WorldWideScience

Sample records for single-stranded deoxyribonucleic acid

  1. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.

    1976-02-01

    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  2. Nature of transforming deoxyribonucleic acid in calcium-treated Escherichia coli

    International Nuclear Information System (INIS)

    Strike, P.; Humphreys, G.O.; Roberts, R.J.

    1979-01-01

    A study of the reactivation of ultraviolet-irradiated plasmid and phage deoxyribonucleic acid molecules after transformation into Escherichia coli strains indicated that, when double-stranded deoxyribonucleic acid was used as the donor species, it was taken up without conversion to the single-stranded form

  3. DEOXYRIBONUCLEIC ACID HYBRIDS OF ACETIC ACID BACTERIA

    Science.gov (United States)

    De Ley, J.; Friedman, S.

    1964-01-01

    De Ley, J. (State University, Ghent, Belgium), and S. Friedman. Deoxyribonucleic acid hybrids of acetic acid bacteria. J. Bacteriol. 88:937–945. 1964.—Deuterated N15-labeled deoxyribonucleic acid (DNA) from Acetobacter aceti (mesoxydans 4) forms hybrids with ordinary DNA from other species of this genus (A. xylinum, A. pasteurianus, A. estunensis, and possibly A. xylinoides) when the guanine plus cytosine base composition does not vary by more than 1 to 2%. Beyond this limit (A. aceti Ch31 and A. muciparus 5) no hybrids are formed. The hybrids are apparently derived from an asymmetrical part of the compositional distribution. The results lend strength to the concept of a genetic species rather than to a division of a genus into sharply separated species, based on small phenotypic differences. Taxonomic implications are discussed. PMID:14219057

  4. Extrachromosomal deoxyribonucleic acid in different enterobacteria

    DEFF Research Database (Denmark)

    Christiansen, C; Christiansen, Gunna; Bak, AL

    1973-01-01

    Eighty-seven different enterobacteria and pseudomonas strains were examined for the presence of extrachromosomal deoxyribonucleic acid (DNA). Thirty-four strains contained closed circular DNA by the ethidium bromide CsCl density technique. Extrachromosomal DNA was most frequent in Escherichia...

  5. Radiotherapy Measurements with a Deoxyribonucleic Acid Doublestrand-Break Dosimeter

    Science.gov (United States)

    Obeidat, Mohammad Ali

    Many types of dosimeters are used in the clinic to measure radiation dose for therapy but none of them directly measures the biological effect of this dose. The overall purpose of this work was to develop a dosimeter that measures biological damage in the form of double-strand breaks to deoxyribonucleic acid. This dosimeter could provide a more biologically relevant measure of radiation damage than the currently utilized dosimeters. A pair of oligonucleotides was designed to fabricate this dosimeter. One is labeled with a 5'-end biotin and the other with a 5'-end 6 Fluorescein amidite (fluorescent dye excited at 495?nanometer, with a peak emission at 520 nanometer). These were designed to adhere to certain locations on the pRS316 vector and serve as the primers for polymerase chain reactions. The end product of this reaction is a 4 kilo-base pair double strands deoxyribonucleic acid fragment with biotin on one end and 6 Fluorescein amidite oligonucleotide on the other attached to streptavidin beads. The biotin end connects the double strands deoxyribonucleic acid to the streptavidin bead. These bead-connected double strands deoxyribonucleic acid were suspended in 50 microliter of phosphate-buffered saline and placed into a tube for irradiation. Following irradiation of the deoxyribonucleic acid dosimeter, we take advantage of the magnetic properties of the streptavidin bead by placing our sample microtube against a magnet. The magnetic field pulls the streptavidin beads against the side of the tube. If a double-strand-break has occurred for a double strands deoxyribonucleic acid, the fluorescein end of the double strands deoxyribonucleic acid becomes free and is no longer attached to the bead or held against the side of the microtube. The free fluorescein following a double-strand-break in double strands deoxyribonucleic acid is referred to here as supernatant. The supernatant is extracted and placed in another microtube, while the unbroken double strands

  6. Development of an Interaction Assay between Single-Stranded Nucleic Acids Trapped with Silica Particles and Fluorescent Compounds

    Directory of Open Access Journals (Sweden)

    R. Maeda

    2012-09-01

    Full Text Available Biopolymers are easily denatured by heating, a change in pH or chemical substances when they are immobilized on a substrate. To prevent denaturation of biopolymers, we developed a method to trap a polynucleotide on a substrate by hydrogen bonding using silica particles with surfaces modified by aminoalkyl chains ([A-AM silane]/SiO2. [A-AM silane]/SiO2 was synthesized by silane coupling reaction of N-2-(aminoethyl-3-aminopropyltrimethoxysilane (A-AM silane with SiO2 particles with a diameter of 5 μm at 100 °C for 20 min. The surface chemical structure of [A-AM silane]/SiO2 was characterized by Fourier transform infrared spectroscopy and molecular orbital calculations. The surface of the silica particles was modified with A-AM silane and primary amine groups were formed. [A-AM silane]/SiO2 was trapped with single-stranded nucleic acids [(Poly-X; X = A (adenine, G (guanine and C (cytosine] in PBS solution at 37 °C for 1 h. The single-stranded nucleic acids were trapped on the surface of the [A-AM silane]/SiO2 by hydrogen bonding to form conjugated materials. The resulting complexes were further conjugated by derivatives of acridine orange (AO as fluorescent labels under the same conditions to form [AO:Poly-X:A-AM silane]/SiO2 complexes. Changes in the fluorescence intensity of these complexes originating from interactions between the single-stranded nucleic acid and aromatic compounds were also evaluated. The change in intensity displayed the order [AO: Poly-G: A-AM silane]/SiO2 > [AO:Poly-A:A-AM silane]/SiO2 >> [AO:Poly-C:A-AM silane]/SiO2. This suggests that the single-stranded nucleic acids conjugated with aminoalkyl chains on the surfaces of SiO2 particles and the change in fluorescence intensity reflected the molecular interaction between AO and the nucleic-acid base in a polynucleotide.

