a probe. However, the variation in amounts of probe DNA among chromosomes was decreased by only about 20%. Then, a program for image processing of the results obtained from FISH using α-satelite DNA was constructed to use as a marker for centromere. When compared with detection of abnormal chromosomes stained by the conventional method, calculation efficacy for only detection of centromere was improved by the use of this program. Calculation to discriminate the normal or not was still complicated and the detection efficacy was little improved. Chromosomal abnormalities in lymphocytes were used to detect the effects of radiation. In this method, it is needed to shift the phase of cells into metaphase. The mutation induced by radiation might be often repaired during shifting. To exclude this possibility, DNA extraction was conducted at a low temperature and immediately after exposure to 137 Cs, and a rapid genome detection method was established using the genome DNA. As the model genomes, the following three were used: 1) long chain repeated sequences widely dispersed over chromosome, 2) cluster genes, 3) single copy genes. The effects of radiation were detectable at 1-2 Gy for the long repeated sequences and at 7 Gy for the cluster genes, respectively, whereas no significant effects were observed at any Gy tested for the single copy genes. Amplification was marked in the cells exposed at 1-10 Gy (peak at 4 Gy), suggesting that these regions had

  14. Mycobacterium smegmatis Lhr Is a DNA-dependent ATPase and a 3'-to-5' DNA translocase and helicase that prefers to unwind 3'-tailed RNA:DNA hybrids. (United States)

    Ordonez, Heather; Shuman, Stewart


    We are interested in the distinctive roster of helicases of Mycobacterium, a genus of the phylum Actinobacteria that includes the human pathogen Mycobacterium tuberculosis and its avirulent relative Mycobacterium smegmatis. Here, we identify and characterize M. smegmatis Lhr as the exemplar of a novel clade of superfamily II helicases, by virtue of its biochemical specificities and signature domain organization. Lhr is a 1507-amino acid monomeric nucleic acid-dependent ATPase that uses the energy of ATP hydrolysis to drive unidirectional 3'-to-5' translocation along single strand DNA and to unwind duplexes en route. The ATPase is more active in the presence of calcium than magnesium. ATP hydrolysis is triggered by either single strand DNA or single strand RNA, yet the apparent affinity for a DNA activator is 11-fold higher than for an RNA strand of identical size and nucleobase sequence. Lhr is 8-fold better at unwinding an RNA:DNA hybrid than it is at displacing a DNA:DNA duplex of identical nucleobase sequence. The truncated derivative Lhr-(1-856) is an autonomous ATPase, 3'-to-5' translocase, and RNA:DNA helicase. Lhr-(1-856) is 100-fold better RNA:DNA helicase than DNA:DNA helicase. Lhr homologs are found in bacteria representing eight different phyla, being especially prevalent in Actinobacteria (including M. tuberculosis) and Proteobacteria (including Escherichia coli).

  15. Storage conditions of blood samples and primer selection affect the yield of cDNA polymerase chain reaction products of hepatitis C virus

    NARCIS (Netherlands)

    Cuypers, H. T.; Bresters, D.; Winkel, I. N.; Reesink, H. W.; Weiner, A. J.; Houghton, M.; van der Poel, C. L.; Lelie, P. N.


    We have noticed that suboptimal specimen processing and storage conditions may cause false-negative results in the detection of hepatitis C virus (HCV) RNA in plasma or serum. To establish the influence of specimen handling in a serological laboratory on the rate of detection of HCV RNA by the cDNA

  16. TopBP1/Dpb11 binds DNA anaphase bridges to prevent genome instability

    DEFF Research Database (Denmark)

    Germann, Susanne Manuela; Schramke, Vera; Pedersen, Rune Troelsgaard


    yeast Saccharomyces cerevisiae and the avian DT40 cell line as model systems for studying DNA anaphase bridges and show that TopBP1/Dpb11 plays an evolutionarily conserved role in their metabolism. Together with the single-stranded DNA binding protein RPA, TopBP1/Dpb11 binds to UFBs, and depletion...

  17. On the identification techniques for ionizing radiation structure breaks in the DNA molecule

    International Nuclear Information System (INIS)

    Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.


    In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)

  18. Polarizability of DNA Block Copolymer Nanoparticles Observed by Electrostatic Force Microscopy

    NARCIS (Netherlands)

    Sowwan, Mukhles; Faroun, Maryam; Mentovich, Elad; Ibrahim, Imad; Haboush, Shayma; Alemdaroglu, Fikri Emrah; Kwak, Minseok; Richter, Shachar; Herrmann, Andreas


    In this study, DNA block copolymer (DBC) micelles with a polystyrene (PS) core and a single-stranded (ss) DNA shell were doped with ferrocene (Fc) molecules. Tapping mode atomic force microscopy (AFM) was used to study the morphology of the doped and undoped block copolymer aggregates. We show that

  19. Effect of Radiofrequency Radiation on DNA Duplex Stability and Replication. (United States)


    Ando, T. A nuclease specific for heat-denatured DNA isolated from a product of Aspergillus oryzae . Biochim Biophys Acta 114:158-168 (1966). Blakeley...metabolic acti- vation. Mutation Res 64:315-328 (1979). Vogt,. V.M. Purification and further properties of single-strand-specific nuclease from Aspergillus oryzae . Eur J Biochem 33:192-200 (1973). 42

  20. Detection of DNA hybridizations using solid-state nanopores

    International Nuclear Information System (INIS)

    Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng


    We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.

