
Sample records for single-stranded dna molecule

  1. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W


    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  2. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.


    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  3. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.


    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  4. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)


    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  5. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.


    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  6. Single-Molecule Kinetics Reveal Cation-Promoted DNA Duplex Formation Through Ordering of Single-Stranded Helices (United States)

    Dupuis, Nicholas F.; Holmstrom, Erik D.; Nesbitt, David J.


    In this work, the kinetics of short, fully complementary oligonucleotides are investigated at the single-molecule level. Constructs 6–9 bp in length exhibit single exponential kinetics over 2 orders of magnitude time for both forward (kon, association) and reverse (koff, dissociation) processes. Bimolecular rate constants for association are weakly sensitive to the number of basepairs in the duplex, with a 2.5-fold increase between 9 bp (k′on = 2.1(1) × 106 M−1 s−1) and 6 bp (k′on = 5.0(1) × 106 M−1 s−1) sequences. In sharp contrast, however, dissociation rate constants prove to be exponentially sensitive to sequence length, varying by nearly 600-fold over the same 9 bp (koff = 0.024 s−1) to 6 bp (koff = 14 s−1) range. The 8 bp sequence is explored in more detail, and the NaCl dependence of kon and koff is measured. Interestingly, konincreases by >40-fold (kon = 0.10(1) s−1 to 4.0(4) s−1 between [NaCl] = 25 mM and 1 M), whereas in contrast, koffdecreases by fourfold (0.72(3) s−1 to 0.17(7) s−1) over the same range of conditions. Thus, the equilibrium constant (Keq) increases by ≈160, largely due to changes in the association rate, kon. Finally, temperature-dependent measurements reveal that increased [NaCl] reduces the overall exothermicity (ΔΔH° > 0) of duplex formation, albeit by an amount smaller than the reduction in entropic penalty (−TΔΔS° duplex formation. PMID:23931323

  7. Single-strand breaks in supercoiled DNA induced by vacuum-UV radiation in aqueous solution

    Energy Technology Data Exchange (ETDEWEB)

    Takakura, Kaoru; Ishikawa, Mitsuo; Hieda, Kotaro; Kobayashi, Katsumi; Ito, Atsushi; Ito, Takashi


    The induction of single-strand breaks in the DNA of plasmid pBR 322 by vacuum-UV radiation above 145 nm in aqueous solutions was studied in relation to the production of OH-radicals in water. The similarity and dissimilarity were examined on the wavelength dependence between the two effects. The maximum of single strand breaks at 150 nm could be explained by the action of OH-radicals derived from direct water photolysis: the maximum at 180 nm remains unexplained. There was no indication that the direct absorption of photon by the DNA molecule plays an important role in the production of single-strand breaks.

  8. Single-strand breaks in supercoiled DNA induced by vacuum-UV radiation in aqueous solution

    International Nuclear Information System (INIS)

    Takakura, Kaoru; Ishikawa, Mitsuo; Hieda, Kotaro; Kobayashi, Katsumi; Ito, Atsushi; Ito, Takashi


    The induction of single-strand breaks in the DNA of plasmid pBR 322 by vacuum-UV radiation above 145 nm in aqueous solutions was studied in relation to the production of OH-radicals in water. The similarity and dissimilarity were examined on the wavelength dependence between the two effects. The maximum of single strand breaks at 150 nm could be explained by the action of OH-radicals derived from direct water photolysis: the maximum at 180 nm remains unexplained. There was no indication that the direct absorption of photon by the DNA molecule plays an important role in the production of single-strand breaks. (author)

  9. Mammalian DNA single-strand break repair: an X-ra(y)ted affair. (United States)

    Caldecott, K W


    The genetic stability of living cells is continuously threatened by the presence of endogenous reactive oxygen species and other genotoxic molecules. Of particular threat are the thousands of DNA single-strand breaks that arise in each cell, each day, both directly from disintegration of damaged sugars and indirectly from the excision repair of damaged bases. If un-repaired, single-strand breaks can be converted into double-strand breaks during DNA replication, potentially resulting in chromosomal rearrangement and genetic deletion. Consequently, cells have adopted multiple pathways to ensure the rapid and efficient removal of single-strand breaks. A general feature of these pathways appears to be the extensive employment of protein-protein interactions to stimulate both the individual component steps and the overall repair reaction. Our current understanding of DNA single-strand break repair is discussed, and testable models for the architectural coordination of this important process are presented. Copyright 2001 John Wiley & Sons, Inc.

  10. DNA single strand break in fibroblast from Down syndrome patients

    International Nuclear Information System (INIS)

    Rozga, B.


    The radiosensitivity of tree trisomic (trisomia +21) strains of human fibroblasts to gamma radiation has been investigated in vitro and the causes of induction and repair of single strand DNA breaks in these cells have been estimated. The single strand breaks in DNA of normal and trisomic cells have been found to be ameliorated with an approximately equal efficiency. Repair has been found to be three times slower in trisomic cells compared to their normal relevant, most likely due to their elevated sensitivity to ionizing radiation and the following mortality of trisomic cells, and/or the potential occurrence of a great number of chromosome aberrations in cells irradiated in vitro. (author). 28 refs, 4 figs, 1 tab

  11. Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides. (United States)

    Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M; Högberg, Björn


    Single-stranded oligonucleotides are important as research tools, as diagnostic probes, in gene therapy and in DNA nanotechnology. Oligonucleotides are typically produced via solid-phase synthesis, using polymer chemistries that are limited relative to what biological systems produce. The number of errors in synthetic DNA increases with oligonucleotide length, and the resulting diversity of sequences can be a problem. Here we present the 'monoclonal stoichiometric' (MOSIC) method for enzyme-mediated production of DNA oligonucleotides. We amplified oligonucleotides from clonal templates derived from single bacterial colonies and then digested cutter hairpins in the products, which released pools of oligonucleotides with precisely controlled relative stoichiometric ratios. We prepared 14-378-nucleotide MOSIC oligonucleotides either by in vitro rolling-circle amplification or by amplification of phagemid DNA in Escherichia coli. Analyses of the formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides.

  12. Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides (United States)

    Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M.; Högberg, Björn


    Single-stranded oligonucleotides are important as research tools as probes for diagnostics and gene therapy. Today, production of oligonucleotides is done via solid-phase synthesis. However, the capabilities of current polymer chemistry are limited in comparison to what can be produced in biological systems. The errors in synthetic DNA increases with oligonucleotide length, and sequence diversity can often be a problem. Here, we present the Monoclonal Stoichiometric (MOSIC) method for enzymatic DNA oligonucleotide production. Using this method, we amplify oligonucleotides from clonal templates followed by digestion of a cutter-hairpin, resulting in pools of monoclonal oligonucleotides with precisely controlled relative stoichiometric ratios. We present data where MOSIC oligonucleotides, 14–378 nt long, were prepared either by in vitro rolling-circle amplification, or by amplification in Escherichia coli in the form of phagemid DNA. The formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides. PMID:23727986

  13. Programmable autonomous synthesis of single-stranded DNA (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng


    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  14. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface. (United States)

    Akbari, Fahimeh; Foroutan, Masumeh


    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  15. Novel Single-Stranded DNA Virus Genomes Recovered from Chimpanzee Feces Sampled from the Mambilla Plateau in Nigeria (United States)

    Walters, Matthew; Bawuro, Musa; Christopher, Alfred; Knight, Alexander; Kraberger, Simona; Stainton, Daisy; Chapman, Hazel


    ABSTRACT Metagenomic approaches are rapidly expanding our knowledge of the diversity of viruses. In the fecal matter of Nigerian chimpanzees we recovered three gokushovirus genomes, one circular replication-associated protein encoding single-stranded DNA virus (CRESS), and a CRESS DNA molecule. PMID:28254982

  16. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.


    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  17. Purification of Single-Stranded cDNA Based on RNA Degradation Treatment and Adsorption Chromatography. (United States)

    Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M


    Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.

  18. Genetic analysis of RPA single-stranded DNA binding protein in Haloferax volcanii


    Stroud, A. L.


    Replication protein A (RPA) is a single-stranded DNA-binding protein that is present in all three domains of life. The roles of RPA include stabilising and protecting single- stranded DNA from nuclease degradation during DNA replication and repair. To achieve this, RPA uses an oligosaccharide-binding fold (OB fold) to bind single- stranded DNA. Haloferax volcanii encodes three RPAs – RPA1, RPA2 and RPA3, of which rpa1 and rpa3 are in operons with genes encoding associated proteins (APs). ...

  19. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  20. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can


    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  1. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif. (United States)

    Zhu, Jie; Feng, Xiaolu; Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can


    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  2. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.


    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  3. Chemo-mechanical pushing of proteins along single-stranded DNA. (United States)

    Sokoloski, Joshua E; Kozlov, Alexander G; Galletto, Roberto; Lohman, Timothy M


    Single-stranded (ss)DNA binding (SSB) proteins bind with high affinity to ssDNA generated during DNA replication, recombination, and repair; however, these SSBs must eventually be displaced from or reorganized along the ssDNA. One potential mechanism for reorganization is for an ssDNA translocase (ATP-dependent motor) to push the SSB along ssDNA. Here we use single molecule total internal reflection fluorescence microscopy to detect such pushing events. When Cy5-labeled Escherichia coli (Ec) SSB is bound to surface-immobilized 3'-Cy3-labeled ssDNA, a fluctuating FRET signal is observed, consistent with random diffusion of SSB along the ssDNA. Addition of Saccharomyces cerevisiae Pif1, a 5' to 3' ssDNA translocase, results in the appearance of isolated, irregularly spaced saw-tooth FRET spikes only in the presence of ATP. These FRET spikes result from translocase-induced directional (5' to 3') pushing of the SSB toward the 3' ssDNA end, followed by displacement of the SSB from the DNA end. Similar ATP-dependent pushing events, but in the opposite (3' to 5') direction, are observed with EcRep and EcUvrD (both 3' to 5' ssDNA translocases). Simulations indicate that these events reflect active pushing by the translocase. The ability of translocases to chemo-mechanically push heterologous SSB proteins along ssDNA provides a potential mechanism for reorganization and clearance of tightly bound SSBs from ssDNA.

  4. Solubilization of Single-walled Carbon Nanotubes with Single- stranded DNA Generated from Asymmetric PCR

    Directory of Open Access Journals (Sweden)

    Chunhai Fan


    Full Text Available Carbon nanotubes (CNTs can be effectively dispersed and functionalized bywrapping with long single-stranded DNA (ssDNA synthesized by asymmetric PCR. ThessDNA-CNTs attached on surface of glass carbon electrode made it possible forelectrochemical analysis and sensing, which was demonstrated by reduction of H2O2 onhemoglobin/ssDNA-CNTs modified electrodes. This research showed the potentialapplication of DNA-functionalised CNTs in construction of future electrochemicalbiosensors.

  5. Electron attachment to DNA single strands: gas phase and aqueous solution. (United States)

    Gu, Jiande; Xie, Yaoming; Schaefer, Henry F


    The 2'-deoxyguanosine-3',5'-diphosphate, 2'-deoxyadenosine-3',5'-diphosphate, 2'-deoxycytidine-3',5'-diphosphate and 2'-deoxythymidine-3',5'-diphosphate systems are the smallest units of a DNA single strand. Exploring these comprehensive subunits with reliable density functional methods enables one to approach reasonable predictions of the properties of DNA single strands. With these models, DNA single strands are found to have a strong tendency to capture low-energy electrons. The vertical attachment energies (VEAs) predicted for 3',5'-dTDP (0.17 eV) and 3',5'-dGDP (0.14 eV) indicate that both the thymine-rich and the guanine-rich DNA single strands have the ability to capture electrons. The adiabatic electron affinities (AEAs) of the nucleotides considered here range from 0.22 to 0.52 eV and follow the order 3',5'-dTDP > 3',5'-dCDP > 3',5'-dGDP > 3',5'-dADP. A substantial increase in the AEA is observed compared to that of the corresponding nucleic acid bases and the corresponding nucleosides. Furthermore, aqueous solution simulations dramatically increase the electron attracting properties of the DNA single strands. The present investigation illustrates that in the gas phase, the excess electron is situated both on the nucleobase and on the phosphate moiety for DNA single strands. However, the distribution of the extra negative charge is uneven. The attached electron favors the base moiety for the pyrimidine, while it prefers the 3'-phosphate subunit for the purine DNA single strands. In contrast, the attached electron is tightly bound to the base fragment for the cytidine, thymidine and adenosine nucleotides, while it almost exclusively resides in the vicinity of the 3'-phosphate group for the guanosine nucleotides due to the solvent effects. The comparatively low vertical detachment energies (VDEs) predicted for 3',5'-dADP(-) (0.26 eV) and 3',5'-dGDP(-) (0.32 eV) indicate that electron detachment might compete with reactions having high activation barriers

  6. Molecular dynamics simulation of a DNA containing a single strand break

    Energy Technology Data Exchange (ETDEWEB)

    Yamaguchi, H.; Siebers, G.; Furukawa, A.; Otagiri, N.; Osman, R


    Molecular dynamics simulations were performed for a dodecamer DNA containing a single strand break (SSB), which has been represented by a 3'-OH deoxyribose and 5'-OH phosphate in the middle of the strand. Molecular force field parameters of the 5'-OH phosphate region were determined from an ab initio calculation at the HF/6-31G level using the program package GAMESS. The DNA was placed in a periodic boundary box with water molecules and Na+ counter-ions to produce a neutralised system. After minimisation, the system was heated to 300 K, equilibrated and a production run at constant NTP was executed for 1 ns using AMBER 4.1. Snapshots of the SSB-containing DNA and a detailed analysis of the equilibriated average structure revealed surprisingly small conformational changes compared to normal DNA. However, dynamic properties calculated using the essential dynamics method showed some features that may be important for the recognition of this damage by repair enzymes. (author)

  7. Selection and Characterization of Single Stranded DNA Aptamers for the Hormone Abscisic Acid (United States)

    Gonzalez, Victor M.; Millo, Enrico; Sturla, Laura; Vigliarolo, Tiziana; Bagnasco, Luca; Guida, Lucrezia; D'Arrigo, Cristina; De Flora, Antonio; Salis, Annalisa; Martin, Elena M.; Bellotti, Marta; Zocchi, Elena


    The hormone abscisic acid (ABA) is a small molecule involved in pivotal physiological functions in higher plants. Recently, ABA has been also identified as an endogenous hormone in mammals, regulating different cell functions including inflammatory processes, stem cell expansion, insulin release, and glucose uptake. Aptamers are short, single-stranded (ss) oligonucleotidesable to recognize target molecules with high affinity. The small size of the ABA molecule represented a challenge for aptamer development and the aim of this study was to develop specific anti-ABA DNA aptamers. Biotinylated abscisic acid (bio-ABA) was immobilized on streptavidin-coated magnetic beads. DNA aptamers against bio-ABA were selected with 7 iterative rounds of the systematic evolution of ligands by exponential enrichment method (SELEX), each round comprising incubation of the ABA-binding beads with the ssDNA sequences, DNA elution, electrophoresis, and polymerase chain reaction (PCR) amplification. The PCR product was cloned and sequenced. The binding affinity of several clones was determined using bio-ABA immobilized on streptavidin-coated plates. Aptamer 2 and aptamer 9 showed the highest binding affinity, with dissociation constants values of 0.98±0.14 μM and 0.80±0.07 μM, respectively. Aptamers 2 and 9 were also able to bind free, unmodified ABA and to discriminate between different ABA enantiomers and isomers. Our findings indicate that ssDNA aptamers can selectively bind ABA and could be used for the development of ABA quantitation assays. PMID:23971905

  8. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.


    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  9. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia


    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  10. RADX interacts with single-stranded DNA to promote replication fork stability

    DEFF Research Database (Denmark)

    Schubert, Lisa; Ho, Teresa; Hoffmann, Saskia


    Single-stranded DNA (ssDNA) regions form as an intermediate in many DNA-associated transactions. Multiple cellular proteins interact with ssDNA via the oligonucleotide/oligosaccharide-binding (OB) fold domain. The heterotrimeric, multi-OB fold domain-containing Replication Protein A (RPA) complex...... ssDNA-binding activities is critical for avoiding these defects. Our findings establish RADX as an important component of cellular pathways that promote DNA replication integrity under basal and stressful conditions by means of multiple ssDNA-binding proteins....

  11. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud


    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  12. Expression, purification and biochemical characterization of a single-stranded DNA binding protein from Herbaspirillum seropedicae. (United States)

    Vernal, Javier; Serpa, Viviane I; Tavares, Carolina; Souza, Emanuel M; Pedrosa, Fábio O; Terenzi, Hernán


    An open reading frame encoding a protein similar in size and sequence to the Escherichia coli single-stranded DNA binding protein (SSB protein) was identified in the Herbaspirillum seropedicae genome. This open reading frame was cloned into the expression plasmid pET14b. The SSB protein from H. seropedicae, named Hs_SSB, was overexpressed in E. coli strain BL21(DE3) and purified to homogeneity. Mass spectrometry data confirmed the identity of this protein. The apparent molecular mass of the native Hs_SSB was estimated by gel filtration, suggesting that the native protein is a tetramer made up of four similar subunits. The purified protein binds to single-stranded DNA (ssDNA) in a similar manner to other SSB proteins. The production of this recombinant protein in good yield opens up the possibility of obtaining its 3D-structure and will help further investigations into DNA metabolism.

  13. Selection and characterization of single stranded DNA aptamers recognizing fumonisin B1

    International Nuclear Information System (INIS)

    Chen, Xiujuan; Huang, Yukun; Duan, Nuo; Wu, Shijia; Xia, Yu; Ma, Xiaoyuan; Ding, Zhansheng; Wang, Zhouping; Zhu, Changqing; Jiang, Yuan


    We present an improved method for the selection of single-stranded DNA aptamers that can recognize fumonisin B 1 (FB 1 ). FB 1 is a carcinogenic mycotoxin mainly found in corn and corn-based food products worldwide, posing a global threat to feed and food safety. Selection was based on the mag-SELEX (magnetic bead systematic evolution of ligands by exponential enrichment) technology modified by adopting free analogs of targets rather than immobilized targets for counter selections. Firstly, aptamer candidates for FB 1 were selected from an 80 nt random DNA library after 13 rounds of selection. Next, binding assays were performed for affinity evaluation, and circular dichroism spectroscopy was used to investigate their conformation. A high-affinity aptamer designated as F10 (with a dissociation constant of 62 ± 5 nM) was identified and tested for its specificity by competitive binding assays. The results demonstrate that this improved mag-SELEX technology facilitates aptamer screening because it avoids the tedious immobilization of counter-selection molecules on magnetic beads. The aptamers obtained by this technique open new possibilities for the detection of FB 1 via aptasensors. (author)

  14. Selection and characterization of single stranded DNA aptamers recognizing fumonisin B{sub 1}

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Xiujuan; Huang, Yukun; Duan, Nuo; Wu, Shijia; Xia, Yu; Ma, Xiaoyuan; Ding, Zhansheng; Wang, Zhouping [State Key Laboratory of Food Science and Technology, Synergetic Innovation Center of Food Safety and Nutrition, School of Food Science and Technology, Jiangnan University, Wuxi, 214122 (China); Zhu, Changqing; Jiang, Yuan [Animal, Plant and Food Inspection Centre, Jiangsu Entry-Exit Inspection and Quarantine Bureau, Nanjing, 210001 (China)


    We present an improved method for the selection of single-stranded DNA aptamers that can recognize fumonisin B{sub 1} (FB{sub 1}). FB{sub 1} is a carcinogenic mycotoxin mainly found in corn and corn-based food products worldwide, posing a global threat to feed and food safety. Selection was based on the mag-SELEX (magnetic bead systematic evolution of ligands by exponential enrichment) technology modified by adopting free analogs of targets rather than immobilized targets for counter selections. Firstly, aptamer candidates for FB{sub 1} were selected from an 80 nt random DNA library after 13 rounds of selection. Next, binding assays were performed for affinity evaluation, and circular dichroism spectroscopy was used to investigate their conformation. A high-affinity aptamer designated as F10 (with a dissociation constant of 62 ± 5 nM) was identified and tested for its specificity by competitive binding assays. The results demonstrate that this improved mag-SELEX technology facilitates aptamer screening because it avoids the tedious immobilization of counter-selection molecules on magnetic beads. The aptamers obtained by this technique open new possibilities for the detection of FB{sub 1} via aptasensors. (author)

  15. Temporary electron localization and scattering in disordered single strands of DNA

    International Nuclear Information System (INIS)

    Caron, Laurent; Sanche, Leon


    We present a theoretical study of the effect of structural and base sequence disorders on the transport properties of nonthermal electron scattering within and from single strands of DNA. The calculations are based on our recently developed formalism to treat multiple elastic scattering from simplified pseudomolecular DNA subunits. Structural disorder is shown to increase both the elastic scattering cross section and the attachment probability on the bases at low energy. Sequence disorder, however, has no significant effect

  16. Defective processing of methylated single-stranded DNA by E. coli alkB mutants (United States)

    Dinglay, Suneet; Trewick, Sarah C.; Lindahl, Tomas; Sedgwick, Barbara


    Escherichia coli alkB mutants are very sensitive to DNA methylating agents. Despite these mutants being the subject of many studies, no DNA repair or other function has been assigned to the AlkB protein or to its human homolog. Here, we report that reactivation of methylmethanesulfonate (MMS)-treated single-stranded DNA phages, M13, f1, and G4, was decreased dramatically in alkB mutants. No such decrease occurred when using methylated λ phage or M13 duplex DNA. These data show that alkB mutants have a marked defect in processing methylation damage in single-stranded DNA. Recombinant AlkB protein bound more efficiently to single- than double-stranded DNA. The single-strand damage processed by AlkB was primarily cytotoxic and not mutagenic and was induced by SN2 methylating agents, MMS, DMS, and MeI but not by SN1 agent N-methyl-N-nitrosourea or by γ irradiation. Strains lacking other DNA repair activities, alkA tag, xth nfo, uvrA, mutS, and umuC, were not defective in reactivation of methylated M13 phage and did not enhance the defect of an alkB mutant. A recA mutation caused a small but additive defect. Thus, AlkB functions in a novel pathway independent of these activities. We propose that AlkB acts on alkylated single-stranded DNA in replication forks or at transcribed regions. Consistent with this theory, stationary phase alkB cells were less MMS sensitive than rapidly growing cells. PMID:10950872

  17. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks. (United States)

    Pachkowski, Brian; Nakamura, Jun


    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  18. MEIOB targets single-strand DNA and is necessary for meiotic recombination.

    Directory of Open Access Journals (Sweden)

    Benoit Souquet

    Full Text Available Meiotic recombination is a mandatory process for sexual reproduction. We identified a protein specifically implicated in meiotic homologous recombination that we named: meiosis specific with OB domain (MEIOB. This protein is conserved among metazoan species and contains single-strand DNA binding sites similar to those of RPA1. Our studies in vitro revealed that both recombinant and endogenous MEIOB can be retained on single-strand DNA. Those in vivo demonstrated the specific expression of Meiob in early meiotic germ cells and the co-localization of MEIOB protein with RPA on chromosome axes. MEIOB localization in Dmc1 (-/- spermatocytes indicated that it accumulates on resected DNA. Homologous Meiob deletion in mice caused infertility in both sexes, due to a meiotic arrest at a zygotene/pachytene-like stage. DNA double strand break repair and homologous chromosome synapsis were impaired in Meiob (-/- meiocytes. Interestingly MEIOB appeared to be dispensable for the initial loading of recombinases but was required to maintain a proper number of RAD51 and DMC1 foci beyond the zygotene stage. In light of these findings, we propose that RPA and this new single-strand DNA binding protein MEIOB, are essential to ensure the proper stabilization of recombinases which is required for successful homology search and meiotic recombination.

  19. Viral interference with DNA repair by targeting of the single-stranded DNA binding protein RPA. (United States)

    Banerjee, Pubali; DeJesus, Rowena; Gjoerup, Ole; Schaffhausen, Brian S


    Correct repair of damaged DNA is critical for genomic integrity. Deficiencies in DNA repair are linked with human cancer. Here we report a novel mechanism by which a virus manipulates DNA damage responses. Infection with murine polyomavirus sensitizes cells to DNA damage by UV and etoposide. Polyomavirus large T antigen (LT) alone is sufficient to sensitize cells 100 fold to UV and other kinds of DNA damage. This results in activated stress responses and apoptosis. Genetic analysis shows that LT sensitizes via the binding of its origin-binding domain (OBD) to the single-stranded DNA binding protein replication protein A (RPA). Overexpression of RPA protects cells expressing OBD from damage, and knockdown of RPA mimics the LT phenotype. LT prevents recruitment of RPA to nuclear foci after DNA damage. This leads to failure to recruit repair proteins such as Rad51 or Rad9, explaining why LT prevents repair of double strand DNA breaks by homologous recombination. A targeted intervention directed at RPA based on this viral mechanism could be useful in circumventing the resistance of cancer cells to therapy.

  20. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux


    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  1. Genomic mapping of single-stranded DNA in hydroxyurea-challenged yeasts identifies origins of replication. (United States)

    Feng, Wenyi; Collingwood, David; Boeck, Max E; Fox, Lindsay A; Alvino, Gina M; Fangman, Walton L; Raghuraman, Mosur K; Brewer, Bonita J


    During DNA replication one or both strands transiently become single stranded: first at the sites where initiation of DNA synthesis occurs (known as origins of replication) and subsequently on the lagging strands of replication forks as discontinuous Okazaki fragments are generated. We report a genome-wide analysis of single-stranded DNA (ssDNA) formation in the presence of hydroxyurea during DNA replication in wild-type and checkpoint-deficient rad53 Saccharomyces cerevisiae cells. In wild-type cells, ssDNA was first observed at a subset of replication origins and later 'migrated' bi-directionally, suggesting that ssDNA formation is associated with continuously moving replication forks. In rad53 cells, ssDNA was observed at virtually every known origin, but remained there over time, suggesting that replication forks stall. Telomeric regions seemed to be particularly sensitive to the loss of Rad53 checkpoint function. Replication origins in Schizosaccharomyces pombe were also mapped using our method.

  2. The impact of base stacking on the conformations and electrostatics of single-stranded DNA. (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois


    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail:; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki


    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  4. Strand Displacement by DNA Polymerase III Occurs through a τ-ψ-χ Link to Single-stranded DNA-binding Protein Coating the Lagging Strand Template*


    Yuan, Quan; McHenry, Charles S.


    In addition to the well characterized processive replication reaction catalyzed by the DNA polymerase III holoenzyme on single-stranded DNA templates, the enzyme possesses an intrinsic strand displacement activity on flapped templates. The strand displacement activity is distinguished from the single-stranded DNA-templated reaction by a high dependence upon single-stranded DNA binding protein and an inability of γ-complex to support the reaction in the absence of τ. However, if γ-complex is p...

  5. Rolling replication of UV-irradiated duplex DNA in the phi X174 replicative-form----single-strand replication system in vitro

    International Nuclear Information System (INIS)

    Shavitt, O.; Livneh, Z.


    Cloning of the phi X174 viral origin of replication into phage M13mp8 produced an M13-phi X174 chimera, the DNA of which directed efficient replicative-form----single-strand rolling replication in vitro. This replication assay was performed with purified phi X174-encoded gene A protein, Escherichia coli rep helicase, single-stranded DNA-binding protein, and DNA polymerase III holoenzyme. The nicking of replicative-form I (RFI) DNA by gene A protein was essentially unaffected by the presence of UV lesions in the DNA. However, unwinding of UV-irradiated DNA by the rep helicase was inhibited twofold as compared with unwinding of the unirradiated substrate. UV irradiation of the substrate DNA caused a strong inhibition in its ability to direct DNA synthesis. However, even DNA preparations that contained as many as 10 photodimers per molecule still supported the synthesis of progeny full-length single-stranded DNA. The appearance of full-length radiolabeled products implied at least two full rounds of replication, since the first round released the unlabeled plus viral strand of the duplex DNA. Pretreatment of the UV-irradiated DNA substrate with purified pyrimidine dimer endonuclease from Micrococcus luteus, which converted photodimer-containing supercoiled RFI DNA into relaxed, nicked RFII DNA and thus prevented its replication, reduced DNA synthesis by 70%. Analysis of radiolabeled replication products by agarose gel electrophoresis followed by autoradiography revealed that this decrease was due to a reduction in the synthesis of progeny full-length single-stranded DNA. This implies that 70 to 80% of the full-length DNA products produced in this system were synthesized on molecules that carried photodimers

  6. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams


    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  7. Helical filaments of human Dmc1 protein on single-stranded DNA: a cautionary tale (United States)

    Yu, Xiong; Egelman, Edward H.


    Proteins in the RecA/Rad51/RadA family form nucleoprotein filaments on DNA that catalyze a strand exchange reaction as part of homologous genetic recombination. Because of the centrality of this system to many aspects of DNA repair, the generation of genetic diversity, and cancer when this system fails or is not properly regulated, these filaments have been the object of many biochemical and biophysical studies. A recent paper has argued that the human Dmc1 protein, a meiotic homolog of bacterial RecA and human Rad51, forms filaments on single stranded DNA with ∼ 9 subunits per turn in contrast to the filaments formed on double stranded DNA with ∼ 6.4 subunits per turn, and that the stoichiometry of DNA binding is different between these two filaments. We show using scanning transmission electron microscopy (STEM) that the Dmc1 filament formed on single stranded DNA has a mass per unit length expected from ∼ 6.5 subunits per turn. More generally, we show how ambiguities in helical symmetry determination can generate incorrect solutions, and why one sometimes must use other techniques, such as biochemistry, metal shadowing, or STEM to resolve these ambiguities. While three-dimensional reconstruction of helical filaments from EM images is a powerful tool, the intrinsic ambiguities that may be present with limited resolution are not sufficiently appreciated. PMID:20600108

  8. Influence of DNA conformation on radiation-induced single-strand breaks

    International Nuclear Information System (INIS)

    Barone, F.; Belli, M.; Mazzei, F.


    We performed experiments on two DNA fragments of about 300 bp having different conformation to test whether radiation-induced single-strand breakage is dependent on DNA conformation. Breakage analysis was carried out by denaturing polyacrylamide gel electrophoresis, which allows determination of the broken site at single nucleotide resolution. We found uniform cutting patterns in B-form regions. On the contrary, X- or γ-irradiation of curved fragments of kinetoplast DNA showed that the distribution of single-strand breaks was not uniform along the fragment, as the cleavage pattern was modulated in phase with the runs of A-T pairs. This modulation likely reflected the reduced accessibility of the sites which on hydroxyl-radical attack give rise to strand breaks. The cleavage pattern was phased with the runs of A-T pairs. Moreover, the overall yield of strand breaks was considerably lower in curved DNA fragments than in those with extended straight regions. The conformation effect found here indicates that the cleavage pattern reflects the fine structural features of DNA. (orig./MG)

  9. Biophysical characterization of the association of histones with single-stranded DNA. (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier


    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted


    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  11. Single-strand breaks induced in Bacillus subtilis DNA by ultraviolet light: action spectrum and properties

    International Nuclear Information System (INIS)

    Peak, M.J.; Peak, J.G.


    The induction of single-strand breaks (alkali-labile bonds plus frank breaks) in the DNA of Bacillus subtilis irradiated in vivo by monochromatic UV light at wavelengths from 254 to 434nm was measured. The spectrum consists of a major far-UV (below 320nm) component and a minor near-UV shoulder. A mutant deficient in DNA polymerase I accumulates breaks caused by near-UV (above 320nm) wavelengths faster than the wild-type strain proficient in polymerase I. Measurable breaks in extracted DNA are induced at a higher frequency than those induced in vivo. Anoxia, glycerol, and diazobicyclo (2.2.2.) octane inhibit break formation in extracted DNA. Alkali-labile bonds induced by 365-nm UV radiation are largely (78%) covalent bond chain breaks, the remainder consists of true alkali-labile bonds, probably apurinic and apyrimidinic sites. (author)

  12. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.


    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  13. Transcription blockage by homopurine DNA sequences: role of sequence composition and single-strand breaks (United States)

    Belotserkovskii, Boris P.; Neil, Alexander J.; Saleh, Syed Shayon; Shin, Jane Hae Soo; Mirkin, Sergei M.; Hanawalt, Philip C.


    The ability of DNA to adopt non-canonical structures can affect transcription and has broad implications for genome functioning. We have recently reported that guanine-rich (G-rich) homopurine-homopyrimidine sequences cause significant blockage of transcription in vitro in a strictly orientation-dependent manner: when the G-rich strand serves as the non-template strand [Belotserkovskii et al. (2010) Mechanisms and implications of transcription blockage by guanine-rich DNA sequences., Proc. Natl Acad. Sci. USA, 107, 12816–12821]. We have now systematically studied the effect of the sequence composition and single-stranded breaks on this blockage. Although substitution of guanine by any other base reduced the blockage, cytosine and thymine reduced the blockage more significantly than adenine substitutions, affirming the importance of both G-richness and the homopurine-homopyrimidine character of the sequence for this effect. A single-strand break in the non-template strand adjacent to the G-rich stretch dramatically increased the blockage. Breaks in the non-template strand result in much weaker blockage signals extending downstream from the break even in the absence of the G-rich stretch. Our combined data support the notion that transcription blockage at homopurine-homopyrimidine sequences is caused by R-loop formation. PMID:23275544

  14. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    Energy Technology Data Exchange (ETDEWEB)

    Meffert, H; Boehm, F; Soennichsen, N; Gens, J [Humboldt-Universitaet, Berlin (German Democratic Republic). Bereich Medizin (Charite)


    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization.

  15. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.


    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  16. Excess single-stranded DNA inhibits meiotic double-strand break repair.

    Directory of Open Access Journals (Sweden)

    Rebecca Johnson


    Full Text Available During meiosis, self-inflicted DNA double-strand breaks (DSBs are created by the protein Spo11 and repaired by homologous recombination leading to gene conversions and crossovers. Crossover formation is vital for the segregation of homologous chromosomes during the first meiotic division and requires the RecA orthologue, Dmc1. We analyzed repair during meiosis of site-specific DSBs created by another nuclease, VMA1-derived endonuclease (VDE, in cells lacking Dmc1 strand-exchange protein. Turnover and resection of the VDE-DSBs was assessed in two different reporter cassettes that can repair using flanking direct repeat sequences, thereby obviating the need for a Dmc1-dependent DNA strand invasion step. Access of the single-strand binding complex replication protein A, which is normally used in all modes of DSB repair, was checked in chromatin immunoprecipitation experiments, using antibody against Rfa1. Repair of the VDE-DSBs was severely inhibited in dmc1Delta cells, a defect that was associated with a reduction in the long tract resection required to initiate single-strand annealing between the flanking repeat sequences. Mutants that either reduce Spo11-DSB formation or abolish resection at Spo11-DSBs rescued the repair block. We also found that a replication protein A component, Rfa1, does not accumulate to expected levels at unrepaired single-stranded DNA (ssDNA in dmc1Delta cells. The requirement of Dmc1 for VDE-DSB repair using flanking repeats appears to be caused by the accumulation of large quantities of ssDNA that accumulate at Spo11-DSBs when Dmc1 is absent. We propose that these resected DSBs sequester both resection machinery and ssDNA binding proteins, which in wild-type cells would normally be recycled as Spo11-DSBs repair. The implication is that repair proteins are in limited supply, and this could reflect an underlying mechanism for regulating DSB repair in wild-type cells, providing protection from potentially harmful effects

  17. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  18. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos


    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  19. Cdc45-induced loading of human RPA onto single-stranded DNA. (United States)

    Szambowska, Anna; Tessmer, Ingrid; Prus, Piotr; Schlott, Bernhard; Pospiech, Helmut; Grosse, Frank


    Cell division cycle protein 45 (Cdc45) is an essential component of the eukaryotic replicative DNA helicase. We found that human Cdc45 forms a complex with the single-stranded DNA (ssDNA) binding protein RPA. Moreover, it actively loads RPA onto nascent ssDNA. Pull-down assays and surface plasmon resonance studies revealed that Cdc45-bound RPA complexed with ssDNA in the 8-10 nucleotide binding mode, but dissociated when RPA covered a 30-mer. Real-time analysis of RPA-ssDNA binding demonstrated that Cdc45 catalytically loaded RPA onto ssDNA. This placement reaction required physical contacts of Cdc45 with the RPA70A subdomain. Our results imply that Cdc45 controlled stabilization of the 8-nt RPA binding mode, the subsequent RPA transition into 30-mer mode and facilitated an ordered binding to ssDNA. We propose that a Cdc45-mediated loading guarantees a seamless deposition of RPA on newly emerging ssDNA at the nascent replication fork. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.


    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  1. A conserved MCM single-stranded DNA binding element is essential for replication initiation. (United States)

    Froelich, Clifford A; Kang, Sukhyun; Epling, Leslie B; Bell, Stephen P; Enemark, Eric J


    The ring-shaped MCM helicase is essential to all phases of DNA replication. The complex loads at replication origins as an inactive double-hexamer encircling duplex DNA. Helicase activation converts this species to two active single hexamers that encircle single-stranded DNA (ssDNA). The molecular details of MCM DNA interactions during these events are unknown. We determined the crystal structure of the Pyrococcus furiosus MCM N-terminal domain hexamer bound to ssDNA and define a conserved MCM-ssDNA binding motif (MSSB). Intriguingly, ssDNA binds the MCM ring interior perpendicular to the central channel with defined polarity. In eukaryotes, the MSSB is conserved in several Mcm2-7 subunits, and MSSB mutant combinations in S. cerevisiae Mcm2-7 are not viable. Mutant Mcm2-7 complexes assemble and are recruited to replication origins, but are defective in helicase loading and activation. Our findings identify an important MCM-ssDNA interaction and suggest it functions during helicase activation to select the strand for translocation. DOI:

  2. Mapping yeast origins of replication via single-stranded DNA detection. (United States)

    Feng, Wenyi; Raghuraman, M K; Brewer, Bonita J


    Studies in th Saccharomyces cerevisiae have provided a framework for understanding how eukaryotic cells replicate their chromosomal DNA to ensure faithful transmission of genetic information to their daughter cells. In particular, S. cerevisiae is the first eukaryote to have its origins of replication mapped on a genomic scale, by three independent groups using three different microarray-based approaches. Here we describe a new technique of origin mapping via detection of single-stranded DNA in yeast. This method not only identified the majority of previously discovered origins, but also detected new ones. We have also shown that this technique can identify origins in Schizosaccharomyces pombe, illustrating the utility of this method for origin mapping in other eukaryotes.

  3. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.


    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  4. Repair of single-strand breaks induced in the DNA of Proteus mirabilis by excision repair after UV-irradiation

    International Nuclear Information System (INIS)

    Stoerl, K.; Mund, C.


    Single-strand breaks have been produced in the DNA of P. mirabilis after UV-irradiation in dependence on the incident UV-doses. It has been found that there exists a discrepancy between the single-strand breaks estimated from sedimentation in alkaline sucrose gradients and the expected single-strand breaks approximated from measurements of dimer excision. The low number in incision breaks observed by sedimentation experiments is an indication that the cells are able to repair the excision-induced breaks as fast as they are formed. Toluenized cells have been used for investigation of the incision step independently of subsequent repair processes. In presence of NMN the appearance of more single-strand breaks in the DNA has been observed. Furthermore, the number of incision breaks in toluenized cells increased in presence of exogenous ATP. The completion of the excision repair process has been investigated by observing the rejoining of incision breaks. After irradiation with UV-doses higher than approximately 240 erg/mm 2 the number of single-strand breaks remaining unrepaired in the DNA increased. Studies of the influence of nutrition conditions on the repair process have shown approximately the same capacity for repair of single-strand breaks in growth medium as well as in buffer. Progress in the excision repair was also followed by investigation of the DNA synthesized at the template-DNA containing the pyrimidine dimers. In comparison with E. coli, P. mirabilis showed a somewhat lower efficiency for the repair of single-strand breaks during the excision repair. (author)

  5. RPA Stabilization of Single-Stranded DNA Is Critical for Break-Induced Replication. (United States)

    Ruff, Patrick; Donnianni, Roberto A; Glancy, Eleanor; Oh, Julyun; Symington, Lorraine S


    DNA double-strand breaks (DSBs) are cytotoxic lesions that must be accurately repaired to maintain genome stability. Replication protein A (RPA) plays an important role in homology-dependent repair of DSBs by protecting the single-stranded DNA (ssDNA) intermediates formed by end resection and by facilitating Rad51 loading. We found that hypomorphic mutants of RFA1 that support intra-chromosomal homologous recombination are profoundly defective for repair processes involving long tracts of DNA synthesis, in particular break-induced replication (BIR). The BIR defects of the rfa1 mutants could be partially suppressed by eliminating the Sgs1-Dna2 resection pathway, suggesting that Dna2 nuclease attacks the ssDNA formed during end resection when not fully protected by RPA. Overexpression of Rad51 was also found to suppress the rfa1 BIR defects. We suggest that Rad51 binding to the ssDNA formed by excessive end resection and during D-loop migration can partially compensate for dysfunctional RPA. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  6. Reconstitution of RPA-covered single-stranded DNA-activated ATR-Chk1 signaling. (United States)

    Choi, Jun-Hyuk; Lindsey-Boltz, Laura A; Kemp, Michael; Mason, Aaron C; Wold, Marc S; Sancar, Aziz


    ATR kinase is a critical upstream regulator of the checkpoint response to various forms of DNA damage. Previous studies have shown that ATR is recruited via its binding partner ATR-interacting protein (ATRIP) to replication protein A (RPA)-covered single-stranded DNA (RPA-ssDNA) generated at sites of DNA damage where ATR is then activated by TopBP1 to phosphorylate downstream targets including the Chk1 signal transducing kinase. However, this critical feature of the human ATR-initiated DNA damage checkpoint signaling has not been demonstrated in a defined system. Here we describe an in vitro checkpoint system in which RPA-ssDNA and TopBP1 are essential for phosphorylation of Chk1 by the purified ATR-ATRIP complex. Checkpoint defective RPA mutants fail to activate ATR kinase in this system, supporting the conclusion that this system is a faithful representation of the in vivo reaction. Interestingly, we find that an alternative form of RPA (aRPA), which does not support DNA replication, can substitute for the checkpoint function of RPA in vitro, thus revealing a potential role for aRPA in the activation of ATR kinase. We also find that TopBP1 is recruited to RPA-ssDNA in a manner dependent on ATRIP and that the N terminus of TopBP1 is required for efficient recruitment and activation of ATR kinase.

  7. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells. (United States)

    Hirsch, Matthew L; Fagan, B Matthew; Dumitru, Raluca; Bower, Jacquelyn J; Yadav, Swati; Porteus, Matthew H; Pevny, Larysa H; Samulski, R Jude


    Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  8. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  9. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.