  7. Highly stable triple helix formation by homopyrimidine (l)-acyclic threoninol nucleic acids with single stranded DNA and RNA

    DEFF Research Database (Denmark)

    Kumar, Vipin; Kesavan, Venkitasamy; Gothelf, Kurt Vesterager

    2015-01-01

    Acyclic (l)-threoninol nucleic acid (aTNA) containing thymine, cytosine and adenine nucleobases were synthesized and shown to form surprisingly stable triplexes with complementary single stranded homopurine DNA or RNA targets. The triplex structures consist of two (l)-aTNA strands and one DNA...... or RNA, and these triplexes are significantly stronger than the corresponding DNA or RNA duplexes as shown in competition experiments. As a unique property the (l)-aTNAs exclusively form triplex structures with DNA and RNA and no duplex structures are observed by gel electrophoresis. The results were...... compared to the known enantiomer (d)-aTNA, which forms much weaker triplexes depending upon temperature and time. It was demonstrated that (l)-aTNA triplexes are able to stop primer extension on a DNA template, showing the potential of (l)-aTNA for antisense applications....

  8. Extrachromosomal deoxyribonucleic acid in R factor-harboring Enterobacteriaceae

    DEFF Research Database (Denmark)

    Møller, JK; Bak, AL; Christiansen, C

    1976-01-01

    Extrachromosomal deoxyribonucleic acid (DNA) from 24 different R factor-harboring Enterobacteriaceae was isolated and characterized by analytical ultracentrifugation and electron microscopy. The R factors represented 15 different patterns of transferable drug resistance found in enterobacteria from...... from 1.700 to 1.720 g/cm3. The majority of the bacteria contained extrachromosomal DNAs of various densities. Three-fourths of the R factors were classified as fi+. The investigation illustrates the extensive variability in the physical characteristics of plasmid DNA from R factor-harboring strains....

  9. Transport properties of poly(GACT)–poly(CTGA) deoxyribonucleic acid

    Indian Academy of Sciences (India)

    Deoxyribonucleic acid; electronic transmission; carbon nanotube; ladder model; Green's function method. PACS Nos 73.63.-b; 73.63.Fg; 81.07.Nb. 1. Introduction. The discovery that the deoxyribonucleic acid (DNA) can conduct the electric cur- rent, has made it an interesting candidate for the roles that nature did not intend.

  10. Electrogenerated chemiluminescence detection for deoxyribonucleic acid hybridization based on gold nanoparticles carrying multiple probes

    International Nuclear Information System (INIS)

    Wang Hui; Zhang Chengxiao; Li Yan; Qi Honglan

    2006-01-01

    A novel sensitive electrogenerated chemiluminescence (ECL) method for the detection deoxyribonucleic acid (DNA) hybridization based on gold nanoparticles carrying multiple probes was developed. Ruthenium bis(2,2'-bipyridine)(2,2'-bipyridine-4,4'-dicarboxylic acid)-N-hydroxysuccinimide ester (Ru(bpy) 2 (dcbpy)NHS) was used as a ECL label and gold nanoparticle as a carrier. Probe single strand DNA (ss-DNA) was self-assembled at the 3'-terminal with a thiol group to the surface of gold nanoparticle and covalently labeled at the 5'-terminal of a phosphate group with Ru(bpy) 2 (dcbpy)NHS and the resulting conjugate (Ru(bpy) 2 (dcbpy)NHS)-ss-DNA-Au, was taken as a ECL probe. When target analyte ss-DNA was immobilized on a gold electrode by self-assembled monolayer technique and then hybridized with the ECL probe to form a double-stranded DNA (ds-DNA), a strong ECL response was electrochemically generated. The ECL intensity was linearly related to the concentration of the complementary sequence (target ss-DNA) in the range from 1.0 x 10 -11 to 1.0 x 10 -8 mol L -1 , and the linear regression equation was S = 57301 + 4579.6 lg C (unit of C is mol L -1 ). A detection limit of 5.0 x 10 -12 mol L -1 for target ss-DNA was achieved. The ECL signal generated from many reporters of ECL probe prepared is greatly amplified, compared to the convention scheme which is based on one reporter per hybridization event

  11. Role of deoxyribonucleic acid technology in forensic dentistry

    Science.gov (United States)

    Datta, Pankaj; Datta, Sonia Sood

    2012-01-01

    In the last few years, Deoxyribonucleic Acid (DNA) analysis methods have been applied to forensic cases. Forensic dental record comparison has been used for human identification in cases where destruction of bodily tissues or prolonged exposure to the environment has made other means of identification impractical, that is, after fire exposure or mass disaster. Teeth play an important role in identification and criminology, due to their unique characteristics and relatively high degree of physical and chemical resistance. The use of a DNA profile test in forensic dentistry offers a new perspective in human identification. The DNA is responsible for storing all the genetic material and is unique to each individual. The currently available DNA tests have high reliability and are accepted as legal proofs in courts. This article gives an overview of the evolution of DNA technology in the last few years, highlighting its importance in cases of forensic investigation. PMID:23087582

  12. Equine herpesviruses: antigenic relationships and deoxyribonucleic acid densities.

    Science.gov (United States)

    Plummer, G; Goodheart, C R; Studdert, M J

    1973-10-01

    Equine herpesviruses with a deoxyribonucleic acid density of 1.716 to 1.717 g/cm(3) were compared with one another by the plaque-reduction test and by the rate of development of cytopathic effect as indicated by plaque size in rabbit kidney cultures. Of the 19 isolates studied, the 9 which had already been tentatively labeled equine abortion viruses were serologically similar to one another; each of them grew more quickly than did any of the other 10 isolates although the mean plaque sizes formed a series of gradations with no clear hiatus which would permit the unequivocal delineation of the abortion viruses from the slowly growing strains. The 10 slowly growing isolates showed antigenic heterogeneity even though complement was present; the neutralizing capacity of an antiserum against the heterologous strains was, in most instances, markedly less than against the homologous strains, the range of the 50% endpoints being much greater than that observed among the equine abortion viruses, or among isolates of herpes simplex type 1. There was no cross neutralization between the equine abortion viruses and any of the 10 slowly growing isolates. An extra band of deoxyribonucleic acid, at 1.723 to 1.725 g/cm(3), was present in two of the slowly growing strains when originally grown in rabbit cells, but was no longer present after passage in cat cells. This band occupied the same position as one reported in the hamster-passaged strain of equine abortion virus, and had a density similar to that of the equine genital herpesvirus. Although the taxonomic demarcation of the equine abortion viruses and the slowly growing herpesviruses from one another is still open to question, they can be conveniently labeled equine herpesviruses 1 and 2, respectively; the genital virus would be termed equine herpesvirus 3.