  1. Detection of DNA hybridizations using solid-state nanopores

    Energy Technology Data Exchange (ETDEWEB)

    Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng, E-mail: [Department of Physics, Brown University, Providence, RI 02912 (United States)


    We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.

  2. Role of teh Rad52 Amino-terminal DNA Binding Activity in DNA Strand Capture in Homologous Recombination

    DEFF Research Database (Denmark)

    Shi, Idina; Hallwyl, Swee Chuang Lim; Seong, Changhyun


    Saccharomyces cerevisiae Rad52 protein promotes homologous recombination by nucleating the Rad51 recombinase onto replication protein A-coated single-stranded DNA strands and also by directly annealing such strands. We show that the purified rad52-R70A mutant protein, with a compromised amino-ter...

  3. Electrolytic reduction of nitroheterocyclic drugs leads to biologically important damage in DNA

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Pluijmackers-Westmijze, E.J.; Loman, H.


    The effects of electrolytic reduction of nitroimidazole drugs on biologically active DNA was studied. The results show that reduction of the drugs in the presence of DNA affects inactivation for both double-stranded (RF) and single-stranded phiX174 DNA. However, stable reduction products did not make a significant contribution to the lethal damage in DNA. This suggests that probably a short-lived intermediate of reduction of nitro-compounds is responsible for damage to DNA. (author)

  4. Detection of human DNA polymorphisms with a simplified denaturing gradient gel electrophoresis technique.


    Noll, W W; Collins, M


    Single base pair differences between otherwise identical DNA molecules can result in altered melting behavior detectable by denaturing gradient gel electrophoresis. We have developed a simplified procedure for using denaturing gradient gel electrophoresis to detect base pair changes in genomic DNA. Genomic DNA is digested with restriction enzymes and hybridized in solution to labeled single-stranded probe DNA. The excess probe is then hybridized to complementary phage M13 template DNA, and th...

  5. Variabilidad genética de Aedes aegypti en algunas áreas del Perú usando Single Stranded Conformational Polymorphism (SSCP

    Directory of Open Access Journals (Sweden)

    Nélida Leiva G


    Full Text Available Aedes aegypti es el vector responsable de la transmisión del virus del dengue, su distribución geográfica se ha ampliado rápidamente debido principalmente a la intervención de los seres humanos. Objetivo: Analizar la variabilidad genética de este mosquito mediante la comparación del Segundo Espaciador Transcrito Interno (ITS 2 perteneciente al ADN ribosomal (rADN. Materiales y Métodos: Se analizaron muestras de ocho localidades (Jaén, Tingo María, Iquitos, Lambayeque, el distrito de El Rimac, Sullana y Zarumilla y uno de la provincia de Huaquillas (Ecuador. El análisis de la variabilidad se determinó usando la técnica conocida como SSCP (Single Stranded Conformation Polymorphism. Resultados: El estudio muestra que existe variabilidad genética entre las poblaciones analizadas, principalmente entre las muestras localizadas en la costa del Perú (Zarumilla, El Rímac, Sullana y Huaquillas y las muestras del nororiente (Tingo María, Iquitos, Jaén y Lambayeque Conclusión: Se determinaron dos variantes genéticas entre las poblaciones de Aedes aegypti: Costeña y Nororiental, que probablemente provienen de dos ancestros diferentes y cuyo ancestro común sufrió de aislamiento por distancia. Se observó que no existe relación entre las distancias genéticas y las distancias geográficas indicando que la migración de estas poblaciones es el resultado de la intervención de los seres humanos que diseminan al vector y no por la migración activa del mosquito. Se plantea el papel de la Cordillera de los Andes en la migración y separación de las poblaciones de Aedes.

  6. Novel Positive-Sense, Single-Stranded RNA (+ssRNA) Virus with Di-Cistronic Genome from Intestinal Content of Freshwater Carp (Cyprinus carpio) (United States)

    Pankovics, Péter; Simmonds, Peter


    A novel positive-sense, single-stranded RNA (+ssRNA) virus (Halastavi árva RNA virus, HalV; JN000306) with di-cistronic genome organization was serendipitously identified in intestinal contents of freshwater carps (Cyprinus carpio) fished by line-fishing from fishpond “Lőrinte halastó” located in Veszprém County, Hungary. The complete nucleotide (nt) sequence of the genomic RNA is 9565 nt in length and contains two long - non-in-frame - open reading frames (ORFs), which are separated by an intergenic region. The ORF1 (replicase) is preceded by an untranslated sequence of 827 nt, while an untranslated region of 139 nt follows the ORF2 (capsid proteins). The deduced amino acid (aa) sequences of the ORFs showed only low (less than 32%) and partial similarity to the non-structural (2C-like helicase, 3C-like cystein protease and 3D-like RNA dependent RNA polymerase) and structural proteins (VP2/VP4/VP3) of virus families in Picornavirales especially to members of the viruses with dicistronic genome. Halastavi árva RNA virus is present in intestinal contents of omnivorous freshwater carps but the origin and the host species of this virus remains unknown. The unique viral sequence and the actual position indicate that Halastavi árva RNA virus seems to be the first member of a new di-cistronic ssRNA virus. Further studies are required to investigate the specific host species (and spectrum), ecology and role of Halastavi árva RNA virus in the nature. PMID:22195010

  7. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani


    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  8. Superimposed Code Theoretic Analysis of Deoxyribonucleic Acid (DNA) Codes and DNA Computing (United States)


    DNA strand and its Watson - Crick complement can be used to perform mathematical computation. This research addresses how the...Acid dsDNA double stranded DNA MOSAIC Mobile Stream Processing Cluster PCR Polymerase Chain Reaction RAM Random Access Memory ssDNA single stranded DNA WC Watson – Crick A Adenine C Cytosine G Guanine T Thymine ...are 5′→3′ and strands with strikethrough are 3′→5′. A dsDNA duplex formed between a strand and its reverse complement is called a

  9. Photocleavage of DNA: irradiation of quinone-containing reagents converts supercoiled to linear DNA

    International Nuclear Information System (INIS)

    Kock, T.; Schuster, G.B.; Ropp, J.D.; Sligar, S.G.