    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  10. Automated methods for single-stranded DNA isolation and dideoxynucleotide DNA sequencing reactions on a robotic workstation

    International Nuclear Information System (INIS)

    Mardis, E.R.; Roe, B.A.


    Automated procedures have been developed for both the simultaneous isolation of 96 single-stranded M13 chimeric template DNAs in less than two hours, and for simultaneously pipetting 24 dideoxynucleotide sequencing reactions on a commercially available laboratory workstation. The DNA sequencing results obtained by either radiolabeled or fluorescent methods are consistent with the premise that automation of these portions of DNA sequencing projects will improve the reproducibility of the DNA isolation and the procedures for these normally labor-intensive steps provides an approach for rapid acquisition of large amounts of high quality, reproducible DNA sequence data

  11. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik


    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  12. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B


    for phosphotyrosine-containing proteins in Streptomyces griseus by immunoaffinity chromatography identified bacterial SSBs as a novel target of bacterial tyrosine kinases. Since genes encoding protein-tyrosine kinases (PTKs) have not been recognized in streptomycetes, and SSBs from Streptomyces coelicolor (Sc......SSB) and Bacillus subtilis (BsSSB) share 38.7% identity, we used a B.subtilis protein-tyrosine kinase YwqD to phosphorylate two cognate SSBs (BsSSB and YwpH) in vitro. We demonstrate that in vivo phosphorylation of B.subtilis SSB occurs on tyrosine residue 82, and this reaction is affected antagonistically...... by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  13. Thermodynamic characterization of binding Oxytricha nova single strand telomere DNA with the alpha protein N-terminal domain. (United States)

    Buczek, Pawel; Horvath, Martin P


    The Oxytricha nova telemere binding protein alpha subunit binds single strand DNA and participates in a nucleoprotein complex that protects the very ends of chromosomes. To understand how the N-terminal, DNA binding domain of alpha interacts with DNA we measured the stoichiometry, enthalpy (DeltaH), entropy (DeltaS), and dissociation constant (K(D-DNA)) for binding telomere DNA fragments at different temperatures and salt concentrations using native gel electrophoresis and isothermal titration calorimetry (ITC). About 85% of the total free energy of binding corresponded with non-electrostatic interactions for all DNAs. Telomere DNA fragments d(T(2)G(4)), d(T(4)G(4)), d(G(3)T(4)G(4)), and d(G(4)T(4)G(4)) each formed monovalent protein complexes. In the case of d(T(4)G(4)T(4)G(4)), which has two tandemly repeated d(TTTTTGGGG) telomere motifs, two binding sites were observed. The high-affinity "A site" has a dissociation constant, K(D-DNA(A)) = 13(+/-4) nM, while the low-affinity "B site" is characterized by K(D-DNA(B)) = 5600(+/-600) nM at 25 degrees C. Nucleotide substitution variants verified that the A site corresponds principally with the 3'-terminal portion of d(T(4)G(4)T(4)G(4)). The relative contributions of entropy (DeltaS) and enthalpy (DeltaH) for binding reactions were DNA length-dependent as was heat capacity (DeltaCp). These trends with respect to DNA length likely reflect structural transitions in the DNA molecule that are coupled with DNA-protein association. Results presented here are important for understanding early intermediates and subsequent stages in the assembly of the full telomere nucleoprotein complex and how binding events can prepare the telomere DNA for extension by telomerase, a critical event in telomere biology.

  14. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity. (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L


    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity* (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.


    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  16. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.


    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  17. Analysis of the substrate recognition state of TDP-43 to single-stranded DNA using fluorescence correlation spectroscopy

    Directory of Open Access Journals (Sweden)

    Akira Kitamura


    Full Text Available Normal function and abnormal aggregation of transactivation response (TAR DNA/RNA-binding protein 43 kDa (TDP-43 are directly associated with the lethal genetic diseases: cystic fibrosis, amyotrophic lateral sclerosis (ALS, and frontotemporal lobar degeneration (FTLD. The binding of TDP-43 to single-stranded DNA (ssDNA or RNA is involved in transcriptional repression, regulation of RNA splicing, and RNA stabilization. Equilibrium dissociation constants (Kd of TDP-43 and ssDNA or RNA have been determined using various methods; however, methods that can measure Kd with high sensitivity in a short time using a small amount of TDP-43 in solution would be advantageous. Here, in order to determine the Kd of TDP-43 and fluorescence-labeled ssDNA as well as the binding stoichiometry, we use fluorescence correlation spectroscopy (FCS, which detects the slowed diffusion of molecular interactions in solution with single-molecule sensitivity, in addition to electrophoretic mobility shift assay (EMSA. Using tandem affinity chromatography of TDP-43 dually tagged with glutathione-S-transferase and poly-histidine tags, highly purified protein was obtained. FCS successfully detected specific interaction between purified TDP-43 and TG ssDNA repeats, with a Kd in the nanomolar range. The Kd of the TDP-43 mutant was not different from the wild type, although mutant oligomers, which did not bind ssDNA, were observed. Analysis of the fluorescence brightness per dimerized TDP-43/ssDNA complex was used to evaluate their binding stoichiometry. The results suggest that an assay combining FCS and EMSA can precisely analyze ssDNA recognition mechanisms, and that FCS may be applied for the rapid and quantitative determination of the interaction strength between TDP-43 and ssDNA or RNA. These methods will aid in the elucidation of the substrate recognition mechanism of ALS- and FTLD-associated variants of TDP-43.

  18. DNA translocation by human uracil DNA glycosylase: the case of single-stranded DNA and clustered uracils. (United States)

    Schonhoft, Joseph D; Stivers, James T


    Human uracil DNA glycosylase (hUNG) plays a central role in DNA repair and programmed mutagenesis of Ig genes, requiring it to act on sparsely or densely spaced uracil bases located in a variety of contexts, including U/A and U/G base pairs, and potentially uracils within single-stranded DNA (ssDNA). An interesting question is whether the facilitated search mode of hUNG, which includes both DNA sliding and hopping, changes in these different contexts. Here we find that hUNG uses an enhanced local search mode when it acts on uracils in ssDNA, and also, in a context where uracils are densely clustered in duplex DNA. In the context of ssDNA, hUNG performs an enhanced local search by sliding with a mean sliding length larger than that of double-stranded DNA (dsDNA). In the context of duplex DNA, insertion of high-affinity abasic product sites between two uracil lesions serves to significantly extend the apparent sliding length on dsDNA from 4 to 20 bp and, in some cases, leads to directionally biased 3' → 5' sliding. The presence of intervening abasic product sites mimics the situation where hUNG acts iteratively on densely spaced uracils. The findings suggest that intervening product sites serve to increase the amount of time the enzyme remains associated with DNA as compared to nonspecific DNA, which in turn increases the likelihood of sliding as opposed to falling off the DNA. These findings illustrate how the search mechanism of hUNG is not predetermined but, instead, depends on the context in which the uracils are located.

  19. Interactive Roles of DNA Helicases and Translocases with the Single-Stranded DNA Binding Protein RPA in Nucleic Acid Metabolism. (United States)

    Awate, Sanket; Brosh, Robert M


    Helicases and translocases use the energy of nucleoside triphosphate binding and hydrolysis to unwind/resolve structured nucleic acids or move along a single-stranded or double-stranded polynucleotide chain, respectively. These molecular motors facilitate a variety of transactions including replication, DNA repair, recombination, and transcription. A key partner of eukaryotic DNA helicases/translocases is the single-stranded DNA binding protein Replication Protein A (RPA). Biochemical, genetic, and cell biological assays have demonstrated that RPA interacts with these human molecular motors physically and functionally, and their association is enriched in cells undergoing replication stress. The roles of DNA helicases/translocases are orchestrated with RPA in pathways of nucleic acid metabolism. RPA stimulates helicase-catalyzed DNA unwinding, enlists translocases to sites of action, and modulates their activities in DNA repair, fork remodeling, checkpoint activation, and telomere maintenance. The dynamic interplay between DNA helicases/translocases and RPA is just beginning to be understood at the molecular and cellular levels, and there is still much to be learned, which may inform potential therapeutic strategies.

  20. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.


    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)


    Quantitation of intracellular NAD(P)H in living cells can monitor an imbalance of DNA single strand break repair in real time.ABSTRACTDNA single strand breaks (SSBs) are one of the most frequent DNA lesions in genomic DNA generated either by oxidative stress or du...

  2. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.


    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  3. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.


    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  4. Kinetics of repair of DNA single-strand breaks in cultured mammalian cells

    International Nuclear Information System (INIS)

    Vexler, F.B.; Eidus, L.Kh.; Vexler, A.M.


    Postirradiation treatment of Chinese hamster cells with cysteamine (MEA), caffeine-benzoate (CB) and caffeine sharply inhibits the repair of DNA single-strand breaks in the first five minutes. This inhibition is reversible since removing of the agent leads immediately to the resumption of the repair. The rate of the repair is decreased with prolongation of treatment and increasing concentration of the modifying agent. The efficiency of the substances studied depends not only on their concentration in the medium. For MEA and CB, which are weak electrolytes, it is also pH-dependent. This is explained by the theory of dissociation of weak electrolytes and their distribution between the cell and medium. It is shown that intracellular concentration of the substances is the most important factor determining their efficiency. All the three substances exert practically the same effect when compared at equal intracellular concentration. The above presented data serve as evidence for the existence of an unspecific mechanism of the effect of the substances studied. (author)

  5. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.


    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  6. Explanation for excessive DNA single-strand breaks and endogenous repair foci in pluripotent mouse embryonic stem cells. (United States)

    Banáth, J P; Bañuelos, C A; Klokov, D; MacPhail, S M; Lansdorp, P M; Olive, P L


    Pluripotent mouse embryonic stem cells (mES cells) exhibit approximately 100 large gammaH2AX repair foci in the absence of measurable numbers of DNA double-strand breaks. Many of these cells also show excessive numbers of DNA single-strand breaks (>10,000 per cell) when analyzed using the alkaline comet assay. To understand the reasons for these unexpected observations, various methods for detecting DNA strand breaks were applied to wild-type mES cells and to mES cells lacking H2AX, ATM, or DNA-PKcs. H2AX phosphorylation and expression of other repair complexes were measured using flow and image analysis of antibody-stained cells. Results indicate that high numbers of endogenous gammaH2AX foci and single-strand breaks in pluripotent mES cells do not require ATM or DNA-PK kinase activity and appear to be associated with global chromatin decondensation rather than pre-existing DNA damage. This will limit applications of gammaH2AX foci analysis in mES cells to relatively high levels of initial or residual DNA damage. Excessive numbers of single-strand breaks in the alkaline comet assay can be explained by the vulnerability of replicating chromatin in mES cells to osmotic shock. This suggests that caution is needed in interpreting results with the alkaline comet assay when applied to certain cell types or after treatment with agents that make chromatin vulnerable to osmotic changes. Differentiation of mES cells caused a reduction in histone acetylation, gammaH2AX foci intensity, and DNA single-strand breakage, providing a link between chromatin structural organization, excessive gammaH2AX foci, and sensitivity of replicating mES cell chromatin to osmotic shock.

  7. Alterations in the nuclear matrix protein mass correlate with heat-induced inhibition of DNA single-strand-break repair

    International Nuclear Information System (INIS)

    Warters, R.L.; Brizgys, L.M.; Lyons, B.W.


    The total protein mass co-isolating with the nuclear matrix or nucleoid from Chinese hamster ovary (CHO) cells was observed to increase in heated cells as a function of increasing exposure temperature between 43 0 C and 45 0 C or of exposure time at any temperature. The sedimentation distance of the CHO cell nucleoid in sucrose gradients increased with increasing exposure time at 45 0 C. Both these nuclear alterations correlated in a log-linear manner with heat-induced inhibition of DNA strand break repair. A two-fold threshold increase in nuclear matrix protein mass preceded any substantial inhibition of repair of DNA single-strand breaks. When preheated cells were incubated at 37 0 C the nuclear matrix protein mass and nucleoid sedimentation recovered with a half-time of about 5 h, while DNA single-strand-break repair recovered with a half-time of about 2 h. When preheated cells were placed at 41 0 C a further increase was observed in the nuclear matrix protein mass and the half-time of DNA strand break repair, while nucleoid sedimentation recovered toward control values. These results implicate alterations in the protein mass of the nuclear matrix in heat-induced inhibition of repair of DNA single-strand breaks. (author)

  8. Yield of single-strand breaks in the DNA of E. coli 10 msec after irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Fox, R A; Fielden, E M; Sapora, O [Institute of Cancer Research, Sutton (UK). Surrey Branch


    The rapid mixing of 0.3M alkali with a suspension of E.coli B/r 6 +- 3 and 144 +- 3 msec after irradiation with electrons (4.3 MeV, 0 to 50 krad) has been used to make a comparison of the yields of single strand breaks in the presence and absence of oxygen. No significant difference was observed between the numbers of single strand breaks appearing at 6 and 144 msec after irradiation. Assuming that mixing with alkali inactivates the cellular repair enzymes within several milliseconds, these results indicate that enzymic repair does not operate within this time scale. It seems probable that radiation chemical processes are responsible for the initial oxygen effect on single strand breaks.

  9. RPA-coated single-stranded DNA as a platform for post-translational modifications in the DNA damage response. (United States)

    Maréchal, Alexandre; Zou, Lee


    The Replication Protein A (RPA) complex is an essential regulator of eukaryotic DNA metabolism. RPA avidly binds to single-stranded DNA (ssDNA) through multiple oligonucleotide/oligosaccharide-binding folds and coordinates the recruitment and exchange of genome maintenance factors to regulate DNA replication, recombination and repair. The RPA-ssDNA platform also constitutes a key physiological signal which activates the master ATR kinase to protect and repair stalled or collapsed replication forks during replication stress. In recent years, the RPA complex has emerged as a key target and an important regulator of post-translational modifications in response to DNA damage, which is critical for its genome guardian functions. Phosphorylation and SUMOylation of the RPA complex, and more recently RPA-regulated ubiquitination, have all been shown to control specific aspects of DNA damage signaling and repair by modulating the interactions between RPA and its partners. Here, we review our current understanding of the critical functions of the RPA-ssDNA platform in the maintenance of genome stability and its regulation through an elaborate network of covalent modifications.

  10. Overproduction of single-stranded-DNA-binding protein specifically inhibits recombination of UV-irradiated bacteriophage DNA in Escherichia coli

    International Nuclear Information System (INIS)

    Moreau, P.L.


    Overproduction of single-stranded DNA (ssDNA)-binding protein (SSB) in uvr Escherichia coli mutants results in a wide range of altered phenotypes. (i) Cell survival after UV irradiation is decreased; (ii) expression of the recA-lexA regulon is slightly reduced after UV irradiation, whereas it is increased without irradiation; and (iii) recombination of UV-damaged lambda DNA is inhibited, whereas recombination of nonirradiated DNA is unaffected. These results are consistent with the idea that in UV-damaged bacteria, SSB is first required to allow the formation of short complexes of RecA protein and ssDNA that mediate cleavage of the LexA protein. However, in a second stage, SSB should be displaced from ssDNA to permit the production of longer RecA-ssDNA nucleoprotein filaments that are required for strand pairing and, hence, recombinational repair. Since bacteria overproducing SSB appear identical in physiological respects to recF mutant bacteria, it is suggested that the RecF protein (alone or with other proteins of the RecF pathway) may help RecA protein to release SSB from ssDNA

  11. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.


    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  12. Molecular Genetic Characterization of Mutagenesis Using a Highly Sensitive Single-Stranded DNA Reporter System in Budding Yeast. (United States)

    Chan, Kin


    Mutations are permanent alterations to the coding content of DNA. They are starting material for the Darwinian evolution of species by natural selection, which has yielded an amazing diversity of life on Earth. Mutations can also be the fundamental basis of serious human maladies, most notably cancers. In this chapter, I describe a highly sensitive reporter system for the molecular genetic analysis of mutagenesis, featuring controlled generation of long stretches of single-stranded DNA in budding yeast cells. This system is ~100- to ~1000-fold more susceptible to mutation than conventional double-stranded DNA reporters, and is well suited for generating large mutational datasets to investigate the properties of mutagens.

  13. Electroporation and microinjection successfully deliver single-stranded and duplex DNA into live cells as detected by FRET measurements.

    Directory of Open Access Journals (Sweden)

    Rosemary A Bamford

    Full Text Available Förster resonance energy transfer (FRET technology relies on the close proximity of two compatible fluorophores for energy transfer. Tagged (Cy3 and Cy5 complementary DNA strands forming a stable duplex and a doubly-tagged single strand were shown to demonstrate FRET outside of a cellular environment. FRET was also observed after transfecting these DNA strands into fixed and live cells using methods such as microinjection and electroporation, but not when using lipid based transfection reagents, unless in the presence of the endosomal acidification inhibitor bafilomycin. Avoiding the endocytosis pathway is essential for efficient delivery of intact DNA probes into cells.

  14. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.


    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  15. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing. (United States)

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon


    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  16. Mechanism of replication of ultraviolet-irradiated single-stranded DNA by DNA polymerase III holoenzyme of Escherichia coli. Implications for SOS mutagenesis

    International Nuclear Information System (INIS)

    Livneh, Z.


    Replication of UV-irradiated oligodeoxynucleotide-primed single-stranded phi X174 DNA with Escherichia coli DNA polymerase III holoenzyme in the presence of single-stranded DNA-binding protein was investigated. The extent of initiation of replication on the primed single-stranded DNA was not altered by the presence of UV-induced lesions in the DNA. The elongation step exhibited similar kinetics when either unirradiated or UV-irradiated templates were used. Inhibition of the 3'----5' proofreading exonucleolytic activity of the polymerase by dGMP or by a mutD mutation did not increase bypass of pyrimidine photodimers, and neither did purified RecA protein influence the extent of photodimer bypass as judged by the fraction of full length DNA synthesized. Single-stranded DNA-binding protein stimulated bypass since in its absence the fraction of full length DNA decreased 5-fold. Termination of replication at putative pyrimidine dimers involved dissociation of the polymerase from the DNA, which could then reinitiate replication at other available primer templates. Based on these observations a model for SOS-induced UV mutagenesis is proposed

  17. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  18. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.


    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  19. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB). (United States)

    van Loon, Barbara; Samson, Leona D


    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  20. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.


    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  1. Ion Density Analysis of Single-Stranded DNA in Liquid Crystal (United States)

    Iwabata, Kazuki; Seki, Yasutaka; Toizumi, Ryota; Shimada, Yuki; Furue, Hirokazu; Sakaguchi, Kengo


    With the widespread use of liquid crystals (LCs) in liquid crystal displays, we have looked into the application of liquid crystals in biotechnology. The purpose of the study described here is to investigate the physical properties of DNA using LCs. Synthetic oligonucleotide molecules were dispersed in MLC6884, the sample injected into antiparallel cells, and the amount of mobile ions was measured. The LC cell doped with oligonucleotide molecules showed a sequence-dependent, specific correlation between oligonucleotide concentration and the amount of mobile ions in the LC cells. In the framework of the Stokes model and polyacrylamide gel electrophoresis (PAGE) analysis, we speculate that this result arises from the difference in ion mobility, which is caused by the shape of the oligonucleotide molecule in the LC.

  2. Theoretical Study of the Transpore Velocity Control of Single-Stranded DNA

    Directory of Open Access Journals (Sweden)

    Weixin Qian


    Full Text Available The electrokinetic transport dynamics of deoxyribonucleic acid (DNA molecules have recently attracted significant attention in various fields of research. Our group is interested in the detailed examination of the behavior of DNA when confined in micro/nanofluidic channels. In the present study, the translocation mechanism of a DNA-like polymer chain in a nanofluidic channel was investigated using Langevin dynamics simulations. A coarse-grained bead-spring model was developed to simulate the dynamics of a long polymer chain passing through a rectangular cross-section nanopore embedded in a nanochannel, under the influence of a nonuniform electric field. Varying the cross-sectional area of the nanopore was found to allow optimization of the translocation process through modification of the electric field in the flow channel, since a drastic drop in the electric potential at the nanopore was induced by changing the cross-section. Furthermore, the configuration of the polymer chain in the nanopore was observed to determine its translocation velocity. The competition between the strength of the electric field and confinement in the small pore produces various transport mechanisms and the results of this study thus represent a means of optimizing the design of nanofluidic devices for single molecule detection.

  3. Molecular mechanisms of induced mutagenesis. Replication in vivo of bacteriophage phiX174 single-stranded, ultraviolet light-irradiated DNA in intact and irradiated host cells

    Energy Technology Data Exchange (ETDEWEB)

    Caillet-Fauquet, P; Defais, M; Radman, M [Brussels Univ. (Belgium)


    Genetic analysis has revealed that radiation and many chemical mutagens induce in bacteria an error-prone DNA repair process which is responsible for their mutagenic effect. The biochemical mechanism of this inducible error-prone repair has been studied by analysis of the first round of DNA synthesis on ultraviolet light-irradiated phiX174 DNA in both intact and ultraviolet light-irradiated host cells. Intracellular phiX174 DNA was extracted, subjected to isopycnic CsCl density-gradient analysis, hydroxylapatite chromatography and digestion by single-strand-specific endonuclease S/sub 1/. Ultraviolet light-induced photolesions in viral DNA cause a permanent blockage of DNA synthesis in intact Escherichia coli cells. However, when host cells were irradiated and incubated to induce fully the error-prone repair system, a significant fraction of irradiated phiX174 DNA molecules can be fully replicated. Thus, inducible error-prone repair in E.coli is manifested by an increased capacity for DNA synthesis on damaged phiX174 DNA. Chloramphenicol (100 g/ml), which is an inhibitor of the inducible error-prone DNA repair, is also an inhibitor of this particular inducible DNA synthesis.

  4. Strand displacement by DNA polymerase III occurs through a tau-psi-chi link to single-stranded DNA-binding protein coating the lagging strand template. (United States)

    Yuan, Quan; McHenry, Charles S


    In addition to the well characterized processive replication reaction catalyzed by the DNA polymerase III holoenzyme on single-stranded DNA templates, the enzyme possesses an intrinsic strand displacement activity on flapped templates. The strand displacement activity is distinguished from the single-stranded DNA-templated reaction by a high dependence upon single-stranded DNA binding protein and an inability of gamma-complex to support the reaction in the absence of tau. However, if gamma-complex is present to load beta(2), a truncated tau protein containing only domains III-V will suffice. This truncated protein is sufficient to bind both the alpha subunit of DNA polymerase (Pol) III and chipsi. This is reminiscent of the minimal requirements for Pol III to replicate short single-stranded DNA-binding protein (SSB)-coated templates where tau is only required to serve as a scaffold to hold Pol III and chi in the same complex (Glover, B., and McHenry, C. (1998) J. Biol. Chem. 273, 23476-23484). We propose a model in which strand displacement by DNA polymerase III holoenzyme depends upon a Pol III-tau-psi-chi-SSB binding network, where SSB is bound to the displaced strand, stabilizing the Pol III-template interaction. The same interaction network is probably important for stabilizing the leading strand polymerase interactions with authentic replication forks. The specificity constant (k(cat)/K(m)) for the strand displacement reaction is approximately 300-fold less favorable than reactions on single-stranded templates and proceeds with a slower rate (150 nucleotides/s) and only moderate processivity (approximately 300 nucleotides). PriA, the initiator of replication restart on collapsed or misassembled replication forks, blocks the strand displacement reaction, even if added to an ongoing reaction.

  5. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris


    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA......-binding proteins have previously been found to be phosphorylated on tyrosine and arginine residues. While tyrosine phosphorylation was shown to enhance the DNA-binding properties of SsbA, arginine phosphorylation was not functionally characterized.Materials and methods: We used mass spectrometry analysis to detect...... phosphorylation of SsbA purified from B. subtilis cells. The detected phosphorylation site was assessed for its influence on DNA-binding in vitro, using electrophoretic mobility shift assays. The ability of B. subtilis serine/threonine kinases to phosphorylate SsbA was assessed using in vitro phosphorylation...

  6. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.


    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  7. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.


    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  8. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  9. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)


    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  10. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.


    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  11. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii. (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten


    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  12. Structural Basis of Mec1-Ddc2-RPA Assembly and Activation on Single-Stranded DNA at Sites of Damage. (United States)

    Deshpande, Ishan; Seeber, Andrew; Shimada, Kenji; Keusch, Jeremy J; Gut, Heinz; Gasser, Susan M


    Mec1-Ddc2 (ATR-ATRIP) is a key DNA-damage-sensing kinase that is recruited through the single-stranded (ss) DNA-binding replication protein A (RPA) to initiate the DNA damage checkpoint response. Activation of ATR-ATRIP in the absence of DNA damage is lethal. Therefore, it is important that damage-specific recruitment precedes kinase activation, which is achieved at least in part by Mec1-Ddc2 homodimerization. Here, we report a structural, biochemical, and functional characterization of the yeast Mec1-Ddc2-RPA assembly. High-resolution co-crystal structures of Ddc2-Rfa1 and Ddc2-Rfa1-t11 (K45E mutant) N termini and of the Ddc2 coiled-coil domain (CCD) provide insight into Mec1-Ddc2 homodimerization and damage-site targeting. Based on our structural and functional findings, we present a Mec1-Ddc2-RPA-ssDNA composite structural model. By way of validation, we show that RPA-dependent recruitment of Mec1-Ddc2 is crucial for maintaining its homodimeric state at ssDNA and that Ddc2's recruitment domain and CCD are important for Mec1-dependent survival of UV-light-induced DNA damage. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. DNA single-strand breaks during repair of uv damage in human fibroblasts and abnormalities of repair in xeroderma pigmentosum

    International Nuclear Information System (INIS)

    Fornace, A.J. Jr.; Kohn, K.W.; Kann, H.E. Jr.


    The method of DNA alkaline elution was applied to a study of the formation and resealing of DNA single-strand breaks after irradiation of human fibroblasts with ultraviolet light (UV). The general features of the results were consistent with current concepts of DNA excision repair, in that breaks appeared rapidly after uv, and resealed slowly in normal fibroblasts, whereas breaks did not appear in those cells of patients with xeroderma pigmentosum (XP) that are known to have defects in DNA repair synthesis. The appearance of breaks required a short post-uv incubation, consistent with the expected action of an endonuclease. Cells of the variant form of XP characterized by normal DNA repair synthesis exhibited normal production of breaks after uv, but were slower than normal cells in resealing these breaks. This difference was enhanced by caffeine. A model is proposed to relate this finding with a previously described defect in post-replication repair in these XP variant cells. DNA crosslinking appears to cause an underestimate in the measurement of DNA breakage after uv

  14. Effect of nalidixic acid on repair of single-strand breaks in DNA induced by ionizing irradiation in Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Francia, I [Debreceni Orvostudomanyi Egyetem (Hungary); Okos, A; Hernadi, F J [Institute of Pharmacology, Debrecen (Hungary)


    The incidence of DNA single-strand breaks induced by /sup 60/Co irradiation and their repair in E.coli K12 (AB 1157) rec/sup +/ cells were studied by the alkaline sucrose gradient sedimentation method described by McGrath and Williams. For the quantitative analysis of sedimentation profiles we used the s 1/2 values described by Veatch and Okada. The s 1/2 value of non-irradiated controls was 22.4, and after 20 krads irradiation it was found to be 11.7. A postirradiation incubation at 37 /sup 0/C for 60 min increasedthe s 1/2 value from 11.7 to 22.1. Nalidixic acid at low concentration (20-50 did not block, but at 100 extensively inhibited the above repair process, exhibiting an s 1/2 value of 14.4.

  15. Yeast Srs2 Helicase Promotes Redistribution of Single-Stranded DNA-Bound RPA and Rad52 in Homologous Recombination Regulation

    Directory of Open Access Journals (Sweden)

    Luisina De Tullio


    Full Text Available Srs2 is a super-family 1 helicase that promotes genome stability by dismantling toxic DNA recombination intermediates. However, the mechanisms by which Srs2 remodels or resolves recombination intermediates remain poorly understood. Here, single-molecule imaging is used to visualize Srs2 in real time as it acts on single-stranded DNA (ssDNA bound by protein factors that function in recombination. We demonstrate that Srs2 is highly processive and translocates rapidly (∼170 nt per second in the 3′→5′ direction along ssDNA saturated with replication protein A (RPA. We show that RPA is evicted from DNA during the passage of Srs2. Remarkably, Srs2 also readily removes the recombination mediator Rad52 from RPA-ssDNA and, in doing so, promotes rapid redistribution of both Rad52 and RPA. These findings have important mechanistic implications for understanding how Srs2 and related nucleic acid motor proteins resolve potentially pathogenic nucleoprotein intermediates.

  16. Yeast Srs2 Helicase Promotes Redistribution of Single-Stranded DNA-Bound RPA and Rad52 in Homologous Recombination Regulation. (United States)

    De Tullio, Luisina; Kaniecki, Kyle; Kwon, Youngho; Crickard, J Brooks; Sung, Patrick; Greene, Eric C


    Srs2 is a super-family 1 helicase that promotes genome stability by dismantling toxic DNA recombination intermediates. However, the mechanisms by which Srs2 remodels or resolves recombination intermediates remain poorly understood. Here, single-molecule imaging is used to visualize Srs2 in real time as it acts on single-stranded DNA (ssDNA) bound by protein factors that function in recombination. We demonstrate that Srs2 is highly processive and translocates rapidly (∼170 nt per second) in the 3'→5' direction along ssDNA saturated with replication protein A (RPA). We show that RPA is evicted from DNA during the passage of Srs2. Remarkably, Srs2 also readily removes the recombination mediator Rad52 from RPA-ssDNA and, in doing so, promotes rapid redistribution of both Rad52 and RPA. These findings have important mechanistic implications for understanding how Srs2 and related nucleic acid motor proteins resolve potentially pathogenic nucleoprotein intermediates. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  17. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD


    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  18. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA. (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee


    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  19. DNA polymerase I-mediated repair of 365 nm-induced single-strand breaks in the DNA of Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Ley, R D; Sedita, B A; Boye, E [Argonne National Lab., Ill. (USA)


    Irradiation of closed circular phage lambda DNA in vivo at 365 nm results in the induction of single-strand breaks and alkali-labile lesions at rates of 1.1 x 10/sup -14/ and 0.2 x 10/sup -14//dalton/J/m/sup 2/, respectively. The sum of the induction rates is similar to the rate of induction of single-strand breaks plus alkali-labile lesions (1 x 10/sup -14//dalton/J/m/sup 2/) observed in the E. coli genome. Postirradiation incubation of wild-type cells in buffer results in rapid repair of the breaks (up to 80% repaired in 10 min). No repair was observed in a DNA polymerase I-deficient mutant of E.coli.

  20. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.


    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  1. Single-strand DNA-binding protein SSB1 facilitates TERT recruitment to telomeres and maintains telomere G-overhangs. (United States)

    Pandita, Raj K; Chow, Tracy T; Udayakumar, Durga; Bain, Amanda L; Cubeddu, Liza; Hunt, Clayton R; Shi, Wei; Horikoshi, Nobuo; Zhao, Yong; Wright, Woodring E; Khanna, Kum Kum; Shay, Jerry W; Pandita, Tej K


    Proliferating mammalian stem and cancer cells express telomerase [telomerase reverse transcriptase (TERT)] in an effort to extend chromosomal G-overhangs and maintain telomere ends. Telomerase-expressing cells also have higher levels of the single-stranded DNA-binding protein SSB1, which has a critical role in DNA double-strand break (DSB) repair. Here, we report that SSB1 binds specifically to G-strand telomeric DNA in vitro and associates with telomeres in vivo. SSB1 interacts with the TERT catalytic subunit and regulates its interaction with telomeres. Deletion of SSB1 reduces TERT interaction with telomeres and leads to G-overhang loss. Although SSB1 is recruited to DSB sites, we found no corresponding change in TERT levels at these sites, implying that SSB1-TERT interaction relies upon a specific chromatin structure or context. Our findings offer an explanation for how telomerase is recruited to telomeres to facilitate G-strand DNA extension, a critical step in maintaining telomere ends and cell viability in all cancer cells. Cancer Res; 75(5); 858-69. ©2015 AACR. ©2015 American Association for Cancer Research.

  2. Single-strand DNA binding protein SSB1 facilitates TERT recruitment to telomeres and maintains telomere G-overhangs (United States)

    Pandita, Raj K.; Chow, Tracy T.; Udayakumar, Durga; Bain, Amanda L.; Cubeddu, Liza; Hunt, Clayton R.; Shi, Wei; Horikoshi, Nobuo; Zhao, Yong; Wright, Woodring E.; Khanna, Kum Kum; Shay, Jerry W.; Pandita, Tej K.


    Proliferating mammalian stem and cancer cells express telomerase (TERT) in an effort to extend chromosomal G-overhangs and maintain telomere ends. Telomerase-expressing cells also have higher levels of the single-stranded DNA binding protein SSB1, which has a critical role in DNA double-strand break repair. Here we report that SSB1 binds specifically to G-strand telomeric DNA in vitro and associates with telomeres in vivo. SSB1 interacted with the TERT catalytic subunit and regulates its interaction with telomeres. Deletion of SSB1 reduced TERT interaction with telomeres and lead to G-overhang loss. While SSB1 was recruited to DSB sites, we found no corresponding change in TERT levels at these sites, implying that SSB1-TERT interaction relied upon a specific chromatin structure or context. Our findings offer an explanation for how telomerase is recruited to telomeres to facilitate G-strand DNA extension, a critical step in maintaining telomere ends and cell viability in all cancer cells. PMID:25589350

  3. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)


    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  4. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude


    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  5. All-atom molecular dynamics simulations of spin labelled double and single-strand DNA for EPR studies. (United States)

    Prior, C; Danilāne, L; Oganesyan, V S


    We report the first application of fully atomistic molecular dynamics (MD) simulations to the prediction of electron paramagnetic resonance (EPR) spectra of spin labelled DNA. Models for two structurally different DNA spin probes with either the rigid or flexible position of the nitroxide group in the base pair, employed in experimental studies previously, have been developed. By the application of the combined MD-EPR simulation methodology we aimed at the following. Firstly, to provide a test bed against a sensitive spectroscopic technique for the recently developed improved version of the parmbsc1 force field for MD modelling of DNA. The predicted EPR spectra show good agreement with the experimental ones available from the literature, thus confirming the accuracy of the currently employed DNA force fields. Secondly, to provide a quantitative interpretation of the motional contributions into the dynamics of spin probes in both duplex and single-strand DNA fragments and to analyse their perturbing effects on the local DNA structure. Finally, a combination of MD and EPR allowed us to test the validity of the application of the Model-Free (M-F) approach coupled with the partial averaging of magnetic tensors to the simulation of EPR spectra of DNA systems by comparing the resultant EPR spectra with those simulated directly from MD trajectories. The advantage of the M-F based EPR simulation approach over the direct propagation techniques is that it requires motional and order parameters that can be calculated from shorter MD trajectories. The reported MD-EPR methodology is transferable to the prediction and interpretation of EPR spectra of higher order DNA structures with novel types of spin labels.

  6. Evidence of pervasive biologically functional secondary structures within the genomes of eukaryotic single-stranded DNA viruses. (United States)

    Muhire, Brejnev Muhizi; Golden, Michael; Murrell, Ben; Lefeuvre, Pierre; Lett, Jean-Michel; Gray, Alistair; Poon, Art Y F; Ngandu, Nobubelo Kwanele; Semegni, Yves; Tanov, Emil Pavlov; Monjane, Adérito Luis; Harkins, Gordon William; Varsani, Arvind; Shepherd, Dionne Natalie; Martin, Darren Patrick


    Single-stranded DNA (ssDNA) viruses have genomes that are potentially capable of forming complex secondary structures through Watson-Crick base pairing between their constituent nucleotides. A few of the structural elements formed by such base pairings are, in fact, known to have important functions during the replication of many ssDNA viruses. Unknown, however, are (i) whether numerous additional ssDNA virus genomic structural elements predicted to exist by computational DNA folding methods actually exist and (ii) whether those structures that do exist have any biological relevance. We therefore computationally inferred lists of the most evolutionarily conserved structures within a diverse selection of animal- and plant-infecting ssDNA viruses drawn from the families Circoviridae, Anelloviridae, Parvoviridae, Nanoviridae, and Geminiviridae and analyzed these for evidence of natural selection favoring the maintenance of these structures. While we find evidence that is consistent with purifying selection being stronger at nucleotide sites that are predicted to be base paired than at sites predicted to be unpaired, we also find strong associations between sites that are predicted to pair with one another and site pairs that are apparently coevolving in a complementary fashion. Collectively, these results indicate that natural selection actively preserves much of the pervasive secondary structure that is evident within eukaryote-infecting ssDNA virus genomes and, therefore, that much of this structure is biologically functional. Lastly, we provide examples of various highly conserved but completely uncharacterized structural elements that likely have important functions within some of the ssDNA virus genomes analyzed here.

  7. Replication of UV-irradiated single-stranded DNA by DNA polymerase III holoenzyme of Escherichia coli: evidence for bypass of pyrimidine photodimers

    International Nuclear Information System (INIS)

    Livneh, Z.


    Replication of UV-irradiated circular single-stranded phage M13 DNA by Escherichia coli RNA polymerase (EC and DNA polymerase III holoenzyme (EC in the presence of single-stranded DNA binding protein yielded full-length as well as partially replicated products. A similar result was obtained with phage G4 DNA primed with E. coli DNA primase, and phage phi X174 DNA primed with a synthetic oligonucleotide. The fraction of full-length DNA was several orders of magnitude higher than predicted if pyrimidine photodimers were to constitute absolute blocks to DNA replication. Recent models have suggested that pyrimidine photodimers are absolute blocks to DNA replication and that SOS-induced proteins are required to allow their bypass. Our results demonstrate that, under in vitro replication conditions, E. coli DNA polymerase III holoenzyme can insert nucleotides opposite pyrimidine dimers to a significant extent, even in the absence of SOS-induced proteins

  8. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo


    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  9. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.


    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  10. DFT investigations of phosphotriesters hydrolysis in aqueous solution: a model for DNA single strand scission induced by N-nitrosoureas. (United States)

    Liu, Tingting; Zhao, Lijiao; Zhong, Rugang


    DNA phosphotriester adducts are common alkylation products of DNA phosphodiester moiety induced by N-nitrosoureas. The 2-hydroxyethyl phosphotriester was reported to hydrolyze more rapidly than other alkyl phosphotriesters both in neutral and in alkaline conditions, which can cause DNA single strand scission. In this work, DFT calculations have been employed to map out the four lowest activation free-energy profiles for neutral and alkaline hydrolysis of triethyl phosphate (TEP) and diethyl 2-hydroxyethyl phosphate (DEHEP). All the hydrolysis pathways were illuminated to be stepwise involving an acyclic or cyclic phosphorane intermediate for TEP or DEHEP, respectively. The rate-limiting step for all the hydrolysis reactions was found to be the formation of phosphorane intermediate, with the exception of DEHEP hydrolysis in alkaline conditions that the decomposition process turned out to be the rate-limiting step, owing to the extraordinary low formation barrier of cyclic phosphorane intermediate catalyzed by hydroxide. The rate-limiting barriers obtained for the four reactions are all consistent with the available experimental information concerning the corresponding hydrolysis reactions of phosphotriesters. Our calculations performed on the phosphate triesters hydrolysis predict that the lower formation barriers of cyclic phosphorane intermediates compared to its acyclic counter-part should be the dominant factor governing the hydrolysis rate enhancement of DEHEP relative to TEP both in neutral and in alkaline conditions.

  11. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate. (United States)

    Zhang, Xueru; McGown, Linda B


    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Ultra-fast repair of single-strand breaks in DNA of. gamma. -irradiated Chinese hamster cells

    Energy Technology Data Exchange (ETDEWEB)

    Leontjeva, G A; Mantzighin, Yu A; Gaziev, A I [AN SSSR, Pushchino-na-Oke. Inst. Biologicheskoj Fiziki


    Studies of the effect of thermal treatment of Chinese hamster cells on sedimentation of DNA in the alkaline sucrose gradient showed that heating the cells to 68/sup 0/C for 15 min caused the same degradation as ..gamma..-irradiation with 5 to 7 krad at 37/sup 0/C. The inhibition of cellular repair enzymes by heating was therefore unacceptable. The process of ultra-fast repair is essentially determined by the DNA-ligase reaction, which is activated in the presence of Mg ions, and inhibited in mammalian cells in the presence of EDTA and pyrophosphate. Sedimentation profiles were therefore measured for the DNA of Chinese hamster cells ..gamma..-irradiated (5 krad) at 0/sup 0/C or 22/sup 0/C in the presence of Mg/sup + +/, or EDTA and pyrophosphate, and the results demonstrated ultra-fast repair only at 20 to 37/sup 0/C, in contrast to bacteria. A study was made of the temperature dependence of the activity of the DNA ligases isolated from E.coli and rabbit bone marrow. The NAD-dependent bacterial DNA ligase was active at temperatures from 0 to 40/sup 0/C, whereas ATP-dependent DNA ligase of mammals only showed activity in the range 15 to 40/sup 0/C. The differing temperature dependences of ultra-fast repair in bacterial and mammalian cells are in agreement with the temperature dependences of the activities of isolated enzymes, and the results suggest that the process of ultra-fast repair of single-strand breaks of DNA takes place in both bacterial and mammalian cells.

  13. Electrical signatures of single-stranded DNA with single base mutations in a nanopore capacitor

    International Nuclear Information System (INIS)

    Gracheva, Maria E; Aksimentiev, Aleksei; Leburton, Jean-Pierre


    In this paper, we evaluate the magnitude of the electrical signals produced by DNA translocation through a 1 nm diameter nanopore in a capacitor membrane with a numerical multi-scale approach, and assess the possibility of resolving individual nucleotides as well as their types in the absence of conformational disorder. We show that the maximum recorded voltage caused by the DNA translocation is about 35 mV, while the maximum voltage signal due to the DNA backbone is about 30 mV, and the maximum voltage of a DNA base is about 8 mV. Signals from individual nucleotides can be identified in the recorded voltage traces, suggesting a 1 nm diameter pore in a capacitor can be used to accurately count the number of nucleotides in a DNA strand. Furthermore, we study the effect of a single base substitution on the voltage trace, and calculate the differences among the voltage traces due to a single base mutation for the sequences C 3 AC 7 , C 3 CC 7 , C 3 GC 7 and C 3 TC 7 . The calculated voltage differences are in the 5-10 mV range. The calculated maximum voltage caused by the translocation of individual bases varies from 2 to 9 mV, which is experimentally detectable

  14. Absorption by DNA single strands of adenine isolated in vacuo: The role of multiple chromophores

    DEFF Research Database (Denmark)

    Nielsen, L.M.; Pedersen, S.O.; Kirketerp, M.-B.S.


    to that for the adenine molecule and the dAMP mononucleotide. Desolvation has little effect on the bandwidth, which implies that inhomogenous broadening of the absorption bands in aqueous solution is of minor importance compared to, e.g., conformational disorder. Finally, at high photon energies, internal conversion...