  13. Lidocaine and ropivacaine, but not bupivacaine, demethylate deoxyribonucleic acid in breast cancer cells in vitro

    NARCIS (Netherlands)

    Lirk, P.; Hollmann, M. W.; Fleischer, M.; Weber, N. C.; Fiegl, H.

    2014-01-01

    Lidocaine demethylates deoxyribonucleic acid (DNA) in breast cancer cells. This modification of epigenetic information may be of therapeutic relevance in the perioperative period, because a decrease in methylation can reactivate tumour suppressor genes and inhibit tumour growth. The objectives of

  14. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.

    1978-01-01

    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  15. (FTA)® for sampling and recovery of deoxyribonucleic acid (DNA)

    African Journals Online (AJOL)

    Application of fast technology for analysis (FTA)® for sampling and recovery of deoxyribonucleic acid (DNA) for molecular characterization of cowpea breeding lines for Striga resistance. ... of breeding activities. Key word: Marker assisted selection, Striga gesnerioides, race, FTA® PlantSaver Card, PCR, tissue prints, DNA.

  16. Electrochemical sensing of tumor suppressor protein p53-deoxyribonucleic acid complex stability at an electrified interface

    Czech Academy of Sciences Publication Activity Database

    Paleček, Emil; Černocká, Hana; Ostatná, Veronika; Navrátilová, Lucie; Brázdová, Marie

    2014-01-01

    Roč. 828, MAY2014 (2014), s. 1-8 ISSN 0003-2670 R&D Projects: GA ČR(CZ) GAP301/11/2055; GA ČR(CZ) GA13-00956S; GA ČR(CZ) GA13-36108S Institutional support: RVO:68081707 Keywords : Deoxyribonucleic acid-protein binding * Tumor suppressor protein p53 * Electrochemical sensing Subject RIV: BO - Biophysics Impact factor: 4.513, year: 2014

  17. Quantitative determination of deoxyribonucleic acid in rat brain

    Science.gov (United States)

    Penn, N. W.; Suwalski, R.

    1969-01-01

    1. A procedure is given for spectrophotometric analysis of rat brain DNA after its resolution into component bases. Amounts of tissue in the range 50–100mg. can be used. 2. The amount of DNA obtained by the present method is 80% greater than that reported for rat brain by a previous procedure specific for DNA thymine. Identity of the material is established by the base ratios of purines and pyrimidines. The features responsible for the higher yield are the presence of dioxan during alkaline hydrolysis of tissue, the determination of the optimum concentration of potassium hydroxide in this step and omission of organic washes of the initial acid-precipitated residues. 3. The requirement for dioxan during alkaline hydrolysis suggests a possible association of brain DNA with lipid. The concentration of potassium hydroxide that gives maximum yield is 0·1m, indicating that there may be internucleotide linkages in this DNA that are more sensitive to alkali than those of liver or thymus DNA. 4. This procedure gives low yields of DNA from liver. It is not suitable for analysis of the DNA from this tissue. PMID:5353529

  18. Influence of surfactant on dynamics of photoinduced motions in a dye-doped deoxyribonucleic acid

    Science.gov (United States)

    Mysliwiec, Jaroslaw; Parafiniuk, Kacper; Miniewicz, Andrzej; Rau, Ileana; Kajzar, Francois; Niziol, Jacek; Hebda, Edyta; Pielichowski, Jan; Sahraoui, Bouchta

    2012-10-01

    Pure deoxyribonucleic acid (DNA) is known to be soluble in water only and exhibits poor temperature stability. In contrary, it is well known that the complex of DNA - with cetyltrimethyl ammonium (CTMA) is soluble in alcohols and can be processed into very good optical quality thin films by solution casting and spin deposition. Despite the success of DNA-CTMA, there is still need for new cationic surfactants which would extend the range of available solvents for DNA complex. We test and present experimental results of influence of new surfactants based on benzalkonium chloride (BA), and didecyldimethylammonium chloride (DDCA) for applications in all optical switching.

  19. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family.

    Science.gov (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław

    2017-05-01

    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  20. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)

    student

    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  1. Deoxyribonucleic acid repair in Escherichia coli mutants deficient in the 5'----3' exonuclease activity of deoxyribonucleic acid polymerase I and exonuclease VII

    International Nuclear Information System (INIS)

    Chase, J.W.; Masker, W.E.

    1977-01-01

    A series of Escherichia coli strains deficient in the 5'----3' exonuclease activity associated with deoxyribonucleic acid (DNA) polymerase I (exonuclease VI) and exonuclease VII has been constructed. Both of these enzymes are capable of pyrimidine dimer excision in vitro. These strains were examined for conditional lethality, sensitivity to ultraviolet (UV) and X-irradiation, postirradiation DNA degradation, and ability to excise pyrimidine dimers. It was found that strains deficient in both exonuclease VI (polAex-) and exonuclease VII (xseA-) are significantly reduced in their ability to survive incubation at elevated temperature (43 degrees C) beyond the reduction previously observed for the polAex single mutants. The UV and X-ray sensitivity of the exonuclease VI-deficient strains was not increased by the addition of the xseA7 mutation. Mutants deficient in both enzymes are about as efficient as wild-type strains at excising dimers produced by up to 40 J/m2 UV. At higher doses strains containing only polAex- mutations show reduced ability to excise dimers; however, the interpretation of dimer excision data at these doses is complicated by extreme postirradiation DNA degradation in these strains. The additional deficiency in the polAex xseA7 double-mutant strains has no significant effect on either postirradiation DNA degradation or the apparent deficiency in dimer excision at high UV doses observed in polAex single mutants