    Irradiation (350 nm) of air-saturated solutions of reagents containing an anthraquinone group linked to quaternary alkyl ammonium groups converts supercoiled DNA to circular and to linear DNA. Generation of linear DNA does not occur by accumulation of numerous single-strand cuts but by coincident-site double-strand cleavage of DNA. Irradiation forms the triplet state of the anthraquinone, which reacts either by hydrogen atom abstraction from a sugar of DNA or by electron transfer from a base of the DNA. Subsequent reactions result in chain scission. The quinone is apparently reformed after this sequence and reirradiation leads to double-strand cleavage. (Author)

  10. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur


    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  11. Sedimentation properties of DNA-membrane complexes and yield of DNA breaks at irradiation of mammalian cells

    International Nuclear Information System (INIS)

    Erzgraber, G.; Kozubek, S.; Lapidus, I.L.


    The dependence of the relative sedimentation velocity of DNA-membrane complexes on the dose of irradiation and time of incubation of Chinese Hamster cells is analysed. It is concluded that the initial part of the curve provides the information on the occurrence of single strand breaks in DNA; the position of the local maximum allows us to calculate the yield of DNA double strand breaks. The reparation decay constant can be estimated as well

  12. Nanotechnology: A Policy Primer (United States)


    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  13. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples. (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G


    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  14. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini


    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  15. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology. (United States)

    Galkiewicz, Julia P; Kellogg, Christina A


    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  16. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿


    Galkiewicz, Julia P.; Kellogg, Christina A.


    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  17. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿ (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.


    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  18. Development of DNA-based radiopharmaceuticals carrying Auger-electron emitters for anti-gene radiotherapy

    International Nuclear Information System (INIS)

    Panyutin, I.G.; Winters, T.A.; Feinendegen, L.E.; Neumann, R.D.


    Targeting of radiation damage to specific DNA sequences is the essence of antigene radiotherapy. This technique also provides a tool to study molecular mechanisms of DNA repair on a defined, single radio damaged site. It was achieved such sequence-specific radio damage by combining the highly localized DNA damage produced by the decay of Auger-electron-emitters such as 125 I with the sequence-specific action of triplex-forming oligonucleotides (TFO). TFO complementary to polypurine-polypyrimidine regions of human genes were synthesized and labeled with 125 I-dCTP by the primer extension method. 125 I-TFO were delivered into cells with several delivery systems. In addition, human enzymes capable of supporting DNA single-strand-break repair were isolated and assessed for their role in the repair of this lesion. Also, the mutagenicity and repairability of 125 I-TFO-induced double strand breaks (DSB) were assessed by repair of plasmid possessing a site-specific DSB lesion. Using plasmids containing target polypurine-polypyrimidine tracts, it was obtained the fine structure of sequence-specific DNA breaks produced by decay of 125 I with single-nucleotide resolution. It was showed that the designed 125 I-TFO in nanomolar concentrations could bind to and introduce double-strand breaks into the target sequences in situ, i.e., within isolated nuclei and intact digitonin-permeabilized cells. It was also showed 125 I-TFO-induced DSB to be highly mutagenic lesions resulting in a mutation frequency of nearly 80%, with deletions comprising the majority of mutations. The results obtained demonstrate the ability of 125 I-TFO to target specific sequences in their natural environment - within eukaryotic nucleus. Repair of 125 I-TFO-induced DNA damage should typically result in mutagenic gene inactivation

  19. Psoralens cleave pBR322 DNA under ultraviolet radiation

    International Nuclear Information System (INIS)

    Kagan, J.; Xinsheng Chen; Wang, T.P.


    Supercoiled (SC) pBR322 was used to probe the recent claim that 5-geranoxylpsoralen (5-GOP) did not photoreact with DNA. Contrary to expectations, 5-GOP was found to damage DNA in the presence of UV-A through two competing pathways; (a) single strand breaks, identified by the conversion of supercoiled into open circular and linear DNA, and (b) cross-linking, revealed by the fluence-dependent decrease in the extent of denaturation of the double stranded supercoiled DNA to single stranded circular DNA. In addition, a fluence-dependent modification reduced the ability of the restriction enzyme EcoR I to linearize the photosensitized DNA, and alkali-labile lesions were generated. Psoralen, 5-methoxypsoralen, and 8-methoxypsoralen, which are well-known to undergo cycloaddition to DNA, had a more pronounced effect on supercoiled DNA. Single strand breaks occurred more readily than with 5-GOP, and the surviving SC form remaining had reduced electrophoretic mobility in agarose gels. In all cases, the DNA damage was more prominent when oxygen was absent. (author)

  20. The beta subunit modulates bypass and termination at UV lesions during in vitro replication with DNA polymerase III holoenzyme of Escherichia coli

    International Nuclear Information System (INIS)

    Shavitt, O.; Livneh, Z.