  15. Expansion during PCR of short single-stranded DNA fragments carrying nonselfcomplementary dinucleotide or trinucleotide repeats

    Czech Academy of Sciences Publication Activity Database

    Reichová, Naďa; Kypr, Jaroslav


    Roč. 30, č. 3 (2003), s. 155-163 ISSN 0301-4851 R&D Projects: GA ČR GA301/01/0590 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA * PCR * expansion Subject RIV: BO - Biophysics Impact factor: 0.565, year: 2003

  16. Replication protein A (RPA) hampers the processive action of APOBEC3G cytosine deaminase on single-stranded DNA. (United States)

    Lada, Artem G; Waisertreiger, Irina S-R; Grabow, Corinn E; Prakash, Aishwarya; Borgstahl, Gloria E O; Rogozin, Igor B; Pavlov, Youri I


    Editing deaminases have a pivotal role in cellular physiology. A notable member of this superfamily, APOBEC3G (A3G), restricts retroviruses, and Activation Induced Deaminase (AID) generates antibody diversity by localized deamination of cytosines in DNA. Unconstrained deaminase activity can cause genome-wide mutagenesis and cancer. The mechanisms that protect the genomic DNA from the undesired action of deaminases are unknown. Using the in vitro deamination assays and expression of A3G in yeast, we show that replication protein A (RPA), the eukaryotic single-stranded DNA (ssDNA) binding protein, severely inhibits the deamination activity and processivity of A3G. We found that mutations induced by A3G in the yeast genomic reporter are changes of a single nucleotide. This is unexpected because of the known property of A3G to catalyze multiple deaminations upon one substrate encounter event in vitro. The addition of recombinant RPA to the oligonucleotide deamination assay severely inhibited A3G activity. Additionally, we reveal the inverse correlation between RPA concentration and the number of deaminations induced by A3G in vitro on long ssDNA regions. This resembles the "hit and run" single base substitution events observed in yeast. Our data suggest that RPA is a plausible antimutator factor limiting the activity and processivity of editing deaminases in the model yeast system. Because of the similar antagonism of yeast RPA and human RPA with A3G in vitro, we propose that RPA plays a role in the protection of the human genome cell from A3G and other deaminases when they are inadvertently diverged from their natural targets. We propose a model where RPA serves as one of the guardians of the genome that protects ssDNA from the destructive processive activity of deaminases by non-specific steric hindrance.

  17. Replication protein A (RPA hampers the processive action of APOBEC3G cytosine deaminase on single-stranded DNA.

    Directory of Open Access Journals (Sweden)

    Artem G Lada

    Full Text Available Editing deaminases have a pivotal role in cellular physiology. A notable member of this superfamily, APOBEC3G (A3G, restricts retroviruses, and Activation Induced Deaminase (AID generates antibody diversity by localized deamination of cytosines in DNA. Unconstrained deaminase activity can cause genome-wide mutagenesis and cancer. The mechanisms that protect the genomic DNA from the undesired action of deaminases are unknown. Using the in vitro deamination assays and expression of A3G in yeast, we show that replication protein A (RPA, the eukaryotic single-stranded DNA (ssDNA binding protein, severely inhibits the deamination activity and processivity of A3G.We found that mutations induced by A3G in the yeast genomic reporter are changes of a single nucleotide. This is unexpected because of the known property of A3G to catalyze multiple deaminations upon one substrate encounter event in vitro. The addition of recombinant RPA to the oligonucleotide deamination assay severely inhibited A3G activity. Additionally, we reveal the inverse correlation between RPA concentration and the number of deaminations induced by A3G in vitro on long ssDNA regions. This resembles the "hit and run" single base substitution events observed in yeast.Our data suggest that RPA is a plausible antimutator factor limiting the activity and processivity of editing deaminases in the model yeast system. Because of the similar antagonism of yeast RPA and human RPA with A3G in vitro, we propose that RPA plays a role in the protection of the human genome cell from A3G and other deaminases when they are inadvertently diverged from their natural targets. We propose a model where RPA serves as one of the guardians of the genome that protects ssDNA from the destructive processive activity of deaminases by non-specific steric hindrance.

  18. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.


    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  19. Viral recombination blurs taxonomic lines: examination of single-stranded DNA viruses in a wastewater treatment plant

    Directory of Open Access Journals (Sweden)

    Victoria M. Pearson


    Full Text Available Understanding the structure and dynamics of microbial communities, especially those of economic concern, is of paramount importance to maintaining healthy and efficient microbial communities at agricultural sites and large industrial cultures, including bioprocessors. Wastewater treatment plants are large bioprocessors which receive water from multiple sources, becoming reservoirs for the collection of many viral families that infect a broad range of hosts. To examine this complex collection of viruses, full-length genomes of circular ssDNA viruses were isolated from a wastewater treatment facility using a combination of sucrose-gradient size selection and rolling-circle amplification and sequenced on an Illumina MiSeq. Single-stranded DNA viruses are among the least understood groups of microbial pathogens due to genomic biases and culturing difficulties, particularly compared to the larger, more often studied dsDNA viruses. However, the group contains several notable well-studied examples, including agricultural pathogens which infect both livestock and crops (Circoviridae and Geminiviridae, and model organisms for genetics and evolution studies (Microviridae. Examination of the collected viral DNA provided evidence for 83 unique genotypic groupings, which were genetically dissimilar to known viral types and exhibited broad diversity within the community. Furthermore, although these genomes express similarities to known viral families, such as Circoviridae, Geminiviridae, and Microviridae, many are so divergent that they may represent new taxonomic groups. This study demonstrated the efficacy of the protocol for separating bacteria and large viruses from the sought after ssDNA viruses and the ability to use this protocol to obtain an in-depth analysis of the diversity within this group.

  20. Radiation-induced base substitution mutagenesis in single-stranded DNA phage M13

    International Nuclear Information System (INIS)

    Brandenburger, A.; Godson, G.N.; Glickman, B.W.; Sluis, C.A. van


    To elucidate the relative contributions of targeted and untargeted mutations to γ and UV radiation mutagenesis, the DNA sequences of 174 M13 revertant phages isolated from stocks of irradiated or unirradiated amber mutants grown in irradiated (SOS-induced) or unirradiated (non-induced) host bacteria, have been determined. Differences in the spectra of base change mutations induced in the various conditions were apparent, but no obvious specificity of mutagenesis was detected. In particular, under the present conditions, pyrimidine dimers did not seem to be the principal sites of UV-induced base substitution mutagenesis, suggesting that such mutagenesis occurs at the sites of lesions other than pyrimidine dimers, or is untargeted. (U.K.)

  1. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines. (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao


    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  2. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.


    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  3. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.


    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  4. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy


    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried


    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  5. Induction of single-strand DNA breaks in human cells by H2O2 formed in near-uv (black light)-irradiated medium

    International Nuclear Information System (INIS)

    Wang, R.J.; Ananthaswamy, H.N.; Nixon, B.T.; Hartman, P.S.; Eisenstark, A.


    When Dulbecco's modified Eagle's medium (depleted of phenol red) was irradiated for up to 3 h by 4 to 5 W/m 2 black light, hydrogen peroxide (H 2 O 2 ) was produced. Generation of H 2 O 2 resulted from riboflavin-sensitized photooxidation of tryptophan and tyrosine. Reagent H 2 O 2 , or hydrogen peroxide generated in black light-exposed aqueous solutions containing riboflavin and tryptophan, induced 2 x 10 4 single-strand breaks per 10 16 daltons of DNA in intact, physiologically viable human D98/AH 2 cells. Concomitant with the single-strand breaks in the cells was loss of cellular reproductive viability. Two classes of photoproducts were identified: H 2 O 2 and non-H 2 O 2 . The H 2 O 2 component of the photoproducts was responsible for all the single-strand break induction but for only partial loss of reproductive viability. The non-H 2 O 2 photoproducts, accountable for the remainder of cell lethality, caused no single-strand breaks

  6. Yield of single-strand breaks in the DNA of E.coli 10 msec after irradiation

    International Nuclear Information System (INIS)

    Fox, R.A.; Fielden, E.M.; Sapora, O.


    The rapid mixing of 0.3M alkali with a suspension of E.coli B/r 6 +- 3 and 144 +- 3 msec after irradiation with electrons (4.3 MeV, 0 to 50 krad) has been used to make a comparison of the yields of single strand breaks in the presence and absence of oxygen. No significant difference was observed between the numbers of single strand breaks appearing at 6 and 144 msec after irradiation. Assuming that mixing with alkali inactivates the cellular repair enzymes within several milliseconds, these results indicate that enzymic repair does not operate within this time scale. It seems probable that radiation chemical processes are responsible for the initial oxygen effect on single strand breaks. (U.K.)

  7. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.


    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  8. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.


    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  9. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr


    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single-stranded DNA-binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  10. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak


    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  11. SALP, a new single-stranded DNA library preparation method especially useful for the high-throughput characterization of chromatin openness states. (United States)

    Wu, Jian; Dai, Wei; Wu, Lin; Wang, Jinke


    Next-generation sequencing (NGS) is fundamental to the current biological and biomedical research. Construction of sequencing library is a key step of NGS. Therefore, various library construction methods have been explored. However, the current methods are still limited by some shortcomings. This study developed a new NGS library construction method, Single strand Adaptor Library Preparation (SALP), by using a novel single strand adaptor (SSA). SSA is a double-stranded oligonucleotide with a 3' overhang of 3 random nucleotides, which can be efficiently ligated to the 3' end of single strand DNA by T4 DNA ligase. SALP can be started with any denatured DNA fragments such as those sheared by Tn5 tagmentation, enzyme digestion and sonication. When started with Tn5-tagmented chromatin, SALP can overcome a key limitation of ATAC-seq and become a high-throughput NGS library construction method, SALP-seq, which can be used to comparatively characterize the chromatin openness state of multiple cells unbiasly. In this way, this study successfully characterized the comparative chromatin openness states of four different cell lines, including GM12878, HepG2, HeLa and 293T, with SALP-seq. Similarly, this study also successfully characterized the chromatin openness states of HepG2 cells with SALP-seq by using 10 5 to 500 cells. This study developed a new NGS library construction method, SALP, by using a novel kind of single strand adaptor (SSA), which should has wide applications in the future due to its unique performance.

  12. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family. (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław


    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  13. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H


    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  14. Construction of a microfluidic chip, using dried-down reagents, for LATE-PCR amplification and detection of single-stranded DNA. (United States)

    Jia, Yanwei; Mak, Pui-In; Massey, Conner; Martins, Rui P; Wangh, Lawrence J


    LATE-PCR is an advanced form of non-symmetric PCR that efficiently generates single-stranded DNA which can readily be characterized at the end of amplification by hybridization to low-temperature fluorescent probes. We demonstrate here for the first time that monoplex and duplex LATE-PCR amplification and probe target hybridization can be carried out in double layered PDMS microfluidics chips containing dried reagents. Addition of a set of reagents during dry down overcomes the common problem of single-stranded oligonucleotide binding to PDMS. These proof-of-principle results open the way to construction of inexpensive point-of-care devices that take full advantage of the analytical power of assays built using LATE-PCR and low-temperature probes.

  15. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.


    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  16. Direct imaging of hexaamine-ruthenium(III) in domain boundaries in monolayers of single-stranded DNA

    DEFF Research Database (Denmark)

    Grubb, Mikala; Wackerbarth, Hainer; Wengel, J.


    We describe adsorption and identification of the binding sites of [Ru(NH3)(6)](3+) (RuHex) molecules in a closely packed monolayer of a 13-base ss-DNA on Au(111) electrodes by electrochemical in situ scanning tunneling microscopy (STM), cyclic voltammetry and interfacial capacitance data. In situ...

  17. [Expression and purification of a novel thermophilic bacterial single-stranded DNA-binding protein and enhancement the synthesis of DNA and cDNA]. (United States)

    Jia, Xiao-Wei; Zhang, Guo-Hui; Shi, Hai-Yan


    Express a novel species of single-stranded DNA-binding protein (SSB) derived from Thermococcus kodakarensis KOD1, abbreviated kod-ssb. And evaluate the effect of kod-ssb on PCR-based DNA amplification and reverse transcription. We express kod-ssb with the Transrtta (DE3), and kod-ssb was purified by affinity chromatography on a Ni2+ Sepharose column, detected by SDS-PAGE. To evaluate the effect of kod-ssb on PCR-based DNA amplification, the human beta globin gene was used as template to amplify a 5-kb, 9-kb and 13-kb. And to detect the effect of kod-ssb on reverse transcription, we used RNA from flu cell culture supernatant extraction as templates to implement qRT-PCR reaction. The plasmid pET11a-kod was transformed into Transetta (DE3) and the recombinant strain Transetta (pET11 a-kod) was obtained. The kod-ssb was highly expressed when the recombinant strain Transetta(pET11a-kod) was induced by IPTG. The specific protein was detected by SDS-PAGE. To confirm that kod-ssb can enhance target DNA synthesis and reduce PCR by-products, 5-, 9-, and 13-kb human beta globin gene fragments were used as templates for PCR. When PCR reactions did not include SSB proteins, the specific PCR product was contaminated with non-specific products. When kod -ssb was added, kod-ssb significantly enhanced amplification of the 5-, 9-and 13-kb target product and minimised the non-specific PCR products. To confirm that kod-ssb can enhance target cDNA synthesis, RNA from flu cell culture supernatant extraction was used as templates for qRT-PCR reaction. The results was that when kod-ssb was added, kod-ssb significantly enhanced the synthesis of cDNA, average Ct value is 19.42, and the average Ct value without kod-ssb is 22.15. kod-ssb may in future be used to enhance DNA and cDNA amplification.

  18. Histone H3.3 promotes IgV gene diversification by?enhancing formation of AID?accessible single?stranded DNA


    Romanello, Marina; Schiavone, Davide; Frey, Alexander; Sale, Julian E


    Abstract Immunoglobulin diversification is driven by activation?induced deaminase (AID), which converts cytidine to uracil within the Ig variable (IgV) regions. Central to the recruitment of AID to the IgV genes are factors that regulate the generation of single?stranded DNA (ssDNA), the enzymatic substrate of AID. Here, we report that chicken DT40 cells lacking variant histone H3.3 exhibit reduced IgV sequence diversification. We show that this results from impairment of the ability of AID t...

  19. Reduction of spontaneous somatic mutation frequency by a low-dose X irradiation of Drosophila larvae and possible involvement of DNA single-strand damage repair. (United States)

    Koana, Takao; Takahashi, Takashi; Tsujimura, Hidenobu


    The third instar larvae of Drosophila were irradiated with X rays, and the somatic mutation frequency in their wings was measured after their eclosion. In the flies with normal DNA repair and apoptosis functions, 0.2 Gy irradiation at 0.05 Gy/min reduced the frequency of the so-called small spot (mutant cell clone with reduced reproductive activity) compared with that in the sham-irradiated flies. When apoptosis was suppressed using the baculovirus p35 gene, the small spot frequency increased four times in the sham-irradiated control group, but the reduction by the 0.2-Gy irradiation was still evident. In a non-homologous end joining-deficient mutant, the small spot frequency was also reduced by 0.2 Gy radiation. In a mutant deficient in single-strand break repair, no reduction in the small spot frequency by 0.2 Gy radiation was observed, and the small spot frequency increased with the radiation dose. Large spot (mutant cell clone with normal reproductive activity) frequency was not affected by suppression of apoptosis and increased monotonically with radiation dose in wild-type larvae and in mutants for single- or double-strand break repair. It is hypothesized that some of the small spots resulted from single-strand damage and, in wild-type larvae, 0.2 Gy radiation activated the normal single-strand break repair gene, which reduced the background somatic mutation frequency.

  20. Direct Binding to Replication Protein A (RPA)-coated Single-stranded DNA Allows Recruitment of the ATR Activator TopBP1 to Sites of DNA Damage* (United States)

    Acevedo, Julyana; Yan, Shan; Michael, W. Matthew


    A critical event for the ability of cells to tolerate DNA damage and replication stress is activation of the ATR kinase. ATR activation is dependent on the BRCT (BRCA1 C terminus) repeat-containing protein TopBP1. Previous work has shown that recruitment of TopBP1 to sites of DNA damage and stalled replication forks is necessary for downstream events in ATR activation; however, the mechanism for this recruitment was not known. Here, we use protein binding assays and functional studies in Xenopus egg extracts to show that TopBP1 makes a direct interaction, via its BRCT2 domain, with RPA-coated single-stranded DNA. We identify a point mutant that abrogates this interaction and show that this mutant fails to accumulate at sites of DNA damage and that the mutant cannot activate ATR. These data thus supply a mechanism for how the critical ATR activator, TopBP1, senses DNA damage and stalled replication forks to initiate assembly of checkpoint signaling complexes. PMID:27129245

  1. Histone H3.3 promotes IgV gene diversification by enhancing formation of AID-accessible single-stranded DNA. (United States)

    Romanello, Marina; Schiavone, Davide; Frey, Alexander; Sale, Julian E


    Immunoglobulin diversification is driven by activation-induced deaminase (AID), which converts cytidine to uracil within the Ig variable (IgV) regions. Central to the recruitment of AID to the IgV genes are factors that regulate the generation of single-stranded DNA (ssDNA), the enzymatic substrate of AID Here, we report that chicken DT40 cells lacking variant histone H3.3 exhibit reduced IgV sequence diversification. We show that this results from impairment of the ability of AID to access the IgV genes due to reduced formation of ssDNA during IgV transcription. Loss of H3.3 also diminishes IgV R-loop formation. However, reducing IgV R-loops by RNase HI overexpression in wild-type cells does not affect IgV diversification, showing that these structures are not necessary intermediates for AID access. Importantly, the reduction in the formation of AID-accessible ssDNA in cells lacking H3.3 is independent of any effect on the level of transcription or the kinetics of RNAPII elongation, suggesting the presence of H3.3 in the nucleosomes of the IgV genes increases the chances of the IgV DNA becoming single-stranded, thereby creating an effective AID substrate. © 2016 MRC Laboratory of Molecular Biology. Published under the terms of the CC BY 4.0 license.

  2. On-site detection of Phytophthora spp.—single-stranded target DNA as the limiting factor to improve on-chip hybridization

    International Nuclear Information System (INIS)

    Schwenkbier, Lydia; Pollok, Sibyll; Popp, Jürgen; Weber, Karina; König, Stephan; Wagner, Stefan; Werres, Sabine; Weber, Jörg; Hentschel, Martin


    We report on a lab-on-a-chip approach for on-site detection of Phytophthora species that allows visual signal readout. The results demonstrate the significance of single-stranded DNA (ssDNA) generation in terms of improving the intensity of the hybridization signal and to improve the reliability of the method. Conventional PCR with subsequent heat denaturation, sodium hydroxide-based denaturation, lambda exonuclease digestion and two asymmetric PCR methods were investigated for the species P. fragariae, P. kernoviae, and P. ramorum. The positioning of the capture probe within the amplified yeast GTP-binding protein (YPT1) target DNA was also of interest because it significantly influences the intensity of the signal. Statistical tests were used to validate the impact of the ssDNA generation methods and the capture-target probe position. The single-stranded target DNA generated by Linear-After-The-Exponential PCR (LATE-PCR) was found to produce signal intensities comparable to post-PCR exonuclease treatment. The LATE-PCR is the best method for the on-site detection of Phytophthora because the enzymatic digestion after PCR is more laborious and time-consuming. (author)

  3. Calibration of denaturing agarose gels for molecular weight estimation of DNA: size determination of the single-stranded genomes of parvoviruses

    Energy Technology Data Exchange (ETDEWEB)

    Snyder, C.E. (Oak Ridge National Lab., TN); Schmoyer, R.L.; Bates, R.C.; Mitra, S.


    Vertical slab gel electrophoresis of DNA with CH/sub 3/HgOH-containing agarose produces sharp bands whose mobilities are suitable for size estimation of single-stranded DNA containing 600 to 20,000 bases. The relationship of electrophoretic mobility to size of DNA over this range is a smooth, S-shaped function, and an empirical model was developed to express the relationship. The model involves terms in squared and reciprocal mobilities, and produced excellent fit of known standard markers to measured mobilities. It was used to estimate the sizes of six parvovirus DNAs: Kilham rat virus (KRV), H-1, LuIII, and minute virus of mice (MVM) DNAs had molecular weights of 1.66 to 1.70 x 10/sup 6/, while the molecular weight of bovine parvovirus (BPV) DNA was 1.84 x 10/sup 6/ and that of adenoassociated virus (AAV) DNA was 1.52 x 10/sup 6/.

  4. Cytogenetic Markers, DNA Single-Strand Breaks, Urinary Metabolites, and DNA Repair Rates in Styrene-Exposed Lamination Workers

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Tuimala, J.; Štětina, R.; Kumar, R.; Manini, P.; Naccarati, Alessio; Maestri, L.; Vodičková, L.; Kuricová, Miroslava; Jarventaus, H.; Majvalková, Z.; Hirvonen, A.; Imbriani, M.; Mutti, A.; Norppa, H.; Hemminki, K.


    Roč. 112, č. 8 (2004), s. 867-871 ISSN 0091-6765 R&D Projects: GA ČR GA310/03/0437; GA ČR GA310/01/0802 Institutional research plan: CEZ:AV0Z5039906 Keywords : DNA repair rates * genotoxicity Subject RIV: FM - Hygiene Impact factor: 3.929, year: 2004

  5. Single-strand conformation polymorphism (SSCP)-based mutation scanning approaches to fingerprint sequence variation in ribosomal DNA of ascaridoid nematodes. (United States)

    Zhu, X Q; Gasser, R B


    In this study, we assessed single-strand conformation polymorphism (SSCP)-based approaches for their capacity to fingerprint sequence variation in ribosomal DNA (rDNA) of ascaridoid nematodes of veterinary and/or human health significance. The second internal transcribed spacer region (ITS-2) of rDNA was utilised as the target region because it is known to provide species-specific markers for this group of parasites. ITS-2 was amplified by PCR from genomic DNA derived from individual parasites and subjected to analysis. Direct SSCP analysis of amplicons from seven taxa (Toxocara vitulorum, Toxocara cati, Toxocara canis, Toxascaris leonina, Baylisascaris procyonis, Ascaris suum and Parascaris equorum) showed that the single-strand (ss) ITS-2 patterns produced allowed their unequivocal identification to species. While no variation in SSCP patterns was detected in the ITS-2 within four species for which multiple samples were available, the method allowed the direct display of four distinct sequence types of ITS-2 among individual worms of T. cati. Comparison of SSCP/sequencing with the methods of dideoxy fingerprinting (ddF) and restriction endonuclease fingerprinting (REF) revealed that also ddF allowed the definition of the four sequence types, whereas REF displayed three of four. The findings indicate the usefulness of the SSCP-based approaches for the identification of ascaridoid nematodes to species, the direct display of sequence variation in rDNA and the detection of population variation. The ability to fingerprint microheterogeneity in ITS-2 rDNA using such approaches also has implications for studying fundamental aspects relating to mutational change in rDNA.

  6. Effect of vitamin E on cytotoxicity, DNA single strand breaks, chromosomal aberrations, and mutation in Chinese hamster V-79 cells exposed to ultraviolet-B light

    International Nuclear Information System (INIS)

    Sugiyama, M.; Tsuzuki, K.; Matsumoto, K.; Ogura, R.


    The effect of pretreatment with vitamin E on cytotoxicity, DNA single strand breaks, and chromosomal aberrations as well as on mutation induced by ultraviolet-B light (UV-B) was investigated in Chinese hamster V-79 cells. Cellular pretreatment with non-toxic levels of 25 μM α-tocopherol succinate (vitamin E) for 24h prior to exposure resulted in a 10-fold increase in cellular levels of α-tocopherol. Using a colony-forming assay, this pretreatment decreased the cytotoxicity of UV-B light. However, alkaline elution assays demonstrated that pretreatment with vitamin E did not affect the number of DNA single strand breaks caused by UV-B light. UV-B exposure produced a dose-dependent induction of chromosomal aberrations and mutations at the HGPRT locus, and neither of these actions of UV-B was influenced by pretreatment with the vitamin. These results suggest that vitamin E protects cells from UV-B-induced cytotoxicity, possibly through its ability to scavenge free radicals. The genotoxicity induced by UV-B light may not correlate directly with the cytotoxic action of this wavelength region in sunlight. (author)

  7. Localization of specific sequences and DNA single-strand breaks in individual UV-A-irradiated human lymphocytes by COMET FISH (United States)

    Bock, Claudia; Rapp, Alexander; Dittmar, Heike; Monajembashi, Shamci; Greulich, Karl-Otto


    The COMET assay, a single cell electrophoresis technique which allows to separate electrophoretically fractionated DNA according to size has been combined with fluorescence in situ hybridization (FISH) which allows to localize specific genes or gene regions. This combination (COMET FISH) allows the detection of DNA single strand breaks in specific regions of the genome of human lymphocytes at the single cell level. Various types of DNA probes, e.g. centromere-, (alpha) - satellite-, telomere-, whole chromosome-, single copy- and region specific DNA probes have been used to investigate whether the UV-A induced DNA single strand breaks are distributed randomly all over the human genome or induced at specific sites ('hot spots'). In the investigated human peripheral blood lymphocytes all but one centromere reveal low sensitivity for UV-A irradiation (500 kJ/m2), while telomeres are randomly distributed over COMET heads and tails. The human chromosome 1 is fractionated by irradiation, but remains in the COMET head, indicating an only moderate degree of fractionation. Among three tested single copy probes, c- myc, p53 and p58, the p53 gene located on chromosome 17p13.1 and the p58 gene (1p36) appear to be located in UV-A stable regions of the human genome in 95% of 65 investigated lymphocytes. In contrast, the c-myc proto-oncogene (8q24) is found in the COMET tail in 90% of the 27 investigated lymphocytes and thus appears to be more sensitive to UV-A irradiation.

  8. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha; Hamdan, Samir; Richardson, Charles C.


    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha


    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system. (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus


    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  11. Chemical shift changes provide evidence for overlapping single-stranded DNA and XPA binding sites on the 70 kDa subunit of human replication protein A

    Energy Technology Data Exchange (ETDEWEB)

    Daughdrill, Gary W.; Buchko, Garry W.; Botuyan, Maria V.; Arrowsmith, Cheryl H.; Wold, Marc S.; Kennedy, Michael A.; Lowry, David F.


    Replication protein A (RPA) is a heterotrimeric single-stranded DNA (ssDNA) binding protein that can form a complex with the xeroderma pigmentosum group A protein (XPA). This complex can preferentially recognize UV damaged DNA over undamaged DNA and has been implicated in the stabilization of open complex formation during nucleotide excision repair. In this report, NMR spectroscopy was used to investigate the interaction between a fragment of the 70 kDa subunit of human RPA, residues 1-326 (hRPA701-326), and a fragment of the human XPA protein, residues 98-219 (XPA-MBD). Intensity changes were observed for amide resonances in the 1H-15N correlation spectrum of uniformly 15N-labeled hRPA701-326 after the addition of unlabeled XPA-MBD. The intensity changes observed were restricted to an ssDNA binding domain that is between residues 183 and 296 of the hRPA701-326 fragment. The hRPA701-326 residues with the largest resonance intensity reductions were mapped onto the structure of the ssDNA binding domain to identify the binding surface with XPA-MBD. The XPA-MBD binding surface showed significant overlap with an ssDNA binding surface that was previously identified using NMR spectroscopy and X-ray crystallography.

  12. Effects of DNA double-strand and single-strand breaks on intrachromosomal recombination events in cell-cycle-arrested yeast cells

    International Nuclear Information System (INIS)

    Galli, A.; Schiestl, R.H.


    Intrachromosomal recombination between repeated elements can result in deletion (DEL recombination) events. We investigated the inducibility of such intrachromosomal recombination events at different stages of the cell cycle and the nature of the primary DNA lesions capable of initiating these events. Two genetic systems were constructed in Saccharomyces cerevisiae that select for DEL recombination events between duplicated alleles of CDC28 and TUB2. We determined effects of double-strand breaks (DSBs) and single-strand breaks (SSBs) between the duplicated alleles on DEL recombination when induced in dividing cells or cells arrested in G1 or G2. Site-specific DSBs and SSBs were produced by overexpression of the I-Sce I endonuclease and the gene II protein (gIIp), respectively. I-Sce I-induced DSBs caused an increase in DEL recombination frequencies in both dividing and cell-cycle-arrested cells, indicating that G1- and G2-arrested cells are capable of completing DSB repair. In contrast, gIIp-induced SSBs caused an increase in DEL recombination frequency only in dividing cells. To further examine these phenomena we used both γ-irradiation, inducing DSBs as its most relevant lesion, and UV, inducing other forms of DNA damage. UV irradiation did not increase DEL recombination frequencies in G1 or G2, whereas γ-rays increased DEL recombination frequencies in both phases. Both forms of radiation, however, induced DEL recombination in dividing cells. The results suggest that DSBsbut not SSBs induce DEL recombination, probably via the single-strand annealing pathway. Further, DSBs in dividing cells may result from the replication of a UV or SSB-damaged template. Alternatively, UV induced events may occur by replication slippage after DNA polymerase pausing in front of the damage. (author)

  13. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes. (United States)

    Pietilä, Maija K; Roine, Elina; Sencilo, Ana; Bamford, Dennis H; Oksanen, Hanna M


    Viruses infecting archaea show a variety of virion morphotypes, and they are currently classified into more than ten viral families or corresponding groups. A pleomorphic virus morphotype is very common among haloarchaeal viruses, and to date, several such viruses have been isolated. Here, we propose the classification of eight such viruses and formation of a new family, Pleolipoviridae (from the Greek pleo for more or many and lipos for lipid), containing three genera, Alpha-, Beta-, and Gammapleolipovirus. The proposal is currently under review by the International Committee on Taxonomy of Viruses (ICTV). The members of the proposed family Pleolipoviridae infect halophilic archaea and are nonlytic. They share structural and genomic features and differ from any other classified virus. The virion of pleolipoviruses is composed of a pleomorphic membrane vesicle enclosing the genome. All pleolipoviruses have two major structural protein species, internal membrane and spike proteins. Although the genomes of the pleolipoviruses are single- or double-stranded, linear or circular DNA molecules, they share the same genome organization and gene synteny and show significant similarity at the amino acid level. The canonical features common to all members of the proposed family Pleolipoviridae show that they are closely related and thus form a new viral family.

  14. Replication stress-induced chromosome breakage is correlated with replication fork progression and is preceded by single-stranded DNA formation. (United States)

    Feng, Wenyi; Di Rienzi, Sara C; Raghuraman, M K; Brewer, Bonita J


    Chromosome breakage as a result of replication stress has been hypothesized to be the direct consequence of defective replication fork progression, or "collapsed" replication forks. However, direct and genome-wide evidence that collapsed replication forks give rise to chromosome breakage is still lacking. Previously we showed that a yeast replication checkpoint mutant mec1-1, after transient exposure to replication impediment imposed by hydroxyurea (HU), failed to complete DNA replication, accumulated single-stranded DNA (ssDNA) at the replication forks, and fragmented its chromosomes. In this study, by following replication fork progression genome-wide via ssDNA detection and by direct mapping of chromosome breakage after HU exposure, we have tested the hypothesis that the chromosome breakage in mec1 cells occurs at collapsed replication forks. We demonstrate that sites of chromosome breakage indeed correlate with replication fork locations. Moreover, ssDNA can be detected prior to chromosome breakage, suggesting that ssDNA accumulation is the common precursor to double strand breaks at collapsed replication forks.

  15. The influence of inhibitors on dimer removal and repair of single-strand breaks in normal and bromodeoxyuridine substituted DNA of HeLa cells

    International Nuclear Information System (INIS)

    Cornelis, J.J.


    The elimination of cyclobutane pyrimidine dimers from the nuclear DNA of ultraviolet irradiated HeLa cells has been examined by means of chromatography and immunoautoradiography. The extent and duration of the process was similar when dimers were assayed by both methods, proving that the antisera recognized pyrimidine dimers. The rate of dimer excision did not differ through the cell cycle with the exception of mitosis during which no dimers were removed. Dimer excision is a relatively fast process which is terminated within a few hours, but it leaves many dimers in the DNA. Excision is depressed by inhibitors of semiconservative DNA synthesis that affect the DNA precursor pool or DNA polymerases. Cells whose DNA is partly substituted with bromodeoxyuridine instead of thymidine, repair single-strand breaks and remove dimers at the same rate but to different extents. On the other hand, inhibitors limit repair of breaks and removal of dimers to the same degree suggesting that the repair of the two types of lesion is coordinated. (Auth.)

  16. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB)


    van Loon, Barbara; Samson, Leona D.


    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known...

  17. C-terminal phenylalanine of bacteriophage T7 single-stranded DNA-binding protein is essential for strand displacement synthesis by T7 DNA polymerase at a nick in DNA. (United States)

    Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C


    Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5'-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations.

  18. C-terminal Phenylalanine of Bacteriophage T7 Single-stranded DNA-binding Protein Is Essential for Strand Displacement Synthesis by T7 DNA Polymerase at a Nick in DNA* (United States)

    Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C.


    Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5′-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations. PMID:19726688

  19. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Boye, E.; Johansen, I.; Brustad, T.


    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 2 0 C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 2 0 C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  20. Potentiometric sensing of nuclease activities and oxidative damage of single-stranded DNA using a polycation-sensitive membrane electrode. (United States)

    Ding, Jiawang; Qin, Wei


    A simple, general and label-free potentiometric method to measure nuclease activities and oxidative DNA damage in a homogeneous solution using a polycation-sensitive membrane electrode is reported. Protamine, a linear polyionic species, is used as an indicator to report the cleavage of DNA by nucleases such as restriction and nonspecific nucleases, and the damage of DNA induced by hydroxyl radicals. Measurements can be done with a titration mode or a direct detection mode. For the potentiometric titration mode, the enzymatic cleavage dramatically affects the electrostatical interaction between DNA and protamine and thus shifts the response curve for the potentiometric titration of the DNA with protamine. Under the optimized conditions, the enzyme activities can be sensed potentiometrically with detection limits of 2.7×10(-4)U/µL for S1 nuclease, and of 3.9×10(-4)U/µL for DNase I. For the direct detection mode, a biocomplex between protamine and DNA is used as a substrate. The nuclease of interest cleaves the DNA from the protamine/DNA complex into smaller fragments, so that free protamine is generated and can be detected potentiometrically via the polycation-sensitive membrane electrode. Using a direct measurement, the nuclease activities could be rapidly detected with detection limits of 3.2×10(-4)U/µL for S1 nuclease, and of 4.5×10(-4)U/µL for DNase I. Moreover, the proposed potentiometric assays demonstrate the potential applications in the detection of hydroxyl radicals. It is anticipated that the present potentiometric strategy will provide a promising platform for high-throughput screening of nucleases, reactive oxygen species and the drugs with potential inhibition abilities. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS

    Energy Technology Data Exchange (ETDEWEB)

    Pachkowski, Brian F. [Department of Environmental Sciences and Engineering, University of North Carolina, Chapel Hill, NC (United States); Tano, Keizo [Research Reactor Institute, Kyoto University, Kumatori (Japan); Afonin, Valeriy [Department of Environmental Sciences and Engineering, University of North Carolina, Chapel Hill, NC (United States); Elder, Rhoderick H. [School of Environment and Life Sciences, University of Salford, Greater Manchester (United Kingdom); Takeda, Shunichi [Department of Radiation Genetics, Kyoto University Graduate School of Medicine, Sakyo-ku, Kyoto (Japan); Watanabe, Masami [Research Reactor Institute, Kyoto University, Kumatori (Japan); Swenberg, James A. [Department of Environmental Sciences and Engineering, University of North Carolina, Chapel Hill, NC (United States); Nakamura, Jun, E-mail: [Department of Environmental Sciences and Engineering, University of North Carolina, Chapel Hill, NC (United States)


    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase {beta}.

  2. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS. (United States)

    Pachkowski, Brian F; Tano, Keizo; Afonin, Valeriy; Elder, Rhoderick H; Takeda, Shunichi; Watanabe, Masami; Swenberg, James A; Nakamura, Jun


    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase beta.

  3. Single-strand breaks in the DNA of the uvrA and uvrB strains of Escherichia coli K-12 after ultraviolet irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Youngs, D A; Smith, K C [Stanford Univ., Calif. (USA). Dept. of Radiology


    DNA single-strand breaks were produced in uvrA and uvrB strains of E.coli K-12 after UV (254 nm) irradiation. These breaks appeared to be produced both directly by photochemical events, and by a temperature-dependent process. Cyclobutane-type pyrimidine dimers are probably not the photoproducts that lead to the temperature-dependent breaks, since photoreactivation had no detectable effect on the final yield of breaks. The DNA strand breaks appeared to be repairable by a process that requires DNA polymerase I and polynucleotide ligase, but not the recA, recB, recF, lexA101 or uvrD gene products. It is hypothesized that these temperature-dependent breaks occur either as a result of breakdown of a thermolabile photoproduct, or as the initial endonucleolytic event of a uvrA, uvrB-independent excision repair process that acts on a UV photoproduct other than the cyclobutane-type pyrimidine dimer.

  4. Crystal structure of APOBEC3A bound to single-stranded DNA reveals structural basis for cytidine deamination and specificity. (United States)

    Kouno, Takahide; Silvas, Tania V; Hilbert, Brendan J; Shandilya, Shivender M D; Bohn, Markus F; Kelch, Brian A; Royer, William E; Somasundaran, Mohan; Kurt Yilmaz, Nese; Matsuo, Hiroshi; Schiffer, Celia A


    Nucleic acid editing enzymes are essential components of the immune system that lethally mutate viral pathogens and somatically mutate immunoglobulins, and contribute to the diversification and lethality of cancers. Among these enzymes are the seven human APOBEC3 deoxycytidine deaminases, each with unique target sequence specificity and subcellular localization. While the enzymology and biological consequences have been extensively studied, the mechanism by which APOBEC3s recognize and edit DNA remains elusive. Here we present the crystal structure of a complex of a cytidine deaminase with ssDNA bound in the active site at 2.2 Å. This structure not only visualizes the active site poised for catalysis of APOBEC3A, but pinpoints the residues that confer specificity towards CC/TC motifs. The APOBEC3A-ssDNA complex defines the 5'-3' directionality and subtle conformational changes that clench the ssDNA within the binding groove, revealing the architecture and mechanism of ssDNA recognition that is likely conserved among all polynucleotide deaminases, thereby opening the door for the design of mechanistic-based therapeutics.

  5. Quantifying DNA melting transitions using single-molecule force spectroscopy

    International Nuclear Information System (INIS)

    Calderon, Christopher P; Chen, W-H; Harris, Nolan C; Kiang, C-H; Lin, K-J


    We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

  6. Quantifying DNA melting transitions using single-molecule force spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Calderon, Christopher P [Department of Computational and Applied Mathematics, Rice University, Houston, TX (United States); Chen, W-H; Harris, Nolan C; Kiang, C-H [Department of Physics and Astronomy, Rice University, Houston, TX (United States); Lin, K-J [Department of Chemistry, National Chung Hsing University, Taichung, Taiwan (China)], E-mail:


    We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

  7. Gauging the Nanotoxicity of h2D-C2N toward Single-Stranded DNA: An in Silico Molecular Simulation Approach. (United States)

    Mukhopadhyay, Titas Kumar; Bhattacharyya, Kalishankar; Datta, Ayan


    Recent toxicological assessments of graphene, graphene oxides, and some other two-dimensional (2D) materials have shown them to be substantially toxic at the nanoscale, where they inhibit and eventually disrupt biological processes. These shortfalls of graphene and analogs have resulted in a quest for novel biocompatible 2D materials with minimum cytotoxicity. In this article, we demonstrate C 2 N (h2D-C 2 N), a newly synthesized 2D porous graphene analog, to be non-nanotoxic toward genetic materials from an "in-silico" point of view through sequence-dependent binding of different polynucleotide single-stranded DNA (ssDNA) onto it. The calculated binding energy of nucleobases and the free energy of binding of polynucleotides follow the common trait, cytosine > guanine > adenine > thymine, and are well within the limits of physisorption. Ab-initio simulations completely exclude the possibility of any chemical reaction, demonstrating purely noncovalent binding of nucleobases with C 2 N through a crucial interplay between hydrogen bonding and π-stacking interactions with the surface. Further, we show that the extent of distortion inflicted upon ssDNA by C 2 N is negligible. Analysis of the density of states of the nucleobase-C 2 N hybrids confirms minimum electronic perturbation of the bases after adsorption. Most importantly, we demonstrate the potency of C 2 N in nucleic acid transportation via reversible binding of ssDNA. The plausible use of C 2 N as a template for DNA repair is illustrated through an example of C 2 N-assisted complementary ssDNA winding.

  8. Restriction map of the single-stranded DNA genome of Kilham rat virus strain 171, a nondefective parvovirus

    International Nuclear Information System (INIS)

    Banerjee, P.T.; Rathrock, R.; Mitra, S.


    A physical map of Kilham rat virus strain 171 DNA was constructed by analyzing the sizes and locations of restriction endonuclease-generated fragments of the replicative-form viral DNA synthesized in vitro. BglI, KpnI, BamHI, SmaI, XhoI, and XorII did not appear to have any cleavage sites, whereas 11 other enzymes cleaved the genome at one to eight sites, and AluI generated more than 12 distinct fragments. The 30 restriction sites that were mapped were distributed randomly in the viral genome. A comparison of the restriction fragments of in vivo- and in vitro-replicated replicative-form DNAs showed that these DNAs were identical except in the size or configuration of the terminal fragments

  9. In Vitro Selection of Single-Stranded DNA Molecular Recognition Elements against S. aureus Alpha Toxin and Sensitive Detection in Human Serum

    Directory of Open Access Journals (Sweden)

    Ka L. Hong


    Full Text Available Alpha toxin is one of the major virulence factors secreted by Staphylococcus aureus, a bacterium that is responsible for a wide variety of infections in both community and hospital settings. Due to the prevalence of S. aureus related infections and the emergence of methicillin-resistant S. aureus, rapid and accurate diagnosis of S. aureus infections is crucial in benefiting patient health outcomes. In this study, a rigorous Systematic Evolution of Ligands by Exponential Enrichment (SELEX variant previously developed by our laboratory was utilized to select a single-stranded DNA molecular recognition element (MRE targeting alpha toxin with high affinity and specificity. At the end of the 12-round selection, the selected MRE had an equilibrium dissociation constant (Kd of 93.7 ± 7.0 nM. Additionally, a modified sandwich enzyme-linked immunosorbent assay (ELISA was developed by using the selected ssDNA MRE as the toxin-capturing element and a sensitive detection of 200 nM alpha toxin in undiluted human serum samples was achieved.