  2. Study of the interaction of enzyme Heparanase 1 (HPSE1) active with deoxyribonucleic acids

    International Nuclear Information System (INIS)

    Cid, Gisele da Silva

    2016-01-01

    The human heparanase 1 (HPSE 1) is a protein with multiple functions and has emerged as a promising therapeutic target in the context of antitumor therapy. This fact is due to its clinical relevance in the tumor development and progression, as determined by their enzymatic ability to degrade heparan sulfate (HS), the main constituent of the extracellular matrix, providing a tumor microenvironment to tumor dissemination. In addition, this protein plays a significant role in the increase of tumor cells migration ionizing radiation dose delivery in radiotherapy from the increase in the expression levels of HPSE1. In order to evaluate in more detail the functions of active HPSE1, it has been proposed to characterize the interaction of human heparanase protein 1 with deoxyribonucleic acids. Our results are original and point to a new function of HPSE1 of the endonuclease type. (author)

  3. Fluorescence, spectroscopic and NLO properties of green tea extract in deoxyribonucleic acid

    Science.gov (United States)

    Manea, Ana-Maria; Rau, Ileana; Kajzar, Francois; Meghea, Aurelia

    2013-11-01

    Natural, purely biological deoxyribonucleic acid (DNA)-green tea extract (GTE) complexes at different concentrations were prepared and characterized for their spectroscopic, fluorescent, linear and nonlinear optical properties. The complexes can be processed into good optical quality thin films by solution casting. They fluoresce when excited in UV absorption band, with a significantly larger quantum yield for the DNA-GTE complex than for a pure GTE solution. The thin film refractive indices were determined by Fabry-Perot (FP) interference patterns. The third-order nonlinear optical (NLO) properties of thin films were determined by the optical third-harmonic generation technique at 1064.2 nm fundamental wavelength. The phase of THG susceptibility was determined from the concentration variation of THG susceptibility. It reveals presence of a two-photon resonance with a band lying in the optical gap.

  4. Dielectric behavior of irradiated and nonirradiadiated deoxyribonucleic acid (DNA)-crotonic acid interaction in 5% dextrose solution

    International Nuclear Information System (INIS)

    Erginun, M.

    1980-01-01

    Deoxyribonucleic acid (DNA), ex. thymus, dissolved in 5% dextrose, was exposed to gamma radiation at doses between 0-5000 Rads. Crotonic acid dissolved in 5% dextrose was added to this irradiated DNA at t=0 and t=24 hrs after irradiation, in concentrations between 0-1.000 mg/ml. The dielectric behavior of the DNA-irradiation-crotonic acid interaction was investigated at T=20 0 C by pH, permittivity (dielectric constant) and conductivity measurements. The pH, permittivity and conductivity measurements exhibit that the effective and critical conditions for the DNA-irradiation-crotonic acid interaction are; low doses of irradiation (350 Rad.), low concentrations of crotonic acid (0.05-0.100 mg/ml) and the addition of crotonic acid 24 hours after the irradiation. These results support and are in good agreement with those results observed with mammalian cells and laboratory animals when the chemical carcinogens are given in conjunction with radiation

  5. Fluorescence quenching of graphene oxide combined with the site-specific cleavage of restriction endonuclease for deoxyribonucleic acid demethylase activity assay.

    Science.gov (United States)

    Ji, Lijuan; Qian, Yingdan; Wu, Ping; Zhang, Hui; Cai, Chenxin

    2015-04-15

    We report on the development of a sensitive and selective deoxyribonucleic acid (DNA) demethylase (using MBD2 as an example) activity assay by coupling the fluorescence quenching of graphene oxide (GO) with the site-specific cleavage of HpaII endonuclease to improve the selectivity. This approach was developed by designing a single-stranded probe (P1) that carries a binding region to facilitate the interaction with GO, which induces fluorescence quenching of the labeled fluorophore (FAM, 6-carboxyfluorescein), and a sensing region, which contains a hemi-methylated site of 5'-CmCGG-3', to specifically recognize the target (T1, a 32-mer DNA from the promoter region of p53 gene) and hybridize with it to form a P1/T1 duplex. After demethylation with MBD2, the duplex can be specifically cleaved using HpaII, which releases the labeled FAM from the GO surface and results in the recovery of fluorescence. However, this cleavage is blocked by the hemi-methylation of this site. Thus, the magnitude of the recovered fluorescence signal is related to the MBD2 activity, which establishes the basis of the DNA demethylase activity assay. This assay can determine as low as ∼(0.05±0.01) ng mL(-1) (at a signal/noise of 3) of MBD2 with a linear range of 0.2-300 ng mL(-1) and recognize MBD2 from other possibly coexisting proteins and cancer cell extracts. The advantage of this assay is its ability to avoid false signals and no requirement of bisulfite conversion, PCR amplification, radioisotope labeling, or separation. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Optoelectronic studies on heterocyclic bases of deoxyribonucleic acid for DNA photonics.

    Science.gov (United States)

    El-Diasty, Fouad; Abdel-Wahab, Fathy

    2015-10-01

    The optoelectronics study of large molecules, particularly π-stacking molecules, such as DNA is really an extremely difficult task. We perform first electronic structure calculations on the heterocyclic bases of 2'-deoxyribonucleic acid based on Lorentz-Fresnel dispersion theory. In the UV-VIS range of spectrum, many of the optoelectronic parameters for DNA four bases namely adenine, guanine, cytosine and thymine are calculated and discussed. The results demonstrate that adenine has the highest hyperpolarizability, whereas thymine has the lowest hyperpolarizability. Cytosine has the lower average oscillator energy and the higher lattice energy. Thymine infers the most stable nucleic base with the lower phonon energy. Thymine also has the highest average oscillator energy and the lower lattice energy. Moreover, the four nucleic acid bases have large band gap energies less than 5 eV with a semiconducting behavior. Guanine shows the smallest band gap and the highest Fermi level energy, whereas adenine elucidates the highest band gap energy. Copyright © 2015. Published by Elsevier B.V.