    The cycling time of DNA polymerase III holoenzyme during replication of UV-irradiated single-stranded (ss) DNA was longer than with unirradiated DNA (8 versus 3 min, respectively), most likely due to slow dissociation from lesion-terminated nascent DNA strands. Initiation of elongation on primed ssDNA was not significantly inhibited by the presence of UV lesions as indicated by the identical distribution of replication products synthesized at early and late reaction times and by the identical duration of the initial synthesis bursts on both unirradiated and UV-irradiated DNA templates. When replication was performed with DNA polymerase III* supplemented with increasing quantities of purified beta 2 subunit, the cycling time on UV-irradiated DNA decreased from 14.8 min at 1.7 nM beta 2 down to 6 min at 170 nM beta 2, a concentration in which beta 2 was in large excess over the polymerase. In parallel to the reduction in cycling time, also the bypass frequency of cyclobutane-photodimers decreased with increasing beta 2 concentration, and at 170 nM beta 2, bypass of photodimers was essentially eliminated. It has been shown that polymerase complexes with more than one beta 2 per polymerase molecule were formed at high beta 2 concentrations. It is plausible that polymerase complexes obtained under high beta 2 concentration dissociate from lesion-terminated primers faster than polymerase complexes formed at a low beta 2 concentration. This is expected to favor termination over bypass at pyrimidine photodimers and thus decrease their bypass frequency. These results suggest that the beta 2 subunit might act as a sensor for obstacles to replication caused by DNA damage, and that it terminates elongation at these sites by promoting dissociation. The intracellular concentration of beta 2 was estimated to be 250 nM

  1. Radiosensitivity of mice of different lines and age as determinated with reference to ''intestinal'' death and DNA repair in intestinal epithelium cells

    Energy Technology Data Exchange (ETDEWEB)

    Konoplyannikova, O.A.; Sklobovskaya, M.V.; Konoplyannikov, A.G.; Saenko, A.S. (Akademiya Meditsinskikh Nauk SSSR, Obninsk. Nauchno-Issledovatel' skij Inst. Meditsinskoj Radiologii)

    A study was made of the influence of strain- and age-related differences on mouse mortality after irradiation with doses lying within the ''intestinal'' dose range, and also damages to stem cells of intestinal epithelium and induction and repair of single-strand DNA breaks in intestinal epitherium cells. Mice of different lines and age vary in LDsub(50/4) and stem cell radiosensitivity. There are no differences in the sedimentation constants of DNA fragments in alkaline lysates of intestinal crypts of intact mice of different age. Radiosensitivity determined with reference to single-strand breaks induction in DNA is similar with different mouse groups. Repair of single-strand DNA breaks of elderly mice is slower than that of young animals.

  2. Radiosensitivity of mice of different lines and age as determinated with reference to ''intestinal'' death and DNA repair in intestinal epithelium cells

    International Nuclear Information System (INIS)

    Konoplyannikova, O.A.; Sklobovskaya, M.V.; Konoplyannikov, A.G.; Saenko, A.S.


    A study was made of the influence of strain- and age-related differences on mouse mortality after irradiation with doses lying within the ''intest+nal'' dose range, and also damages to stem cells of intestinal epithelium and induction and repair of single-strand DNA breaks in intestinal epitherium cells. Mice of different lines and age vary in LDsub(50/4) and stem cell radiosensitivity. There are no differences in the sedimentation constants of DNA fragments in alkaline lysates of intestinal crypts of intact mice of different age. Radiosensitivity determined with reference to single-strand breaks induction in DNA is similar with different mo use groups. Repair of single-strand DNA breaks of eldery mice is slower than that of young animals

  3. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela


    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  4. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.). (United States)

    Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W


    Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation

  5. Quantifying DNA melting transitions using single-molecule force spectroscopy

    International Nuclear Information System (INIS)

    Calderon, Christopher P; Chen, W-H; Harris, Nolan C; Kiang, C-H; Lin, K-J


    We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

  6. Quantifying DNA melting transitions using single-molecule force spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Calderon, Christopher P [Department of Computational and Applied Mathematics, Rice University, Houston, TX (United States); Chen, W-H; Harris, Nolan C; Kiang, C-H [Department of Physics and Astronomy, Rice University, Houston, TX (United States); Lin, K-J [Department of Chemistry, National Chung Hsing University, Taichung, Taiwan (China)], E-mail:


    We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

  7. Involvement of DNA polymerase beta in repair of ionizing radiation damage as measured by in vitro plasmid assays.

    NARCIS (Netherlands)

    Vens, C.; Hofland, I.; Begg, A.C.


    Characteristic of damage introduced in DNA by ionizing radiation is the induction of a wide range of lesions. Single-strand breaks (SSBs) and base damages outnumber double-strand breaks (DSBs). If unrepaired, these lesions can lead to DSBs and increased mutagenesis. XRCC1 and DNA polymerase beta

  8. Cloning-free template DNA preparation for cell-free protein synthesis via two-step PCR using versatile primer designs with short 3'-UTR. (United States)

    Nomoto, Mika; Tada, Yasuomi


    Cell-free protein synthesis (CFPS) systems largely retain the endogenous translation machinery of the host organism, making them highly applicable for proteomics analysis of diverse biological processes. However, laborious and time-consuming cloning procedures hinder progress with CFPS systems. Herein, we report the development of a rapid and efficient two-step polymerase chain reaction (PCR) method to prepare linear DNA templates for a wheat germ CFPS system. We developed a novel, effective short 3'-untranslated region (3'-UTR) sequence that facilitates translation. Application of the short 3'-UTR to two-step PCR enabled the generation of various transcription templates from the same plasmid, including fusion proteins with N- or C-terminal tags, and truncated proteins. Our method supports the cloning-free expression of target proteins using an mRNA pool from biological material. The established system is a highly versatile platform for in vitro protein synthesis using wheat germ CFPS. © 2017 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  9. Genetic recombination in escherichia coli and its relationship with DNA replication

    International Nuclear Information System (INIS)

    Siddiqui, O.