  10. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA. (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S


    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  11. Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody: a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody. (United States)

    Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua


    Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.

  12. The UNG2 Arg88Cys variant abrogates RPA-mediated recruitment of UNG2 to single-stranded DNA. (United States)

    Torseth, Kathrin; Doseth, Berit; Hagen, Lars; Olaisen, Camilla; Liabakk, Nina-Beate; Græsmann, Heidi; Durandy, Anne; Otterlei, Marit; Krokan, Hans E; Kavli, Bodil; Slupphaug, Geir


    In human cell nuclei, UNG2 is the major uracil-DNA glycosylase initiating DNA base excision repair of uracil. In activated B cells it has an additional role in facilitating mutagenic processing of AID-induced uracil at Ig loci and UNG-deficient patients develop hyper-IgM syndrome characterized by impaired class-switch recombination and disturbed somatic hypermutation. How UNG2 is recruited to either error-free or mutagenic uracil processing remains obscure, but likely involves regulated interactions with other proteins. The UNG2 N-terminal domain contains binding motifs for both proliferating cell nuclear antigen (PCNA) and replication protein A (RPA), but the relative contribution of these interactions to genomic uracil processing is not understood. Interestingly, a heterozygous germline single-nucleotide variant leading to Arg88Cys (R88C) substitution in the RPA-interaction motif of UNG2 has been observed in humans, but with unknown functional relevance. Here we demonstrate that UNG2-R88C protein is expressed from the variant allele in a lymphoblastoid cell line derived from a heterozygous germ line carrier. Enzyme activity as well as localization in replication foci of UNG2-R88C was similar to that of WT. However, binding to RPA was essentially abolished by the R88C substitution, whereas binding to PCNA was unaffected. Moreover, we show that disruption of the PCNA-binding motif impaired recruitment of UNG2 to S-phase replication foci, demonstrating that PCNA is a major factor for recruitment of UNG2 to unperturbed replication forks. Conversely, in cells treated with hydroxyurea, RPA mediated recruitment of UNG2 to stalled replication forks independently of functional PCNA binding. Modulation of PCNA- versus RPA-binding may thus constitute a functional switch for UNG2 in cells subsequent to genotoxic stress and potentially also during the processing of uracil at the immunoglobulin locus in antigen-stimulated B cells. Copyright © 2012 Elsevier B.V. All rights

  13. A biomarker model of sublethal genotoxicity (DNA single-strand breaks and adducts) using the sentinel organism Aporrectodea longa in spiked soil

    International Nuclear Information System (INIS)

    Martin, Francis L.; Piearce, Trevor G.; Hewer, Alan; Phillips, David H.; Semple, Kirk T.


    There is a need to develop risk biomarkers during the remediation of contaminated land. We employed the earthworm, Aporrectodea longa (Ude), to determine whether genotoxicity measures could be applied to this organism's intestinal tissues. Earthworms were added, for 24 h or 7 days, to soil samples spiked with benzo[a]pyrene (B[a]P) and/or lindane. After exposure, intestinal tissues (crop/gizzard or intestine) were removed prior to the measurement in disaggregated cells of DNA single-strand breaks (SSBs) by the alkaline comet assay. Damage was quantified by comet tail length (CTL, μm). B[a]P 24-h exposure induced dose-related increases (P 32 P-postlabelling, showed a two-adduct-spot pattern. This preliminary investigation suggests that earthworm tissues may be incorporated into genotoxicity assays to facilitate hazard identification within terrestrial ecosystems. - Sublethal genotoxicity in the sentinel organism A. longa can be used to monitor the effects of contaminants in soil

  14. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy


    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  15. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray. (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino


    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  16. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino


    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  17. Extraction of ultrashort DNA molecules from herbarium specimens. (United States)

    Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A


    DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

  18. On the identification techniques for ionizing radiation structure breaks in the DNA molecule

    International Nuclear Information System (INIS)

    Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.


    In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)

  19. Genetic polymorphisms in DNA repair genes and possible links with DNA repair rates, chromosomal aberrations and single-strand breaks in DNA

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Kumar, R.; Štětina, R.; Sanyal, S.; Souček, P.; Haufroid, V.; Dušinská, M.; Kuricová, M.; Zámečníková, M.; Musak, L.; Buchancová, J.; Norppa, H.; Hirvonen, A.; Vodičková, L.; Naccarati, Alessio; Matoušů, Zora; Hemminki, K.


    Roč. 25, č. 5 (2004), s. 757-763 ISSN 0143-3334 R&D Projects: GA ČR GA310/03/0437; GA ČR GA310/01/0802 Institutional research plan: CEZ:AV0Z5039906 Keywords : DNA repair rates * genotoxicity Subject RIV: FM - Hygiene Impact factor: 5.375, year: 2004

  20. Single-molecule chemical reactions on DNA origami

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther; Tørring, Thomas; Rotaru, Alexandru


    as templates for building materials with new functional properties. Relatively large nanocomponents such as nanoparticles and biomolecules can also be integrated into DNA nanostructures and imaged. Here, we show that chemical reactions with single molecules can be performed and imaged at a local position...... on a DNA origami scaffold by atomic force microscopy. The high yields and chemoselectivities of successive cleavage and bond-forming reactions observed in these experiments demonstrate the feasibility of post-assembly chemical modification of DNA nanostructures and their potential use as locally......DNA nanotechnology and particularly DNA origami, in which long, single-stranded DNA molecules are folded into predetermined shapes, can be used to form complex self-assembled nanostructures. Although DNA itself has limited chemical, optical or electronic functionality, DNA nanostructures can serve...

  1. OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

    Directory of Open Access Journals (Sweden)

    Kevin M. Bradley


    Full Text Available Synthetic biologists wishing to self-assemble large DNA (L-DNA constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson–Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS, and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting" software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

  2. Contribution of single-strand breaks and alkali-labile bonds to the loss of infectivity of γ-irradiated phiX174 RF-DNA in E. coli cells mutant in various repair functions

    International Nuclear Information System (INIS)

    McKee, R.H.


    Twenty-one radiation sensitive mutants have been examined for their capacity to support gamma-irradiated phiX174 RF-DNA. The survival of phiX174 RF-DNA was reduced in essentially all of the sensitive mutants. The irradiated phiX174 RF-DNA was then separated into populations containing either single-strand breaks or alkali-labile bonds to examine the capacity of the mutants to repair each of the classes of lesions. It was found that all E. coli strains are unable to repair 22 percent of the single-strand breaks and all sensitive mutants are unable to repair an additional 10 percent of the breaks. All the repair functions examined are involved in single-strand break repair and none are more or less necessary than any of the others. PhiX174 RF-DNA is also inactivated by alkali-labile bonds. In the normal strains the inactivation efficiency is 0.16 lethal events per lesion with a threshold dose of 15 to 20 krads. The mutants are divided into two classes by their sensitivity to alkali-labile bonds. Both classes of mutants are also inactivated by alkali-labile bonds with efficiencies of about 0.17 and 0.29 lethal events per lesion, respectively. It is proposed that the differences seen in survival curves of phiX174 measured in the sensitive mutants is due to this difference. Although in normal cells the efficiency of inactivation of phiX174 by single-strand breaks is 50 percent greater than by alkali-labile bonds, alkali-labile bonds are produced at approximately twice the rate of single-strand breaks so alkali-labile bonds account for about 61 percent of the overall inactivation. In the mutants of least sensitivity alkali-labile bonds account for about 54 percent of the inactivating events and in the most sensitive about 67 percent

  3. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)


    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ► To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ► ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ► PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ► The findings

  4. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)


    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  5. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)


    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  6. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee


    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  7. Formation of DNA single-strand breaks by near-ultraviolet and gamma-rays in normal and Bloom's syndrome skin fibroblasts

    International Nuclear Information System (INIS)

    Hirschi, M.; Netrawali, M.S.; Remsen, J.F.; Cerutti, P.A.


    The formation of single-strand breaks by near-ultraviolet light at 313 nm and by aerobic gamma-rays was compared for skin fibroblast monolayer cultures from 4 normal donors (NF) and 8 patients with Bloom's syndrome (BS) by the alkaline elution method. In 6 of 8 BS strains, the number of breaks induced by near-ultraviolet light, 2.25 kJ/sq m, at 0 degrees was comparable to NF, while elevated breakage was observed in BS strains HG 369 and HG 916. Breakage frequencies were increased substantially in 6 of 8 BS strains relative to NF when the near-ultraviolet light exposure was at 37 degrees. BS strain GM 2520 represents an exception since normal breakage frequencies were induced both at 0 degrees and 37 degrees. Aerobic gamma-rays (75 R) induced comparable numbers of single-strand breaks in BS and NF strains at 0 degrees. The breakage frequencies were reduced an average of 17% in NF when the same dose was given at 30 degrees followed by 6 min incubation. Under the same conditions, the breakage frequencies were on the average reduced by 42% relative to 0 degrees in the BS strains, indicating that they possess normal or possibly slightly increased capacities for the rejoining of gamma-ray-induced breaks

  8. Random, double- and single-strand DNA breaks can be differentiated in the method of Comet assay by the shape of the comet image. (United States)

    Georgieva, Milena; Zagorchev, Plamen; Miloshev, George


    Comet assay is an invaluable tool in DNA research. It is widely used to detect DNA damage as an indicator of exposure to genotoxic stress. A canonical set of parameters and specialized software programs exist for Comet assay data quantification and analysis. None of them so far has proven its potential to employ a computer-based algorithm for assessment of the shape of the comet as an indicator of the exact mechanism by which the studied genotoxins cut in the molecule of DNA. Here, we present 14 unique measurements of the comet image based on the comet morphology. Their mathematical derivation and statistical analysis allowed precise description of the shape of the comet image which in turn discriminated the cause of genotoxic stress. This algorithm led to the development of the "CometShape" software which allowed easy discrimination among different genotoxins depending on the type of DNA damage they induce. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Reparation in unicellular green algae during chronic exposure to the action of mutagenic factors. II. Restoration of single-stranded DNA breaks following exposure of Chlamydomonas reinchardii to gamma-irradiation

    International Nuclear Information System (INIS)

    Sergeeva, S.A.; Ptitsina, S.N.; Shevchenko, V.A.


    The restoration of single-stranded breaks in the DNA in different strains of unicellular green algae (chlamydomonads) during chronic exposure to the action of mutagenic factors following γ-irradiation was investigated. It was shown that the restoration of DNA breaks was most effective in the case of strain M γ/sup mt + /, which is resistant to radiation. Strains, that were sensitive to UV irradiation showed a similar order of DNA break restoration as the wild-type strain. Strain UVS-1 showed a higher level of restoration than the wild-type strain. The data indicated that chlamydomonads have different pathways of reparation, which lead to the restoration of breaks induced by γ-irradiation and UV-rays

  10. Sub-ensemble monitoring of DNA strand displacement using multiparameter single-molecule FRET


    Baltierra Jasso, Laura; Morten, Michael; Magennis, Steven William


    Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constan...

  11. Procedure for normalization of cDNA libraries (United States)

    Bonaldo, Maria DeFatima; Soares, Marcelo Bento


    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

  12. Protein dynamics during presynaptic complex assembly on individual ssDNA molecules


    Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.


    Homologous recombination is a conserved pathway for repairing double?stranded breaks, which are processed to yield single?stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single?molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA?ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 b...

  13. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.


    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  14. Repair of γ-irradiation-induced DNA single-strand breaks in human bone marrow cells. Analysis of unfractionated and CD34+ cells using single-cell gel electrophoresis

    International Nuclear Information System (INIS)

    Lankinen, Maarit H.; Vilpo, Juhani A.


    Human bone marrow mononuclear cells (BMMNCs) were separated by density gradient centrifugation, and a subpopulation of progenitor cells was further isolated using anti-CD34-coated magnetic beads. The cells were irradiated with γ-rays (0.93-5.43 Gy) from a 137 Cs source. The extent of DNA damage, i.e., single-strand breaks (SSBs) and alkali-labile lesions of individual cells, was investigated using the alkaline single-cell gel electrophoresis technique. The irradiation resulted in a dose-dependent increase in DNA migration, reflecting the number of detectable DNA lesions. An approximately similar extent of SSB formation was observed in BMMNCs and CD34+ cells. Damage was repaired when the cells were incubated at 37C: a fast initial repair phase was followed by a slower rejoining of SSBs in both BMMNC and CD34+ cell populations. A significantly longer time was required to repair the lesions caused by 5.43 Gy than those caused by 0.93 Gy. In the present work we report, for the first time, the induction and repair of DNA SSBs at the level of single human bone marrow cells when exposed to ionizing radiation at clinically relevant doses. These data, together with our previous results with human blood granulocytes and lymphocytes, indicate an approximately similar extent of formation and repair of γ-irradiation-induced DNA SSBs in immature and mature human hematopoietic cells

  15. Effect of caffeine on the parameters of the motive and gamma-irradiated DNA molecules

    International Nuclear Information System (INIS)

    Osipov, N.D.; Kondrat'eva, O.P.; Erisman, Eh.V.


    The binding of caffeine with DNA and its pole as a DNA molecule protector against radiational damage have been studied. It is shown that with the ratio of DNA and caffeine concentrations used no complex formation occurs. The irradiation of the DNA solution by 1 krad dose of γ-rays causes only a few single-strand breaks which leads to the decrease in the volume macromolecules without changing its thermodynamic ligidity. The presence of caffeine in the DNA solution before its irradiation decreases considerably the extent of radiational damage

  16. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong


    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  17. Single molecule DNA detection with an atomic vapor notch filter

    Energy Technology Data Exchange (ETDEWEB)

    Uhland, Denis; Rendler, Torsten; Widmann, Matthias; Lee, Sang-Yun [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Wrachtrup, Joerg; Gerhardt, Ilja [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Max Planck Institute for Solid State Research, Stuttgart (Germany)


    The detection of single molecules has facilitated many advances in life- and material-science. Commonly the fluorescence of dye molecules is detected, which are attached to a non-fluorescent structure under study. For fluorescence microscopy one desires to maximize the detection efficiency together with an efficient suppression of undesired laser leakage. Here we present the use of the narrow-band filtering properties of hot atomic sodium vapor to selectively filter the excitation light from the red-shifted fluorescence of dye labeled single-stranded DNA molecules. A statistical analysis proves an enhancement in detection efficiency of more than 15% in a confocal and in a wide-field configuration. (orig.)

  18. Correlation between cell survival and DNA single-strand break repair proficiency in the Chinese hamster ovary cell lines AA8 and EM9 irradiated with 365-nm ultraviolet-A radiation

    Energy Technology Data Exchange (ETDEWEB)

    Churchill, M.E.; Peak, J.G.; Peak, M.J. (Argonne National Lab., IL (USA))


    Cell survival parameters and the induction and repair of DNA single-strand breaks were measured in two Chinese hamster ovary cell lines after irradiation with monochromatic UVA radiation of wavelength 365 nm. The radiosensitive mutant cell line EM9 is known to repair ionizing-radiation-induced single-strand breaks (SSB) more slowly than the parent line AA8. EM9 was determined to be 1.7-fold more sensitive to killing by 365-nm radiation than AA8 at the 10% survival level, and EM9 had a smaller shoulder region on the survival curve ({alpha} = 1.76) than AA8 ({alpha} = 0.62). No significant differences were found between the cell lines in the initial yields of SSB induced either by {gamma}-radiation (as determined by alkaline sucrose gradient sedimentation) or by 365-nm UVA (as determined by alkaline elution). For measurement of initial SSB, cells were irradiated at 0.5{sup o}C to minimize DNA repair processes. Rejoining of 365-nm induced SSB was measured by irradiating cells at 0.5{sup o}C, allowing them to repair at 37{sup o}C in full culture medium, and then quantitating the remaining SSB by alkaline elution. The repair of these breaks followed biphasic kinetics in both cell lines. EM9 repaired the breaks more slowly (T{sub 1/2} values of 1.3 and 61.3 min) than did AA8 (T{sub 1/2} values of 0.9 and 53.3 min), and EM9 also left more breaks unrepaired 90 min after irradiation (24% vs 8% for AA8). Thus, the sensitivity of EM9 to 365-nm radiation correlated with its deficiency in repairing DNA lesions revealed as SSB in alkaline elution. These results suggest that DNA may be a critical target in 365-nm induced cellular lethality and that the ability of AA8 and EM9 cells to repair DNA strand breaks may be related to their ability to survive 365-nm radiation. (author).

  19. The Rev1 interacting region (RIR) motif in the scaffold protein XRCC1 mediates a low-affinity interaction with polynucleotide kinase/phosphatase (PNKP) during DNA single-strand break repair. (United States)

    Breslin, Claire; Mani, Rajam S; Fanta, Mesfin; Hoch, Nicolas; Weinfeld, Michael; Caldecott, Keith W


    The scaffold protein X-ray repair cross-complementing 1 (XRCC1) interacts with multiple enzymes involved in DNA base excision repair and single-strand break repair (SSBR) and is important for genetic integrity and normal neurological function. One of the most important interactions of XRCC1 is that with polynucleotide kinase/phosphatase (PNKP), a dual-function DNA kinase/phosphatase that processes damaged DNA termini and that, if mutated, results in ataxia with oculomotor apraxia 4 (AOA4) and microcephaly with early-onset seizures and developmental delay (MCSZ). XRCC1 and PNKP interact via a high-affinity phosphorylation-dependent interaction site in XRCC1 and a forkhead-associated domain in PNKP. Here, we identified using biochemical and biophysical approaches a second PNKP interaction site in XRCC1 that binds PNKP with lower affinity and independently of XRCC1 phosphorylation. However, this interaction nevertheless stimulated PNKP activity and promoted SSBR and cell survival. The low-affinity interaction site required the highly conserved Rev1-interacting region (RIR) motif in XRCC1 and included three critical and evolutionarily invariant phenylalanine residues. We propose a bipartite interaction model in which the previously identified high-affinity interaction acts as a molecular tether, holding XRCC1 and PNKP together and thereby promoting the low-affinity interaction identified here, which then stimulates PNKP directly. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. [Single-molecule detection and characterization of DNA replication based on DNA origami]. (United States)

    Wang, Qi; Fan, Youjie; Li, Bin


    To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

  1. Correlation of MFOLD-predicted DNA secondary structures with separation patterns obtained by capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis. (United States)

    Glavac, Damjan; Potocnik, Uros; Podpecnik, Darja; Zizek, Teofil; Smerkolj, Sava; Ravnik-Glavac, Metka


    We have studied 57 different mutations within three beta-globin gene promoter fragments with sizes 52 bp, 77 bp, and 193 bp by fluorescent capillary electrophoresis CE-SSCP analysis. For each mutation and wild type, energetically most-favorable predicted secondary structures were calculated for sense and antisense strands using the MFOLD DNA-folding algorithm in order to investigate if any correlation exists between predicted DNA structures and actual CE migration time shifts. The overall CE-SSCP detection rate was 100% for all mutations in three studied DNA fragments. For shorter 52 bp and 77 bp DNA fragments we obtained a positive correlation between the migration time shifts and difference in free energy values of predicted secondary structures at all temperatures. For longer 193 bp beta-globin gene fragments with 46 mutations MFOLD predicted different secondary structures for 89% of mutated strands at 25 degrees C and 40 degrees C. However, the magnitude of the mobility shifts did not necessarily correlate with their secondary structures and free energy values except for the sense strand at 40 degrees C where this correlation was statistically significant (r = 0.312, p = 0.033). Results of this study provided more direct insight into the mechanism of CE-SSCP and showed that MFOLD prediction could be helpful in making decisions about the running temperatures and in prediction of CE-SSCP data patterns, especially for shorter (50-100 bp) DNA fragments. Copyright 2002 Wiley-Liss, Inc.

  2. Conformationally locked aryl C-nucleosides: synthesis of phosphoramidite monomers and incorporation into single-stranded DNA and LNA (locked nucleic acid)

    DEFF Research Database (Denmark)

    Babu, B. Ravindra; Prasad, Ashok K.; Trikha, Smriti


    . The phosphoramidite approach was used for automated incorporation of the LNA-type beta-configured C-aryl monomers 17a-17e into short DNA and 2'-OMe-RNA/LNA strands. It is shown that universal hybridization can be obtained with a conformationally restricted monomer as demonstrated most convincingly for the pyrene LNA...... monomer 17d, both in a DNA context and in an RNA-like context. Increased binding affinity of oligonucleotide probes for universal hybridization can be induced by combining the pyrene LNA monomer 17d with affinity-enhancing 2'-OMe-RNA/LNA monomers....

  3. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H; Frykholm, Karolin; Reymer, Anna; Renodon-Corniè re, Axelle; Takahashi, Masayuki; Nordé n, Bengt


    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated

  4. Interaction of Ddc1 and RPA with single-stranded/double-stranded DNA junctions in yeast whole cell extracts: Proteolytic degradation of the large subunit of replication protein A in ddc1Δ strains. (United States)

    Sukhanova, Maria V; D'Herin, Claudine; Boiteux, Serge; Lavrik, Olga I


    To characterize proteins that interact with single-stranded/double-stranded (ss/ds) DNA junctions in whole cell free extracts of Saccharomyces cerevisiae, we used [(32)P]-labeled photoreactive partial DNA duplexes containing a 3'-ss/ds-junction (3'-junction) or a 5'-ss/ds-junction (5'-junction). Identification of labeled proteins was achieved by MALDI-TOF mass spectrometry peptide mass fingerprinting and genetic analysis. In wild-type extract, one of the components of the Ddc1-Rad17-Mec3 complex, Ddc1, was found to be preferentially photocrosslinked at a 3'-junction. On the other hand, RPAp70, the large subunit of the replication protein A (RPA), was the predominant crosslinking product at a 5'-junction. Interestingly, ddc1Δ extracts did not display photocrosslinking of RPAp70 at a 5'-junction. The results show that RPAp70 crosslinked to DNA with a 5'-junction is subject to limited proteolysis in ddc1Δ extracts, whereas it is stable in WT, rad17Δ, mec3Δ and mec1Δ extracts. The degradation of the RPAp70-DNA adduct in ddc1Δ extract is strongly reduced in the presence of the proteasome inhibitor MG 132. We also addressed the question of the stability of free RPA, using anti-RPA antibodies. The results show that RPAp70 is also subject to proteolysis without photocrosslinking to DNA upon incubation in ddc1Δ extract. The data point to a novel property of Ddc1, modulating the turnover of DNA binding proteins such as RPAp70 by the proteasome. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. A Eu(III) doped metal-organic framework conjugated with fluorescein-labeled single-stranded DNA for detection of Cu(II) and sulfide. (United States)

    Weng, Han; Yan, Bing


    In this paper, Bio-MOF-1 is prepared as reported and then Eu 3+ is introduced into it via cation exchange method. A FAM-labeled ssDNA is chosen to fabricate with the obtained Eu 3+ @Bio-MOF-1. A luminescent hybrid material is assembled, which can exhibit the fluorescence of Eu 3+ and FAM simultaneously by adjusting the ratio of FAM-ssDNA and Eu 3+ @Bio-MOF-1. The sample is then used for the detecting of metal ions, results shows which has good selectively for Cu 2+ (LOD = 0.14 μM, 0-250 μM). The introduction of Cu 2+ can quench the fluorescence of FAM while the luminescent intensity of Eu 3+ enhancing. After the detection of Cu 2+ , the Cu 2+ involved hybrid system can then be further employed for the detection of S 2- (LOD = 1.3 μM, 0-50 μM). Low concentration of S 2- can make the luminescent intensity of Eu 3+ decrease gradually while high concentration of S 2- can further recover the luminescent of FAM, which is quenched by Cu 2+ . Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi


    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  7. Single Molecule Atomic Force Microscopy Studies of Photosensitized Singlet Oxygen Behavior on a DNA Origami Template

    DEFF Research Database (Denmark)

    Helmig, Sarah Wendelboe; Rotaru, Alexandru; Arian, Dumitru


    DNA origami, the folding of a long single-stranded DNA sequence (scaffold strand) by hundreds of short synthetic oligonucleotides (staple strands) into parallel aligned helices, is a highly efficient method to form advanced self-assembled DNA-architectures. Since molecules and various materials can...... be conjugated to each of the short staple strands, the origami method offers a unique possibility of arranging molecules and materials in well-defined positions on a structured surface. Here we combine the action of light with AFM and DNA nanostructures to study the production of singlet oxygen from a single...... photosensitizer molecule conjugated to a selected DNA origami staple strand on an origami structure. We demonstrate a distance-dependent oxidation of organic moieties incorporated in specific positions on DNA origami by singlet oxygen produced from a single photosensitizer located at the center of each origami....

  8. Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules (United States)

    Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan

    DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.


    NARCIS (Netherlands)



    The single-strand origin (SSO) of the rolling-circle (RC), broad-host-range lactococcal plasmid pWVO1 was functionally characterized. The activity of this SSO in the conversion of single-stranded DNA to double-stranded DNA was tested both in vivo and in vitro. In addition, the effect of this SSO on

  10. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms. (United States)

    Swanson, Colby A; Sliwinski, Marek K


    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  11. Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy (United States)

    Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto


    DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016

  12. Preparation, Single-Molecule Manipulation, and Energy Transfer Investigation of a Polyfluorene-graft-DNA polymer. (United States)

    Madsen, Mikael; Christensen, Rasmus S; Krissanaprasit, Abhichart; Bakke, Mette R; Riber, Camilla F; Nielsen, Karina S; Zelikin, Alexander N; Gothelf, Kurt V


    Conjugated polymers have been intensively studied due to their unique optical and electronic properties combined with their physical flexibility and scalable bottom up synthesis. Although the bulk qualities of conjugated polymers have been extensively utilized in research and industry, the ability to handle and manipulate conjugated polymers at the nanoscale lacks significantly behind. Here, the toolbox for controlled manipulation of conjugated polymers was expanded through the synthesis of a polyfluorene-DNA graft-type polymer (poly(F-DNA)). The polymer possesses the characteristics associated with the conjugated polyfluorene backbone, but the protruding single-stranded DNA provides the material with an exceptional addressability. This study demonstrates controlled single-molecule patterning of poly(F-DNA), as well as energy transfer between two different polymer-DNA conjugates. Finally, highly efficient DNA-directed quenching of polyfluorene fluorescence was shown. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Diversity of DNA β, a satellite molecule associated with some monopartite begomoviruses

    International Nuclear Information System (INIS)

    Briddon, Rob W.; Bull, Simon E.; Amin, Imran; Idris, Ali M.; Mansoor, Shahid; Bedford, Ian D.; Dhawan, Poonam; Rishi, Narayan; Siwatch, Surender S.; Abdel-Salam, Aly M.; Brown, Judith K.; Zafar, Yusuf; Markham, Peter G.


    DNA β molecules are symptom-modulating, single-stranded DNA satellites associated with monopartite begomoviruses (family Geminiviridae). Such molecules have thus far been shown to be associated with Ageratum yellow vein virus from Singapore and Cotton leaf curl Multan virus from Pakistan. Here, 26 additional DNA β molecules, associated with diverse plant species obtained from different geographical locations, were cloned and sequenced. These molecules were shown to be widespread in the Old World, where monopartite begomoviruses are known to occur. Analysis of the sequences revealed a highly conserved organization for DNA β molecules consisting of a single conserved open reading frame, an adenine-rich region, and a region of high sequence conservation [the satellite conserved region (SCR)]. The SCR contains a potential hairpin structure with the loop sequence TAA/GTATTAC; similar to the origins of replication of geminiviruses and nanoviruses. Two major groups of DNA β satellites were resolved by phylogenetic analyses. One group originated from hosts within the Malvaceae and the second from a more diverse group of plants within the Solanaceae and Compositae. Within the two clusters, DNA β molecules showed relatedness based both on host and geographic origin. These findings strongly support coadaptation of DNA β molecules with their respective helper begomoviruses

  14. Atomic force spectroscopic and SPR kinetic analysis of long circular and short ssDNA molecules interacting with single-stranded DNA-binding protein

    Czech Academy of Sciences Publication Activity Database

    Horáčková, V.; Hlaváček, Antonín; Čundlerová, V.; Pastucha, M.; Skládal, P.


    Roč. 148, č. 11 (2017), s. 2011-2018 ISSN 0026-9247 Institutional support: RVO:68081715 Keywords : microscopy * biology * specificity * surface Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 1.282, year: 2016

  15. Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET. (United States)

    Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W


    Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. DNA degradation, UV sensitivity and SOS-mediated mutagenesis in strains of Escherichia coli deficient in single-strand DNA binding protein: Effects of mutations and treatments that alter levels of exonuclease V or RecA protein

    International Nuclear Information System (INIS)

    Lieberman, H.B.; Witkin, E.M.


    Certain strains suppress the temperature-sensitivity caused by ssb-1, which encodes a mutant ssDNA binding protein (SSB). At 42 0 C, such strains are extremely UV-sensitive, degrade their DNA extensively after UV irradiation, and are defficient in UV mutability and UV induction of recA protein synthesis. We transduced recC22, which eliminates Exonuclease V activity, and recAo281, which causes operator-constitutive synthesis of recA protein, into such an ssb-1 strain. Both double mutants degraded their DNA extensively at 42 0 C after UV irradiation, and both were even more UV-sensitive than the ssb-1 single mutant. We conclude that one or more nucleases other than Exonuclease V degrades DNA in the ssb recC strain, and that recA protein, even if synthesized copiously, can function efficiently in recombinational DNA repair and in control of post-UV DNA degradation only if normal SSB is also present. Pretreatment with nalidixic acid at 30 0 C restored normal UV mutability at 42 0 C, but did not increase UV resistance, in an ssb-1 strain. Another ssb allele, ssb-113, which blocks SOS induction at 30 0 C, increases spontaneous mutability more than tenfold. The ssb-113 allele was transduced into the SOS-constitutive recA730 strain SC30. This double mutant expressed the same elevated spontaneous and UV-induced mutability at 30 0 C as the ssb + recA730 strain, and was three times more UV-resistant than its ssb-113 recA + parent. We conclude that ssb-1 at 42 0 C and ssb-113 at 30 0 C block UV-induced activation of recA protease, but that neither allele interferes with subsequent steps in SOS-mediated mutagenesis. (orig.)

  17. S1-sensitive sites in DNA after γ-irradiation

    International Nuclear Information System (INIS)

    Martin-Bertram, H.


    DNA from γ-irradiated T 1 bacteriophages was analyzed for 'single-stranded' sites by cleavage with S1 nuclease from Aspergillus oryzae as lesion probe. The ratio of 'S1-sensitive sites' to the amount of radiation-induced single-strand breaks was about one. Presumably these 'denatured' sites were associated with single-strand breaks. The subsequent check for the persistence of 'single-stranded' sites within the DNA molecule by thermokinetics demonstrated a strong affinity of the nuclease to its substrate, the single-stranded lesion, and a perfect excision. It is assumed that the direct absorption of radiation energy in the DNA gives rise to the formation of such bulky lesions. (Auth.)

  18. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.


    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  19. Difference Raman spectroscopy of DNA molecules

    International Nuclear Information System (INIS)

    Anokhin, Andrey S; Yuzyuk, Yury I; Gorelik, Vladimir S; Dovbeshko, Galina I; Pyatyshev, Alexander Yu


    In this paper the micro-Raman spectra of calf DNA for different points of DNA sample have been recorded. The Raman spectra were made with help of difference Raman spectroscopy technique. Raman spectra were recorded with high spatial resolution from different points of the wet and dry samples in different spectral range (100÷4000cm −1 ) using two lasers: argon (514.5 nm) and helium -neon (632.8 nm). The significant differences in the Raman spectra for dry and wet DNA and for different points of DNA molecules were observed. The obtained data on difference Raman scattering spectra of DNA molecules may be used for identification of DNA types and for analysis of genetic information associated with the molecular structure of this molecule

  20. Single-molecule analysis reveals the kinetics and physiological relevance of MutL-ssDNA binding.

    Directory of Open Access Journals (Sweden)

    Jonghyun Park


    Full Text Available DNA binding by MutL homologs (MLH/PMS during mismatch repair (MMR has been considered based on biochemical and genetic studies. Bulk studies with MutL and its yeast homologs Mlh1-Pms1 have suggested an integral role for a single-stranded DNA (ssDNA binding activity during MMR. We have developed single-molecule Förster resonance energy transfer (smFRET and a single-molecule DNA flow-extension assays to examine MutL interaction with ssDNA in real time. The smFRET assay allowed us to observe MutL-ssDNA association and dissociation. We determined that MutL-ssDNA binding required ATP and was the greatest at ionic strength below 25 mM (K(D = 29 nM while it dramatically decreases above 100 mM (K(D>2 µM. Single-molecule DNA flow-extension analysis suggests that multiple MutL proteins may bind ssDNA at low ionic strength but this activity does not enhance stability at elevated ionic strengths. These studies are consistent with the conclusion that a stable MutL-ssDNA interaction is unlikely to occur at physiological salt eliminating a number of MMR models. However, the activity may infer some related dynamic DNA transaction process during MMR.

  1. Nano-manipulation of single DNA molecules

    International Nuclear Information System (INIS)

    Hu Jun; Shanghai Jiaotong Univ., Shanghai; Lv Junhong; Wang Guohua; Wang Ying; Li Minqian; Zhang Yi; Li Bin; Li Haikuo; An Hongjie


    Nano-manipulation of single atoms and molecules is a critical technique in nanoscience and nanotechnology. This review paper will focus on the recent development of the manipulation of single DNA molecules based on atomic force microscopy (AFM). Precise manipulation has been realized including varied manipulating modes such as 'cutting', 'pushing', 'folding', 'kneading', 'picking up', 'dipping', etc. The cutting accuracy is dominated by the size of the AFM tip, which is usually 10 nm or less. Single DNA fragments can be cut and picked up and then amplified by single molecule PCR. Thus positioning isolation and sequencing can be performed. (authors)

  2. Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

    KAUST Repository

    Shirbini, Afnan


    Single-molecule DNA flow-stretching assays have been a powerful approach to study various aspects on the mechanism of DNA replication for more than a decade. This technique depends on flow-induced force on a bead attached to a surface-tethered DNA. The difference in the elastic property between double-strand DNA (long) and single-strand DNA (short) at low regime force allows the observation of the beads motion when the dsDNA is converted to ssDNA by the replisome machinery during DNA replication. Here, I aim to develop an assay to track in real-time the encounter of the bacteriophage T7 replisome with abasic lesion site inserted on the leading strand template. I optimized methods to construct the DNA substrate that contains the abasic site and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image the encounter of the T7 replisome with abasic site and to characterize how the interactions between the helicase and the polymerase could influence the polymerase proofreading ability and its direct bypass of this highly common DNA damage type.

  3. Transformation of Saccharomyces cerevisiae with UV-irradiated single-stranded plasmid. (United States)

    Zgaga, Z


    UV-irradiated single-stranded replicative plasmids were used to transform different yeast strains. The low doses of UV used in this study (10-75 J/m2) caused a significant decrease in the transforming efficiency of plasmid DNA in the Rad+ strain, while they had no effect on transformation with double-stranded plasmids of comparable size. Neither the rev3 mutation, nor the rad18 or rad52 mutations influenced the efficiency of transformation with irradiated single-stranded plasmid. However, it was found to be decreased in the double rev3 rad52 mutant. Extracellular irradiation of plasmid that contains both URA3 and LEU2 genes (psLU) gave rise to up to 5% Leu- transformants among selected Ura+ ones in the repair-proficient strain. Induction of Leu- transformants was dose-dependent and only partially depressed in the rev3 mutant. These results suggest that both mutagenic and recombinational repair processes operate on UV-damaged single-stranded DNA in yeast.

  4. A Heterogeneous Nuclear Ribonucleoprotein A/B-Related Protein Binds to Single-Stranded DNA near the 5′ End or within the Genome of Feline Parvovirus and Can Modify Virus Replication (United States)

    Wang, Dai; Parrish, Colin R.


    Phage display of cDNA clones prepared from feline cells was used to identify host cell proteins that bound to DNA-containing feline panleukopenia virus (FPV) capsids but not to empty capsids. One gene found in several clones encoded a heterogeneous nuclear ribonucleoprotein (hnRNP)-related protein (DBP40) that was very similar in sequence to the A/B-type hnRNP proteins. DBP40 bound specifically to oligonucleotides representing a sequence near the 5′ end of the genome which is exposed on the outside of the full capsid but did not bind most other terminal sequences. Adding purified DBP40 to an in vitro fill-in reaction using viral DNA as a template inhibited the production of the second strand after nucleotide (nt) 289 but prior to nt 469. DBP40 bound to various regions of the viral genome, including a region between nt 295 and 330 of the viral genome which has been associated with transcriptional attenuation of the parvovirus minute virus of mice, which is mediated by a stem-loop structure of the DNA and cellular proteins. Overexpression of the protein in feline cells from a plasmid vector made them largely resistant to FPV infection. Mutagenesis of the protein binding site within the 5′ end viral genome did not affect replication of the virus. PMID:10438866

  5. LEGO-like DNA Structures

    DEFF Research Database (Denmark)

    Gothelf, Kurt Vesterager


    -dimensional (3D) DNA structures by self-assembly of single-stranded DNA “bricks.” The method opens a new route to complex self-assembled (3D) nanostructures that may serve as addressable templates for placing guest molecules with high precision, with possible applications in biophysics, medicine...

  6. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth


    Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells....... We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices...

  7. Programmed Switching of Single Polymer Conformation on DNA Origami

    DEFF Research Database (Denmark)

    Krissanaprasit, Abhichart; Madsen, Mikael; Knudsen, Jakob Bach


    -molecule conjugated polymer. The polymer is functionalized with short single-stranded (ss) DNA strands that extend from the backbone of the polymer and serve as handles. The DNA polymer conjugate can be aligned on DNA origami in three well-defined geometries (straight line, left-turned, and right-turned pattern......) by DNA hybridization directed by single-stranded guiding strands and ssDNA tracks extending from the origami surface and polymer handle. We demonstrate switching of a conjugated organic polymer conformation between left- and right-turned conformations of the polymer on DNA origami based on toehold...

  8. Binding of radiation-induced phenylalanine radicals to DNA

    International Nuclear Information System (INIS)

    Schans, G.P. van der; Rijn, C.J.S. van; Bleichrodt, J.F.


    When an aqueous solution of double-stranded DNA of bacteriophage PM2 containing phenylalanine and saturated with N 2 O is irradiated with γ-rays, radiation-induced phenylalanine radicals are bound covalently. Under the conditions used about 25 phenylalanine molecules may be bound per lethal hit. Also for single-stranded PM2 DNA, most of the phenylalanine radicals bound are non-lethal. Evidence is presented that in double-stranded DNA an appreciable fraction of the single-strand breaks is induced by phenylalanine radicals. Radiation products of phenylalanine and the phenylalanine bound to the DNA decrease the sensitivity of the DNA to the induction of single-strand breaks. There are indications that the high efficiency of protection by radiation products of phenylalanine is due to their positive charge, which will result in a relatively high concentration of these compounds in the vicinity of the negatively charged DNA molecules

  9. The role of the C-domain of bacteriophage T4 gene 32 protein in ssDNA binding and dsDNA helix-destabilization: Kinetic, single-molecule, and cross-linking studies (United States)

    Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.


    The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784

  10. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries. (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan


    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  11. Electron microscope autoradiography of isolated DNA molecules

    International Nuclear Information System (INIS)

    Delain, Etienne; Bouteille, Michel


    Autoradiographs of 3 H-thymidine-labelled DNA molecules were observed with an electron microscope. After ten months of exposure significant labelling was obtained with tritiated T7 DNA molecules which had a specific activity of 630,000 cpm/μg. Although isolated DNA molecules were not stretched out to such an extent that they could be rigorously compared to straight 'hot lines', the resolution was estimated and found to be similar to that obtained by autoradiography on thin plastic sections. The H.D. value was of the order of 1600A. From the known specific activity of the macromolecules, it was possible to compare the expected number of disintegrations from the samples to the number of grains obtained on the autoradiograms. This enabled us to calculate 1/ The absolute autoradiographic efficiency and 2/ The per cent ratio of thymidine residues labelled with tritium. These results throw some light on the resolution and sensitivity of electron microscope autoradiography of shadowed isolated macromolecules as compared to thin plastic sections

  12. Effect of temperature and ionic strength on the dissociation kinetics and lifetime of PNA-DNA triplexes

    DEFF Research Database (Denmark)

    Kosaganov, Y N; Stetsenko, D A; Lubyako, E N


    Dissociation kinetics of triplexes formed by molecules of peptide nucleic acid (PNA) and DNA have been studied. The complexes consisted of oligomeric PNA containing 10 thymine bases and the dA(10) target incorporated in single-stranded (ssDNA) or double-stranded DNA (dsDNA). Their dissociation wa...

  13. Theory of high-force DNA stretching and overstretching

    NARCIS (Netherlands)

    Storm, C.; Nelson, P.


    Single-molecule experiments on single- and double-stranded DNA have sparked a renewed interest in the force versus extension of polymers. The extensible freely jointed chain (FJC) model is frequently invoked to explain the observed behavior of single-stranded DNA, but this model does not

  14. Elastic Properties of Nucleic Acids by Single-Molecule Force Spectroscopy. (United States)

    Camunas-Soler, Joan; Ribezzi-Crivellari, Marco; Ritort, Felix


    We review the current knowledge on the use of single-molecule force spectroscopy techniques to extrapolate the elastic properties of nucleic acids. We emphasize the lesser-known elastic properties of single-stranded DNA. We discuss the importance of accurately determining the elastic response in pulling experiments, and we review the simplest models used to rationalize the experimental data as well as the experimental approaches used to pull single-stranded DNA. Applications used to investigate DNA conformational transitions and secondary structure formation are also highlighted. Finally, we provide an overview of the effects of salt and temperature and briefly discuss the effects of contour length and sequence dependence.

  15. DNA-psoralen interaction: a single molecule experiment. (United States)

    Rocha, M S; Viana, N B; Mesquita, O N


    By attaching one end of a single lambda-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the lambda-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particularly interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.