  7. Deoxyribonucleic acid synthesis in synchronized mammalian KB cells infected with herpes simplex virus.

    Science.gov (United States)

    Cohen, G H; Vaughan, R K; Lawrence, W C

    1971-06-01

    We examined the patterns of host cell and virus deoxyribonucleic acid (DNA) synthesis in synchronized cultures of KB cells infected at different stages of the cell cycle with herpes simplex virus (HSV). We found that the initiation of HSV DNA synthesis, we well as the production of new infectious virus, is independent of the S, G1, and G2 phases of the mitotic cycle of the host cell. This is in contrast to data previously found with equine abortion virus. Because HSV replicates independently of the cell cycle, we were able to establish conditions that would permit the study of rates of HSV DNA synthesized in logarithmically growing cells in the virtual absence of cellular DNA synthesis. This eliminates the need for separation of viral and cellular DNA by isopycnic centrifugation in CsCl. We found that HSV DNA synthesis was initiated between 2 to 3 hr after infection. The rate of DNA synthesis increased rapidly, reaching a maximum 4 hr after infection, and decreased to 50% of maximum by 8 hr. Evidence is also presented which suggests that HSV infection can inhibit both the ongoing synthesis of host DNA as well as the initiation of the S phase.

  8. The relationship between alterations in spermatozoal deoxyribonucleic acid, heparin binding sites, and semen quality.

    Science.gov (United States)

    Peluso, J J; Luciano, A A; Nulsen, J C

    1992-03-01

    To assess the relationship between spermatozoal deoxyribonucleic acid (DNA) and fertilizing potential. Semen samples were examined from nine fertile donors and six donors without a confirmed pregnancy. All samples were in the normal range for count, morphology, and motility. Spermatozoa from these specimens were stained with acridine orange or Feulgen's reagent. The presence of heparin binding sites was determined by counting the number of spermatozoa that bound to heparin-coated agarose beads. Acridine orange staining demonstrated that in the fertile group 42% +/- 2% of the spermatozoa fluoresced green indicating that the DNA was intact, whereas only 25% +/- 3% of the spermatozoa fluoresced green in the nonfertile group (P less than 0.05). Feulgen's staining revealed that more spermatozoa from infertile donors showed a heterogeneous DNA distribution (P less than 0.05). The DNA content of spermatozoa with heterogeneous distribution of DNA was reduced by 10% compared with those with homogeneous DNA (P less than 0.05). Normal spermatozoa as well as those with DNA anomalies possessed heparin binding sites. These data demonstrated that in donor specimens with normal counts, morphology, and motility, a higher percentage of spermatozoa possess less and/or denatured DNA in the infertile group compared with the fertile donors. In contrast, the surface membranes of spermatozoa with altered DNA have heparin binding sites as do spermatozoa with intact DNA.

  9. Hybridization of Deoxyribonucleic Acid and Immobilization of Green Fluorescent Protein on Nanostructured Organosilane Templates

    Science.gov (United States)

    Tanii, Takashi; Hosaka, Takumi; Miyake, Takeo; Kanari, Yuzo; Zhang, Guo-Jun; Funatsu, Takashi; Ohdomari, Iwao

    2005-07-01

    We propose a novel process for preferential immobilization of deoxyribonucleic acid (DNA) and green fluorescent protein (GFP) onto organosilane self-assembled monolayer (SAM) templates. One of the advantages of using the organosilane SAM as the template is that it is electron-beam sensitive and, by utilizing the SAM as an alternative resist film, we can make nanopatterns on a molecular scale because the proximity effect is negligible owing to the film’s thinness. An other advantage is that the organosilane SAM is repellent to both DNA and GFP. Thus, the patterned SAM can be utilized as the passivation film covering the outside of the pattern while DNA and GFP are immobilized within the pattern. We investigate two kinds of organosilane SAMs for the template. One is n-octadecyltrimethoxysilane (ODS) SAM, and the other is 1H,1H,2H,2H-perfluorodecyltriethoxysilane (FDS) SAM. Our results indicate that the ODS SAM is more repellent to DNA than the FDS SAM and is suitable for DNA immobilization, while the FDS SAM template is suitable for GFP immobilization via biotin-avidin coupling because the FDS SAM surface prevents the nonspecific adsorption of streptavidin. Although the nonspecific adsorption of DNA and GFP on a SAM is also recognized, by controlling both the concentration and the incubation time, we can immobilize DNA and GFP preferentially onto nanopatterns of 100 nm diameter.

  10. Photoreactions of ruthenium(II) and osmium(II) complexes with deoxyribonucleic acid (DNA).

    Science.gov (United States)

    Moucheron, C; Kirsch-De Mesmaeker, A; Kelly, J M

    1997-09-01

    The design of Ru(II) and Os(II) complexes which are photoreactive with deoxyribonucleic acid (DNA) represents one of the main targets for the development of novel molecular tools for the study of DNA and, in the future, for the production of new, metal-based, anti-tumor drugs. In this review, we explain how it is possible to make a complex photoreactive with nucleobases and nucleic acids. According to the photophysical behaviour of the Ru(II) compounds, two types of photochemistry are expected: (1) photosubstitution of a ligand by a nucleobase and another monodentate ligand, which takes place from the triplet, metal-centred (3MC) state; this state is populated thermally from the lowest lying triplet metal to ligand charge transfer (3MLCT) state; (2) photoreaction from the 3MLCT state, corresponding to photoredox processes with DNA bases. The two photoreactivities are in competition. By modulating appropriately the redox properties of the 3MLCT state, an electron transfer process from the base to the excited complex takes place, and is directly correlated with DNA cleavage or the formation of an adduct of the complex to DNA. In this adduct, guanine is linked by N2 to the alpha-position of a non-chelating nitrogen of the polyazaaromatic ligand without destruction of the complex. Different strategies are explained which increase the affinity of the complexes for DNA and direct the complex photoreactivity to sites of special DNA topology or targeted sequences of bases. Moreover, the replacement of the Ru(II) ion by the Os(II) ion in the photoreactive complexes leads to an increased specificity of photoreaction. Indeed, only one type of photoreactivity (from the 3MLCT state) is present for the Os(II) complexes because the 3MC state is too high in energy to be populated at room temperature.