    Relationship of DNA replication with genetic recombination in Escherichia Coli was investigated by mating Hfr donors labelled with H 3 -thymine, C 13 and N 15 to C 13 N 15 labelled recipients. The DNA extracted from the zygotes was analysed on CsCl density gradients. The results show that all of the biparentally labelled DNA arises from the single strand insertions of the donor DNA. (M.G.B.)

  10. The Los Alamos primer

    CERN Document Server

    Serber, Robert


    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  11. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun


    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  12. RPA binds histone H3-H4 and functions in DNA replication-coupled nucleosome assembly. (United States)

    Liu, Shaofeng; Xu, Zhiyun; Leng, He; Zheng, Pu; Yang, Jiayi; Chen, Kaifu; Feng, Jianxun; Li, Qing


    DNA replication-coupled nucleosome assembly is essential to maintain genome integrity and retain epigenetic information. Multiple involved histone chaperones have been identified, but how nucleosome assembly is coupled to DNA replication remains elusive. Here we show that replication protein A (RPA), an essential replisome component that binds single-stranded DNA, has a role in replication-coupled nucleosome assembly. RPA directly binds free H3-H4. Assays using a synthetic sequence that mimics freshly unwound single-stranded DNA at replication fork showed that RPA promotes DNA-(H3-H4) complex formation immediately adjacent to double-stranded DNA. Further, an RPA mutant defective in H3-H4 binding exhibited attenuated nucleosome assembly on nascent chromatin. Thus, we propose that RPA functions as a platform for targeting histone deposition to replication fork, through which RPA couples nucleosome assembly with ongoing DNA replication. Copyright © 2017, American Association for the Advancement of Science.

  13. Theory of high-force DNA stretching and overstretching. (United States)

    Storm, C; Nelson, P C


    Single-molecule experiments on single- and double-stranded DNA have sparked a renewed interest in the force versus extension of polymers. The extensible freely jointed chain (FJC) model is frequently invoked to explain the observed behavior of single-stranded DNA, but this model does not satisfactorily describe recent high-force stretching data. We instead propose a model (the discrete persistent chain) that borrows features from both the FJC and the wormlike chain, and show that it resembles the data more closely. We find that most of the high-force behavior previously attributed to stretch elasticity is really a feature of the corrected entropic elasticity; the true stretch compliance of single-stranded DNA is several times smaller than that found by previous authors. Next we elaborate our model to allow coexistence of two conformational states of DNA, each with its own stretch and bend elastic constants. Our model is computationally simple and gives an excellent fit through the entire overstretching transition of nicked, double-stranded DNA. The fit gives the first value for the bend stiffness of the overstretched state. In particular, we find the effective bend stiffness for DNA in this state to be about 12 nm k(B)T, a value quite different from either the B-form or single-stranded DNA.

  14. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh


    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  15. Force induced DNA melting

    International Nuclear Information System (INIS)

    Santosh, Mogurampelly; Maiti, Prabal K


    When pulled along the axis, double-strand DNA undergoes a large conformational change and elongates by roughly twice its initial contour length at a pulling force of about 70 pN. The transition to this highly overstretched form of DNA is very cooperative. Applying a force perpendicular to the DNA axis (unzipping), double-strand DNA can also be separated into two single-stranded DNA, this being a fundamental process in DNA replication. We study the DNA overstretching and unzipping transition using fully atomistic molecular dynamics (MD) simulations and argue that the conformational changes of double-strand DNA associated with either of the above mentioned processes can be viewed as force induced DNA melting. As the force at one end of the DNA is increased the DNA starts melting abruptly/smoothly above a critical force depending on the pulling direction. The critical force f m , at which DNA melts completely decreases as the temperature of the system is increased. The melting force in the case of unzipping is smaller compared to the melting force when the DNA is pulled along the helical axis. In the case of melting through unzipping, the double-strand separation has jumps which correspond to the different energy minima arising due to sequence of different base pairs. The fraction of Watson-Crick base pair hydrogen bond breaking as a function of force does not show smooth and continuous behavior and consists of plateaus followed by sharp jumps.

  16. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van


    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  17. Inhibition of gamma-radiation induced DNA damage in plasmid pBR322 by TMG, a water-soluble derivative of vitamin E. (United States)

    Rajagopalan, Rema; Wani, Khalida; Huilgol, Nagaraj G; Kagiya, Tsutomu V; Nair, Cherupally K Krishnan


    Alpha-tocopherol monoglucoside (TMG), a water-soluble derivative of alpha-tocopherol, has been examined for its ability to protect DNA against radiation-induced strand breaks. Gamma radiation, up to a dose of 6 Gy (dose rate, 0.7 Gy/minute), induced a dose-dependent increase in single strand breaks (SSBs) in plasmid pBR322 DNA. TMG inhibited the formation of gamma-radiation induced DNA single strand breaks (SSBs) in a concentration-dependent manner; 500 microM of TMG protected the single strand breaks completely. It also protected thymine glycol formation induced by gamma-radiation in a dose-dependent manner, based on an estimation of thymine glycol by HPLC.