  16. Biotechnological mass production of DNA origami (United States)

    Praetorius, Florian; Kick, Benjamin; Behler, Karl L.; Honemann, Maximilian N.; Weuster-Botz, Dirk; Dietz, Hendrik


    DNA nanotechnology, in particular DNA origami, enables the bottom-up self-assembly of micrometre-scale, three-dimensional structures with nanometre-precise features. These structures are customizable in that they can be site-specifically functionalized or constructed to exhibit machine-like or logic-gating behaviour. Their use has been limited to applications that require only small amounts of material (of the order of micrograms), owing to the limitations of current production methods. But many proposed applications, for example as therapeutic agents or in complex materials, could be realized if more material could be used. In DNA origami, a nanostructure is assembled from a very long single-stranded scaffold molecule held in place by many short single-stranded staple oligonucleotides. Only the bacteriophage-derived scaffold molecules are amenable to scalable and efficient mass production; the shorter staple strands are obtained through costly solid-phase synthesis or enzymatic processes. Here we show that single strands of DNA of virtually arbitrary length and with virtually arbitrary sequences can be produced in a scalable and cost-efficient manner by using bacteriophages to generate single-stranded precursor DNA that contains target strand sequences interleaved with self-excising ‘cassettes’, with each cassette comprising two Zn2+-dependent DNA-cleaving DNA enzymes. We produce all of the necessary single strands of DNA for several DNA origami using shaker-flask cultures, and demonstrate end-to-end production of macroscopic amounts of a DNA origami nanorod in a litre-scale stirred-tank bioreactor. Our method is compatible with existing DNA origami design frameworks and retains the modularity and addressability of DNA origami objects that are necessary for implementing custom modifications using functional groups. With all of the production and purification steps amenable to scaling, we expect that our method will expand the scope of DNA nanotechnology in

  17. Identification of a Single Strand Origin of Replication in the Integrative and Conjugative Element ICEBs1 of Bacillus subtilis.

    Directory of Open Access Journals (Sweden)

    Laurel D Wright


    Full Text Available We identified a functional single strand origin of replication (sso in the integrative and conjugative element ICEBs1 of Bacillus subtilis. Integrative and conjugative elements (ICEs, also known as conjugative transposons are DNA elements typically found integrated into a bacterial chromosome where they are transmitted to daughter cells by chromosomal replication and cell division. Under certain conditions, ICEs become activated and excise from the host chromosome and can transfer to neighboring cells via the element-encoded conjugation machinery. Activated ICEBs1 undergoes autonomous rolling circle replication that is needed for the maintenance of the excised element in growing and dividing cells. Rolling circle replication, used by many plasmids and phages, generates single-stranded DNA (ssDNA. In many cases, the presence of an sso enhances the conversion of the ssDNA to double-stranded DNA (dsDNA by enabling priming of synthesis of the second DNA strand. We initially identified sso1 in ICEBs1 based on sequence similarity to the sso of an RCR plasmid. Several functional assays confirmed Sso activity. Genetic analyses indicated that ICEBs1 uses sso1 and at least one other region for second strand DNA synthesis. We found that Sso activity was important for two key aspects of the ICEBs1 lifecycle: 1 maintenance of the plasmid form of ICEBs1 in cells after excision from the chromosome, and 2 stable acquisition of ICEBs1 following transfer to a new host. We identified sequences similar to known plasmid sso's in several other ICEs. Together, our results indicate that many other ICEs contain at least one single strand origin of replication, that these ICEs likely undergo autonomous replication, and that replication contributes to the stability and spread of these elements.

  18. Single Molecule Scanning of DNA Radiation Oxidative Damage, Phase I (United States)

    National Aeronautics and Space Administration — This proposal will develop an assay to map genomic DNA, at the single molecule level and in a nanodevice, for oxidative DNA damage arising from radiation exposure;...

  19. Detection of DNA hybridizations using solid-state nanopores

    International Nuclear Information System (INIS)

    Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng


    We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.

  20. Detection of DNA hybridizations using solid-state nanopores

    Energy Technology Data Exchange (ETDEWEB)

    Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng, E-mail: [Department of Physics, Brown University, Providence, RI 02912 (United States)


    We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.

  1. Single Molecule Nano-Metronome (United States)

    Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip


    We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050

  2. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan


    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  3. Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA (United States)

    Dimitrov, Valentin V.


    This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

  4. Polarizability of DNA Block Copolymer Nanoparticles Observed by Electrostatic Force Microscopy

    NARCIS (Netherlands)

    Sowwan, Mukhles; Faroun, Maryam; Mentovich, Elad; Ibrahim, Imad; Haboush, Shayma; Alemdaroglu, Fikri Emrah; Kwak, Minseok; Richter, Shachar; Herrmann, Andreas


    In this study, DNA block copolymer (DBC) micelles with a polystyrene (PS) core and a single-stranded (ss) DNA shell were doped with ferrocene (Fc) molecules. Tapping mode atomic force microscopy (AFM) was used to study the morphology of the doped and undoped block copolymer aggregates. We show that

  5. Systematic Identification of Determinants for Single-Strand Annealing-Mediated Deletion Formation in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Maia Segura-Wang


    Full Text Available To ensure genomic integrity, living organisms have evolved diverse molecular processes for sensing and repairing damaged DNA. If improperly repaired, DNA damage can give rise to different types of mutations, an important class of which are genomic structural variants (SVs. In spite of their importance for phenotypic variation and genome evolution, potential contributors to SV formation in Saccharomyces cerevisiae (budding yeast, a highly tractable model organism, are not fully recognized. Here, we developed and applied a genome-wide assay to identify yeast gene knockout mutants associated with de novo deletion formation, in particular single-strand annealing (SSA-mediated deletion formation, in a systematic manner. In addition to genes previously linked to genome instability, our approach implicates novel genes involved in chromatin remodeling and meiosis in affecting the rate of SSA-mediated deletion formation in the presence or absence of stress conditions induced by DNA-damaging agents. We closely examined two candidate genes, the chromatin remodeling gene IOC4 and the meiosis-related gene MSH4, which when knocked-out resulted in gene expression alterations affecting genes involved in cell division and chromosome organization, as well as DNA repair and recombination, respectively. Our high-throughput approach facilitates the systematic identification of processes linked to the formation of a major class of genetic variation.

  6. Single Molecule Nano-Metronome


    Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip


    We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule ...

  7. Concentrating and labeling genomic DNA in a nanofluidic array

    DEFF Research Database (Denmark)

    Marie, Rodolphe; Pedersen, Jonas Nyvold; Mir, Kalim U.


    , however, hinder the polymerase activity. We demonstrate a device and a protocol for the enzymatic labeling of genomic DNA arranged in a dense array of single molecules without attaching the enzyme or the DNA to a surface. DNA molecules accumulate in a dense array of pits embedded within a nanoslit due...... to entropic trapping. We then perform ϕ29 polymerase extension from single-strand nicks created on the trapped molecules to incorporate fluorescent nucleotides into the DNA. The array of entropic traps can be loaded with λ-DNA molecules to more than 90% of capacity at a flow rate of 10 pL min-1. The final...

  8. Master equation approach to DNA breathing in heteropolymer DNA

    DEFF Research Database (Denmark)

    Ambjörnsson, Tobias; Banik, Suman K; Lomholt, Michael A


    After crossing an initial barrier to break the first base-pair (bp) in double-stranded DNA, the disruption of further bps is characterized by free energies up to a few k(B)T. Thermal motion within the DNA double strand therefore causes the opening of intermittent single-stranded denaturation zones......, the DNA bubbles. The unzipping and zipping dynamics of bps at the two zipper forks of a bubble, where the single strand of the denatured zone joins the still intact double strand, can be monitored by single molecule fluorescence or NMR methods. We here establish a dynamic description of this DNA breathing...... in a heteropolymer DNA with given sequence in terms of a master equation that governs the time evolution of the joint probability distribution for the bubble size and position along the sequence. The transfer coefficients are based on the Poland-Scheraga free energy model. We derive the autocorrelation function...

  9. DNA analysis by single molecule stretching in nanofluidic biochips

    DEFF Research Database (Denmark)

    Abad, E.; Juarros, A.; Retolaza, A.


    Imprint Lithography (NIL) technology combined with a conventional anodic bonding of the silicon base and Pyrex cover. Using this chip, we have performed single molecule imaging on a bench-top fluorescent microscope system. Lambda phage DNA was used as a model sample to characterize the chip. Single molecules of λ-DNA......Stretching single DNA molecules by confinement in nanofluidic channels has attracted a great interest during the last few years as a DNA analysis tool. We have designed and fabricated a sealed micro/nanofluidic device for DNA stretching applications, based on the use of the high throughput Nano...... stained with the fluorescent dye YOYO-1 were stretched in the nanochannel array and the experimental results were analysed to determine the extension factor of the DNA in the chip and the geometrical average of the nanochannel inner diameter. The determination of the extension ratio of the chip provides...

  10. Detection of human DNA polymorphisms with a simplified denaturing gradient gel electrophoresis technique.


    Noll, W W; Collins, M


    Single base pair differences between otherwise identical DNA molecules can result in altered melting behavior detectable by denaturing gradient gel electrophoresis. We have developed a simplified procedure for using denaturing gradient gel electrophoresis to detect base pair changes in genomic DNA. Genomic DNA is digested with restriction enzymes and hybridized in solution to labeled single-stranded probe DNA. The excess probe is then hybridized to complementary phage M13 template DNA, and th...

  11. Packaging signals in single-stranded RNA viruses: nature?s alternative to a purely electrostatic assembly mechanism


    Stockley, Peter G.; Twarock, Reidun; Bakker, Saskia E.; Barker, Amy M.; Borodavka, Alexander; Dykeman, Eric; Ford, Robert J.; Pearson, Arwen R.; Phillips, Simon E. V.; Ranson, Neil A.; Tuma, Roman


    The formation of a protective protein container is an essential step in the life-cycle of most viruses. In the case of single-stranded (ss)RNA viruses, this step occurs in parallel with genome packaging in a co-assembly process. Previously, it had been thought that this process can be explained entirely by electrostatics. Inspired by recent single-molecule fluorescence experiments that recapitulate the RNA packaging specificity seen in vivo for two model viruses, we present an alternative the...

  12. How to read and write mechanical information in DNA molecules (United States)

    Schiessel, Helmut

    In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.

  13. Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition. (United States)

    Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M


    Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

  14. A single molecule DNA flow stretching microscope for undergraduates

    NARCIS (Netherlands)

    Williams, Kelly; Grafe, Brendan; Burke, Kathryn M.; Tanner, Nathan; van Oijen, Antoine M.; Loparo, Joseph; Price, Allen C.


    The design of a simple, safe, and inexpensive single molecule flow stretching instrument is presented. The instrument uses a low cost upright microscope coupled to a webcam for imaging single DNA molecules that are tethered in an easy to construct microfluidic flow cell. The system requires no

  15. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.


    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  16. Automation of a single-DNA molecule stretching device

    DEFF Research Database (Denmark)

    Sørensen, Kristian Tølbøl; Lopacinska, Joanna M.; Tommerup, Niels


    We automate the manipulation of genomic-length DNA in a nanofluidic device based on real-time analysis of fluorescence images. In our protocol, individual molecules are picked from a microchannel and stretched with pN forces using pressure driven flows. The millimeter-long DNA fragments free...

  17. DNA molecules and human therapeutics | Danquah | African Journal ...

    African Journals Online (AJOL)

    Nucleic acid molecules are championing a new generation of reverse engineered biopharmaceuticals. In terms of potential application in gene medicine, plasmid DNA (pDNA) vectors have exceptional therapeutic and immunological profiles as they are free from safety concerns associated with viral vectors, display ...

  18. Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

    NARCIS (Netherlands)

    Tanner, Nathan A.; Loparo, Joseph J.; Oijen, Antoine M. van


    We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides. The

  19. Toxin MqsR Cleaves Single-Stranded mRNA with Various 5 Ends (United States)


    either protein ORIGINAL RESEARCH Toxin MqsR cleaves single- stranded mRNA with various 5’ ends Nityananda Chowdhury1,*, Brian W. Kwan1,*, Louise which a single 5′- GCU site was predicted to be single- stranded (ssRNA), double- stranded (dsRNA), in the loop of a stem - loop (slRNA), or in a...single- stranded 5′- GCU sites since cleavage was approximately 20- fold higher than cleavage seen with the 5′- GCU site in the stem - loop and

  20. Fanconi anemia complementation group A (FANCA) protein has intrinsic affinity for nucleic acids with preference for single-stranded forms. (United States)

    Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin


    The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5'-flap or 5'-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772-1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found.

  1. Fanconi Anemia Complementation Group A (FANCA) Protein Has Intrinsic Affinity for Nucleic Acids with Preference for Single-stranded Forms* (United States)

    Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y.; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin


    The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5′-flap or 5′-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772–1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found. PMID:22194614

  2. Highly parallel translation of DNA sequences into small molecules.

    Directory of Open Access Journals (Sweden)

    Rebecca M Weisinger

    Full Text Available A large body of in vitro evolution work establishes the utility of biopolymer libraries comprising 10(10 to 10(15 distinct molecules for the discovery of nanomolar-affinity ligands to proteins. Small-molecule libraries of comparable complexity will likely provide nanomolar-affinity small-molecule ligands. Unlike biopolymers, small molecules can offer the advantages of cell permeability, low immunogenicity, metabolic stability, rapid diffusion and inexpensive mass production. It is thought that such desirable in vivo behavior is correlated with the physical properties of small molecules, specifically a limited number of hydrogen bond donors and acceptors, a defined range of hydrophobicity, and most importantly, molecular weights less than 500 Daltons. Creating a collection of 10(10 to 10(15 small molecules that meet these criteria requires the use of hundreds to thousands of diversity elements per step in a combinatorial synthesis of three to five steps. With this goal in mind, we have reported a set of mesofluidic devices that enable DNA-programmed combinatorial chemistry in a highly parallel 384-well plate format. Here, we demonstrate that these devices can translate DNA genes encoding 384 diversity elements per coding position into corresponding small-molecule gene products. This robust and efficient procedure yields small molecule-DNA conjugates suitable for in vitro evolution experiments.

  3. Studying DNA looping by single-molecule FRET. (United States)

    Le, Tung T; Kim, Harold D


    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

  4. Aligned deposition and electrical measurements on single DNA molecules

    International Nuclear Information System (INIS)

    Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid


    A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)

  5. Developing DNA nanotechnology using single-molecule fluorescence. (United States)

    Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal


    CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and

  6. Packaging signals in single-stranded RNA viruses: nature's alternative to a purely electrostatic assembly mechanism. (United States)

    Stockley, Peter G; Twarock, Reidun; Bakker, Saskia E; Barker, Amy M; Borodavka, Alexander; Dykeman, Eric; Ford, Robert J; Pearson, Arwen R; Phillips, Simon E V; Ranson, Neil A; Tuma, Roman


    The formation of a protective protein container is an essential step in the life-cycle of most viruses. In the case of single-stranded (ss)RNA viruses, this step occurs in parallel with genome packaging in a co-assembly process. Previously, it had been thought that this process can be explained entirely by electrostatics. Inspired by recent single-molecule fluorescence experiments that recapitulate the RNA packaging specificity seen in vivo for two model viruses, we present an alternative theory, which recognizes the important cooperative roles played by RNA-coat protein interactions, at sites we have termed packaging signals. The hypothesis is that multiple copies of packaging signals, repeated according to capsid symmetry, aid formation of the required capsid protein conformers at defined positions, resulting in significantly enhanced assembly efficiency. The precise mechanistic roles of packaging signal interactions may vary between viruses, as we have demonstrated for MS2 and STNV. We quantify the impact of packaging signals on capsid assembly efficiency using a dodecahedral model system, showing that heterogeneous affinity distributions of packaging signals for capsid protein out-compete those of homogeneous affinities. These insights pave the way to a new anti-viral therapy, reducing capsid assembly efficiency by targeting of the vital roles of the packaging signals, and opens up new avenues for the efficient construction of protein nanocontainers in bionanotechnology.

  7. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska


    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  8. Charge transport in polyguanine-polycytosine DNA molecules

    International Nuclear Information System (INIS)

    Wei, J H; Chan, K S


    A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules

  9. Small molecules, inhibitors of DNA-PK, targeting DNA repair and beyond

    Directory of Open Access Journals (Sweden)

    David eDavidson


    Full Text Available Many current chemotherapies function by damaging genomic DNA in rapidly dividing cells ultimately leading to cell death. This therapeutic approach differentially targets cancer cells that generally display rapid cell division compared to normal tissue cells. However, although these treatments are initially effective in arresting tumor growth and reducing tumor burden, resistance and disease progression eventually occur. A major mechanism underlying this resistance is increased levels of cellular DNA repair. Most cells have complex mechanisms in place to repair DNA damage that occurs due to environmental exposures or normal metabolic processes. These systems, initially overwhelmed when faced with chemotherapy induced DNA damage, become more efficient under constant selective pressure and as a result chemotherapies become less effective. Thus, inhibiting DNA repair pathways using target specific small molecule inhibitors may overcome cellular resistance to DNA damaging chemotherapies. Non-homologous end joining (NHEJ a major mechanism for the repair of double strand breaks (DSB in DNA is regulated in part by the serine/threonine kinase, DNA dependent protein kinase (DNA-PK. The DNA-PK holoenzyme acts as a scaffold protein tethering broken DNA ends and recruiting other repair molecules. It also has enzymatic activity that may be involved in DNA damage signaling. Because of its’ central role in repair of DSBs, DNA-PK has been the focus of a number of small molecule studies. In these studies specific DNA-PK inhibitors have shown efficacy in synergizing chemotherapies in vitro. However, compounds currently known to specifically inhibit DNA-PK are limited by poor pharmacokinetics: these compounds have poor solubility and have high metabolic lability in vivo leading to short serum half-lives. Future improvement in DNA-PK inhibition will likely be achieved by designing new molecules based on the recently reported crystallographic structure of DNA

  10. Single-molecule mechanics of protein-labelled DNA handles

    Directory of Open Access Journals (Sweden)

    Vivek S. Jadhav


    Full Text Available DNA handles are often used as spacers and linkers in single-molecule experiments to isolate and tether RNAs, proteins, enzymes and ribozymes, amongst other biomolecules, between surface-modified beads for nanomechanical investigations. Custom DNA handles with varying lengths and chemical end-modifications are readily and reliably synthesized en masse, enabling force spectroscopic measurements with well-defined and long-lasting mechanical characteristics under physiological conditions over a large range of applied forces. Although these chemically tagged DNA handles are widely used, their further individual modification with protein receptors is less common and would allow for additional flexibility in grabbing biomolecules for mechanical measurements. In-depth information on reliable protocols for the synthesis of these DNA–protein hybrids and on their mechanical characteristics under varying physiological conditions are lacking in literature. Here, optical tweezers are used to investigate different protein-labelled DNA handles in a microfluidic environment under different physiological conditions. Digoxigenin (DIG-dsDNA-biotin handles of varying sizes (1000, 3034 and 4056 bp were conjugated with streptavidin or neutravidin proteins. The DIG-modified ends of these hybrids were bound to surface-modified polystyrene (anti-DIG beads. Using different physiological buffers, optical force measurements showed consistent mechanical characteristics with long dissociation times. These protein-modified DNA hybrids were also interconnected in situ with other tethered biotinylated DNA molecules. Electron-multiplying CCD (EMCCD imaging control experiments revealed that quantum dot–streptavidin conjugates at the end of DNA handles remain freely accessible. The experiments presented here demonstrate that handles produced with our protein–DNA labelling procedure are excellent candidates for grasping single molecules exposing tags suitable for molecular

  11. A high throughput system for the preparation of single stranded templates grown in microculture. (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M


    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  12. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)


    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  13. Single Molecule Screening of Disease DNA Without Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ji-Young [Iowa State Univ., Ames, IA (United States)


    The potential of single molecule detection as an analysis tool in biological and medical fields is well recognized today. This fast evolving technique will provide fundamental sensitivity to pick up individual pathogen molecules, and therefore contribute to a more accurate diagnosis and a better chance for a complete cure. Many studies are being carried out to successfully apply this technique in real screening fields. In this dissertation, several attempts are shown that have been made to test and refine the application of the single molecule technique as a clinical screening method. A basic applicability was tested with a 100% target content sample, using electrophoretic mobility and multiple colors as identification tools. Both electrophoretic and spectral information of individual molecule were collected within a second, while the molecule travels along the flow in a capillary. Insertion of a transmission grating made the recording of the whole spectrum of a dye-stained molecule possible without adding complicated instrumental components. Collecting two kinds of information simultaneously and combining them allowed more thorough identification, up to 98.8% accuracy. Probing mRNA molecules with fluorescently labeled cDNA via hybridization was also carried out. The spectral differences among target, probe, and hybrid were interpreted in terms of dispersion distances after transmission grating, and used for the identification of each molecule. The probes were designed to have the least background when they are free, but have strong fluorescence after hybridization via fluorescence resonance energy transfer. The mRNA-cDNA hybrids were further imaged in whole blood, plasma, and saliva, to test how far a crude preparation can be tolerated. Imaging was possible with up to 50% of clear bio-matrix contents, suggesting a simple lysis and dilution would be sufficient for imaging for some cells. Real pathogen DNA of human papillomavirus (HPV) type-I6 in human genomic DNA

  14. Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution. (United States)

    Gahlon, Hailey L; Romano, Louis J; Rueda, David


    Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

  15. Analysis of DNA interactions using single-molecule force spectroscopy. (United States)

    Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert


    Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.

  16. DNA replication at the single-molecule level

    NARCIS (Netherlands)

    Stratmann, S.A.; Oijen, A.M. van


    A cell can be thought of as a highly sophisticated micro factory: in a pool of billions of molecules – metabolites, structural proteins, enzymes, oligonucleotides – multi-subunit complexes assemble to perform a large number of basic cellular tasks, such as DNA replication, RNA/protein synthesis or

  17. Voltage dependency of transmission probability of aperiodic DNA molecule (United States)

    Wiliyanti, V.; Yudiarsah, E.


    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  18. Single Molecule Study of DNA Organization and Recombination (United States)

    Xiao, Botao

    We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force

  19. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.


    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  20. Inhibition of DNA glycosylases via small molecule purine analogs.

    Directory of Open Access Journals (Sweden)

    Aaron C Jacobs

    Full Text Available Following the formation of oxidatively-induced DNA damage, several DNA glycosylases are required to initiate repair of the base lesions that are formed. Recently, NEIL1 and other DNA glycosylases, including OGG1 and NTH1 were identified as potential targets in combination chemotherapeutic strategies. The potential therapeutic benefit for the inhibition of DNA glycosylases was validated by demonstrating synthetic lethality with drugs that are commonly used to limit DNA replication through dNTP pool depletion via inhibition of thymidylate synthetase and dihydrofolate reductase. Additionally, NEIL1-associated synthetic lethality has been achieved in combination with Fanconi anemia, group G. As a prelude to the development of strategies to exploit the potential benefits of DNA glycosylase inhibition, it was necessary to develop a reliable high-throughput screening protocol for this class of enzymes. Using NEIL1 as the proof-of-principle glycosylase, a fluorescence-based assay was developed that utilizes incision of site-specifically modified oligodeoxynucleotides to detect enzymatic activity. This assay was miniaturized to a 1536-well format and used to screen small molecule libraries for inhibitors of the combined glycosylase/AP lyase activities. Among the top hits of these screens were several purine analogs, whose postulated presence in the active site of NEIL1 was consistent with the paradigm of NEIL1 recognition and excision of damaged purines. Although a subset of these small molecules could inhibit other DNA glycosylases that excise oxidatively-induced DNA adducts, they could not inhibit a pyrimidine dimer-specific glycosylase.

  1. Single-stranded nucleic acids promote SAMHD1 complex formation. (United States)

    Tüngler, Victoria; Staroske, Wolfgang; Kind, Barbara; Dobrick, Manuela; Kretschmer, Stefanie; Schmidt, Franziska; Krug, Claudia; Lorenz, Mike; Chara, Osvaldo; Schwille, Petra; Lee-Kirsch, Min Ae


    SAM domain and HD domain-containing protein 1 (SAMHD1) is a dGTP-dependent triphosphohydrolase that degrades deoxyribonucleoside triphosphates (dNTPs) thereby limiting the intracellular dNTP pool. Mutations in SAMHD1 cause Aicardi-Goutières syndrome (AGS), an inflammatory encephalopathy that mimics congenital viral infection and that phenotypically overlaps with the autoimmune disease systemic lupus erythematosus. Both disorders are characterized by activation of the antiviral cytokine interferon-α initiated by immune recognition of self nucleic acids. Here we provide first direct evidence that SAMHD1 associates with endogenous nucleic acids in situ. Using fluorescence cross-correlation spectroscopy, we demonstrate that SAMHD1 specifically interacts with ssRNA and ssDNA and establish that nucleic acid-binding and formation of SAMHD1 complexes are mutually dependent. Interaction with nucleic acids and complex formation do not require the SAM domain, but are dependent on the HD domain and the C-terminal region of SAMHD1. We finally demonstrate that mutations associated with AGS exhibit both impaired nucleic acid-binding and complex formation implicating that interaction with nucleic acids is an integral aspect of SAMHD1 function.

  2. Single-molecule denaturation mapping of DNA in nanofluidic channels

    DEFF Research Database (Denmark)

    Reisner, Walter; Larsen, Niels Bent; Silahtaroglu, Asli


    Here we explore the potential power of denaturation mapping as a single-molecule technique. By partially denaturing YOYO (R)-1-labeled DNA in nanofluidic channels with a combination of formamide and local heating, we obtain a sequence-dependent "barcode" corresponding to a series of local dips...... and peaks in the intensity trace along the extended molecule. We demonstrate that this structure arises from the physics of local denaturation: statistical mechanical calculations of sequence-dependent melting probability can predict the barcode to be observed experimentally for a given sequence...

  3. Second-strand cDNA synthesis: classical method

    International Nuclear Information System (INIS)

    Gubler, U.


    The classical scheme for the synthesis of double-stranded cDNA as it was reported in 1976 is described. Reverse transcription of mRNA with oligo(dT) as the primer generates first strands with a small loop at the 3' end of the cDNA (the end that corresponds to the 5' end of the mRNA). Subsequent removal of the mRNA by alkaline hydrolysis leaves single-stranded cDNA molecules again with a small 3' loop. This loop can be used by either reverse transcriptase or Klenow fragment of DNA polymerase I as a primer for second-strand synthesis. The resulting products are double-stranded cDNA molecules that are covalently closed at the end corresponding to the 5' end of the original mRNA. Subsequent cleavage of the short piece of single-stranded cDNA within the loop with the single-strand-specific S 1 nuclease generate open double-stranded molecules that can be used for molecular cloning in plasmids or in phage. Useful variations of this scheme have been described

  4. The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows

    International Nuclear Information System (INIS)

    Shen Zigang; Huang Yibo; Li Bin; Zhang Yi


    Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)

  5. Radiobiology of DNA strand breakage

    International Nuclear Information System (INIS)

    Johansen, I.


    The yield of single-strand breaks in lambda DNA within lysogenic host bacteria was measured after exposure to 4-MeV electrons (50 msec) and rapid transfer (45 msec) to alkaline detergent. In nitrogen anoxia the yield was 1.2 x 10 -12 DNA single-strand breaks per rad per dalton, and under full oxygenation the yield increased to 5 x 10 -12 breaks per rad per dalton. A search for the presence of fast repair mechanisms failed to demonstrate the presence of any mechanism for repair of strand breaks operating within a fraction of a second. Strand breaks produced in the presence of oxygen were repaired in 30--40 sec, while breaks produced under anoxia were rejoined even slower. A functional product from the polAl gene was needed for the rejoining of the broken molecules. Intermediate levels of DNA strand breakage seen at low concentrations of oxygen are dependent on the concentration of cellular sulfhydryl compounds, suggesting that in strand breakage oxygen and hydrogen donors compete for reactions with radiation-induced transients in the DNA. Intercomparisons of data on radiation-induced lethality of cells and single-strand breaks in episomal DNA allow the distinction between two classes of radiation-induced radicals, R 1 and R 2 , with different chemical properties; R 1 reacts readily with oxygen and N-oxyls under formation of potentially lethal products. The reactivity of oxygen in this reaction is 30--40 times higher than that of TMPN. R 2 reacts 16 times more readily than R 1 with oxygen under formation of single-strand breaks in the DNA. R 2 does not react with N-oxyls

  6. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.


    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  7. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP


    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to


    NARCIS (Netherlands)



    In this paper we describe the isolation and characterization of single strand origins (SSOs) of several cryptic Bacillus subtilis plasmids which use the rolling-circle mechanism of replication, The plasmids used in this study involved pTA1015, pTA1020, pTA1030, pTA1040, pTA1050 and pTA1060, The SSO

  9. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast. (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A


    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  10. Intracellular generation of single-strand template increases the knock-in efficiency by combining CRISPR/Cas9 with AAV. (United States)

    Xiao, Qing; Min, Taishan; Ma, Shuangping; Hu, Lingna; Chen, Hongyan; Lu, Daru


    Targeted integration of transgenes facilitates functional genomic research and holds prospect for gene therapy. The established microhomology-mediated end-joining (MMEJ)-based strategy leads to the precise gene knock-in with easily constructed donor, yet the limited efficiency remains to be further improved. Here, we show that single-strand DNA (ssDNA) donor contributes to efficient increase of knock-in efficiency and establishes a method to achieve the intracellular linearization of long ssDNA donor. We identified that the CRISPR/Cas9 system is responsible for breaking double-strand DNA (dsDNA) of palindromic structure in inverted terminal repeats (ITRs) region of recombinant adeno-associated virus (AAV), leading to the inhibition of viral second-strand DNA synthesis. Combing Cas9 plasmids targeting genome and ITR with AAV donor delivery, the precise knock-in of gene cassette was achieved, with 13-14% of the donor insertion events being mediated by MMEJ in HEK 293T cells. This study describes a novel method to integrate large single-strand transgene cassettes into the genomes, increasing knock-in efficiency by 13.6-19.5-fold relative to conventional AAV-mediated method. It also provides a comprehensive solution to the challenges of complicated production and difficult delivery with large exogenous fragments.

  11. A study on interaction of DNA molecules and carbon nanotubes for an effective ejection of the molecules

    International Nuclear Information System (INIS)

    Wu, N.; Wang, Q.


    The ejection of DNA molecules from carbon nanotubes is reported from interaction energy perspectives by molecular dynamics simulations. The critical ejection energy, which is to be applied to a DNA molecule for a successful ejection from a carbon nanotube, is investigated based on a study on the friction and binding energy between the DNA molecule and the tube. An effective ejection is realized by subjecting a kinetic energy on the DNA molecule that is larger than the solved critical ejection energy. In addition, the relationship between ejection energies and sizes of DNA molecules and carbon nanotubes is investigated. -- Highlights: ► Report the ejection of DNA molecules from CNTs from interaction energy perspectives. ► Develop a methodology for the critical energy of an effective ejection of a DNA molecule from a CNT. ► Present the relationship between critical ejection energies and sizes of DNA molecules and CNTs. ► Provide a general guidance on the ejection of encapsulated molecules from CNTs.

  12. Normalized cDNA libraries (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris


    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  13. Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy. (United States)

    Hengel, Sarah R; Spies, M Ashley; Spies, Maria


    To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Single-Stranded Nucleic Acids Bind to the Tetramer Interface of SAMHD1 and Prevent Formation of the Catalytic Homotetramer. (United States)

    Seamon, Kyle J; Bumpus, Namandjé N; Stivers, James T


    Sterile alpha motif and HD domain protein 1 (SAMHD1) is a unique enzyme that plays important roles in nucleic acid metabolism, viral restriction, and the pathogenesis of autoimmune diseases and cancer. Although much attention has been focused on its dNTP triphosphohydrolase activity in viral restriction and disease, SAMHD1 also binds to single-stranded RNA and DNA. Here we utilize a UV cross-linking method using 5-bromodeoxyuridine-substituted oligonucleotides coupled with high-resolution mass spectrometry to identify the binding site for single-stranded nucleic acids (ssNAs) on SAMHD1. Mapping cross-linked amino acids on the surface of existing crystal structures demonstrated that the ssNA binding site lies largely along the dimer-dimer interface, sterically blocking the formation of the homotetramer required for dNTPase activity. Surprisingly, the disordered C-terminus of SAMHD1 (residues 583-626) was also implicated in ssNA binding. An interaction between this region and ssNA was confirmed in binding studies using the purified SAMHD1 583-626 peptide. Despite a recent report that SAMHD1 possesses polyribonucleotide phosphorylase activity, we did not detect any such activity in the presence of inorganic phosphate, indicating that nucleic acid binding is unrelated to this proposed activity. These data suggest an antagonistic regulatory mechanism in which the mutually exclusive oligomeric state requirements for ssNA binding and dNTP hydrolase activity modulate these two functions of SAMHD1 within the cell.

  15. Physical manipulation of single-molecule DNA using microbead and its application to analysis of DNA-protein interaction

    International Nuclear Information System (INIS)

    Kurita, Hirofumi; Yasuda, Hachiro; Takashima, Kazunori; Katsura, Shinji; Mizuno, Akira


    We carried out an individual DNA manipulation using an optical trapping for a microbead. This manipulation system is based on a fluorescent microscopy equipped with an IR laser. Both ends of linear DNA molecule were labeled with a biotin and a thiol group, respectively. Then the biotinylated end was attached to a microbead, and the other was immobilized on a thiol-linkable glass surface. We controlled the form of an individual DNA molecule by moving the focal point of IR laser, which trapped the microbead. In addition, we applied single-molecule approach to analyze DNA hydrolysis. We also used microchannel for single-molecule observation of DNA hydrolysis. The shortening of DNA in length caused by enzymatic hydrolysis was observed in real-time. The single-molecule DNA manipulation should contribute to elucidate detailed mechanisms of DNA-protein interactions

  16. Quantum-Sequencing: Fast electronic single DNA molecule sequencing (United States)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant


    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  17. Chromosomal aberrations and deoxyribonucleic acid single-strand breaks in adipose-derived stem cells during long-term expansion in vitro. (United States)

    Froelich, Katrin; Mickler, Johannes; Steusloff, Gudrun; Technau, Antje; Ramos Tirado, Mario; Scherzed, Agmal; Hackenberg, Stephan; Radeloff, Andreas; Hagen, Rudolf; Kleinsasser, Norbert


    Adipose-derived stem cells (ASCs) are a promising mesenchymal cell source for tissue engineering approaches. To obtain an adequate cell amount, in vitro expansion of the cells may be required in some cases. To monitor potential contraindications for therapeutic applications in humans, DNA strand breaks and chromosomal aberrations in ASCs during in vitro expansion were examined. After isolation of ASC from human lipoaspirates of seven patients, in vitro expansion over 10 passages was performed. Cells from passages 1, 2, 3, 5 and 10 were used for the alkaline single-cell microgel electrophoresis (comet) assay to detect DNA single-strand breaks and alkali labile as well as incomplete excision repair sites. Chromosomal changes were examined by means of the chromosomal aberration test. During in vitro expansion, ASC showed no DNA single-strand breaks in the comet assay. With the chromosomal aberration test, however, a significant increase in chromosomal aberrations were detected. The study showed that although no DNA fragmentation could be determined, the safety of ASC cannot be ensured with respect to chromosome stability during in vitro expansion. Thus, reliable analyses for detecting ASC populations, which accumulate chromosomal aberrations or even undergo malignant transformation during extensive in vitro expansion, must be implemented as part of the safety evaluation of these cells for stem cell-based therapy. Copyright © 2013 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  18. The Globular State of the Single-Stranded RNA: Effect of the Secondary Structure Rearrangements (United States)

    Grigoryan, Zareh A.; Karapetian, Armen T.


    The mutual influence of the slow rearrangements of secondary structure and fast collapse of the long single-stranded RNA (ssRNA) in approximation of coarse-grained model is studied with analytic calculations. It is assumed that the characteristic time of the secondary structure rearrangement is much longer than that for the formation of the tertiary structure. A nonequilibrium phase transition of the 2nd order has been observed. PMID:26345143

  19. The Globular State of the Single-Stranded RNA: Effect of the Secondary Structure Rearrangements

    Directory of Open Access Journals (Sweden)

    Zareh A. Grigoryan


    Full Text Available The mutual influence of the slow rearrangements of secondary structure and fast collapse of the long single-stranded RNA (ssRNA in approximation of coarse-grained model is studied with analytic calculations. It is assumed that the characteristic time of the secondary structure rearrangement is much longer than that for the formation of the tertiary structure. A nonequilibrium phase transition of the 2nd order has been observed.

  20. Comparison of the electrophoretic method with the sedimentation method for the analysis of DNA strand breaks

    International Nuclear Information System (INIS)

    Yamamoto, Osamu; Ogawa, Masaaki; Hoshi, Masaharu


    Application of electrophoresis to the analysis of DNA strand breaks was studied comparing with the sedimentation analysis. A BRL gel electrophoresis system (Type V16) was used for this study. Calf thymus DNA (1 mg/ml) irradiated with 60 Co gamma-rays in SSC solution was applied to both the electrophoretic analysis and the sedimentation analysis. Lamda phage DNA and its fragments were employed as the standard size molecules. In a range from 1 k base pairs to 6 k base pairs in length for double stranded DNA or from 2 k bases to 12 k bases for single stranded DNA, the calculated average molecular weight from the electrophoresis coincided with that from the sedimentation. Number of single strand breaks and double strand breaks were 1.34 x 10 11 breaks/mg/rad (G = 0.215) and 0.48 x 10 5 breaks/mg/rad 2 , respectively. (author)

  1. The interaction of linear and ring forms of DNA molecules with nanodiamonds synthesized by detonation

    International Nuclear Information System (INIS)

    Purtov, K V; Burakova, L P; Puzyr, A P; Bondar, V S


    Nanodiamonds synthesized by detonation have been found not to immobilize the ring form of pUC19 plasmid DNA. Linear pUC19 molecules with blunt ends, prepared by restriction of the initial ring form of pUC19 DNA, and linear 0.25-10 kb DNA fragments are adsorbed on nanodiamonds. The amount of adsorbed linear DNA molecules depends on the size of the molecules and the size of the nanodiamond clusters

  2. Theory of high-force DNA stretching and overstretching. (United States)

    Storm, C; Nelson, P C


    Single-molecule experiments on single- and double-stranded DNA have sparked a renewed interest in the force versus extension of polymers. The extensible freely jointed chain (FJC) model is frequently invoked to explain the observed behavior of single-stranded DNA, but this model does not satisfactorily describe recent high-force stretching data. We instead propose a model (the discrete persistent chain) that borrows features from both the FJC and the wormlike chain, and show that it resembles the data more closely. We find that most of the high-force behavior previously attributed to stretch elasticity is really a feature of the corrected entropic elasticity; the true stretch compliance of single-stranded DNA is several times smaller than that found by previous authors. Next we elaborate our model to allow coexistence of two conformational states of DNA, each with its own stretch and bend elastic constants. Our model is computationally simple and gives an excellent fit through the entire overstretching transition of nicked, double-stranded DNA. The fit gives the first value for the bend stiffness of the overstretched state. In particular, we find the effective bend stiffness for DNA in this state to be about 12 nm k(B)T, a value quite different from either the B-form or single-stranded DNA.

  3. Multiplex single-molecule interaction profiling of DNA barcoded proteins (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.


    In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

  4. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana


    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  5. mtSSB may sequester UNG1 at mitochondrial ssDNA and delay uracil processing until the dsDNA conformation is restored

    DEFF Research Database (Denmark)

    Wollen Steen, Kristian; Doseth, Berit; westbye, Marianne


    Single-strand DNA binding proteins protect DNA from nucleolytic damage, prevent formation of secondary structures and prevent premature reannealing of DNA in DNA metabolic transactions. In eukaryotes, the nuclear single-strand DNA binding protein RPA is essential for chromosomal DNA replication...

  6. Comparison of Whole-Cell SELEX Methods for the Identification of Staphylococcus Aureus-Specific DNA Aptamers


    Moon, Jihea; Kim, Giyoung; Park, Saet Byeol; Lim, Jongguk; Mo, Changyeun


    Whole-cell Systemic Evolution of Ligands by Exponential enrichment (SELEX) is the process by which aptamers specific to target cells are developed. Aptamers selected by whole-cell SELEX have high affinity and specificity for bacterial surface molecules and live bacterial targets. To identify DNA aptamers specific to Staphylococcus aureus, we applied our rapid whole-cell SELEX method to a single-stranded ssDNA library. To improve the specificity and selectivity of the aptamers, we designed, s...

  7. Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

    DEFF Research Database (Denmark)

    Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads


    Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so......-megabase- to megabase-sized DNA molecules were recovered from the gel and analysed by denaturation-renaturation optical mapping. Size-selected molecules from the same gel were sequenced by NGS. The optically mapped molecules and the NGS reads showed enrichment from regions defined by NotI restriction sites. We...... demonstrate that the unannotated genome can be characterized in a locus-specific manner via molecules partially overlapping with the annotated genome. The method is a promising tool for investigation of structural variants in enriched human genomic regions for both research and diagnostic purposes. Our...

  8. Electronic transport in single-helical protein molecules: Effects of multiple charge conduction pathways and helical symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Kundu, Sourav, E-mail:; Karmakar, S.N.


    We propose a tight-binding model to investigate electronic transport properties of single helical protein molecules incorporating both the helical symmetry and the possibility of multiple charge transfer pathways. Our study reveals that due to existence of both the multiple charge transfer pathways and helical symmetry, the transport properties are quite rigid under influence of environmental fluctuations which indicates that these biomolecules can serve as better alternatives in nanoelectronic devices than its other biological counterparts e.g., single-stranded DNA.

  9. Single DNA denaturation and bubble dynamics

    International Nuclear Information System (INIS)

    Metzler, Ralf; Ambjoernsson, Tobias; Hanke, Andreas; Fogedby, Hans C


    While the Watson-Crick double-strand is the thermodynamically stable state of DNA in a wide range of temperature and salt conditions, even at physiological conditions local denaturation bubbles may open up spontaneously due to thermal activation. By raising the ambient temperature, titration, or by external forces in single molecule setups bubbles proliferate until full denaturation of the DNA occurs. Based on the Poland-Scheraga model we investigate both the equilibrium transition of DNA denaturation and the dynamics of the denaturation bubbles with respect to recent single DNA chain experiments for situations below, at, and above the denaturation transition. We also propose a new single molecule setup based on DNA constructs with two bubble zones to measure the bubble coalescence and extract the physical parameters relevant to DNA breathing. Finally we consider the interplay between denaturation bubbles and selectively single-stranded DNA binding proteins.

  10. Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

    DEFF Research Database (Denmark)

    Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads


    Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so...