  11. Superimposed Code Theoretic Analysis of Deoxyribonucleic Acid (DNA) Codes and DNA Computing

    Science.gov (United States)

    2010-01-01

    Polynucleotides Using Oligonucleotide Tags”, U.S. Patent No. 5,604,097, 1997 10. Brenner, S. et al., “ Gene Expression Analysis by Massively ... Parallel Signature Sequencing ( MPSS ) on Microbead Arrarys”, Nat. Biotechnol., 18, 2000, pp. 630-634. 11. Cai, H., P. White, D. Torney, A. Deshpande, Z... massive parallelism of DNA hybridization reactions can be exploited to construct a DNA based associative memory. Single strands of DNA are

  12. pH-responsive deoxyribonucleic acid capture/release by polydopamine functionalized magnetic nanoparticles

    International Nuclear Information System (INIS)

    Wang, Yu; Ma, Xiangdong; Ding, Chun; Jia, Li

    2015-01-01

    Highlights: • PDA@Fe 3 O 4 were prepared and applied for efficient extraction of DNA from pathogens. • The DNA capture and release by PDA@Fe 3 O 4 was pH-induced. • The adsorption capacity of PDA@Fe 3 O 4 for DNA was 161 mg g −1 . • PDA@Fe 3 O 4 based MSPE was combined with PCR and CE for rapid detection of pathogens. - Abstract: Polydopamine functionalized magnetic nanoparticles (PDA@Fe 3 O 4 ) were prepared and characterized by transmission electron microscopy, scanning electron microscopy, zeta potential and vibrating sample magnetometry. They were found to enable highly efficient capture of genomic deoxyribonucleic acid (DNA). The adsorption capacity of PDA@Fe 3 O 4 for genomic DNA can reach 161 mg g −1 . The extraction protocol used aqueous solutions for DNA binding to and releasing from the surface of the magnetic particles based on the pH inducing the charge switch of amino and phenolic hydroxyl groups on PDA@Fe 3 O 4 . The extracted DNA with high quality (A 260 /A 280 = 1.80) can be directly used as templates for polymerase chain reaction (PCR) followed by capillary electrophoresis (CE) analysis. None of the toxic chemical reagents and PCR inhibitors was used throughout the whole procedure. PDA@Fe 3 O 4 based magnetic solid phase extraction (MSPE) method was superior to those using commercial kit and traditional phenol–chloroform extraction methods in yield of DNA. The developed PDA@Fe 3 O 4 based MSPE-PCR-CE method was applied for simultaneous and fast detection of Listeria monocytogenes and Escherichia coli O157:H7 in milk

  13. A MapReduce approach to diminish imbalance parameters for big deoxyribonucleic acid dataset.

    Science.gov (United States)

    Kamal, Sarwar; Ripon, Shamim Hasnat; Dey, Nilanjan; Ashour, Amira S; Santhi, V

    2016-07-01

    In the age of information superhighway, big data play a significant role in information processing, extractions, retrieving and management. In computational biology, the continuous challenge is to manage the biological data. Data mining techniques are sometimes imperfect for new space and time requirements. Thus, it is critical to process massive amounts of data to retrieve knowledge. The existing software and automated tools to handle big data sets are not sufficient. As a result, an expandable mining technique that enfolds the large storage and processing capability of distributed or parallel processing platforms is essential. In this analysis, a contemporary distributed clustering methodology for imbalance data reduction using k-nearest neighbor (K-NN) classification approach has been introduced. The pivotal objective of this work is to illustrate real training data sets with reduced amount of elements or instances. These reduced amounts of data sets will ensure faster data classification and standard storage management with less sensitivity. However, general data reduction methods cannot manage very big data sets. To minimize these difficulties, a MapReduce-oriented framework is designed using various clusters of automated contents, comprising multiple algorithmic approaches. To test the proposed approach, a real DNA (deoxyribonucleic acid) dataset that consists of 90 million pairs has been used. The proposed model reduces the imbalance data sets from large-scale data sets without loss of its accuracy. The obtained results depict that MapReduce based K-NN classifier provided accurate results for big data of DNA. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  14. pH-responsive deoxyribonucleic acid capture/release by polydopamine functionalized magnetic nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yu; Ma, Xiangdong; Ding, Chun; Jia, Li, E-mail: jiali@scnu.edu.cn

    2015-03-03

    Highlights: • PDA@Fe{sub 3}O{sub 4} were prepared and applied for efficient extraction of DNA from pathogens. • The DNA capture and release by PDA@Fe{sub 3}O{sub 4} was pH-induced. • The adsorption capacity of PDA@Fe{sub 3}O{sub 4} for DNA was 161 mg g{sup −1}. • PDA@Fe{sub 3}O{sub 4} based MSPE was combined with PCR and CE for rapid detection of pathogens. - Abstract: Polydopamine functionalized magnetic nanoparticles (PDA@Fe{sub 3}O{sub 4}) were prepared and characterized by transmission electron microscopy, scanning electron microscopy, zeta potential and vibrating sample magnetometry. They were found to enable highly efficient capture of genomic deoxyribonucleic acid (DNA). The adsorption capacity of PDA@Fe{sub 3}O{sub 4} for genomic DNA can reach 161 mg g{sup −1}. The extraction protocol used aqueous solutions for DNA binding to and releasing from the surface of the magnetic particles based on the pH inducing the charge switch of amino and phenolic hydroxyl groups on PDA@Fe{sub 3}O{sub 4}. The extracted DNA with high quality (A{sub 260}/A{sub 280} = 1.80) can be directly used as templates for polymerase chain reaction (PCR) followed by capillary electrophoresis (CE) analysis. None of the toxic chemical reagents and PCR inhibitors was used throughout the whole procedure. PDA@Fe{sub 3}O{sub 4} based magnetic solid phase extraction (MSPE) method was superior to those using commercial kit and traditional phenol–chloroform extraction methods in yield of DNA. The developed PDA@Fe{sub 3}O{sub 4} based MSPE-PCR-CE method was applied for simultaneous and fast detection of Listeria monocytogenes and Escherichia coli O157:H7 in milk.