  18. Inhibition of {gamma}-radiation induced DNA damage in plasmid pBR322 by TMG, a water-soluble derivative of vitamin E

    Energy Technology Data Exchange (ETDEWEB)

    Rajagopalan, R.; Nair, C.K.K. [Bhabha Atomic Research Centre, Mumbai (India); Wani, K.; Huilgol, N.G. [Nanavati Hospital and MRC, Vile Parle (India); Kagiya, Tsutomu V. [Kinki Research Foundation, Kyoto (Japan)


    Alpha-tocopherol monoglucoside (TMG), a water-soluble derivative of {alpha}-tocopherol, has been examined for its ability to protect DNA against radiation-induced strand breaks. Gamma radiation, up to a dose of 6 Gy (dose rate, 0.7 Gy/minute), induced a dose-dependent increase in single strand breaks (SSBs) in plasmid pBR322 DNA. TMG inhibited the formation of {gamma}-radiation induced DNA single strand breaks (SSBs) in a concentration-dependent manner; 500 {mu}M of TMG protected the single strand breaks completely. It also protected thymine glycol formation induced by {gamma}-radiation in a dose-dependent manner, based on an estimation of thymine glycol by HPLC. (author)

  19. Inhibition of γ-radiation induced DNA damage in plasmid pBR322 by TMG, a water-soluble derivative of vitamin E

    International Nuclear Information System (INIS)

    Rajagopalan, R.; Nair, C.K.K.; Wani, K.; Huilgol, N.G.; Kagiya, Tsutomu V.


    Alpha-tocopherol monoglucoside (TMG), a water-soluble derivative of α-tocopherol, has been examined for its ability to protect DNA against radiation-induced strand breaks. Gamma radiation, up to a dose of 6 Gy (dose rate, 0.7 Gy/minute), induced a dose-dependent increase in single strand breaks (SSBs) in plasmid pBR322 DNA. TMG inhibited the formation of γ-radiation induced DNA single strand breaks (SSBs) in a concentration-dependent manner; 500 μM of TMG protected the single strand breaks completely. It also protected thymine glycol formation induced by γ-radiation in a dose-dependent manner, based on an estimation of thymine glycol by HPLC. (author)

  20. Examining a DNA Replication Requirement for Bacteriophage λ Red- and Rac Prophage RecET-Promoted Recombination in Escherichia coli. (United States)

    Thomason, Lynn C; Costantino, Nina; Court, Donald L


    Recombineering, in vivo genetic engineering with bacteriophage homologous recombination systems, is a powerful technique for making genetic modifications in bacteria. Two systems widely used in Escherichia coli are the Red system from phage λ and RecET from the defective Rac prophage. We investigated the in vivo dependence of recombineering on DNA replication of the recombining substrate using plasmid targets. For λ Red recombination, when DNA replication of a circular target plasmid is prevented, recombination with single-stranded DNA oligonucleotides is greatly reduced compared to that under replicating conditions. For RecET recombination, when DNA replication of the targeted plasmid is prevented, the recombination frequency is also reduced, to a level identical to that seen for the Red system in the absence of replication. The very low level of oligonucleotide recombination observed in the absence of any phage recombination functions is the same in the presence or absence of DNA replication. In contrast, both the Red and RecET systems recombine a nonreplicating linear dimer plasmid with high efficiency to yield a circular monomer. Therefore, the DNA replication requirement is substrate dependent. Our data are consistent with recombination by both the Red and RecET systems occurring predominately by single-strand annealing rather than by strand invasion. Bacteriophage homologous recombination systems are widely used for in vivo genetic engineering in bacteria. Single- or double-stranded linear DNA substrates containing short flanking homologies to chromosome targets are used to generate precise and accurate genetic modifications when introduced into bacteria expressing phage recombinases. Understanding the molecular mechanism of these recombination systems will facilitate improvements in the technology. Here, two phage-specific systems are shown to require exposure of complementary single-strand homologous targets for efficient recombination; these single-strand

  1. Genetics of repair of radiation damage to DNA in bacteria

    International Nuclear Information System (INIS)

    Billen, D.; Hadden, C.T.


    The purpose of this study was to determine whether chemical protection against single-strand breaks observed in toluene-treated E. coli (AB3063) subjected to X irradiation in air was due to the removal of OH radicals, or resulted from the production of secondary radicals. In toluene-treated cells DNA strand-break production can be measured without the complication of strand ligation during or immediately following x-ray exposure since such cells are deficient in DNA ligase activity

  2. DNA synthesis in irradiated mammalian cells

    International Nuclear Information System (INIS)

    Painter, R.B.; California Univ., San Francisco; Young, B.R.


    One of the first responses observed in S phase mammalian cells that have suffered DNA damage is the inhibition of initiation of DNA replicons. In cells exposed to ionizing radiation, a single-strand break appears to be the stimulus for this effect, whereby the initiation of many adjacent replicons (a replicon cluster) is blocked by a single-strand break in any one of them. In cells exposed to ultraviolet light (u.v.), replicon initiation is blocked at fluences that induce about one pyrimidine dimer per replicon. The inhibition of replicon initiation by u.v. in Chinese hamster cells that are incapable of excising pyrimidine dimers from their DNA is virtually the same as in cells that are proficient in dimer excision. Therefore, a single-strand break formed during excision repair of pyrimidine dimers is not the stimulus for inhibition of replicon initiation in u.v.-irradiated cells. Considering this fact, as well as the comparative insensitivity of human ataxia telangiectasia cells to u.v.-induced inhibition of replicon initiation, we propose that a relatively rare lesion is the stimulus for u.v. -induced inhibition of replicon initiation. (author

  3. Size and frequency of gaps in newly synthesized DNA of xeroderma pigmentosum human cells irradiated with ultraviolet light

    International Nuclear Information System (INIS)

    Meneghini, R.; Cordeiro-Stone, M.; Schumacher, R.I.