  11. Thermodynamics on Soluble Carbon Nanotubes: How Do DNA Molecules Replace Surfactants on Carbon Nanotubes? (United States)

    Kato, Yuichi; Inoue, Ayaka; Niidome, Yasuro; Nakashima, Naotoshi


    Here we represent thermodynamics on soluble carbon nanotubes that enables deep understanding the interactions between single-walled carbon nanotubes (SWNTs) and molecules. We selected sodium cholate and single-stranded cytosine oligo-DNAs (dCn (n = 4, 5, 6, 7, 8, 10, 15, and 20)), both of which are typical SWNT solubilizers, and successfully determined thermodynamic properties (ΔG, ΔH and ΔS values) for the exchange reactions of sodium cholate on four different chiralities of SWNTs ((n,m) = (6,5), (7,5), (10,2), and (8,6)) for the DNAs. Typical results contain i) the dC5 exhibited an exothermic exchange, whereas the dC6, 8, 10, 15, and 20 materials exhibited endothermic exchanges, and ii) the energetics of the dC4 and dC7 exchanges depended on the associated chiral indices and could be endothermic or exothermic. The presented method is general and is applicable to any molecule that interacts with nanotubes. The study opens a way for science of carbon nanotube thermodynamics. PMID:23066502

  12. Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules


    Buyukdagli, Sahin


    We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test charge theory to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the...

  13. Genetic exchanges caused by ultraviolet photoproducts in phage lamda DNA molecules: the role of DNA replication

    International Nuclear Information System (INIS)

    Lin, P.F.; Howard-Flanders, P.; Yale Univ., New Haven, Conn.


    Genetic recombination induced by structural damage in DNA molecules was investigated in E. coli K12(lamda) lysogens infected with genetically marked phage lamda. Photoproducts were induced in the phage DNA before infection by exposing them either to 313 nm light in the presence of acetophenone or to 254 nm light. To test the role of the replication of the damage phage DNA on the frequency of the induced recombination , both heteroimmune and homoimmune crosses were performed, and scored for P + recombinants. In heteroimmune crosses, recombination was less frequent in infected cells exposed to visible light and in wild type cells able to perform excision repair than in excision-defective lysogens. Therefore, much of the induced recombination can be attributed to the pyrimidine dimers in the phage DNA. In homoimmune crosses, replication of the phage DNA containing ultraviolet photoproducts was represented by lamda immunity, and was further blocked by the lack of the P gene product needed for replication. The 254 nm photoproducts increased the frequency of recombination in these homoimmune crosses, even though phage DNA replication was blocked. Irradiation with 313 nm light and acetophenone M, which produces dimers and unknown photoproducts, was not as effective per dimer as the 254 nm light. It is concluded from these results that certain unidentified 254 nm photoproducts can cause recombination even in the absence of DNA replication. They are not pyrimidine dimers, as they are not susceptible to excision repair or photoreactivation. In contrast, pyrimidine dimers appear to cause recombination only when the DNA containing them undergoes replication. (orig./MG) [de

  14. PARP inhibition versus PARP-1 silencing: different outcomes in terms of single-strand break repair and radiation susceptibility

    International Nuclear Information System (INIS)

    Godon, C.; Cordelieres, F.P.; Giocanti, N.; Megnin-Chanet, F.; Hall, J.; Favaudon, V.; Godon, C.; Giocanti, N.; Megnin-Chanet, F.; Hall, J.; Favaudon, V.; Cordelieres, F.P.; Cordelieres, F.P.; Biard, D.


    The consequences of PARP-1 disruption or inhibition on DNA single-strand break repair (SSBR) and radio-induced lethality were determined in synchronized, iso-genic HeLa cells stably silenced or not for poly(ADP-ribose) polymerase-1 (PARP-1) (PARP-1(KD)) or XRCC1 (XRCC1(KD)). PARP-1 inhibition prevented XRCC1-YFP recruitment at sites of 405 nm laser micro irradiation, slowed SSBR 10-fold and triggered the accumulation of large persistent foci of GFP-PARP-1 and GFP-PCNA at photo damaged sites. These aggregates are presumed to hinder the recruitment of other effectors of the base excision repair (BER) pathway.PARP-1 silencing also prevented XRCC1-YFP recruitment but did not lengthen the lifetime of GFP-PCNA foci. Moreover, PARP-1(KD) and XRCC1(KD) cells in S phase completed SSBR as rapidly as controls, while SSBR was delayed in G1. Taken together, the data demonstrate that a PARP-1- and XRCC1-independent SSBR pathway operates when the short patch repair branch of the BER is deficient. Long patch repair is the likely mechanism, as GFP-PCNA recruitment at photo-damaged sites was normal in PARP-1(KD) cells. PARP-1 silencing elicited hyper-radiosensitivity, while radiosensitization by a PARP inhibitor reportedly occurs only in those cells treated in S phase. PARP-1 inhibition and deletion thus have different outcomes in terms of SSBR and radiosensitivity. (authors)

  15. Distinct spatio temporal patterns and PARP dependence of XRCC1 recruitment to single-strand break and base excision repair

    International Nuclear Information System (INIS)

    Campalans, Anna; Kortulewski, Thierry; Amouroux, Rachel; Radicella, J. Pablo; Menoni, Herve; Vermeulen, Wim


    Single-strand break repair (SSBR) and base excision repair (BER) of modified bases and abasic sites share several players. Among them is XRCC1, an essential scaffold protein with no enzymatic activity, required for the coordination of both pathways. XRCC1 is recruited to SSBR by PARP-1, responsible for the initial recognition of the break. The recruitment of XRCC1 to BER is still poorly understood. Here we show by using both local and global induction of oxidative DNA base damage that XRCC1 participation in BER complexes can be distinguished from that in SSBR by several criteria. We show first that XRCC1 recruitment to BER is independent of PARP. Second, unlike SSBR complexes that are assembled within minutes after global damage induction, XRCC1 is detected later in BER patches, with kinetics consistent with the repair of oxidized bases. Third, while XRCC1-containing foci associated with SSBR are formed both in eu- and heterochromatin domains, BER complexes are assembled in patches that are essentially excluded from heterochromatin and where the oxidized bases are detected. (authors)

  16. Studying DNA Looping by Single-Molecule FRET


    Le, Tung T.; Kim, Harold D.


    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can als...

  17. Dynamics of DNA conformations and DNA-protein interaction

    DEFF Research Database (Denmark)

    Metzler, R.; Ambjörnsson, T.; Lomholt, Michael Andersen


    Optical tweezers, atomic force microscopes, patch clamping, or fluorescence techniques make it possible to study both the equilibrium conformations and dynamics of single DNA molecules as well as their interaction with binding proteins. In this paper we address the dynamics of local DNA...... denaturation (bubble breathing), deriving its dynamic response to external physical parameters and the DNA sequence in terms of the bubble relaxation time spectrum and the autocorrelation function of bubble breathing. The interaction with binding proteins that selectively bind to the DNA single strand exposed...... in a denaturation bubble are shown to involve an interesting competition of time scales, varying between kinetic blocking of protein binding up to full binding protein-induced denaturation of the DNA. We will also address the potential to use DNA physics for the design of nanosensors. Finally, we report recent...

  18. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.


    and does not represent a recent acquirement of the phage. The P1 and E. coli SSB proteins are fully functionally interchangeable. SSB-P1 is nonessential for phage growth in an exponentially growing E. coli host, and it is sufficient to promote bacterial growth in the absence of the E. coli SSB protein....... Expression studies showed that the P1 ssb gene is transcribed only, in an rpoS-independent fashion, during stationary-phase growth in E. coli. Mixed infection experiments demonstrated that a wild-type phage has a selective advantage over an ssb-null mutant when exposed to a bacterial host in the stationary...


    Arsenic (As) is a carcinogen whose most important target organs include the skin and lungs. Exposure can occur via water ingestion, or inhalation, as As is a by-product of fossil fuel combustion and other industrial activities. The carcinogenic mechanism of action for As remains ...

  20. PolyA Single Strand DNA Translocation Through an Alpha-Hemolysin Pore Stem (United States)

    OKeeffe, James; Cozmuta, Ioana; Stolc, Viktor


    A new model for the polymer-pore interaction energy is introduced, based on an atomic-scale description of coulombic polymer-pore interaction. The enhanced drift velocity, experimentally observed for short polymers, is successfully accounted for, using this interaction energy model. For R/R(sub 0)>4 (R(sub 0)=7 angstroms) the translocation velocity approaches the free space drift velocity v(sub 0). This motivates the need to appropriately derivatize artificial nanopores, where R>R(sub 0).

  1. A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B. (United States)

    DeGrasse, Jeffrey A


    The bacterium Staphylococcus aureus is a common foodborne pathogen capable of secreting a cocktail of small, stable, and strain-specific, staphylococcal enterotoxins (SEs). Staphylococcal food poisoning (SFP) results when improperly handled food contaminated with SEs is consumed. Gastrointestinal symptoms of SFP include emesis, diarrhea and severe abdominal pain, which manifest within hours of ingesting contaminated food. Immuno-affinity based methods directly detect, identify, and quantify several SEs within a food or clinical sample. However, the success of these assays depends upon the availability of a monoclonal antibody, the development of which is non-trivial and costly. The current scope of the available immuno-affinity based methods is limited to the classical SEs and does not encompass all of the known or emergent SEs. In contrast to antibodies, aptamers are short nucleic acids that exhibit high affinity and specificity for their targets without the high-costs and ethical concerns of animal husbandry. Further, researchers may choose to freely distribute aptamers and develop assays without the proprietary issues that increase the per-sample cost of immuno-affinity assays. This study describes a novel aptamer, selected in vitro, with affinity to staphylococcal enterotoxin B (SEB) that may be used in lieu of antibodies in SE detection assays. The aptamer, designated APT(SEB1), successfully isolates SEB from a complex mixture of SEs with extremely high discrimination. This work sets the foundation for future aptamer and assay development towards the entire family of SEs. The rapid, robust, and low-cost identification and quantification of all of the SEs in S. aureus contaminated food is essential for food safety and epidemiological efforts. An in vitro generated library of SE aptamers could potentially allow for the comprehensive and cost-effective analysis of food samples that immuno-affinity assays currently cannot provide.

  2. A Single-Stranded DNA Aptamer That Selectively Binds to Staphylococcus aureus Enterotoxin B


    DeGrasse, Jeffrey A.


    The bacterium Staphylococcus aureus is a common foodborne pathogen capable of secreting a cocktail of small, stable, and strain-specific, staphylococcal enterotoxins (SEs). Staphylococcal food poisoning (SFP) results when improperly handled food contaminated with SEs is consumed. Gastrointestinal symptoms of SFP include emesis, diarrhea and severe abdominal pain, which manifest within hours of ingesting contaminated food. Immuno-affinity based methods directly detect, identify, and quantify s...

  3. A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B.

    Directory of Open Access Journals (Sweden)

    Jeffrey A DeGrasse

    Full Text Available The bacterium Staphylococcus aureus is a common foodborne pathogen capable of secreting a cocktail of small, stable, and strain-specific, staphylococcal enterotoxins (SEs. Staphylococcal food poisoning (SFP results when improperly handled food contaminated with SEs is consumed. Gastrointestinal symptoms of SFP include emesis, diarrhea and severe abdominal pain, which manifest within hours of ingesting contaminated food. Immuno-affinity based methods directly detect, identify, and quantify several SEs within a food or clinical sample. However, the success of these assays depends upon the availability of a monoclonal antibody, the development of which is non-trivial and costly. The current scope of the available immuno-affinity based methods is limited to the classical SEs and does not encompass all of the known or emergent SEs. In contrast to antibodies, aptamers are short nucleic acids that exhibit high affinity and specificity for their targets without the high-costs and ethical concerns of animal husbandry. Further, researchers may choose to freely distribute aptamers and develop assays without the proprietary issues that increase the per-sample cost of immuno-affinity assays. This study describes a novel aptamer, selected in vitro, with affinity to staphylococcal enterotoxin B (SEB that may be used in lieu of antibodies in SE detection assays. The aptamer, designated APT(SEB1, successfully isolates SEB from a complex mixture of SEs with extremely high discrimination. This work sets the foundation for future aptamer and assay development towards the entire family of SEs. The rapid, robust, and low-cost identification and quantification of all of the SEs in S. aureus contaminated food is essential for food safety and epidemiological efforts. An in vitro generated library of SE aptamers could potentially allow for the comprehensive and cost-effective analysis of food samples that immuno-affinity assays currently cannot provide.

  4. Structural Transformation of Wireframe DNA Origami via DNA Polymerase Assisted Gap-Filling. (United States)

    Agarwal, Nayan P; Matthies, Michael; Joffroy, Bastian; Schmidt, Thorsten L


    The programmability of DNA enables constructing nanostructures with almost any arbitrary shape, which can be decorated with many functional materials. Moreover, dynamic structures can be realized such as molecular motors and walkers. In this work, we have explored the possibility to synthesize the complementary sequences to single-stranded gap regions in the DNA origami scaffold cost effectively by a DNA polymerase rather than by a DNA synthesizer. For this purpose, four different wireframe DNA origami structures were designed to have single-stranded gap regions. This reduced the number of staple strands needed to determine the shape and size of the final structure after gap filling. For this, several DNA polymerases and single-stranded binding (SSB) proteins were tested, with T4 DNA polymerase being the best fit. The structures could be folded in as little as 6 min, and the subsequent optimized gap-filling reaction was completed in less than 3 min. The introduction of flexible gap regions results in fully collapsed or partially bent structures due to entropic spring effects. Finally, we demonstrated structural transformations of such deformed wireframe DNA origami structures with DNA polymerases including the expansion of collapsed structures and the straightening of curved tubes. We anticipate that this approach will become a powerful tool to build DNA wireframe structures more material-efficiently, and to quickly prototype and test new wireframe designs that can be expanded, rigidified, or mechanically switched. Mechanical force generation and structural transitions will enable applications in structural DNA nanotechnology, plasmonics, or single-molecule biophysics.

  5. Injection molded nanofluidic chips: Fabrication method and functional tests using single-molecule DNA experiments

    DEFF Research Database (Denmark)

    Utko, Pawel; Persson, Karl Fredrik; Kristensen, Anders


    We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels.......We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels....

  6. Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules. (United States)

    Park, Suehyun; Joo, Heesun; Kim, Jun Soo


    Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

  7. Investigations of the conformation of DNA, native or alterated by irradiation, with ultraviolet radiation

    International Nuclear Information System (INIS)

    Zierenberg, B.


    An extension of the range of scattering angles in the direction of smaller angles (up to delta = 12 0 ) made it possible to successfully use the light scattering methods for the determination of DNA molecular weights >= 3 x 10 6 . In order to determine the conformation of native DNA in solution, different molecular weights were prepared by ultrasonic degradation. According to their hyperchromicity, these preparations are practically native. When native DNA in solution is irradiated with UV light of the wavelength lambda = 313 nm, two different photoreactions may occur: a) double and single strand breaks leading to degradation of the DNA molecule, and b) dimerisation of neighbouring thymine bases. The two reactions are independent of each other. In the presence of acetophenone as photosensitizer, the reaction type a) is greater by a factor 4 (in terms of single-strand breaks), while the reaction type b) is greater by a factor 16. The number of thymidine dimers per single strand break amounts to 100 for photosensitized reactions and to 25 for non-photosensitized reactions. The number of single strand breaks in terms of the quantum flux of 1 μ Einstein absorbed by the DNA is greater by a factor 3 during irradiation with UV light lambda = 254 nm as compared to the wavelength lambda = 313 nm. At this wavelength, DNA degradation starts at absorption energies as low as >= 2 x 10 7 erg/cm 3 . Light scattering and measurements with DNA containing thymidine dimers indicated neither a change in the total conformation nor a noticeable change in the microstructure. The hyperchromicity of the DNA was also unchanged. From these experimental results, it is concluded that the double helix of DNA is essentially stable to thymidine dimerisation. (orig./MG) [de

  8. Thermophoretic forces on DNA measured with a single-molecule spring balance

    DEFF Research Database (Denmark)

    Pedersen, Jonas Nyvold; Lüscher, Christopher James; Marie, Rodolphe


    We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement ....... We find the Soret coefficient per unit length of DNA at various ionic strengths. It agrees, with novel precision, with results obtained in bulk for DNA too short to shield itself and with the thermodynamic model of thermophoresis.......We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement...

  9. DNA origami as biocompatible surface to match single-molecule and ensemble experiments (United States)

    Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip


    Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

  10. Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters. (United States)

    Yadav, Hemendra; Sharma, Pulkit


    Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. The elastic theory of a single DNA molecule

    Indian Academy of Sciences (India)

    methods and Monte Carlo simulations to understand the entropic elasticity, ... DNA; elastic theory; stacking interaction; supercoiling; hairpin-coil transition. .... the probability distribution of t and ϕ along the DNA chain [14,15], is governed by.

  12. Kinetics of end-to-end collision in short single-stranded nucleic acids. (United States)

    Wang, Xiaojuan; Nau, Werner M


    A novel fluorescence-based method, which entails contact quenching of the long-lived fluorescent state of 2,3-diazabicyclo[2.2.2]-oct-2-ene (DBO), was employed to measure the kinetics of end-to-end collision in short single-stranded oligodeoxyribonucleotides of the type 5'-DBO-(X)n-dG with X = dA, dC, dT, or dU and n = 2 or 4. The fluorophore was covalently attached to the 5' end and dG was introduced as an efficient intrinsic quencher at the 3' terminus. The end-to-end collision rates, which can be directly related to the efficiency of intramolecular fluorescence quenching, ranged from 0.1 to 9.0 x 10(6) s(-1). They were strongly dependent on the strand length, the base sequence, as well as the temperature. Oligonucleotides containing dA in the backbone displayed much slower collision rates and significantly higher positive activation energies than strands composed of pyrimidine bases, suggesting a higher intrinsic rigidity of oligoadenylate. Comparison of the measured collision rates in short single-stranded oligodeoxyribonucleotides with the previously reported kinetics of hairpin formation indicates that the intramolecular collision is significantly faster than the nucleation step of hairpin closing. This is consistent with the configurational diffusion model suggested by Ansari et al. (Ansari, A.; Kuznetsov, S. V.; Shen, Y. Proc.Natl. Acad. Sci. USA 2001, 98, 7771-7776), in which the formation of misfolded loops is thought to slow hairpin formation.

  13. A Single-Molecule Barcoding System using Nanoslits for DNA Analysis (United States)

    Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.

    Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels

  14. Scanning a DNA molecule for bound proteins using hybrid magnetic and optical tweezers.

    Directory of Open Access Journals (Sweden)

    Marijn T J van Loenhout

    Full Text Available The functional state of the genome is determined by its interactions with proteins that bind, modify, and move along the DNA. To determine the positions and binding strength of proteins localized on DNA we have developed a combined magnetic and optical tweezers apparatus that allows for both sensitive and label-free detection. A DNA loop, that acts as a scanning probe, is created by looping an optically trapped DNA tether around a DNA molecule that is held with magnetic tweezers. Upon scanning the loop along the λ-DNA molecule, EcoRI proteins were detected with ~17 nm spatial resolution. An offset of 33 ± 5 nm for the detected protein positions was found between back and forwards scans, corresponding to the size of the DNA loop and in agreement with theoretical estimates. At higher applied stretching forces, the scanning loop was able to remove bound proteins from the DNA, showing that the method is in principle also capable of measuring the binding strength of proteins to DNA with a force resolution of 0.1 pN/[Formula: see text]. The use of magnetic tweezers in this assay allows the facile preparation of many single-molecule tethers, which can be scanned one after the other, while it also allows for direct control of the supercoiling state of the DNA molecule, making it uniquely suitable to address the effects of torque on protein-DNA interactions.

  15. Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging. (United States)

    Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C


    Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.

  16. Torsional regulation of hRPA-induced unwinding of double-stranded DNA

    NARCIS (Netherlands)

    De Vlaminck, I.; Vidic, I.; Van Loenhout, M.T.J.; Kanaar, R.; Lebbink, J.H.G.; Dekker, C.


    All cellular single-stranded (ss) DNA is rapidly bound and stabilized by single stranded DNA-binding proteins (SSBs). Replication protein A, the main eukaryotic SSB, is able to unwind double-stranded (ds) DNA by binding and stabilizing transiently forming bubbles of ssDNA. Here, we study the

  17. Single DNA molecules as probes for interrogating silica surfaces after various chemical treatments

    International Nuclear Information System (INIS)

    Liu Xia; Wu Zhan; Nie Huagui; Liu Ziling; He Yan; Yeung, E.S.


    We examined the adsorption of single YOYO-1-labeled λ-DNA molecules at glass surfaces after treatment with various chemical cleaning methods by using total internal reflection fluorescence microscopy (TIRFM). The characteristics of these surfaces were further assessed using contact angle (CA) measurements and atomic force microscopy (AFM). By recording the real-time dynamic motion of DNA molecules at the liquid/solid interface, subtle differences in adsorption affinities were revealed. The results indicate that the driving force for adsorption of DNA molecules on glass surfaces is mainly hydrophobic interaction. We also found that surface topography plays a role in the adsorption dynamics

  18. Alpha-Helical Fragaceatoxin C Nanopore Engineered for Double-Stranded and Single-Stranded Nucleic Acid Analysis

    NARCIS (Netherlands)

    Wloka, Carsten; Mutter, Natalie Lisa; Soskine, Misha; Maglia, Giovanni


    Nanopores are used in single-molecule DNA analysis and sequencing. Herein, we show that Fragaceatoxin C (FraC), an α-helical pore-forming toxin from an actinoporin protein family, can be reconstituted in sphingomyelin-free standard planar lipid bilayers. We engineered FraC for DNA analysis and show

  19. How to determine local stretching and tension in a flow-stretched DNA molecule

    DEFF Research Database (Denmark)

    Pedersen, Jonas Nyvold; Marie, Rodolphe; Kristensen, Anders


    We determine the nonuniform stretching of and tension in amega base pairs-long fragment of deoxyribonucleic acid (DNA) that is flow stretched in a nanofluidic chip. We use no markers, do not know the contour length of the DNA, and do not have the full DNA molecule inside our field of view. Instead......, we analyze the transverse thermal motion of the DNA. Tension at the center of the DNA adds up to 16 pN, giving almost fully stretched DNA. This method was devised for optical mapping of DNA, specifically, DNA denaturation patterns. It may be useful also for other studies, e.g., DNA......-protein interactions, specifically, their tension dependence. Generally, wherever long strands of DNA—e.g., native DNA extracted from human cells or bacteria—must be stretched with ease for inspection, this method applies....

  20. One-by-one single-molecule detection of mutated nucleobases by monitoring tunneling current using a DNA tip. (United States)

    Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu


    A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.

  1. Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases (United States)

    Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef


    Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

  2. Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

    KAUST Repository

    Hussain, Tanveer; Vovusha, Hakkim; Kaewmaraya, Thanayut; Amornkitbamrung, Vittaya; Ahuja, Rajeev


    Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory

  3. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir


    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  4. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark


    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  5. Probe Microscopic Studies of DNA Molecules on Carbon Nanotubes

    Directory of Open Access Journals (Sweden)

    Kazuo Umemura


    Full Text Available Hybrids of DNA and carbon nanotubes (CNTs are promising nanobioconjugates for nanobiosensors, carriers for drug delivery, and other biological applications. In this review, nanoscopic characterization of DNA-CNT hybrids, in particular, characterization by scanning probe microscopy (SPM, is summarized. In many studies, topographical imaging by atomic force microscopy has been performed. However, some researchers have demonstrated advanced SPM operations in order to maximize its unique and valuable functions. Such sophisticated approaches are attractive and will have a significant impact on future studies of DNA-CNT hybrids.

  6. Visual characterization and quantitative measurement of artemisinin-induced DNA breakage

    Energy Technology Data Exchange (ETDEWEB)

    Cai Huaihong [Bionanotechnology Lab, and Department of Chemistry, Jinan University, Guangzhou 510632 (China); Yang Peihui [Bionanotechnology Lab, and Department of Chemistry, Jinan University, Guangzhou 510632 (China)], E-mail:; Chen Jianan [Bionanotechnology Lab, and Department of Chemistry, Jinan University, Guangzhou 510632 (China); Liang Zhihong [Experiment and Technology Center, Jinan University, Guangzhou 510632 (China); Chen Qiongyu [Institute of Genetic Engineering, Jinan University, Guangzhou 510632 (China); Cai Jiye [Bionanotechnology Lab, and Department of Chemistry, Jinan University, Guangzhou 510632 (China)], E-mail:


    DNA conformational change and breakage induced by artemisinin, a traditional Chinese herbal medicine, have been visually characterized and quantitatively measured by the multiple tools of electrochemistry, UV-vis absorption spectroscopy, atomic force microscopy (AFM), and DNA electrophoresis. Electrochemical and spectroscopic results confirm that artemisinin can intercalate into DNA double helix, which causes DNA conformational changes. AFM imaging vividly demonstrates uneven DNA strand breaking induced by QHS interaction. To assess these DNA breakages, quantitative analysis of the extent of DNA breakage has been performed by analyzing AFM images. Basing on the statistical analysis, the occurrence of DNA breaks is found to depend on the concentration of artemisinin. DNA electrophoresis further validates that the intact DNA molecules are unwound due to the breakages occur at the single strands. A reliable scheme is proposed to explain the process of artemisinin-induced DNA cleavage. These results can provide further information for better understanding the anticancer activity of artemisinin.

  7. DNA-Based Single-Molecule Electronics: From Concept to Function. (United States)

    Wang, Kun


    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

  8. DNA-Based Single-Molecule Electronics: From Concept to Function (United States)


    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

  9. Effects of Environmental Factors and Metallic Electrodes on AC Electrical Conduction Through DNA Molecule. (United States)

    Abdalla, S; Obaid, A; Al-Marzouki, F M


    Deoxyribonucleic acid (DNA) is one of the best candidate materials for various device applications such as in electrodes for rechargeable batteries, biosensors, molecular electronics, medical- and biomedical-applications etc. Hence, it is worthwhile to examine the mechanism of charge transport in the DNA molecule, however, still a question without a clear answer is DNA a molecular conducting material (wire), semiconductor, or insulator? The answer, after the published data, is still ambiguous without any confirmed and clear scientific answer. DNA is found to be always surrounded with different electric charges, ions, and dipoles. These surrounding charges and electric barrier(s) due to metallic electrodes (as environmental factors (EFs)) play a substantial role when measuring the electrical conductivity through λ-double helix (DNA) molecule suspended between metallic electrodes. We found that strong frequency dependence of AC-complex conductivity comes from the electrical conduction of EFs. This leads to superimposing serious incorrect experimental data to measured ones. At 1 MHz, we carried out a first control experiment on electrical conductivity with and without the presence of DNA molecule. If there are possible electrical conduction due to stray ions and contribution of substrate, we will detected them. This control experiment revealed that there is an important role played by the environmental-charges around DNA molecule and any experiment should consider this role. We have succeeded to measure both electrical conductivity due to EFs (σ ENV ) and electrical conductivity due to DNA moleculeDNA ) independently by carrying the measurements at different DNA-lengths and subtracting the data. We carried out measurements as a function of frequency (f) and temperature (T) in the ranges 0.1 Hz molecule from all EFs effects that surround the molecule, but also to present accurate values of σ DNA and the dielectric constant of the molecule ε' DNA as a

  10. Early models of DNA damage formation

    International Nuclear Information System (INIS)

    Śmiałek, Małgorzata A


    Quantification of DNA damage, induced by various types of incident radiation as well as chemical agents, has been the subject of many theoretical and experimental studies, supporting the development of modern cancer therapy. The primary observations showed that many factors can lead to damage of DNA molecules. It became clear that the development of experimental techniques for exploring this phenomenon is required. Another problem was simultaneously dealt with, anticipating on how the damage is distributed within the double helix of the DNA molecule and how the single strand break formation and accumulation can influence the lethal double strand break formation. In this work the most important probabilistic models for DNA strand breakage and damage propagation are summarized and compared.

  11. Absolute determination of single-stranded and self-complementary adeno-associated viral vector genome titers by droplet digital PCR. (United States)

    Lock, Martin; Alvira, Mauricio R; Chen, Shu-Jen; Wilson, James M


    Accurate titration of adeno-associated viral (AAV) vector genome copies is critical for ensuring correct and reproducible dosing in both preclinical and clinical settings. Quantitative PCR (qPCR) is the current method of choice for titrating AAV genomes because of the simplicity, accuracy, and robustness of the assay. However, issues with qPCR-based determination of self-complementary AAV vector genome titers, due to primer-probe exclusion through genome self-annealing or through packaging of prematurely terminated defective interfering (DI) genomes, have been reported. Alternative qPCR, gel-based, or Southern blotting titering methods have been designed to overcome these issues but may represent a backward step from standard qPCR methods in terms of simplicity, robustness, and precision. Droplet digital PCR (ddPCR) is a new PCR technique that directly quantifies DNA copies with an unparalleled degree of precision and without the need for a standard curve or for a high degree of amplification efficiency; all properties that lend themselves to the accurate quantification of both single-stranded and self-complementary AAV genomes. Here we compare a ddPCR-based AAV genome titer assay with a standard and an optimized qPCR assay for the titration of both single-stranded and self-complementary AAV genomes. We demonstrate absolute quantification of single-stranded AAV vector genomes by ddPCR with up to 4-fold increases in titer over a standard qPCR titration but with equivalent readout to an optimized qPCR assay. In the case of self-complementary vectors, ddPCR titers were on average 5-, 1.9-, and 2.3-fold higher than those determined by standard qPCR, optimized qPCR, and agarose gel assays, respectively. Droplet digital PCR-based genome titering was superior to qPCR in terms of both intra- and interassay precision and is more resistant to PCR inhibitors, a desirable feature for in-process monitoring of early-stage vector production and for vector genome biodistribution

  12. Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation (United States)

    Zhang, Yuning; Reisner, Walter


    Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.

  13. Bio-recognitive photonics of a DNA-guided organic semiconductor (United States)

    Back, Seung Hyuk; Park, Jin Hyuk; Cui, Chunzhi; Ahn, Dong June


    Incorporation of duplex DNA with higher molecular weights has attracted attention for a new opportunity towards a better organic light-emitting diode (OLED) capability. However, biological recognition by OLED materials is yet to be addressed. In this study, specific oligomeric DNA-DNA recognition is successfully achieved by tri (8-hydroxyquinoline) aluminium (Alq3), an organic semiconductor. Alq3 rods crystallized with guidance from single-strand DNA molecules show, strikingly, a unique distribution of the DNA molecules with a shape of an `inverted' hourglass. The crystal's luminescent intensity is enhanced by 1.6-fold upon recognition of the perfect-matched target DNA sequence, but not in the case of a single-base mismatched one. The DNA-DNA recognition forming double-helix structure is identified to occur only in the rod's outer periphery. This study opens up new opportunities of Alq3, one of the most widely used OLED materials, enabling biological recognition.

  14. Bio-recognitive photonics of a DNA-guided organic semiconductor. (United States)

    Back, Seung Hyuk; Park, Jin Hyuk; Cui, Chunzhi; Ahn, Dong June


    Incorporation of duplex DNA with higher molecular weights has attracted attention for a new opportunity towards a better organic light-emitting diode (OLED) capability. However, biological recognition by OLED materials is yet to be addressed. In this study, specific oligomeric DNA-DNA recognition is successfully achieved by tri (8-hydroxyquinoline) aluminium (Alq3), an organic semiconductor. Alq3 rods crystallized with guidance from single-strand DNA molecules show, strikingly, a unique distribution of the DNA molecules with a shape of an 'inverted' hourglass. The crystal's luminescent intensity is enhanced by 1.6-fold upon recognition of the perfect-matched target DNA sequence, but not in the case of a single-base mismatched one. The DNA-DNA recognition forming double-helix structure is identified to occur only in the rod's outer periphery. This study opens up new opportunities of Alq3, one of the most widely used OLED materials, enabling biological recognition.

  15. Single-molecule analysis of DNA replication in Xenopus egg extracts

    NARCIS (Netherlands)

    Yardimci, Hasan; Loveland, Anna B.; van Oijen, Antoine M.; Walter, Johannes C.; Mechali, Marcel

    The recent advent in single-molecule imaging and manipulation methods has made a significant impact on the understanding of molecular mechanisms underlying many essential cellular processes. Single-molecule techniques such as electron microscopy and DNA fiber assays have been employed to study the

  16. Characterization of a novel single-stranded RNA mycovirus in pleurotus ostreatus

    International Nuclear Information System (INIS)

    Yu, Hyun Jae; Lim, Dongbin; Lee, Hyun-Sook


    A mycovirus, named oyster mushroom spherical virus (OMSV), was isolated from cultivated oyster mushrooms with a severe epidemic of oyster mushroom Die-back disease. OMSV was a 27-nm spherical virus encapsidating a single-stranded RNA (ssRNA) of 5.784 kb with a coat protein of approximately 28.5 kDa. The nucleotide sequence of the virus revealed that its genomic RNA was positive strand, containing 5784 bases with seven open reading frames (ORF). ORF1 had the motifs of RNA-dependent RNA polymerases (RdRp) and helicase. ORF2 encoded a coat protein. ORF3 to 7 could encode putative polypeptides of approximately 12, 12.5, 21, 14.5, and 23 kDa, respectively, but none of them showed significant similarity to any other known polypeptides. The 5' end of the viral RNA was uncapped and the 3' end was polyadenylated with 74 bases. Genomic structure and organization and the derived amino acid sequence of RdRp and helicase domain were similar to those of tymoviruses, a plant virus group

  17. Fragment-based modelling of single stranded RNA bound to RNA recognition motif containing proteins (United States)

    de Beauchene, Isaure Chauvot; de Vries, Sjoerd J.; Zacharias, Martin


    Abstract Protein-RNA complexes are important for many biological processes. However, structural modeling of such complexes is hampered by the high flexibility of RNA. Particularly challenging is the docking of single-stranded RNA (ssRNA). We have developed a fragment-based approach to model the structure of ssRNA bound to a protein, based on only the protein structure, the RNA sequence and conserved contacts. The conformational diversity of each RNA fragment is sampled by an exhaustive library of trinucleotides extracted from all known experimental protein–RNA complexes. The method was applied to ssRNA with up to 12 nucleotides which bind to dimers of the RNA recognition motifs (RRMs), a highly abundant eukaryotic RNA-binding domain. The fragment based docking allows a precise de novo atomic modeling of protein-bound ssRNA chains. On a benchmark of seven experimental ssRNA–RRM complexes, near-native models (with a mean heavy-atom deviation of <3 Å from experiment) were generated for six out of seven bound RNA chains, and even more precise models (deviation < 2 Å) were obtained for five out of seven cases, a significant improvement compared to the state of the art. The method is not restricted to RRMs but was also successfully applied to Pumilio RNA binding proteins. PMID:27131381

  18. Precise gene modification mediated by TALEN and single-stranded oligodeoxynucleotides in human cells.

    Directory of Open Access Journals (Sweden)

    Xiaoling Wang

    Full Text Available The development of human embryonic stem cells (ESCs and induced pluripotent stem cells (iPSCs facilitates in vitro studies of human disease mechanisms, speeds up the process of drug screening, and raises the feasibility of using cell replacement therapy in clinics. However, the study of genotype-phenotype relationships in ESCs or iPSCs is hampered by the low efficiency of site-specific gene editing. Transcription activator-like effector nucleases (TALENs spurred interest due to the ease of assembly, high efficiency and faithful gene targeting. In this study, we optimized the TALEN design to maximize its genomic cutting efficiency. We showed that using optimized TALENs in conjunction with single-strand oligodeoxynucleotide (ssODN allowed efficient gene editing in human cells. Gene mutations and gene deletions for up to 7.8 kb can be accomplished at high efficiencies. We established human tumor cell lines and H9 ESC lines with homozygous deletion of the microRNA-21 (miR-21 gene and miR-9-2 gene. These cell lines provide a robust platform to dissect the roles these genes play during cell differentiation and tumorigenesis. We also observed that the endogenous homologous chromosome can serve as a donor template for gene editing. Overall, our studies demonstrate the versatility of using ssODN and TALEN to establish genetically modified cells for research and therapeutic application.

  19. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong


    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  20. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks. (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P


    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  1. Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation. (United States)

    Izanloo, Cobra


    An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

  2. Probing Electron-Induced Bond Cleavage at the Single-Molecule Level Using DNA Origami Templates

    DEFF Research Database (Denmark)

    Keller, Adrian Clemens; Bald, Ilko; Rotaru, Alexandru


    Low-energy electrons (LEEs) play an important role in nanolithography, atmospheric chemistry, and DNA radiation damage. Previously, the cleavage of specific chemical bonds triggered by LEEs has been demonstrated in a variety of small organic molecules such as halogenated benzenes and DNA nucleoba...

  3. Tertiary Structures of the Escherichia coli and Human Chromosome 21 Molecules of DNA

    Czech Academy of Sciences Publication Activity Database

    Hanzálek, Petr; Kypr, Jaroslav


    Roč. 283, č. 1 (2001), s. 219-223 ISSN 0006-291X R&D Projects: GA AV ČR IAA5004802 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA crystal structures * phosphorus atom representation * genomic DNA molecules Subject RIV: BO - Biophysics Impact factor: 2.946, year: 2001

  4. Real-time single-molecule observation of rolling-circle DNA replication

    NARCIS (Netherlands)

    Tanner, Nathan A.; Loparo, Joseph J.; Hamdan, Samir M.; Jergic, Slobodan; Dixon, Nicholas E.; Oijen, Antoine M. van


    We present a simple technique for visualizing replication of individual DNA molecules in real time. By attaching a rolling-circle substrate to a TIRF microscope-mounted flow chamber, we are able to monitor the progression of single-DNA synthesis events and accurately measure rates and processivities

  5. Probing the Conformational Landscape of DNA Polymerases Using Diffusion-Based Single-Molecule FRET

    NARCIS (Netherlands)

    Hohlbein, J.; Kapanidis, A.N.


    Monitoring conformational changes in DNA polymerases using single-molecule Förster resonance energy transfer (smFRET) has provided new tools for studying fidelity-related mechanisms that promote the rejection of incorrect nucleotides before DNA synthesis. In addition to the previously known open

  6. See me, feel me: methods to concurrently visualize and manipulate single DNA molecules and associated proteins

    NARCIS (Netherlands)

    van Mameren, J.; Peterman, E.J.G.; Wuite, G.J.L.


    Direct visualization of DNA and proteins allows researchers to investigate DNA-protein interactions with great detail. Much progress has been made in this area as a result of increasingly sensitive single-molecule fluorescence techniques. At the same time, methods that control the conformation of

  7. Structure of DNA-Functionalized Dendrimer Nanoparticles


    Kumar, Mattaparthi Venkata Satish; Maiti, Prabal K


    Atomistic molecular dynamics simulations have been carried out to reveal the characteristic features of ethylenediamine (EDA) cored protonated poly amido amine (PAMAM) dendrimers of generation 3 (G3) and 4 (G4) that are functionalized with single stranded DNAs (ssDNAs). The four ssDNA strands that are attached via alkythiolate [-S (CH2)6-] linker molecule to the free amine groups on the surface of the PAMAM dendrimers observed to undergo a rapid conformational change during the 25 ns long sim...

  8. A 3D-DNA Molecule Made of PlayMais (United States)

    Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl


    More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

  9. Biophysics of DNA-Protein Interactions From Single Molecules to Biological Systems

    CERN Document Server

    Williams, Mark C


    This book presents a concise overview of current research on the biophysics of DNA-protein interactions. A wide range of new and classical methods are presented by authors investigating physical mechanisms by which proteins interact with DNA. For example, several chapters address the mechanisms by which proteins search for and recognize specific binding sites on DNA, a process critical for cellular function. Single molecule methods such as force spectroscopy as well as fluorescence imaging and tracking are described in these chapters as well as other parts of the book that address the dynamics of protein-DNA interactions. Other important topics include the mechanisms by which proteins engage DNA sequences and/or alter DNA structure. These simple but important model interactions are then placed in the broader biological context with discussion of larger protein-DNA complexes . Topics include replication forks, recombination complexes, DNA repair interactions, and ultimately, methods to understand the chromatin...

  10. The cell pole: the site of cross talk between the DNA uptake and genetic recombination machinery. (United States)

    Kidane, Dawit; Ayora, Silvia; Sweasy, Joann B; Graumann, Peter L; Alonso, Juan C


    Natural transformation is a programmed mechanism characterized by binding of free double-stranded (ds) DNA from the environment to the cell pole in rod-shaped bacteria. In Bacillus subtilis some competence proteins, which process the dsDNA and translocate single-stranded (ss) DNA into the cytosol, recruit a set of recombination proteins mainly to one of the cell poles. A subset of single-stranded binding proteins, working as "guardians", protects ssDNA from degradation and limit the RecA recombinase loading. Then, the "mediators" overcome the inhibitory role of guardians, and recruit RecA onto ssDNA. A RecA·ssDNA filament searches for homology on the chromosome and, in a process that is controlled by "modulators", catalyzes strand invasion with the generation of a displacement loop (D-loop). A D-loop resolvase or "resolver" cleaves this intermediate, limited DNA replication restores missing information and a DNA ligase seals the DNA ends. However, if any step fails, the "rescuers" will repair the broken end to rescue chromosomal transformation. If the ssDNA does not share homology with resident DNA, but it contains information for autonomous replication, guardian and mediator proteins catalyze plasmid establishment after inhibition of RecA. DNA replication and ligation reconstitute the molecule (plasmid transformation). In this review, the interacting network that leads to a cross talk between proteins of the uptake and genetic recombination machinery will be placed into prospective.

  11. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D


    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  12. [Lethal effect after transmutation of 33P incorporated into bacteriophage S 13 and mechanisms of DNA double helix rupture]. (United States)

    Apelgot, S


    The experiments show the lethal effect of the beta decay of 33P incorporated in DNA of bacteriophage S 13. The lethal efficiency is high, 0.72 at 0 degrees C and 0.55 at--197 degrees C. The presence of a radical scavenger like AET has no influence. It was found previously that for such phages with single-stranded DNA, the lethal efficiency of 32P decay is unity, and that the lethal event is a DNA single-strand break, owing to the high energy of the nucleogenic 32S atom. As the recoil energy of the 33S atom is too low to account for such a break, it is suggested that the reorganization of the phosphate molecule into sulphate is able to bring about a DNA single-strand break with an efficiency as high as 0.7, at 0 degrees C. A model for the DNA double-strand-break produced by a transmutation processes is suggested.