  15. O-6-methylguanine-deoxyribonucleic acid methyltransferase methylation enhances response to temozolomide treatment in esophageal cancer

    Directory of Open Access Journals (Sweden)

    Rifat Hasina

    2013-01-01

    Full Text Available Background: World-wide, esophageal cancer is a growing epidemic and patients frequently present with advanced disease that is surgically inoperable. Hence, chemotherapy is the predominate treatment. Cytotoxic platinum compounds are mostly used, but their efficacy is only moderate. Newer alkylating agents have shown promise in other tumor types, but little is known about their utility in esophageal cancer. Methods: We utilized archived human esophageal cancer samples and esophageal cancer cell lines to evaluate O-6-methylguanine-deoxyribonucleic acid methyltransferase (MGMT hypermethylation status and determined sensitivity to the alkylating drug temozolomide (TMZ. Immunoblot analysis was performed to determine MGMT protein expression in cell lines. To assess and confirm the effect of TMZ treatment in a methylated esophageal cancer cell line in vivo, a mouse flank xenograft tumor model was utilized. Results: Nearly 71% (12/17 of adenocarcinoma and 38% (3/8 of squamous cell carcinoma (SCC patient samples were MGMT hypermethylated. Out of four adenocarcinoma and nine SCC cell lines tested, one of each histology was hypermethylated. Immunoblot analyses confirmed that hypermethylated cell lines did not express the MGMT protein. In vitro cell viability assays showed the methylated Kyse-140 and FLO cells to be sensitive to TMZ at an IC 50 of 52-420 μM, whereas unmethylated cells Kyse-410 and SKGT-4 did not respond. In an in vivo xenograft tumor model with Kyse-140 cells, which are MGMT hypermethylated, TMZ treatment abrogated tumor growth by more than 60%. Conclusion: MGMT methylation may be an important biomarker in subsets of esophageal cancers and targeting by TMZ may be utilized to successfully treat these patients.

  16. Fluorescence quenching of graphene oxide combined with the site-specific cleavage of restriction endonuclease for deoxyribonucleic acid demethylase activity assay

    Energy Technology Data Exchange (ETDEWEB)

    Ji, Lijuan; Qian, Yingdan; Wu, Ping; Zhang, Hui; Cai, Chenxin, E-mail: cxcai@njnu.edu.cn

    2015-04-15

    Highlights: • An approach for sensitive and selective DNA demethylase activity assay is reported. • This assay is based on the fluorescence quenching of GO and site-specific cleavage of endonuclease. • It can determine as low as 0.05 ng mL{sup −1} of MBD2 with a linear range of 0.2–300 ng mL{sup −1}. • It has an ability to recognize MBD2 from other possibly coexisting proteins and cancer cell extracts. • It can avoid false signals, requiring no bisulfite conversion, PCR amplification, radioisotope-labeling. - Abstract: We report on the development of a sensitive and selective deoxyribonucleic acid (DNA) demethylase (using MBD2 as an example) activity assay by coupling the fluorescence quenching of graphene oxide (GO) with the site-specific cleavage of HpaII endonuclease to improve the selectivity. This approach was developed by designing a single-stranded probe (P1) that carries a binding region to facilitate the interaction with GO, which induces fluorescence quenching of the labeled fluorophore (FAM, 6-carboxyfluorescein), and a sensing region, which contains a hemi-methylated site of 5′-CmCGG-3′, to specifically recognize the target (T1, a 32-mer DNA from the promoter region of p53 gene) and hybridize with it to form a P1/T1 duplex. After demethylation with MBD2, the duplex can be specifically cleaved using HpaII, which releases the labeled FAM from the GO surface and results in the recovery of fluorescence. However, this cleavage is blocked by the hemi-methylation of this site. Thus, the magnitude of the recovered fluorescence signal is related to the MBD2 activity, which establishes the basis of the DNA demethylase activity assay. This assay can determine as low as ∼(0.05 ± 0.01) ng mL{sup −1} (at a signal/noise of 3) of MBD2 with a linear range of 0.2–300 ng mL{sup −1} and recognize MBD2 from other possibly coexisting proteins and cancer cell extracts. The advantage of this assay is its ability to avoid false signals and no

  17. Deoxyribonucleic acid initiation mutation dnaB252 is suppressed by elevated dnaC+ gene dosage.

    OpenAIRE

    Sclafani, R A; Wechsler, J A

    1981-01-01

    The Escherichia coli dnaB252 allele is the only dnaB mutation which confers a deoxyribonucleic acid initiation-defective phenotype on the cell. The presence of a multicopy hybrid plasmid containing the dnaC+ gene in a dnaB252 strain completely suppressed the temperature-sensitive phenotype. It is suggested that at high temperature the dnaB252 protein has a lowered affinity for dnaC protein, and that the formation of a dnaB-dnaC complex is mandatory for initiation.

  18. Identification of a Herbal Powder by Deoxyribonucleic Acid Barcoding and Structural Analyses.

    Science.gov (United States)

    Sheth, Bhavisha P; Thaker, Vrinda S

    2015-10-01

    Authentic identification of plants is essential for exploiting their medicinal properties as well as to stop the adulteration and malpractices with the trade of the same. To identify a herbal powder obtained from a herbalist in the local vicinity of Rajkot, Gujarat, using deoxyribonucleic acid (DNA) barcoding and molecular tools. The DNA was extracted from a herbal powder and selected Cassia species, followed by the polymerase chain reaction (PCR) and sequencing of the rbcL barcode locus. Thereafter the sequences were subjected to National Center for Biotechnology Information (NCBI) basic local alignment search tool (BLAST) analysis, followed by the protein three-dimension structure determination of the rbcL protein from the herbal powder and Cassia species namely Cassia fistula, Cassia tora and Cassia javanica (sequences obtained in the present study), Cassia Roxburghii, and Cassia abbreviata (sequences retrieved from Genbank). Further, the multiple and pairwise structural alignment were carried out in order to identify the herbal powder. The nucleotide sequences obtained from the selected species of Cassia were submitted to Genbank (Accession No. JX141397, JX141405, JX141420). The NCBI BLAST analysis of the rbcL protein from the herbal powder showed an equal sequence similarity (with reference to different parameters like E value, maximum identity, total score, query coverage) to C. javanica and C. roxburghii. In order to solve the ambiguities of the BLAST result, a protein structural approach was implemented. The protein homology models obtained in the present study were submitted to the protein model database (PM0079748-PM0079753). The pairwise structural alignment of the herbal powder (as template) and C. javanica and C. roxburghii (as targets individually) revealed a close similarity of the herbal powder with C. javanica. A strategy as used here, incorporating the integrated use of DNA barcoding and protein structural analyses could be adopted, as a novel