    Native newly synthesized DNA from human cells (xeroderma pigmentosum type) irradiated with ultraviolet light releases short pieces of DNA (L-DNA) when incubated with the single-strand specific S 1 nuclease. This is not observed in the case of unirradiated cells. Previous experiments had shown that the L-DNA resulted from the action of S 1 nuclease upon gaps, i.e., single-stranded DNA discontinuities in larger pieces of double-stranded DNA. We verified that the duplex L-DNA, that arises from the inter-gap regions upon S 1 nuclease treatment, has a size which approximates the distance between two pyrimidine dimers on the same strand. A method was devised to measure the size of the gaps. These parameters have been considered in the proposition of a model for DNA synthesis on a template containing pyrimidine dimers

  4. Dynamics of DNA conformations and DNA-protein interaction

    DEFF Research Database (Denmark)

    Metzler, R.; Ambjörnsson, T.; Lomholt, Michael Andersen


    Optical tweezers, atomic force microscopes, patch clamping, or fluorescence techniques make it possible to study both the equilibrium conformations and dynamics of single DNA molecules as well as their interaction with binding proteins. In this paper we address the dynamics of local DNA...... denaturation (bubble breathing), deriving its dynamic response to external physical parameters and the DNA sequence in terms of the bubble relaxation time spectrum and the autocorrelation function of bubble breathing. The interaction with binding proteins that selectively bind to the DNA single strand exposed...... in a denaturation bubble are shown to involve an interesting competition of time scales, varying between kinetic blocking of protein binding up to full binding protein-induced denaturation of the DNA. We will also address the potential to use DNA physics for the design of nanosensors. Finally, we report recent...

  5. Decreased DNA repair capacity in familial, but not in sporadic Alzheimer's disease

    NARCIS (Netherlands)

    M.E.T.I. Boerrigter; C.M. van Duijn (Cornelia); E. Mullaart; P. Eikelenboom (Piet); C.M.A. van der Togt; D.L. Knook; J. Vijg (Jan); A. Hofman (Albert)


    textabstractUsing the alkaline filter elution technique we determined the induction and disappearance of DNA single-strand breaks (SSB) in freshly isolated peripheral blood lymphocytes (PBL) from 43 Alzheimer's disease (AD) patients and 48 normal, healthy age- and sex-matched control subjects

  6. Decreased DNA repair capacity in familial, but not in sporadic Alzheimer's disease

    NARCIS (Netherlands)

    Boerrigter, M. E.; van Duijn, C. M.; Mullaart, E.; Eikelenboom, P.; van der Togt, C. M.; Knook, D. L.; Hofman, A.; Vijg, J.


    Using the alkaline filter elution technique we determined the induction and disappearance of DNA single-strand breaks (SSB) in freshly isolated peripheral blood lymphocytes (PBL) from 43 Alzheimer's disease (AD) patients and 48 normal, healthy age- and sex-matched control subjects following in vitro

  7. Plasmid DNA damage by heavy ions at spread-out Bragg peak energies

    NARCIS (Netherlands)

    Dang, H. M.; van Goethem, M. J.; van der Graaf, E. R.; Brandenburg, S.; Hoekstra, R.; Schlatholter, T.


    Interaction of ionizing radiation with plasmid DNA can lead to formation of single strand breaks, double strand breaks and clustered lesions. We have investigated the response of the synthetic plasmid pBR322 in aqueous solution upon irradiation with (12)C ions under spread-out Bragg peak conditions

  8. Mouse RAD54 affects DNA double-strand break repair and sister chromatid exchange

    NARCIS (Netherlands)

    H.B. Beverloo (Berna); R.D. Johnson (Roger); M. Jasin (Maria); R. Kanaar (Roland); J.H.J. Hoeijmakers (Jan); M.L.G. Dronkert (Mies)


    textabstractCells can achieve error-free repair of DNA double-strand breaks (DSBs) by homologous recombination through gene conversion with or without crossover. In contrast, an alternative homology-dependent DSB repair pathway, single-strand annealing (SSA), results in deletions. In this study, we

  9. (Pheo)melanin photosensitizes UVA-induced DNA damage in cultured human melanocytes

    NARCIS (Netherlands)

    Wenczl, E.; Schans, G.P. van der; Roza, L.; Kolb, R.M.; Timmerman, A.J.; Smit, N.P.M.; Pavel, S.; Schothorst, A.A.


    The question of whether melanins are photoprotecting and/or photosensitizing in human skin cells continues to be debated. To evaluate the role of melanin upon UVA irradiation, DNA single-strand breaks (ssb) were measured in human melanocytes differing only in the amount of pigment produced by

  10. Structural Transformation of Wireframe DNA Origami via DNA Polymerase Assisted Gap-Filling. (United States)

    Agarwal, Nayan P; Matthies, Michael; Joffroy, Bastian; Schmidt, Thorsten L


    The programmability of DNA enables constructing nanostructures with almost any arbitrary shape, which can be decorated with many functional materials. Moreover, dynamic structures can be realized such as molecular motors and walkers. In this work, we have explored the possibility to synthesize the complementary sequences to single-stranded gap regions in the DNA origami scaffold cost effectively by a DNA polymerase rather than by a DNA synthesizer. For this purpose, four different wireframe DNA origami structures were designed to have single-stranded gap regions. This reduced the number of staple strands needed to determine the shape and size of the final structure after gap filling. For this, several DNA polymerases and single-stranded binding (SSB) proteins were tested, with T4 DNA polymerase being the best fit. The structures could be folded in as little as 6 min, and the subsequent optimized gap-filling reaction was completed in less than 3 min. The introduction of flexible gap regions results in fully collapsed or partially bent structures due to entropic spring effects. Finally, we demonstrated structural transformations of such deformed wireframe DNA origami structures with DNA polymerases including the expansion of collapsed structures and the straightening of curved tubes. We anticipate that this approach will become a powerful tool to build DNA wireframe structures more material-efficiently, and to quickly prototype and test new wireframe designs that can be expanded, rigidified, or mechanically switched. Mechanical force generation and structural transitions will enable applications in structural DNA nanotechnology, plasmonics, or single-molecule biophysics.