  13. Separation and Characterization of DNA Molecules and Intermolecular Interactions in Pressure-Driven Micro Flow (United States)

    Friedrich, Sarah; Wang, Tza-Huei

    Pressure-driven flow in micron-sized diameter capillaries can be used to separate DNA molecules by size in a technique called Free Solution Hydrodynamic Separation. By coupling this technique with Cylindrical Illumination Confocal Spectroscopy, we have developed a highly sensitive and quantitative platform capable of separating DNA molecules by length over a large dynamic range (25 bp to 48 kbp) in a single run using only picoliters or femtograms of a DNA sample. The optical detection volume completely spans the capillary cross section, enabling highly efficient single molecule detection for enhanced sensitivity and quantification accuracy via single molecule counting. Because each DNA molecule generates its own fluorescent burst, these burst profiles can be further analyzed to individually characterize each DNA molecule's shape as it passes through the detection region. We exploit these burst profiles to visualize fluctuations in conformation under shear flow in microcapillaries, and utilizing combined mobility shift analysis, explore the complex relationship between molecular properties including length and conformation, hydrodynamic mobility, solution conditions including ion species and concentrations, and separation conditions including flow rate and capillary diameter.

  14. Electrochemical single-molecule conductivity of duplex and quadruplex DNA

    DEFF Research Database (Denmark)

    Zhang, Ling; Zhang, Jingdong; Ulstrup, Jens


    Photoinduced and electrochemical charge transport in DNA (oligonucleotides, OGNs) and the notions “hopping”, superexchange, polaron, and vibrationally gated charge transport have been in focus over more than two decades. In recent years mapping of electrochemical charge transport of pure and redo...

  15. DNA minor groove binding of small molecules: Experimental and ...

    Indian Academy of Sciences (India)


    Abstract. Eight indole derivatives were studied for their DNA binding ability using fluorescence quenching and molecular docking methods. These indole compounds have structural moieties similar as in few indole alkaloids. Experimental and theoretical studies have suggested that indole derivatives bind in the minor ...

  16. Radioprotection of DNA molecule by oxido-reduction's coenzymes

    International Nuclear Information System (INIS)

    Araos, M.S.; Fernandez, M.; Tomicic, I.; Toha, J.C.


    The radio protective action of respiratory coenzymes on DNA-water solutions is studied after irradiation with a 60 Co source. Coenzymes were used separately or in mixtures of their oxidized and reduced forms. The dose relative factor (DRF) values evaluated by uv absorbancy measurements of DNA damage were high: 18.03 for the (NAD-FAD-quinone) mixture (a respiratory chain model); 14.91 for (quinone-hydroquinone) mixtures; 14.46 for quinone; 14.27 for hydroquinone; 12.49 for FAD; 7.21 for the (NAD-NADH) mixture; 6.48 for NADH and 3.79 for NAD. No parallelism was found between the DNA coenzymes strong interactions and their protective action, performed by overcoming the indirect radiation damage. Besides, uv irradiation studies give no support to protection through direct energy transfer processes from excited DNA to coenzymes. The high efficiency of the mixtures of oxidized-reduced respiratory coenzymes is discussed in terms of simultaneous and equivalent trapping of recombinable radicals. The high tolerance of these protectors in living cells is emphasized. (author)

  17. Morse potential in DNA molecule – An experiment proposal

    Indian Academy of Sciences (India)


    Jul 27, 2012 ... We rely on the helicoidal Peyrard-Bishop model for DNA dynamics. Interaction between nucleotides at a same site belonging to different strands is modelled by a Morse potential energy. This potential depends on two parameters that are different for AT and CG pairs, which is a possible source for ...

  18. Molecular mechanisms of DNA photodamage

    Energy Technology Data Exchange (ETDEWEB)

    Starrs, S.M


    Photodamage in DNA, caused by ultraviolet (UV) light, can occur by direct excitation of the nucleobases or indirectly via the action of photosensitisers. Such, DNA photodamage can be potentially mutagenic or lethal. Among the methods available for detecting UV-induced DNA damage, gel sequencing protocols, utilising synthetic oligodeoxyribonucleotides as targets for UV radiation, allow photolesions to be mapped at nucleotide resolution. This approach has been applied to investigate both DNA damage mechanisms. Following a general overview of DNA photoreactivity, and a description of the main experimental procedures, Chapter 3 identifies the origin of an anomalous mobility shift observed in purine chemical sequence ladders that can confuse the interpretation of DNA cleavage results; measures to abolish this shift are also described. Chapters 4 and 5 examine the alkali-labile DNA damage photosensitised by representative nonsteroidal antiinflammatory drugs (NSAIDs) and the fluoroquinolone antibiotics. Suprofen was the most photoactive NSAID studied, producing different patterns of guanine-specific damage in single-stranded and duplex DNA. Uniform modification of guanine bases, typifying attack by singlet oxygen, was observed in single-stranded oligodeoxyribonucleotides. In duplex molecules, modification was limited to the 5'-G of GG doublets, which is indicative of an electron transfer. The effect of quenchers and photoproduct analysis substantiated these findings. The quinolone, nalidixic acid, behaves similarly. The random base cleavage photosensitised by the fluoroquinolones, has been attributed to free radicals produced during their photodecomposition. Chapter 6 addresses the photoreactivity of purines within unusual DNA structures formed by the repeat sequences (GGA){sub n} and (GA){sub n}, and a minihairpin. There was no definitive evidence for enhanced purine reactivity caused by direct excitation. Finally, Chapter 7 investigates the mutagenic potential of a

  19. Molecular mechanisms of DNA photodamage

    International Nuclear Information System (INIS)

    Starrs, S.M.


    Photodamage in DNA, caused by ultraviolet (UV) light, can occur by direct excitation of the nucleobases or indirectly via the action of photosensitisers. Such, DNA photodamage can be potentially mutagenic or lethal. Among the methods available for detecting UV-induced DNA damage, gel sequencing protocols, utilising synthetic oligodeoxyribonucleotides as targets for UV radiation, allow photolesions to be mapped at nucleotide resolution. This approach has been applied to investigate both DNA damage mechanisms. Following a general overview of DNA photoreactivity, and a description of the main experimental procedures, Chapter 3 identifies the origin of an anomalous mobility shift observed in purine chemical sequence ladders that can confuse the interpretation of DNA cleavage results; measures to abolish this shift are also described. Chapters 4 and 5 examine the alkali-labile DNA damage photosensitised by representative nonsteroidal antiinflammatory drugs (NSAIDs) and the fluoroquinolone antibiotics. Suprofen was the most photoactive NSAID studied, producing different patterns of guanine-specific damage in single-stranded and duplex DNA. Uniform modification of guanine bases, typifying attack by singlet oxygen, was observed in single-stranded oligodeoxyribonucleotides. In duplex molecules, modification was limited to the 5'-G of GG doublets, which is indicative of an electron transfer. The effect of quenchers and photoproduct analysis substantiated these findings. The quinolone, nalidixic acid, behaves similarly. The random base cleavage photosensitised by the fluoroquinolones, has been attributed to free radicals produced during their photodecomposition. Chapter 6 addresses the photoreactivity of purines within unusual DNA structures formed by the repeat sequences (GGA) n and (GA) n , and a minihairpin. There was no definitive evidence for enhanced purine reactivity caused by direct excitation. Finally, Chapter 7 investigates the mutagenic potential of a dimeric

  20. Conjugation of Organic Molecules to DNA and Their Application in DNA Nanotechnology

    DEFF Research Database (Denmark)

    Olsen, Eva Maria


    Denne PhD afhandling præsenterer fire kapitler, som omhandler det videnskabelige område DNA nanoteknologi. Kapitel 1 er en general introduktion til DNA nanoteknologi, som først beskriver opbygningen af DNA og efter flere underkapitler slutter med en gennemgang af nogle fantastiske dynamiske DNA s...

  1. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p: reinterpretation of recent single molecule experiments. (United States)

    Stigter, Dirk


    Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).

  2. Decreased stability of DNA in cells treated with alkylating agents

    Energy Technology Data Exchange (ETDEWEB)

    Frankfurt, O.S. (Cedars Medical Center, Miami, FL (United States))


    A modified highly sensitive procedure for the evaluation of DNA damage in individual cells treated with alkylating agents is reported. The new methodology is based on the amplification of single-strandedness in alkylated DNA by heating in the presence of Mg{sup 2+}. Human ovarian carcinoma cells A2780 were treated with nitrogen mustard (HN2), fixed in methanol, and stained with monoclonal antibody (MOAB) F7-26 generated against HN2-treated DNA. Binding of MOAB was measured by flow cytometry with indirect immunofluorescence. Intensive binding of MOAB to control and drug-treated cells was observed after heating in Tris buffer supplemented with MgCl{sub 2}. Thus, the presence of phosphates and MgCl{sub 2} during heating was necessary for the detection of HN2-induced changes in DNA stability. Fluorescence of HN2-treated cells decreased to background levels after treatment with single-strand-specific S{sub 1} nuclease. MOAB F7-26 interacted with single-stranded regions in DNA and did not bind to dsDNA or other cellular antigens. It is suggested that alkylation of guanines decreased the stability of the DNA molecule and increased the access of MOAB F7-26 to deoxycytidines on the opposite DNA strand.

  3. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses. (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn


    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  4. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide


    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  5. Direct squencing from the minimal number of DNA molecules needed to fill a 454 picotiterplate.

    Directory of Open Access Journals (Sweden)

    Mária Džunková

    Full Text Available The large amount of DNA needed to prepare a library in next generation sequencing protocols hinders direct sequencing of small DNA samples. This limitation is usually overcome by the enrichment of such samples with whole genome amplification (WGA, mostly by multiple displacement amplification (MDA based on φ29 polymerase. However, this technique can be biased by the GC content of the sample and is prone to the development of chimeras as well as contamination during enrichment, which contributes to undesired noise during sequence data analysis, and also hampers the proper functional and/or taxonomic assignments. An alternative to MDA is direct DNA sequencing (DS, which represents the theoretical gold standard in genome sequencing. In this work, we explore the possibility of sequencing the genome of Escherichia coli fs 24 from the minimum number of DNA molecules required for pyrosequencing, according to the notion of one-bead-one-molecule. Using an optimized protocol for DS, we constructed a shotgun library containing the minimum number of DNA molecules needed to fill a selected region of a picotiterplate. We gathered most of the reference genome extension with uniform coverage. We compared the DS method with MDA applied to the same amount of starting DNA. As expected, MDA yielded a sparse and biased read distribution, with a very high amount of unassigned and unspecific DNA amplifications. The optimized DS protocol allows unbiased sequencing to be performed from samples with a very small amount of DNA.

  6. Control of DNA strand displacement kinetics using toehold exchange. (United States)

    Zhang, David Yu; Winfree, Erik


    DNA is increasingly being used as the engineering material of choice for the construction of nanoscale circuits, structures, and motors. Many of these enzyme-free constructions function by DNA strand displacement reactions. The kinetics of strand displacement can be modulated by toeholds, short single-stranded segments of DNA that colocalize reactant DNA molecules. Recently, the toehold exchange process was introduced as a method for designing fast and reversible strand displacement reactions. Here, we characterize the kinetics of DNA toehold exchange and model it as a three-step process. This model is simple and quantitatively predicts the kinetics of 85 different strand displacement reactions from the DNA sequences. Furthermore, we use toehold exchange to construct a simple catalytic reaction. This work improves the understanding of the kinetics of nucleic acid reactions and will be useful in the rational design of dynamic DNA and RNA circuits and nanodevices.

  7. Lingering single-strand breaks trigger Rad51-independent homology-directed repair of collapsed replication forks in the polynucleotide kinase/phosphatase mutant of fission yeast.

    Directory of Open Access Journals (Sweden)

    Arancha Sanchez


    Full Text Available The DNA repair enzyme polynucleotide kinase/phosphatase (PNKP protects genome integrity by restoring ligatable 5'-phosphate and 3'-hydroxyl termini at single-strand breaks (SSBs. In humans, PNKP mutations underlie the neurological disease known as MCSZ, but these individuals are not predisposed for cancer, implying effective alternative repair pathways in dividing cells. Homology-directed repair (HDR of collapsed replication forks was proposed to repair SSBs in PNKP-deficient cells, but the critical HDR protein Rad51 is not required in PNKP-null (pnk1Δ cells of Schizosaccharomyces pombe. Here, we report that pnk1Δ cells have enhanced requirements for Rad3 (ATR/Mec1 and Chk1 checkpoint kinases, and the multi-BRCT domain protein Brc1 that binds phospho-histone H2A (γH2A at damaged replication forks. The viability of pnk1Δ cells depends on Mre11 and Ctp1 (CtIP/Sae2 double-strand break (DSB resection proteins, Rad52 DNA strand annealing protein, Mus81-Eme1 Holliday junction resolvase, and Rqh1 (BLM/WRN/Sgs1 DNA helicase. Coupled with increased sister chromatid recombination and Rad52 repair foci in pnk1Δ cells, these findings indicate that lingering SSBs in pnk1Δ cells trigger Rad51-independent homology-directed repair of collapsed replication forks. From these data, we propose models for HDR-mediated tolerance of persistent SSBs with 3' phosphate in pnk1Δ cells.

  8. A Polypeptide-DNA Hybrid with Selective Linking Capability Applied to Single Molecule Nano-Mechanical Measurements Using Optical Tweezers

    NARCIS (Netherlands)

    Moayed, F.; Mashaghi, A.; Tans, S.J.


    Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an

  9. Droplet Microfluidics Approach for Single-DNA Molecule Amplification and Condensation into DNA-Magnesium-Pyrophosphate Particles

    Directory of Open Access Journals (Sweden)

    Greta Zubaite


    Full Text Available Protein expression in vitro has broad applications in directed evolution, synthetic biology, proteomics and drug screening. However, most of the in vitro expression systems rely on relatively high DNA template concentrations to obtain sufficient amounts of proteins, making it harder to perform in vitro screens on gene libraries. Here, we report a technique for the generation of condensed DNA particles that can serve as efficient templates for in vitro gene expression. We apply droplet microfluidics to encapsulate single-DNA molecules in 3-picoliter (pL volume droplets and convert them into 1 μm-sized DNA particles by the multiple displacement amplification reaction driven by phi29 DNA polymerase. In the presence of magnesium ions and inorganic pyrophosphate, the amplified DNA condensed into the crystalline-like particles, making it possible to purify them from the reaction mix by simple centrifugation. Using purified DNA particles, we performed an in vitro transcription-translation reaction and successfully expressed complex enzyme β-galactosidase in droplets and in the 384-well format. The yield of protein obtained from DNA particles was significantly higher than from the corresponding amount of free DNA templates, thus opening new possibilities for high throughput screening applications.

  10. Near-Complete Genome Sequence of a Novel Single-Stranded RNA Virus Discovered in Indoor Air. (United States)

    Rosario, Karyna; Fierer, Noah; Breitbart, Mya


    Viral metagenomic analysis of heating, ventilation, and air conditioning (HVAC) filters recovered the near-complete genome sequence of a novel virus, named HVAC-associated R NA v irus 1 (HVAC-RV1). The HVAC-RV1 genome is most similar to those of picorna-like viruses identified in arthropods but encodes a small domain observed only in negative-sense single-stranded RNA viruses. Copyright © 2018 Rosario et al.

  11. Normal formation and repair of γ-radiation-induced single and double strand DNA breaks in Down syndrome fibroblasts

    International Nuclear Information System (INIS)

    Steiner, M.E.; Woods, W.G.


    Fibroblasts from patients with Down syndrome (Trisomy 21) were examined for repair capability of γ-radiation-induced single strand and double strand DNA breaks. Formation and repair of DNA breaks were determined by DNA alkaline and non-denaturing elution techniques. Down syndrome fibroblasts were found to repair single strand and double strand breaks as well as fibroblasts from normal controls. (orig.)

  12. Conformational Diversity of Single-Stranded DNA from Bacterial Repetitive Extragenic Palindromes: Implications for the DNA Recognition Elements of Transposases

    Czech Academy of Sciences Publication Activity Database

    Charnavets, Tatsiana; Nunvář, Jaroslav; Nečasová, Iva; Voelker, J.; Breslauer, K.J.; Schneider, Bohdan


    Roč. 103, č. 10 (2015), s. 585-596 ISSN 0006-3525 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109; GA ČR GAP305/12/1801; GA MŠk(CZ) EE2.3.30.0020 Institutional support: RVO:86652036 Keywords : bacterial repetitive extragenic palindromes (REP) * circular dichroism spectroscopy * REP associated tyrosine transposases (RAYTs) Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.248, year: 2015

  13. DNA Origami: Folded DNA-Nanodevices That Can Direct and Interpret Cell Behavior (United States)

    Kearney, Cathal J.; Lucas, Christopher R.; O'Brien, Fergal J.; Castro, Carlos E.


    DNA origami is a DNA-based nanotechnology that utilizes programmed combinations of short complementary oligonucleotides to fold a large single strand of DNA into precise 2-D and 3-D shapes. The exquisite nanoscale shape control of this inherently biocompatible material is combined with the potential to spatially address the origami structures with diverse cargos including drugs, antibodies, nucleic acid sequences, small molecules and inorganic particles. This programmable flexibility enables the fabrication of precise nanoscale devices that have already shown great potential for biomedical applications such as: drug delivery, biosensing and synthetic nanopore formation. In this Progress Report, we will review the advances in the DNA origami field since its inception several years ago and then focus on how these DNA-nanodevices can be designed to interact with cells to direct or probe their behavior. PMID:26840503

  14. Role of electrostatics in the assembly pathway of a single-stranded RNA virus. (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M


    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  15. Electrochemical label-free and sensitive nanobiosensing of DNA hybridization by graphene oxide modified pencil graphite electrode. (United States)

    Ahour, F; Shamsi, A


    Based on the strong interaction between single-stranded DNA (ss-DNA) and graphene material, we have constructed a novel label-free electrochemical biosensor for rapid and facile detection of short sequences ss-DNA molecules related to hepatitis C virus 1a using graphene oxide modified pencil graphite electrode. The sensing mechanism is based on the superior adsorption of single-stranded DNA to GO over double stranded DNA (ds-DNA). The intrinsic guanine oxidation signal measured by differential pulse voltammetry (DPV) has been used for duplex DNA formation detection. The probe ss-DNA adsorbs onto the surface of GO via the π- π* stacking interactions leading to a strong background guanine oxidation signal. In the presence of complementary target, formation of helix which has weak binding ability to GO induced ds-DNA to release from the electrode surface and significant variation in differential pulse voltammetric response of guanine bases. The results indicated that the oxidation peak current was proportional to the concentration of complementary strand in the range of 0.1 nM-0.5 μM with a detection limit of 4.3 × 10 -11  M. The simple fabricated electrochemical biosensor has high sensitivity, good selectivity, and could be applied as a new platform for a range of target molecules in future. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments (United States)

    Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.


    We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.

  17. [The effect of spermine on acid-base equilibrium in DNA molecule]. (United States)

    Slonitskiĭ, S V; Kuptsov, V Iu


    The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.

  18. A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. (United States)

    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan


    The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

  19. DNA-templated synthesis of Pt nanoparticles on single-walled carbon nanotubes. (United States)

    Dong, Lifeng


    A series of electron microscopy characterizations demonstrate that single-stranded deoxyribonucleic acid (ssDNA) can bind to nanotube surfaces and disperse bundled single-walled carbon nanotubes (SWCNTs) into individual tubes. The ssDNA molecules on the nanotube surfaces demonstrate various morphologies, such as aggregated clusters and spiral wrapping around a nanotube with different pitches and spaces, indicating that the morphology of the SWCNT/DNA hybrids is not related solely to the base sequence of the ssDNA or the chirality or the diameter of the nanotubes. In addition to serving as a non-covalent dispersion agent, the ssDNA molecules bonded to the nanotube surface can provide addresses for localizing Pt(II) complexes along the nanotubes. The Pt nanoparticles obtained by a reduction of the Pt2+-DNA adducts are crystals with a size of direct ethanol/methanol fuel cells and nanoscale electronics.

  20. DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences. (United States)

    Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas


    DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

  1. Sequence specificity of alkali-labile DNA damage photosensitized by suprofen. (United States)

    Starrs, S M; Davies, R J


    On irradiation at UVB wavelengths, in aerated neutral aqueous solution, the anti-inflammatory drug suprofen (SP) photosensitizes the production of alkali-labile cleavage sites in DNA much more efficiently than direct strand breaks. It is active at submillimolar concentrations despite having no significant binding affinity for DNA. Gel sequencing studies utilizing 32P-end-labeled oligonucleotides have revealed that piperidine-sensitive lesions are formed predominantly at the positions of guanine (G) bases, with the extent of modification being UV dose- and SP concentration-dependent. Quite distinct patterns of G-specific damage are observed in single-stranded and duplex DNA molecules. The uniform attack at all G residues in single-stranded DNA, which is enhanced in D2O, is compatible with a Type-II mechanism. SP is a known generator of singlet oxygen whose participation in the reaction is supported by the effects of quenchers and scavengers. In duplex DNA, piperidine-induced cleavage occurs with high selectivity at the 5'-G of GG and (less prominently) GA doublets. This behavior is characteristic of a Type-I process involving electron transfer from DNA to photoexcited SP molecules. The ability of SP to sensitize the formation of Type-I and Type-II photo-oxidation products from 2'-deoxyguanosine attests to the feasibility of competing mechanisms in DNA.

  2. In Vitro Selection and Characterization of DNA Aptamers to a Small Molecule Target. (United States)

    Ruscito, Annamaria; McConnell, Erin M; Koudrina, Anna; Velu, Ranganathan; Mattice, Christopher; Hunt, Vernon; McKeague, Maureen; DeRosa, Maria C


    Aptamers, synthetic oligonucleotide-based molecular recognition probes, have found use in a wide array of biosensing technologies based on their tight and highly selective binding to a variety of molecular targets. However, the inherent challenges associated with the selection and characterization of aptamers for small molecule targets have resulted in their underrepresentation, despite the need for small molecule detection in fields such as medicine, the environment, and agriculture. This protocol describes the steps in the selection, sequencing, affinity characterization, and truncation of DNA aptamers that are specific for small molecule targets. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  3. Electrochemiluminescent DNA sensor based on controlled Zn-mediated grafting of diazonium precursors. (United States)

    Torréns, Mabel; Ortiz, Mayreli; Bejarano-Nosas, Diego; O'Sullivan, Ciara K


    Controlled Zn-mediated grafting of a thin layer of a diazonium salt was used to functionalise a carbon electrode with ruthenium(II)-tris-bipyridine (Ru)-labelled DNA for use as a capture probe in an electrochemiluminescent genosensor. A secondary reporter probe was labelled with a ferrocene (Fc) molecule, and in the presence of the single-stranded DNA target a genocomplex formed, where the Fc-label effectively quenched the electrochemiluminescence of the signal emitted from the Ru-label. The spacing of the labels for maximum sensitivity and minimum detection limit was optimised, and the signal reproducibility and stability of the method was established.

  4. Faulty DNA repair following ultraviolet irradiation in Fanconi's anemia

    International Nuclear Information System (INIS)

    Poon, P.K.; Parker, J.W.; O'Brien, R.L.


    Fibroblasts from a patient with Fanconi's anemia were deficient in their ability to excise uv-induced pyrimidine dimers from their DNA but were capable of single-strand break production and unscheduled DNA synthesis

  5. Repair of human DNA in molecules that replicate or remain unreplicated following ultraviolet irradiation

    International Nuclear Information System (INIS)

    Waters, R.


    The extent of DNA replication, the incidence of uv induced pyrimidine dimers and the repair replication observed after their excision was monitored in human fibroblasts uv irradiated with single or split uv doses. The excision repair processes were measured in molecules that remained unreplicated or in those that replicated after the latter uv irradiation. Less DNA replication was observed after a split as opposed to single uv irradiation. Furthermore, a split dose did not modify the excision parameters measured after a single irradiation, regardless of whether the DNA had replicated or not

  6. Detection of human DNA polymorphisms with a simplified denaturing gradient gel electrophoresis technique

    International Nuclear Information System (INIS)

    Noll, W.W.; Collins, M.


    Single base pair differences between otherwise identical DNA molecules can result in altered melting behavior detectable by denaturing gradient gel electrophoresis. The authors have developed a simplified procedure for using denaturing gradient gel electrophoresis to detect base pair changes in genomic DNA. Genomic DNA is digested with restriction enzymes and hybridized in solution to labeled single-stranded probe DNA. The excess probe is then hybridized to complementary phage M13 template DNA, and the reaction mixture is electrophoresed on a denaturing gradient gel. Only the genomic DNA probe hybrids migrate into the gel. Differences in hybrid mobility on the gel indicate base pair changes in the genomic DNA. They have used this technique to identify two polymorphic sites within a 1.2-kilobase region of human chromosome 20. This approach should greatly facilitate the identification of DNA polymorphisms useful for gene linkage studies and the diagnosis of genetic diseases

  7. Adaptive resolution simulation of an atomistic DNA molecule in MARTINI salt solution

    NARCIS (Netherlands)

    Zavadlav, J.; Podgornik, R.; Melo, M.n.; Marrink, S.j.; Praprotnik, M.


    We present a dual-resolution model of a deoxyribonucleic acid (DNA) molecule in a bathing solution, where we concurrently couple atomistic bundled water and ions with the coarse-grained MAR- TINI model of the solvent. We use our fine-grained salt solution model as a solvent in the inner shell

  8. Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules (United States)

    Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David


    We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

  9. A mechanism of gene amplification driven by small DNA fragments.

    Directory of Open Access Journals (Sweden)

    Kuntal Mukherjee

    Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

  10. Control of DNA hybridization by photoswitchable molecular glue. (United States)

    Dohno, Chikara; Nakatani, Kazuhiko


    Hybridization of DNA is one of the most intriguing events in molecular recognition and is essential for living matter to inherit life beyond generations. In addition to the function of DNA as genetic material, DNA hybridization is a key to control the function of DNA-based materials in nanoscience. Since the hybridization of two single stranded DNAs is a thermodynamically favorable process, dissociation of the once formed DNA duplex is normally unattainable under isothermal conditions. As the progress of DNA-based nanoscience, methodology to control the DNA hybridization process has become increasingly important. Besides many reports using the chemically modified DNA for the regulation of hybridization, we focused our attention on the use of a small ligand as the molecular glue for the DNA. In 2001, we reported the first designed molecule that strongly and specifically bound to the mismatched base pairs in double stranded DNA. Further studies on the mismatch binding molecules provided us a key discovery of a novel mode of the binding of a mismatch binding ligand that induced the base flipping. With these findings we proposed the concept of molecular glue for DNA for the unidirectional control of DNA hybridization and, eventually photoswitchable molecular glue for DNA, which enabled the bidirectional control of hybridization under photoirradiation. In this tutorial review, we describe in detail how we integrated the mismatch binding ligand into photoswitchable molecular glue for DNA, and the application and perspective in DNA-based nanoscience.

  11. Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

    KAUST Repository

    Hussain, Tanveer


    Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory calculations. Binding energy range for nucleobases, amino acids and heterocyclic molecules with both the sheets have been found to be (0.43-1.16eV), (0.70-1.58eV) and (0.22-0.96eV) respectively, which along with the binding distances show that these molecules bind to both sheets by physisorption and chemisorption process. The exchange of electric charges between the monolayers and the incident molecules has been examined by means of Bader charge analysis. It has been observed that the introduction of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules alters the electronic properties of both silicene and germanene nano sheets as studied by plotting the total (TDOS) and partial (PDOS) density of states. The DOS plots reveal the variation in the band gaps of both silicene and germanene caused by the introduction of studied molecules. Based on the obtained results we suggest that both silicene and germanene monolayers in their pristine form could be useful for sensing of biomolecules.

  12. Antibacterial small molecules targeting the conserved TOPRIM domain of DNA gyrase.

    Directory of Open Access Journals (Sweden)

    Scott S Walker

    Full Text Available To combat the threat of antibiotic-resistant Gram-negative bacteria, novel agents that circumvent established resistance mechanisms are urgently needed. Our approach was to focus first on identifying bioactive small molecules followed by chemical lead prioritization and target identification. Within this annotated library of bioactives, we identified a small molecule with activity against efflux-deficient Escherichia coli and other sensitized Gram-negatives. Further studies suggested that this compound inhibited DNA replication and selection for resistance identified mutations in a subunit of E. coli DNA gyrase, a type II topoisomerase. Our initial compound demonstrated weak inhibition of DNA gyrase activity while optimized compounds demonstrated significantly improved inhibition of E. coli and Pseudomonas aeruginosa DNA gyrase and caused cleaved complex stabilization, a hallmark of certain bactericidal DNA gyrase inhibitors. Amino acid substitutions conferring resistance to this new class of DNA gyrase inhibitors reside exclusively in the TOPRIM domain of GyrB and are not associated with resistance to the fluoroquinolones, suggesting a novel binding site for a gyrase inhibitor.

  13. Radiation induced degradation of DNA in photodynamic therapy of cancer

    International Nuclear Information System (INIS)

    Ion, Rodica; Scarlat, F.; Niculescu, V.I.R.; Scarlat, Fl.; Gunaydin, Keriman


    DNA is a critical cellular target for oxidative processes induced by physical and chemical stresses. It is known that the direct effect of ionizing radiation on DNA results mainly in base ionization and may lead to mutation, carcinogenesis and cell death. The degradation of DNA induced by laser and ionizing radiation (electron and photon beam) is analyzed in this paper. The ionizing radiation degradation of DNA is a radical process. A series of lesions among the major base degradation product has been measured in isolated DNA exposed to gamma radiation in aerated aqueous solution. Degradation can be accounted for by the formation of hydroxyl radicals upon radiolysis of water (indirect effect). The production of DNA damage by ionizing radiation involves two mechanisms, direct and indirect effects. Direct effect leads to ionization and excitation of DNA molecules, while indirect effect is due to the interaction of reactive species, in particular of OH radicals produced by water radiolysis, with targets in DNA. The relative contribution of the two mechanisms in damaging DNA depends on the type of radiation. Single strand breaks and base damage seem to be mainly produced by the attack of hydroxyl radicals on DNA, whereas double strand breaks result predominantly of direct energy deposition. The four bases are degraded in high yield. Direct effect has been mimicked by photo-induced electron abstraction from the bases producing their radical cation. The base damage may also occur from the formation of radical cation of purine and pyrimidine components. When DNA is irradiated in solution, single strand breaks are mainly due to the abstraction of an H atom from the 4 ' position of 2 ' -deoxyribose by the attack of OH radicals produced by water radiolysis. Quantification of the modified bases showed the guanine is the preferential target. Ionizing radiation induces several types of DNA modifications, including chain breaks, DNA-protein cross-links, oxidized DNA bases

  14. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair (United States)

    Sinurat, E. N.; Yudiarsah, E.


    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  15. DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering. (United States)

    Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi


    We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.

  16. Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography (United States)

    Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan


    The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

  17. Digital quantification of rolling circle amplified single DNA molecules in a resistive pulse sensing nanopore. (United States)

    Kühnemund, M; Nilsson, M


    Novel portable, sensitive and selective DNA sensor methods for bio-sensing applications are required that can rival conventionally used non-portable and expensive fluorescence-based sensors. In this paper, rolling circle amplification (RCA) products are detected in solution and on magnetic particles using a resistive pulse sensing (RPS) nanopore. Low amounts of DNA molecules are detected by padlock probes which are circularized in a strictly target dependent ligation reaction. The DNA-padlock probe-complex is captured on magnetic particles by sequence specific capture oligonucleotides and amplified by a short RCA. Subsequent RPS analysis is used to identify individual particles with single attached RCA products from blank particles. This proof of concept opens up for a novel non-fluorescent digital DNA quantification method that can have many applications in bio-sensing and diagnostic approaches. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Amino acids 16-275 of minute virus of mice NS1 include a domain that specifically binds (ACCA)2-3-containing DNA. (United States)

    Mouw, M; Pintel, D J


    GST-NS1 purified from Escherichia coli and insect cells binds double-strand DNA in an (ACCA)2-3-dependent fashion under similar ionic conditions, independent of the presence of anti-NS1 antisera or exogenously supplied ATP and interacts with single-strand DNA and RNA in a sequence-independent manner. An amino-terminal domain (amino acids 1-275) of NS1 [GST-NS1(1-275)], representing 41% of the full-length NS1 molecule, includes a domain that binds double-strand DNA in a sequence-specific manner at levels comparable to full-length GST-NS1, as well as single-strand DNA and RNA in a sequence-independent manner. The deletion of 15 additional amino-terminal amino acids yielded a molecule [GST-NS1(1-275)] that maintained (ACCA)2-3-specific double-strand DNA binding; however, this molecule was more sensitive to increasing ionic conditions than full-length GST-NS1 and GST-NS1(1-275) and could not be demonstrated to bind single-strand nucleic acids. A quantitative filter binding assay showed that E. coli- and baculovirus-expressed GST-NS1 and E. coli GST-NS1(1-275) specifically bound double-strand DNA with similar equilibrium kinetics [as measured by their apparent equilibrium DNA binding constants (KD)], whereas GST-NS1(16-275) bound 4- to 8-fold less well. Copyright 1998 Academic Press.

  19. Construction of a Holliday Junction in Small Circular DNA Molecules for Stable Motifs and Two-Dimensional Lattices. (United States)

    Guo, Xin; Wang, Xue-Mei; Wei, Shuai; Xiao, Shou-Jun


    Design rules for DNA nanotechnology have been mostly learnt from using linear single-stranded (ss) DNA as the source material. For example, the core structure of a typical DAO (double crossover, antiparallel, odd half-turns) tile for assembling 2D lattices is constructed from only two linear ss-oligonucleotide scaffold strands, similar to two ropes making a square knot. Herein, a new type of coupled DAO (cDAO) tile and 2D lattices of small circular ss-oligonucleotides as scaffold strands and linear ss-oligonucleotides as staple strands are reported. A cDAO tile of cDAO-c64nt (c64nt: circular 64 nucleotides), shaped as a solid parallelogram, is constructed with a Holliday junction (HJ) at the center and two HJs at both poles of a c64nt; similarly, cDAO-c84nt, shaped as a crossed quadrilateral composed of two congruent triangles, is formed with a HJ at the center and four three-way junctions at the corners of a c84nt. Perfect 2D lattices were assembled from cDAO tiles: infinite nanostructures of nanoribbons, nanotubes, and nanorings, and finite nanostructures. The structural relationship between the visible lattices imaged by AFM and the corresponding invisible secondary and tertiary molecular structures of HJs, inclination angle of hydrogen bonds against the double-helix axis, and the chirality of the tile can be interpreted very well. This work could shed new light on DNA nanotechnology with unique circular tiles. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Quantification and Sequencing of Crossover Recombinant Molecules from Arabidopsis Pollen DNA. (United States)

    Choi, Kyuha; Yelina, Nataliya E; Serra, Heïdi; Henderson, Ian R


    During meiosis, homologous chromosomes undergo recombination, which can result in formation of reciprocal crossover molecules. Crossover frequency is highly variable across the genome, typically occurring in narrow hotspots, which has a significant effect on patterns of genetic diversity. Here we describe methods to measure crossover frequency in plants at the hotspot scale (bp-kb), using allele-specific PCR amplification from genomic DNA extracted from the pollen of F 1 heterozygous plants. We describe (1) titration methods that allow amplification, quantification and sequencing of single crossover molecules, (2) quantitative PCR methods to more rapidly measure crossover frequency, and (3) application of high-throughput sequencing for study of crossover distributions within hotspots. We provide detailed descriptions of key steps including pollen DNA extraction, prior identification of hotspot locations, allele-specific oligonucleotide design, and sequence analysis approaches. Together, these methods allow the rate and recombination topology of plant hotspots to be robustly measured and compared between varied genetic backgrounds and environmental conditions.

  1. Molecular Precision at Micrometer Length Scales: Hierarchical Assembly of DNA-Protein Nanostructures. (United States)

    Schiffels, Daniel; Szalai, Veronika A; Liddle, J Alexander


    Robust self-assembly across length scales is a ubiquitous feature of biological systems but remains challenging for synthetic structures. Taking a cue from biology-where disparate molecules work together to produce large, functional assemblies-we demonstrate how to engineer microscale structures with nanoscale features: Our self-assembly approach begins by using DNA polymerase to controllably create double-stranded DNA (dsDNA) sections on a single-stranded template. The single-stranded DNA (ssDNA) sections are then folded into a mechanically flexible skeleton by the origami method. This process simultaneously shapes the structure at the nanoscale and directs the large-scale geometry. The DNA skeleton guides the assembly of RecA protein filaments, which provides rigidity at the micrometer scale. We use our modular design strategy to assemble tetrahedral, rectangular, and linear shapes of defined dimensions. This method enables the robust construction of complex assemblies, greatly extending the range of DNA-based self-assembly methods.

  2. DNA origami-based shape IDs for single-molecule nanomechanical genotyping (United States)

    Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai


    Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

  3. Multiplex single-molecule interaction profiling of DNA-barcoded proteins. (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M


    In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.

  4. Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics (United States)

    Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.


    Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254

  5. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach. (United States)

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A


    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  6. Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami (United States)

    Chikkaraddy, Rohit; Turek, V. A.; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F.; Baumberg, Jeremy J.


    Fabricating nanocavities in which optically-active single quantum emitters are precisely positioned, is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore, and obtain enhancements of $\\geq4\\times10^3$ with high quantum yield ($\\geq50$%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of $\\pm1.5$ nm. Our approach introduces a straightforward non-invasive way to measure and quantify confined optical modes on the nanoscale.

  7. Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami. (United States)

    Chikkaraddy, Rohit; Turek, V A; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F; Baumberg, Jeremy J


    Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 10 3 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale.

  8. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p. (United States)

    Brewer, Laurence R; Friddle, Raymond; Noy, Aleksandr; Baldwin, Enoch; Martin, Shelley S; Corzett, Michele; Balhorn, Rod; Baskin, Ronald J


    Mitochondrial and nuclear DNA are packaged by proteins in a very different manner. Although protein-DNA complexes called "nucleoids" have been identified as the genetic units of mitochondrial inheritance in yeast and man, little is known about their physical structure. The yeast mitochondrial protein Abf2p was shown to be sufficient to compact linear dsDNA, without the benefit of supercoiling, using optical and atomic force microscopy single molecule techniques. The packaging of DNA by Abf2p was observed to be very weak as evidenced by a fast Abf2p off-rate (k(off) = 0.014 +/- 0.001 s(-1)) and the extremely small forces (<0.6 pN) stabilizing the condensed protein-DNA complex. Atomic force microscopy images of individual complexes showed the 190-nm structures are loosely packaged relative to nuclear chromatin. This organization may leave mtDNA accessible for transcription and replication, while making it more vulnerable to damage.

  9. Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores (United States)

    Bell, Nicholas A. W.; Keyser, Ulrich F.


    The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

  10. Single-Molecule Tethered Particle Motion: Stepwise Analyses of Site-Specific DNA Recombination

    Directory of Open Access Journals (Sweden)

    Hsiu-Fang Fan


    Full Text Available Tethered particle motion/microscopy (TPM is a biophysical tool used to analyze changes in the effective length of a polymer, tethered at one end, under changing conditions. The tether length is measured indirectly by recording the Brownian motion amplitude of a bead attached to the other end. In the biological realm, DNA, whose interactions with proteins are often accompanied by apparent or real changes in length, has almost exclusively been the subject of TPM studies. TPM has been employed to study DNA bending, looping and wrapping, DNA compaction, high-order DNA–protein assembly, and protein translocation along DNA. Our TPM analyses have focused on tyrosine and serine site-specific recombinases. Their pre-chemical interactions with DNA cause reversible changes in DNA length, detectable by TPM. The chemical steps of recombination, depending on the substrate and the type of recombinase, may result in a permanent length change. Single molecule TPM time traces provide thermodynamic and kinetic information on each step of the recombination pathway. They reveal how mechanistically related recombinases may differ in their early commitment to recombination, reversibility of individual steps, and in the rate-limiting step of the reaction. They shed light on the pre-chemical roles of catalytic residues, and on the mechanisms by which accessory proteins regulate recombination directionality.

  11. Single-molecule studies of DNA transcription using atomic force microscopy

    International Nuclear Information System (INIS)

    Billingsley, Daniel J; Crampton, Neal; Thomson, Neil H; Bonass, William A; Kirkham, Jennifer


    Atomic force microscopy (AFM) can detect single biomacromolecules with a high signal-to-noise ratio on atomically flat biocompatible support surfaces, such as mica. Contrast arises from the innate forces and therefore AFM does not require imaging contrast agents, leading to sample preparation that is relatively straightforward. The ability of AFM to operate in hydrated environments, including humid air and aqueous buffers, allows structure and function of biological and biomolecular systems to be retained. These traits of the AFM are ensuring that it is being increasingly used to study deoxyribonucleic acid (DNA) structure and DNA–protein interactions down to the secondary structure level. This report focuses in particular on reviewing the applications of AFM to the study of DNA transcription in reductionist single-molecule bottom-up approaches. The technique has allowed new insights into the interactions between ribonucleic acid (RNA) polymerase to be gained and enabled quantification of some aspects of the transcription process, such as promoter location, DNA wrapping and elongation. More recently, the trend is towards studying the interactions of more than one enzyme operating on a single DNA template. These methods begin to reveal the mechanics of gene expression at the single-molecule level and will enable us to gain greater understanding of how the genome is transcribed and translated into the proteome. (topical review)

  12. Efficient DNA ligation in DNA–RNA hybrid helices by Chlorella virus DNA ligase (United States)

    Lohman, Gregory J. S.; Zhang, Yinhua; Zhelkovsky, Alexander M.; Cantor, Eric J.; Evans, Thomas C.


    Single-stranded DNA molecules (ssDNA) annealed to an RNA splint are notoriously poor substrates for DNA ligases. Herein we report the unexpectedly efficient ligation of RNA-splinted DNA by Chlorella virus DNA ligase (PBCV-1 DNA ligase). PBCV-1 DNA ligase ligated ssDNA splinted by RNA with kcat ≈ 8 x 10−3 s−1 and KM DNA ligase produced only 5′-adenylylated DNA with a 20-fold lower kcat and a KM ≈ 300 nM. The rate of ligation increased with addition of Mn2+, but was strongly inhibited by concentrations of NaCl >100 mM. Abortive adenylylation was suppressed at low ATP concentrations (8, leading to increased product yields. The ligation reaction was rapid for a broad range of substrate sequences, but was relatively slower for substrates with a 5′-phosphorylated dC or dG residue on the 3′ side of the ligation junction. Nevertheless, PBCV-1 DNA ligase ligated all sequences tested with 10-fold less enzyme and 15-fold shorter incubation times than required when using T4 DNA ligase. Furthermore, this ligase was used in a ligation-based detection assay system to show increased sensitivity over T4 DNA ligase in the specific detection of a target mRNA. PMID:24203707

  13. Development of DNA elution method to detect irradiated foodstuff

    International Nuclear Information System (INIS)

    Copin, M.P.; Bourgeois, C.M.