  11. In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites. (United States)

    Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R


    In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

  12. Single-strand breaks in oligodeoxyribonucleotides induced by fission neutrons and gamma radiation and measured by gel electrophoresis. Protective effects of aminothiols

    International Nuclear Information System (INIS)

    Swenberg, C.E.; Vaishnav, Y.N.; Li, Bin; Tsao, Hong; Mao, Bing; Geacintov, N.E.


    The technique of high-resolution gel electrophoresis using oligodeoxyribonucleotides of known composition as model systems, offers a simple quantitative estimate of DNA damage in aqueous solution induced by ionizing radiation. The fraction of damaged DNA can be quantitatively defined in terms of the increased electrophoretic mobilities of the damaged oligonucleotides, relative to the mobility of the unirradiated and intact oligonucleotides. The usual direct strand breaks can be observed at γ-ray dosages of 200 Gy. However, at a γ-ray dosage of 400 Gy, only a broad background, attributed to heterogeneously and multiply damaged oligonucleotide fragments with overlapping and varying electrophoretic mobilities, can be distinguished. On the other hand, individual bands due to resolvable DNA fragments are evident even at dosages as high as 400 Gy for fission neutrons. When double-stranded oligonucleotides are exposed to γ-ray dosages of 200 Gy, the fraction of damaged DNA approaches 30-40%. This damage can be almost completely suppressed (>99%) if the irradiations are conducted in aqueous solutions in the presence of 0.5-1.0 mM concentrations of the thiols cysteamine or 3-(3-methylaminopropylamino)propanethiol (WR-151326). The rate constant of reaction of OH·radicals with small double stranded oligonucleotides 16 base pairs long, K DNA , is found to be closer to the diffusion-controlled value (>3 x 10 9 M -1 s -1 ) than the magnitudes of K DNA for the higher molecular weight, native DNA reported in the literature. These observations suggest that oligonucleotides represent more simple model systems than native DNA in solutions for studying the mechanisms of radioprotection exerted by thiols of different structures. (author)

  13. Association of DNA repair polymorphisms with DNA repair functional outcomes in healthy human subjects

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Poláková, Veronika; Tulupová, Elena; Naccarati, Alessio; Vodičková, Ludmila; Kumar, R.; Hánová, Monika; Pardini, Barbara; Slyšková, Jana; Musak, L.; De Palma, G.; Souček, P.; Hemminki, K.


    Roč. 28, č. 3 (2007), s. 657-664 ISSN 0143-3334 R&D Projects: GA MZd NR8563; GA ČR GA310/05/2626 Institutional research plan: CEZ:AV0Z50390512 Keywords : Base excision DNA * Single-strand breaks * Peripheral blood lymphocytes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.406, year: 2007

  14. Defense Primer: DOD Contractors (United States)


    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  15. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins


    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  16. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.


    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  17. DNA cloning: a practical approach. Volume 1

    Energy Technology Data Exchange (ETDEWEB)

    Glover, D M [ed.


    This book is written for the advanced molecular biologist who needs a detailed discussion of cloning technology. Topics of discussion include: genomic library cloning (size of a genomic library, screening methods, chromosome walking, host cell genetics, and general features of bacteriophage Iambda); use of gt10 and gt11 cDNA lambda vectors and general cDNA cloning; RNase H-Pol I cDNA synthesis; method of detecting fusion proteins produced in bacteria; pEMBL family of double-stranded plasmid vectors that can be used to generate single strands; Escherichia coli transformation; production of mutations in cloned sequences; and cloning in gram negative bacteria.

  18. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.


    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  19. Environmental tobacco smoke is just as damaging to DNA as mainstream smoke.


    Bermúdez, E; Stone, K; Carter, K M; Pryor, W A


    This study demonstrates the ability of tar isolated from environmental tobacco smoke (ETS) to nick DNA in mammalian cells. Solutions of ETS tar behave similarly to aqueous solutions of cigarette tar from mainstream smoke. Both solutions contain the tar semiquinone radical, and this radical associates with the DNA in viable rat alveolar macrophages. Solutions of tar from ETS cause single-strand DNA breaks in rat thymocytes in proportion to the amount of tar present, until a plateau is reached....

  20. The sensitivity of active and inactive chromatin to ionizing radiation-induced DNA strand breakage

    International Nuclear Information System (INIS)

    Chiu, S.-M.; Oleinick, N.L.


    The sensitivity of DNA in actively transcribing and inactive states has been compared with regard to γ-radiation-induced single-strand break (SSB) induction. The results indicate that chromatin organization is important in the determination of the sensitivity of cellular DNA toward γ-radiation: Not only the yield but also the rate of repair of SSB is greater in the actively transcribing genes than in the total nuclear DNA. (author)