    The aim of the work is to develop a reliable method to detect whether a fresh and frozen foodstuff has been irradiated. The molecule of DNA is one of the targets of ionizing radiation. The induction of three major classes of lesion have been shown. Double strand breaks, single strand breaks and base damage. Among the different techniques used to observe and quantify the strand breaks, techniques of elution are very interesting. The method proposed consisted of a filtration of the DNA at the atmospheric pressure and in non denaturing conditions. The amount of DNA retained on the filter is measured after being suitably labelled by microfluorometry. A difference in the amount of DNA retained on a filter of 2 μm from a lysed muscular tissue sample between a frozen Norway lobster which has been irradiated and one which has not, is observed. 7 refs

  14. DNA conformation on surfaces measured by fluorescence self-interference. (United States)

    Moiseev, Lev; Unlü, M Selim; Swan, Anna K; Goldberg, Bennett B; Cantor, Charles R


    The conformation of DNA molecules tethered to the surface of a microarray may significantly affect the efficiency of hybridization. Although a number of methods have been applied to determine the structure of the DNA layer, they are not very sensitive to variations in the shape of DNA molecules. Here we describe the application of an interferometric technique called spectral self-interference fluorescence microscopy to the precise measurement of the average location of a fluorescent label in a DNA layer relative to the surface and thus determine specific information on the conformation of the surface-bound DNA molecules. Using spectral self-interference fluorescence microscopy, we have estimated the shape of coiled single-stranded DNA, the average tilt of double-stranded DNA of different lengths, and the amount of hybridization. The data provide important proofs of concept for the capabilities of novel optical surface analytical methods of the molecular disposition of DNA on surfaces. The determination of DNA conformations on surfaces and hybridization behavior provide information required to move DNA interfacial applications forward and thus impact emerging clinical and biotechnological fields.

  15. Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level

    KAUST Repository

    Raducanu, Vlad-Stefan


    Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners and the mechanism of facilitated diffusion along the DNA. The large numbers of interacting partners makes PCNA a necessary factor to consider when studying DNA replication, either in vitro or in vivo. The mechanism of facilitated diffusion along the DNA, i.e. sliding along the duplex, reduces the six degrees of freedom of the molecule, three degrees of freedom of translation and three degrees of freedom of rotation, to only two, translation along the duplex and rotational tracking of the helix. Through this mechanism PCNA can recruit its partner proteins and localize them to the right spot on the DNA, maybe in the right spatial orientation, more effectively and in coordination with other proteins. Passive loading of the closed PCNA ring on the DNA without free ends is a topologically forbidden process. Replication factor C (RFC) uses energy of ATP hydrolysis to mechanically open the PCNA ring and load it on the dsDNA. The first half of the introduction gives overview of PCNA and RFC and the loading mechanism of PCNA on dsDNA. The second half is dedicated to a diffusion model and to an algorithm for analyzing PCNA sliding. PCNA and RFC were successfully purified, simulations and a mean squared displacement analysis algorithm were run and showed good stability and experimental PCNA sliding data was analyzed and led to parameters similar to the ones in literature.

  16. The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET

    Directory of Open Access Journals (Sweden)

    Mengyi Yang


    Full Text Available Summary: Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. : Yang et al. revealed significant conformational dynamics of Cas9 at global and local scales using single-molecule FRET. They uncovered surprising long-range allosteric communication between the HNH nuclease domain and the RNA/DNA heteroduplex at the PAM-distal end that serves as a proofreading checkpoint to govern the nuclease activity and specificity of Cas9. Keywords: CRISPR, Cas9, single-molecule, FRET, conformational dynamics, proofreading, off-target, allosteric communication, genome editing

  17. Packaging signals in two single-stranded RNA viruses imply a conserved assembly mechanism and geometry of the packaged genome. (United States)

    Dykeman, Eric C; Stockley, Peter G; Twarock, Reidun


    The current paradigm for assembly of single-stranded RNA viruses is based on a mechanism involving non-sequence-specific packaging of genomic RNA driven by electrostatic interactions. Recent experiments, however, provide compelling evidence for sequence specificity in this process both in vitro and in vivo. The existence of multiple RNA packaging signals (PSs) within viral genomes has been proposed, which facilitates assembly by binding coat proteins in such a way that they promote the protein-protein contacts needed to build the capsid. The binding energy from these interactions enables the confinement or compaction of the genomic RNAs. Identifying the nature of such PSs is crucial for a full understanding of assembly, which is an as yet untapped potential drug target for this important class of pathogens. Here, for two related bacterial viruses, we determine the sequences and locations of their PSs using Hamiltonian paths, a concept from graph theory, in combination with bioinformatics and structural studies. Their PSs have a common secondary structure motif but distinct consensus sequences and positions within the respective genomes. Despite these differences, the distributions of PSs in both viruses imply defined conformations for the packaged RNA genomes in contact with the protein shell in the capsid, consistent with a recent asymmetric structure determination of the MS2 virion. The PS distributions identified moreover imply a preferred, evolutionarily conserved assembly pathway with respect to the RNA sequence with potentially profound implications for other single-stranded RNA viruses known to have RNA PSs, including many animal and human pathogens. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Structural features of single-stranded integron cassette attC sites and their role in strand selection.

    Directory of Open Access Journals (Sweden)

    Marie Bouvier


    Full Text Available We recently showed that cassette integration and deletion in integron platforms were occurring through unconventional site-specific recombination reactions involving only the bottom strand of attC sites. The lack of sequence conservation among attC sites led us to hypothesize that sequence-independent structural recognition determinants must exist within attC sites. The structural data obtained from a synaptic complex of the Vibrio cholerae integrase with the bottom strand of an attC site has shown the importance of extra helical bases (EHB inside the stem-loop structure formed from the bottom strand. Here, we systematically determined the contribution of three structural elements common to all known single-stranded attC site recombination substrates (the EHBs, the unpaired central spacer (UCS, and the variable terminal structure (VTS to strand choice and recombination. Their roles have been evaluated in vivo in the attIxattC reaction context using the suicide conjugation assay we previously developed, but also in an attCxattC reaction using a deletion assay. Conjugation was used to deliver the attC sites in single-stranded form. Our results show that strand choice is primarily directed by the first EHB, but the presence of the two other EHBs also serves to increase this strand selection. We found that the structure of the central spacer is essential to achieve high level recombination of the bottom strand, suggesting a dual role for this structure in active site exclusion and for hindering the reverse reaction after the first strand exchange. Moreover, we have shown that the VTS has apparently no role in strand selectivity.

  19. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes

    Czech Academy of Sciences Publication Activity Database

    Pietilä, M.K.; Roine, E.; Sencilo, Ana; Bamford, D.H.; Oksanen, H.M.


    Roč. 161, č. 1 (2016), s. 249-256 ISSN 0304-8608 R&D Projects: GA ČR(CZ) GAP302/11/1940 Institutional support: RVO:61388971 Keywords : VIRION ARCHITECTURE * HALOVIRUSES * SPINDLE Subject RIV: EE - Microbiology, Virology Impact factor: 2.058, year: 2016

  20. DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries. (United States)

    Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg


    DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

  1. Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

    KAUST Repository

    Shirbini, Afnan


    and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image

  2. Structural Transitions in Supercoiled Stretched DNA (United States)

    v, Croquette


    Using magnetic micromanipulation techniques [Strick 96]( uc(T.R.) Strick, J.-F. Allemand, D. Bensimon, A. Bensimon) and uc(V.) Croquette, "The elasticity of a single supercoiled DNA molecule", Science, 271, 1835 (1996)., we have studied the mechanical properties (force versus extension) of single DNA molecules under a wide range of torsional stresses (supercoiling). We show that unwinding the DNA double helix leads to a phase separation between regular B-DNA and denaturation bubbles. The fraction of denatured molecule increases linearly with the degree of unwinding, beginning at a value of 1% unwinding. We have confirmed this denatured state by hybridization of homologous single-stranded DNA probes and by a chemical attack of the exposed bases. Surprisingly, when we overwind the molecule, the elasticity curves we obtain may also be interpreted by the coexistence of two phases, B-DNA and a new phase which we note P-DNA. The fraction of this new phase increases smoothly with overwinding, beginning at 3 % and continuing up to 300 %. Our results indicate that this new phase is four times more twisted that the standard B-DNA and is 1.75 times longer. Although the structure of this phase is not yet known, such a high twisting can only be attained if the sugar-phosphate backbones of the two strands are twisted closely while the bases are expelled outside of the molecule's core, in a structure reminiscent of the one proposed by Pauling. Indeed we have shown that this new phase is sensitive to chemical attack whereas the B-DNA is not. This new phase begins to appear on a molecule overwound by 3 % and stretched by a force of 5 pN, conditions typically encountered in vivo during gene transcription. This new phase may thus play a biological role (for more details).

  3. Separation of large DNA molecules by applying pulsed electric field to size exclusion chromatography-based microchip (United States)

    Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong


    Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA moleculesDNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.

  4. Single-Molecule Manipulation of Double-Stranded DNA Using Optical Tweezers: Interaction Studies of DNA with RecA and YOYO-1

    NARCIS (Netherlands)

    Bennink, Martin L.; Scharer, Orlando D.; Kanaar, Ronald; Sakata-Sogawa, Kumiko; Schins, J.M.; Kanger, Johannes S.; de Grooth, B.G.; Greve, Jan


    By using optical tweezers and a specially designed flow cell with an integrated glass micropipette, we constructed a setup similar to that of Smith et al. (Science 271:795-799, 1996) in which an individual double-stranded DNA (dsDNA) molecule can be captured between two polystyrene beads. The first

  5. DNA adsorption characteristics of hollow spherule allophane nano-particles

    International Nuclear Information System (INIS)

    Matsuura, Yoko; Iyoda, Fumitoshi; Arakawa, Shuichi; John, Baiju; Okamoto, Masami; Hayashi, Hidetomo


    To understand the propensity of natural allophane to adsorb the DNA molecules, the adsorption characteristics were assessed against natural allophane (AK70), using single-stranded DNA (ss-DNA) and adenosine 5′-monophosphate (5′-AMP) as a reference molecule. The adsorption capacity of ss-DNA on AK70 exhibited one order of magnitude lower value as compared with that of 5′-AMP. The adsorption capacity of ss-DNA decreased with increasing pH due to the interaction generated between phosphate groups of ss-DNA and functional Al–OH groups on the wall perforations through deprotonating, associated with higher energy barrier for the adsorption of ss-DNA. The adsorption morphologies consisting of the individual ss-DNA with mono-layer coverage of the clustered allophane particle were observed successfully through transmission electron microscopy analysis. - Highlights: • The interaction between phosphate groups of ss-DNA and Al–OH groups • Higher energy barrier for the adsorption of ss-DNA • The individual ss-DNA with mono-layer coverage of the allophane clustered particle

  6. Method for construction of normalized cDNA libraries (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris


    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

  7. Spontaneous unscheduled DNA synthesis in human lymphocytes

    International Nuclear Information System (INIS)

    Forell, B.; Myers, L.S. Jr.; Norman, A.


    The rate of spontaneous unscheduled DNA synthesis in human lymphocytes was estimated from measurements of tritiated thymidine incorporation into double-stranded DNA (ds-DNA) during incubation of cells in vitro. The contribution of scheduled DNA synthesis to the observed incorporation was reduced by inhibiting replication with hydroxyurea and by separating freshly replicated single-stranded DNA (ss-DNA) from repaired ds-DNA by column chromatography. The residual contribution of scheduled DNA synthesis was estimated by observing effects on thymidine incorporation of: (a) increasing the rate of production of apurinic sites, and alternatively, (b) increasing the number of cells in S-phase. Corrections based on estimates of endogenous pool size were also made. The rate of spontaneous unscheduled DNA synthesis is estimated to be 490 +- 120 thymidine molecules incorporated per cell per hour. These results compare favorably with estimates made from rates of depurination and depyrimidination of DNA, measured in molecular systems if we assume thymidine is incorporated by a short patch mechanism which incorporates an average of four bases per lesion

  8. Charge transport properties of a twisted DNA molecule: A renormalization approach

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)


    In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.

  9. Electronic properties and assambly of DNA-based molecules on gold surfaces

    DEFF Research Database (Denmark)

    Salvatore, Princia

    , highly base specific voltammetric peak in the presence of spermidine ions. A capacitive origin was attributed to this peak, and a novel route to detection of hybridization and base pair mismatches proposed on the basis of the high sensitivity to base pair mismatches showed by such ON-based monolayers...... as widely employed as Au(111) surfaces). In particular, SERS offered a valuable and rapid way ofcharacterising interactions between the DNA-based molecules and the NP surface, with no need for complex sample preparation....

  10. Protein dynamics during presynaptic complex assembly on individual ssDNA molecules (United States)

    Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.


    Homologous recombination is a conserved pathway for repairing double–stranded breaks, which are processed to yield single–stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single–molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA–ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 binding extends the ssDNA, and Rad52–RPA clusters remain interspersed along the presynaptic complex. These clusters promote additional binding of RPA and Rad52. Together, our work illustrates the spatial and temporal progression of RPA and Rad52 association with the presynaptic complex, and reveals a novel RPA–Rad52–Rad51–ssDNA intermediate, which has implications for understanding how the activities of Rad52 and RPA are coordinated with Rad51 during the later stages recombination. PMID:25195049

  11. DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules. (United States)

    Eernisse, D J


    DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.

  12. Antibodies to UV irradiated DNA: the monitoring of DNA damage by ELISA and indirect immunofluorescence

    Energy Technology Data Exchange (ETDEWEB)

    Wani, A A; Gibson-D' Ambrosio, R E; D' Ambrosio, S M [Ohio State Univ., Columbus (USA). Dept. of Radiology


    The enzyme-linked immunosorbant assay (ELISA) was modified to (1) characterize antibodies raised in rabbits against UV-irradiated single-stranded DNA (UVssDNA) complexed with methylated BSA and (2) directly detect pyrimidine dimers in irradiated DNA. The antisera specifically bound to UVssDNA, UVpoly(dT) and to a limited extent to UVdsDNA and UVpoly(dC). Fifty per cent of the maximum antibody binding was observed at a 1-5000 dilution against UVssDNA. Binding to ssDNA and poly(dT) was observed only at much higher concentrations of antibody, whereas no binding to double stranded DNA (dsDNA) was observed. The extent of binding of the antibody was dependent on the UV dose to DNA and the concentration of antigen immobilized on the plate. The ability of various irradiated molecules, DNA, homopolymers and linkers to act as inhibitors of antibody binding establishes that the antigenic determinants are mainly thymine homodimers with lower affinity for cytosine dimers. Potential usefulness of the antibodies to directly quantitate pyrimidine dimers in cells exposed to UV radiation was determined by indirect immunofluorescence. Flow cytometric analysis of immunostained human lymphocytes irradiated with 254 nm radiation indicated that greater than 50% of the population had significantly higher fluorescent intensity than unirradiated cells.

  13. Role of exonucleolytic processing and polymerase-DNA association in bypass of lesions during replication in vitro. Significance for SOS-targeted mutagenesis

    International Nuclear Information System (INIS)

    Shwartz, H.; Shavitt, O.; Livneh, Z.


    The role of exonuclease activity in trans-lesion DNA replication with Escherichia coli DNA polymerase III holoenzyme was investigated. RecA protein inhibited the 3'----5' exonuclease activity of the polymerase 2-fold when assayed in the absence of replication and had no effect on turnover of dNTPs into dNMPs. In contrast, single-stranded DNA-binding protein, which had no effect on the exonuclease activity in the absence of replication, showed a pronounced 7-fold suppression of the 3'----5' exonuclease activity during replication. The excision of incorporated dNMP alpha S residues from DNA by the 3'----5' exonuclease activity of DNA polymerase III holoenzyme was inhibited 10-20-fold; still no increase in bypass of pyrimidine photodimers was observed. Thus, in agreement with our previous results in which the exonuclease activity was inhibited at the protein level, inhibition at the DNA level also did not increase bypass of photodimers. Fractionation of the replication mixture after termination of DNA synthesis on a Bio-Gel A-5m column under conditions which favor polymerase-DNA binding yielded a termination complex which could perform turnover of dNTPs into dNMPs. Adding challenge-primed single-stranded DNA to the complex yielded a burst of DNA synthesis which was promoted most likely by DNA polymerase III holoenzyme molecules transferred from the termination complex to the challenge DNA thus demonstrating the instability of the polymerase-DNA association. Addition of a fresh sample of DNA polymerase III holoenzyme to purified termination products, which consist primarily of partially replicated molecules with nascent chains terminated at UV lesions, did not result in any net DNA synthesis as expected

  14. DNA: Polymer and molecular code (United States)

    Shivashankar, G. V.


    The thesis work focusses upon two aspects of DNA, the polymer and the molecular code. Our approach was to bring single molecule micromanipulation methods to the study of DNA. It included a home built optical microscope combined with an atomic force microscope and an optical tweezer. This combined approach led to a novel method to graft a single DNA molecule onto a force cantilever using the optical tweezer and local heating. With this method, a force versus extension assay of double stranded DNA was realized. The resolution was about 10 picoN. To improve on this force measurement resolution, a simple light backscattering technique was developed and used to probe the DNA polymer flexibility and its fluctuations. It combined the optical tweezer to trap a DNA tethered bead and the laser backscattering to detect the beads Brownian fluctuations. With this technique the resolution was about 0.1 picoN with a millisecond access time, and the whole entropic part of the DNA force-extension was measured. With this experimental strategy, we measured the polymerization of the protein RecA on an isolated double stranded DNA. We observed the progressive decoration of RecA on the l DNA molecule, which results in the extension of l , due to unwinding of the double helix. The dynamics of polymerization, the resulting change in the DNA entropic elasticity and the role of ATP hydrolysis were the main parts of the study. A simple model for RecA assembly on DNA was proposed. This work presents a first step in the study of genetic recombination. Recently we have started a study of equilibrium binding which utilizes fluorescence polarization methods to probe the polymerization of RecA on single stranded DNA. In addition to the study of material properties of DNA and DNA-RecA, we have developed experiments for which the code of the DNA is central. We studied one aspect of DNA as a molecular code, using different techniques. In particular the programmatic use of template specificity makes

  15. Applications of Engineered DNA-Binding Molecules Such as TAL Proteins and the CRISPR/Cas System in Biology Research

    Directory of Open Access Journals (Sweden)

    Toshitsugu Fujita


    Full Text Available Engineered DNA-binding molecules such as transcription activator-like effector (TAL or TALE proteins and the clustered regularly interspaced short palindromic repeats (CRISPR and CRISPR-associated proteins (Cas (CRISPR/Cas system have been used extensively for genome editing in cells of various types and species. The sequence-specific DNA-binding activities of these engineered DNA-binding molecules can also be utilized for other purposes, such as transcriptional activation, transcriptional repression, chromatin modification, visualization of genomic regions, and isolation of chromatin in a locus-specific manner. In this review, we describe applications of these engineered DNA-binding molecules for biological purposes other than genome editing.

  16. Non-sticky translocation of bio-molecules through Tween 20-coated solid-state nanopores in a wide pH range (United States)

    Li, Xiaoqing; Hu, Rui; Li, Ji; Tong, Xin; Diao, J. J.; Yu, Dapeng; Zhao, Qing


    Nanopore-based sensing technology is considered high-throughput and low-cost for single molecule detection, but solid-state nanopores have suffered from pore clogging issues. A simple Tween 20 coating method is applied to ensure long-term (several hours) non-sticky translocation of various types of bio-molecules through SiN nanopores in a wide pH range (4.0-13.0). We also emphasize the importance of choosing appropriate concentration of Tween 20 coating buffer for desired effect. By coating nanopores with a Tween 20 layer, we are able to differentiate between single-stranded DNA and double-stranded DNA, to identify drift-dominated domain for single-stranded DNA, to estimate BSA volume and to observe the shape of individual nucleosome translocation event without non-specific adsorption. The wide pH endurance from 4.0 to 13.0 and the broad types of detection analytes including nucleic acids, proteins, and biological complexes highlight the great application potential of Tween 20-coated solid-state nanopores.

  17. Phosphate-methylated DNA aimed at HIV-1 RNA loops and integrated DNA inhibits viral infectivity

    NARCIS (Netherlands)

    Buck, H. M.; Koole, L. H.; van Genderen, M. H.; Smit, L.; Geelen, J. L.; Jurriaans, S.; Goudsmit, J.


    Phosphate-methylated DNA hybridizes strongly and specifically to natural DNA and RNA. Hybridization to single-stranded and double-stranded DNA leads to site-selective blocking of replication and transcription. Phosphate-methylated DNA was used to interrupt the life cycle of the human

  18. Distinct kinetics of human DNA ligases I, IIIalpha, IIIbeta, and IV reveal direct DNA sensing ability and differential physiological functions in DNA repair

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Xi; Ballin, Jeff D.; Della-Maria, Julie; Tsai, Miaw-Sheue; White, Elizabeth J.; Tomkinson, Alan E.; Wilson, Gerald M.


    The three human LIG genes encode polypeptides that catalyze phosphodiester bond formation during DNA replication, recombination and repair. While numerous studies have identified protein partners of the human DNA ligases (hLigs), there has been little characterization of the catalytic properties of these enzymes. In this study, we developed and optimized a fluorescence-based DNA ligation assay to characterize the activities of purified hLigs. Although hLigI joins DNA nicks, it has no detectable activity on linear duplex DNA substrates with short, cohesive single-strand ends. By contrast, hLigIII{beta} and the hLigIII{alpha}/XRCC1 and hLigIV/XRCC4 complexes are active on both nicked and linear duplex DNA substrates. Surprisingly, hLigIV/XRCC4, which is a key component of the major non-homologous end joining (NHEJ) pathway, is significantly less active than hLigIII on a linear duplex DNA substrate. Notably, hLigIV/XRCC4 molecules only catalyze a single ligation event in the absence or presence of ATP. The failure to catalyze subsequent ligation events reflects a defect in the enzyme-adenylation step of the next ligation reaction and suggests that, unless there is an in vivo mechanism to reactivate DNA ligase IV/XRCC4 following phosphodiester bond formation, the cellular NHEJ capacity will be determined by the number of adenylated DNA ligaseIV/XRCC4 molecules.

  19. The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET. (United States)

    Yang, Mengyi; Peng, Sijia; Sun, Ruirui; Lin, Jingdi; Wang, Nan; Chen, Chunlai


    Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  20. DNA requirements for interaction of the C-terminal region of Ku80 with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs). (United States)

    Radhakrishnan, Sarvan Kumar; Lees-Miller, Susan P


    Non-homologous end joining (NHEJ) is the major pathway for the repair of ionizing radiation induced DNA double strand breaks (DSBs) in human cells. Critical to NHEJ is the DNA-dependent interaction of the Ku70/80 heterodimer with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) to form the DNA-PK holoenzyme. However, precisely how Ku recruits DNA-PKcs to DSBs ends to enhance its kinase activity has remained enigmatic, with contradictory findings reported in the literature. Here we address the role of the Ku80 C-terminal region (CTR) in the DNA-dependent interaction of Ku70/80 with DNA-PKcs using purified components and defined DNA structures. Our results show that the Ku80 CTR is required for interaction with DNA-PKcs on short segments of blunt ended 25bp dsDNA or 25bp dsDNA with a 15-base poly dA single stranded (ss) DNA extension, but this requirement is less stringent on longer dsDNA molecules (35bp blunt ended dsDNA) or 25bp duplex DNA with either a 15-base poly dT or poly dC ssDNA extension. Moreover, the DNA-PKcs-Ku complex preferentially forms on 25 bp DNA with a poly-pyrimidine ssDNA extension.Our work clarifies the role of the Ku80 CTR and dsDNA ends on the interaction of DNA-PKcs with Ku and provides key information to guide assembly and biology of NHEJ complexes. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Electron microscopic comparison of the sequences of single-stranded genomes of mammalian parvoviruses by heteroduplex mapping

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, P.T.; Olson, W.H.; Allison, D.P.; Bates, R.C.; Snyder, C.E.; Mitra, S.


    The sequence homologies among the linear single-stranded genomes of several mammalian parvoviruses have been studied by electron microscopic analysis of tthe heteroduplexes produced by reannealing the complementary strands of their DNAs. The genomes of Kilham rat virus, H-1, minute virus of ice and LuIII, which are antigenically distinct non-defective parvoviruses, have considerable homology: about 70% of their sequences are conserved. The homologous regions map at similar locations in the left halves (from the 3' ends) of the genomes. No sequence homology, however, is observed between the DNAs of these nondefective parvoviruses and that of bovine parvovirus, another non-defective virus, or that of defective adenoassociated virus, nor between the genomes of bovine parvovirus and adenoassociated virus. This suggests that only very short, if any, homologous regions are present. From these results, an evolutionary relationship among Kilham rat virus, H-1, minute virus of mice and LuIII is predicted. It is interesting to note that, although LuIII was originally isolated from a human cell line and is specific for human cells in vitro, its genome has sequences in common only with the rodent viruses Kilham rat virus, minute virus of mice and H-1, and not with the other two mammalian parvoviruses tested.

  2. A Novel Single-Strand RNAi Therapeutic Agent Targeting the (Pro)renin Receptor Suppresses Ocular Inflammation. (United States)

    Kanda, Atsuhiro; Ishizuka, Erdal Tan; Shibata, Atsushi; Matsumoto, Takahiro; Toyofuku, Hidekazu; Noda, Kousuke; Namba, Kenichi; Ishida, Susumu


    The receptor-associated prorenin system (RAPS) refers to the pathogenic mechanism whereby prorenin binding to the (pro)renin receptor [(P)RR] dually activates the tissue renin-angiotensin system (RAS) and RAS-independent intracellular signaling. Here we revealed significant upregulation of prorenin and soluble (P)RR levels in the vitreous fluid of patients with uveitis compared to non-inflammatory controls, together with a positive correlation between these RAPS components and monocyte chemotactic protein-1 among several upregulated cytokines. Moreover, we developed a novel single-strand RNAi agent, proline-modified short hairpin RNA directed against human and mouse (P)RR [(P)RR-PshRNA], and we determined its safety and efficacy in vitro and in vivo. Application of (P)RR-PshRNA in mice caused significant amelioration of acute (uveitic) and chronic (diabetic) models of ocular inflammation with no apparent adverse effects. Our findings demonstrate the significant implication of RAPS in the pathogenesis of human uveitis and the potential usefulness of (P)RR-PshRNA as a therapeutic agent to reduce ocular inflammation. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  3. Role of radiation chemical and enzymatic processes on single-strand breaks at short times after irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Sapora, O; Loverock, P S; Fielden, E M [Institute of Cancer Research, Sutton (UK). Surrey Branch


    A rapid mixing lysis technique has been used to study the effects of irradiation at different temperatures on two strains of E.coli K12, one lacking in the polymerase I activity (W3110), and the other carrying a ligase temperature-sensitive mutation (DY179), which had full ligase activity at 30/sup 0/C and none at 46/sup 0/C. The results provided direct evidence for the absence of any ligase-dependent repair of SSB at short times. The addition of 5 x 10/sup -3/M cysteine to heat-treated W3110 cells before irradiation in anoxic conditions practically removed the increase in yield of SSB per single strand genome shown by the heat-treated cells; the response was very close to that of normal cells in anoxia. The important contribution of sulphydryl compounds to the anoxic radio-biological response is thereby demonstrated. The basic difference in damage obtained by irradiation under oxic or anoxic conditions is due not to preferential enzymic (ligase) repair but to differences in radiation chemical events.

  4. Molecular Processes Studied at a Single-Molecule Level Using DNA Origami Nanostructures and Atomic Force Microscopy

    Directory of Open Access Journals (Sweden)

    Ilko Bald


    Full Text Available DNA origami nanostructures allow for the arrangement of different functionalities such as proteins, specific DNA structures, nanoparticles, and various chemical modifications with unprecedented precision. The arranged functional entities can be visualized by atomic force microscopy (AFM which enables the study of molecular processes at a single-molecular level. Examples comprise the investigation of chemical reactions, electron-induced bond breaking, enzymatic binding and cleavage events, and conformational transitions in DNA. In this paper, we provide an overview of the advances achieved in the field of single-molecule investigations by applying atomic force microscopy to functionalized DNA origami substrates.

  5. Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

    DEFF Research Database (Denmark)

    Petersen, L. K.; Blakskjær, P.; Chaikuad, A.


    A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

  6. Direct Single-Molecule Observation of Mode and Geometry of RecA-Mediated Homology Search. (United States)

    Lee, Andrew J; Endo, Masayuki; Hobbs, Jamie K; Wälti, Christoph


    Genomic integrity, when compromised by accrued DNA lesions, is maintained through efficient repair via homologous recombination. For this process the ubiquitous recombinase A (RecA), and its homologues such as the human Rad51, are of central importance, able to align and exchange homologous sequences within single-stranded and double-stranded DNA in order to swap out defective regions. Here, we directly observe the widely debated mechanism of RecA homology searching at a single-molecule level using high-speed atomic force microscopy (HS-AFM) in combination with tailored DNA origami frames to present the reaction targets in a way suitable for AFM-imaging. We show that RecA nucleoprotein filaments move along DNA substrates via short-distance facilitated diffusions, or slides, interspersed with longer-distance random moves, or hops. Importantly, from the specific interaction geometry, we find that the double-stranded substrate DNA resides in the secondary DNA binding-site within the RecA nucleoprotein filament helical groove during the homology search. This work demonstrates that tailored DNA origami, in conjunction with HS-AFM, can be employed to reveal directly conformational and geometrical information on dynamic protein-DNA interactions which was previously inaccessible at an individual single-molecule level.

  7. A polypeptide-DNA hybrid with selective linking capability applied to single molecule nano-mechanical measurements using optical tweezers.

    Directory of Open Access Journals (Sweden)

    Fatemeh Moayed

    Full Text Available Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an efficient, rapid and specific manner, based on the recently developed linkage between the protein StrepTactin (STN and the peptide StrepTag II (ST. We introduce a two-step approach, in which we first construct a hybrid between DNA and a tandem of two STs peptides (tST. In a second step, this hybrid is linked to polystyrene bead surfaces and Maltose Binding Protein (MBP using STN. Furthermore, we show the STN-tST linkage is more stable against forces applied by optical tweezers than the commonly used biotin-Streptavidin (STV linkage. It can be used in conjunction with Neutravidin (NTV-biotin linkages to form DNA tethers that can sustain applied forces above 65 pN for tens of minutes in a quarter of the cases. The method is general and can be applied to construct other surface-DNA and protein-DNA hybrids. The reversibility, high mechanical stability and specificity provided by this linking procedure make it highly suitable for single molecule mechanical studies, as well as biosensing and lab on chip applications.

  8. Caulobacter crescentus Cell Cycle-Regulated DNA Methyltransferase Uses a Novel Mechanism for Substrate Recognition. (United States)

    Woodcock, Clayton B; Yakubov, Aziz B; Reich, Norbert O


    Caulobacter crescentus relies on DNA methylation by the cell cycle-regulated methyltransferase (CcrM) in addition to key transcription factors to control the cell cycle and direct cellular differentiation. CcrM is shown here to efficiently methylate its cognate recognition site 5'-GANTC-3' in single-stranded and hemimethylated double-stranded DNA. We report the K m , k cat , k methylation , and K d for single-stranded and hemimethylated substrates, revealing discrimination of 10 7 -fold for noncognate sequences. The enzyme also shows a similar discrimination against single-stranded RNA. Two independent assays clearly show that CcrM is highly processive with single-stranded and hemimethylated DNA. Collectively, the data provide evidence that CcrM and other DNA-modifying enzymes may use a new mechanism to recognize DNA in a key epigenetic process.

  9. Theory on the Mechanism of DNA Renaturation: Stochastic Nucleation and Zipping.

    Directory of Open Access Journals (Sweden)

    Gnanapragasam Niranjani

    Full Text Available Renaturation of the complementary single strands of DNA is one of the important processes that requires better understanding in the view of molecular biology and biological physics. Here we develop a stochastic dynamical model on the DNA renaturation. According to our model there are at least three steps in the renaturation process viz. nonspecific-contact formation, correct-contact formation and nucleation, and zipping. Most of the earlier two-state models combined nucleation with nonspecific-contact formation step. In our model we suggest that it is considerably meaningful when we combine the nucleation with the zipping since nucleation is the initial step of zipping and nucleated and zipping molecules are indistinguishable. Nonspecific contact formation step is a pure three-dimensional diffusion controlled collision process. Whereas nucleation involves several rounds of one-dimensional slithering and internal displacement dynamics of one single strand of DNA on the other complementary strand in the process of searching for the correct-contact and then initiate nucleation. Upon nucleation, the stochastic zipping follows to generate a fully renatured double stranded DNA. It seems that the square-root dependency of the overall renaturation rate constant on the length of reacting single strands originates mainly from the geometric constraints in the diffusion controlled nonspecific-contact formation step. Further the inverse scaling of the renaturation rate on the viscosity of reaction medium also originates from nonspecific contact formation step. On the other hand the inverse scaling of the renaturation rate with the sequence complexity originates from the stochastic zipping which involves several rounds of crossing over the free-energy barrier at microscopic levels. When the sequence of renaturing single strands of DNA is repetitive with less complexity then the cooperative effects will not be noticeable since the parallel zipping will be a

  10. Nanofluidic single-molecule sorting of DNA: a new concept in separation and analysis of biomolecules towards ultimate level performance

    International Nuclear Information System (INIS)

    Yamamoto, Takatoki; Fujii, Teruo


    Separation and separation-based analysis of biomolecules are fundamentally important techniques in the field of biotechnology. These techniques, however, depend on stochastic processes that intrinsically involve uncertainty, and thus it is not possible to achieve 100% separation accuracy. Theoretically, the ultimate resolution and sensitivity should be realized in a single-molecule system because of the deterministic nature of single-molecule manipulation. Here, we have proposed and experimentally demonstrated the concept of a 'single-molecule sorter' that detects and correctly identifies individual single molecules, realizing the ultimate level of resolution and sensitivity for any separation-based technology. The single-molecule sorter was created using a nanofluidic network consisting of a single inlet channel that branches off into multiple outlet channels. It includes two major functional elements, namely a single-molecule detection and identification element and a flow path switching element to accurately separate single molecules. With this system we have successfully demonstrated the world's first single-molecule sorting using DNA as a sample molecule. In the future, we hope to expand the application of such devices to comprehensive sorting of single-proteins from a single cell. We also believe that in addition to the single-molecule sorting method reported here, other types of single-molecule based processes will emerge and find use in a wide variety of applications.

  11. Fluorescence correlation spectroscopy analysis for accurate determination of proportion of doubly labeled DNA in fluorescent DNA pool for quantitative biochemical assays. (United States)

    Hou, Sen; Sun, Lili; Wieczorek, Stefan A; Kalwarczyk, Tomasz; Kaminski, Tomasz S; Holyst, Robert


    Fluorescent double-stranded DNA (dsDNA) molecules labeled at both ends are commonly produced by annealing of complementary single-stranded DNA (ssDNA) molecules, labeled with fluorescent dyes at the same (3' or 5') end. Because the labeling efficiency of ssDNA is smaller than 100%, the resulting dsDNA have two, one or are without a dye. Existing methods are insufficient to measure the percentage of the doubly-labeled dsDNA component in the fluorescent DNA sample and it is even difficult to distinguish the doubly-labeled DNA component from the singly-labeled component. Accurate measurement of the percentage of such doubly labeled dsDNA component is a critical prerequisite for quantitative biochemical measurements, which has puzzled scientists for decades. We established a fluorescence correlation spectroscopy (FCS) system to measure the percentage of doubly labeled dsDNA (PDL) in the total fluorescent dsDNA pool. The method is based on comparative analysis of the given sample and a reference dsDNA sample prepared by adding certain amount of unlabeled ssDNA into the original ssDNA solution. From FCS autocorrelation functions, we obtain the number of fluorescent dsDNA molecules in the focal volume of the confocal microscope and PDL. We also calculate the labeling efficiency of ssDNA. The method requires minimal amount of material. The samples have the concentration of DNA in the nano-molar/L range and the volume of tens of microliters. We verify our method by using restriction enzyme Hind III to cleave the fluorescent dsDNA. The kinetics of the reaction depends strongly on PDL, a critical parameter for quantitative biochemical measurements. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Universal huygen's principle of synchronization andcoordination in the DNA and cell molecules

    International Nuclear Information System (INIS)

    Gareev, F.A.; Gareeva, G.F.


    Many objects in Nature elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are built as self-consistent hierarchical systems and have the same homological constructions in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to the above-said the corresponding partial motions are determinate. This determinism arises as a consequence of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe

  13. In silico single-molecule manipulation of DNA with rigid body dynamics.

    Directory of Open Access Journals (Sweden)

    Pascal Carrivain


    Full Text Available We develop a new powerful method to reproduce in silico single-molecule manipulation experiments. We demonstrate that flexible polymers such as DNA can be simulated using rigid body dynamics thanks to an original implementation of Langevin dynamics in an open source library called Open Dynamics Engine. We moreover implement a global thermostat which accelerates the simulation sampling by two orders of magnitude. We reproduce force-extension as well as rotation-extension curves of reference experimental studies. Finally, we extend the model to simulations where the control parameter is no longer the torsional strain but instead the torque, and predict the expected behavior for this case which is particularly challenging theoretically and experimentally.

  14. Inhibition of replicon initiation and DNA elongation in Chinese hamster ovary cells by treatment at 45.5 degrees C

    International Nuclear Information System (INIS)

    Wong, R.S.; Dewey, W.C.


    Heat treatment of Chinese hamster ovary cells at 45.5 degrees C for 15 minutes resulted in the inhibition of both the replicon initiation and the DNA elongation processes. Analysis of the DNA made after treatment showed that for up to 30 minutes after hyperthermia, there was a significant increase (45-80% above control level) in the amount of labeled DNA less than or equal to 40S in size and having a distinct peak of 20S. Therefore, elongation of 20S molecules into larger molecules was inhibited or slowed down. These small molecules did not accumulate when recovery times were longer than 30 minutes. The DNA made after 120 and 240 minutes postheat incubation was larger than control size and indicated that, although replicon initiation was still inhibited, elongation between replicons into 120S molecules could take place. However, their subsequent elongation into parental-size molecules was inhibited. The same delay in DNA elongation seen in cells examined immediately after treatment was still observed in cells heated and allowed to recover for 30 minutes. Also, after 30 minutes of recovery, heated cells still had more newly synthesized DNA in the single-stranded fraction than did control cells, which indicates that DNA elongation within a replicon is delayed for at least 30 minutes after heating. Furthermore, at 4 hours after heating, the inhibition of elongation of clusters of replicons into parental molecules prevailed

  15. Single-molecule packaging initiation in real time by a viral DNA packaging machine from bacteriophage T4. (United States)

    Vafabakhsh, Reza; Kondabagil, Kiran; Earnest, Tyler; Lee, Kyung Suk; Zhang, Zhihong; Dai, Li; Dahmen, Karin A; Rao, Venigalla B; Ha, Taekjip


    Viral DNA packaging motors are among the most powerful molecular motors known. A variety of structural, biochemical, and single-molecule biophysical approaches have been used to understand their mechanochemistry. However, packaging initiation has been difficult to analyze because of its transient and highly dynamic nature. Here, we developed a single-molecule fluorescence assay that allowed visualization of packaging initiation and reinitiation in real time and quantification of motor assembly and initiation kinetics. We observed that a single bacteriophage T4 packaging machine can package multiple DNA molecules in bursts of activity separated by long pauses, suggesting that it switches between active and quiescent states. Multiple initiation pathways were discovered including, unexpectedly, direct DNA binding to the capsid portal followed by recruitment of motor subunits. Rapid succession of ATP hydrolysis was essential for efficient initiation. These observations have implications for the evolution of icosahedral viruses and regulation of virus assembly.

  16. DNA based radiological dosimetry technology

    International Nuclear Information System (INIS)

    Diaz Quijada, Gerardo A.; Roy, Emmanuel; Veres, Teodor; Dumoulin, Michel M.; Vachon, Caroline; Blagoeva, Rosita; Pierre, Martin


    Full text: The purpose of this project is to develop a personal and wearable dosimeter using a highly-innovative approach based on the specific recognition of DNA damage with a polymer hybrid. Our biosensor will be sensitive to breaks in nucleic acid macromolecules and relevant to mixed-field radiation. The dosimeter proposed will be small, field deployable and will sense damages for all radiation types at the DNA level. The generalized concept for the novel-based radiological dosimeter: 1) Single or double stranded oligonucleotide is immobilized on surface; 2) Single stranded has higher cross-section for fragmentation; 3) Double stranded is more biological relevant; 4) Radiation induces fragmentation; 5) Ultra-sensitive detection of fragments provides radiation dose. Successful efforts have been made towards a proof-of-concept personal wearable DNA-based dosimeter that is appropriate for mixed-field radiation. The covalent immobilization of oligonucleotides on large areas of plastic surfaces has been demonstrated and corroborated spectroscopically. The surface concentration of DNA was determined to be 8 x 1010 molecules/cm 2 from a Ce(IV) catalyzed hydrolysis study of a fluorescently labelled oligonucleotide. Current efforts are being directed at studying radiation induced fragmentation of DNA followed by its ultra-sensitive detection via a novel method. In addition, proof-of-concept wearable personal devices and a detection platform are presently being fabricated. (author)

  17. Sequence Dependent Interactions Between DNA and Single-Walled Carbon Nanotubes (United States)

    Roxbury, Daniel

    It is known that single-stranded DNA adopts a helical wrap around a single-walled carbon nanotube (SWCNT), forming a water-dispersible hybrid molecule. The ability to sort mixtures of SWCNTs based on chirality (electronic species) has recently been demonstrated using special short DNA sequences that recognize certain matching SWCNTs of specific chirality. This thesis investigates the intricacies of DNA-SWCNT sequence-specific interactions through both experimental and molecular simulation studies. The DNA-SWCNT binding strengths were experimentally quantified by studying the kinetics of DNA replacement by a surfactant on the surface of particular SWCNTs. Recognition ability was found to correlate strongly with measured binding strength, e.g. DNA sequence (TAT)4 was found to bind 20 times stronger to the (6,5)-SWCNT than sequence (TAT)4T. Next, using replica exchange molecular dynamics (REMD) simulations, equilibrium structures formed by (a) single-strands and (b) multiple-strands of 12-mer oligonucleotides adsorbed on various SWCNTs were explored. A number of structural motifs were discovered in which the DNA strand wraps around the SWCNT and 'stitches' to itself via hydrogen bonding. Great variability among equilibrium structures was observed and shown to be directly influenced by DNA sequence and SWCNT type. For example, the (6,5)-SWCNT DNA recognition sequence, (TAT)4, was found to wrap in a tight single-stranded right-handed helical conformation. In contrast, DNA sequence T12 forms a beta-barrel left-handed structure on the same SWCNT. These are the first theoretical indications that DNA-ba