  19. Ex vivo gene editing of the dystrophin gene in muscle stem cells mediated by peptide nucleic acid single stranded oligodeoxynucleotides induces stable expression of dystrophin in a mouse model for Duchenne muscular dystrophy.

    Science.gov (United States)

    Nik-Ahd, Farnoosh; Bertoni, Carmen

    2014-07-01

    Duchenne muscular dystrophy (DMD) is a fatal disease caused by mutations in the dystrophin gene, which result in the complete absence of dystrophin protein throughout the body. Gene correction strategies hold promise to treating DMD. Our laboratory has previously demonstrated the ability of peptide nucleic acid single-stranded oligodeoxynucleotides (PNA-ssODNs) to permanently correct single-point mutations at the genomic level. In this study, we show that PNA-ssODNs can target and correct muscle satellite cells (SCs), a population of stem cells capable of self-renewing and differentiating into muscle fibers. When transplanted into skeletal muscles, SCs transfected with correcting PNA-ssODNs were able to engraft and to restore dystrophin expression. The number of dystrophin-positive fibers was shown to significantly increase over time. Expression was confirmed to be the result of the activation of a subpopulation of SCs that had undergone repair as demonstrated by immunofluorescence analyses of engrafted muscles using antibodies specific to full-length dystrophin transcripts and by genomic DNA analysis of dystrophin-positive fibers. Furthermore, the increase in dystrophin expression detected over time resulted in a significant improvement in muscle morphology. The ability of transplanted cells to return into quiescence and to activate upon demand was confirmed in all engrafted muscles following injury. These results demonstrate the feasibility of using gene editing strategies to target and correct SCs and further establish the therapeutic potential of this approach to permanently restore dystrophin expression into muscle of DMD patients. © 2014 AlphaMed Press.

  20. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  1. High mobility organic field-effect transistor based on water-soluble deoxyribonucleic acid via spray coating

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Wei; Han, Shijiao; Huang, Wei; Yu, Junsheng, E-mail: jsyu@uestc.edu.cn [State Key Laboratory of Electronic Thin Films and Integrated Devices, School of Optoelectronic Information, University of Electronic Science and Technology of China (UESTC), Chengdu 610054 (China)

    2015-01-26

    High mobility organic field-effect transistors (OFETs) by inserting water-soluble deoxyribonucleic acid (DNA) buffer layer between electrodes and pentacene film through spray coating process were fabricated. Compared with the OFETs incorporated with DNA in the conventional organic solvents of ethanol and methanol: water mixture, the water-soluble DNA based OFET exhibited an over four folds enhancement of field-effect mobility from 0.035 to 0.153 cm{sup 2}/Vs. By characterizing the surface morphology and the crystalline structure of pentacene active layer through atomic force microscope and X-ray diffraction, it was found that the adoption of water solvent in DNA solution, which played a key role in enhancing the field-effect mobility, was ascribed to both the elimination of the irreversible organic solvent-induced bulk-like phase transition of pentacene film and the diminution of a majority of charge trapping at interfaces in OFETs.

  2. Ability of Bacillus subtilis protoplasts to repair irradiated bacteriophage deoxyribonucleic acid via acquired and natural enzymatic systems

    International Nuclear Information System (INIS)

    Yasbin, R.E.; Andersen, B.J.; Sutherland, B.M.

    1981-01-01

    A novel form of enzyme therapy was achieved by utilizing protoplasts of Bacillus subtilis. Photoreactivating enzyme of Escherichia coli was successfully inserted into the protoplasts of B. subtilis treated with polyethylene glycol. This enzyme was used to photoreactivate ultraviolet-damaged bacteriophage deoxyribonucleic acid (DNA). Furthermore, in polyethylene glycol-treated protoplasts, ultraviolet-irradiated transfecting bacteriophage DNA was shown to be a functional substrate for the host DNA excision repair system. Previous results (R.E. Yasbin, J.D. Fernwalt, and P.I. Fields, J. Bacteriol.; 137: 391-396) showed that ultraviolet-irradiated bacteriophage DNA could not be repaired via the excision repair system of competent cells. Therefore, the processing of bacteriophage DNA by protoplasts and by competent cells must be different. This sensitive protoplast assay can be used to identify and to isolate various types of DNA repair enzymes

  3. Evaluation of deoxyribonucleic acid (DNA) isolated from human bloodstains exposed to ultraviolet light, heat, humidity, and soil contamination

    International Nuclear Information System (INIS)

    McNally, L.; Shaler, R.C.; Baird, M.; Balazs, I.; De Forest, P.; Kobilinsky, L.

    1989-01-01

    This study was designed to analyze the effects of common environmental insults on the ability to obtain deoxyribonucleic acid (DNA) restriction fragment-length polymorphisms (RFLP) patterns from laboratory prepared specimens. The environmental conditions studied include the exposure of dried bloodstains to varying amounts of relative humidity (0, 33, 67, and 98%), heat (37 degree C), and ultraviolet light for periods of up to five days. In addition, the effect of drying over a four-day period in whole blood collected with and without ethylenediaminetetraacetate (EDTA) was examined. The results of the study showed that, under the conditions studied, the integrity of DNA is not altered such that false RFLP patterns are obtained. The only effect observed was that the overall RFLP pattern becomes weaker, but individual RFLP fragments are neither created nor destroyed

  4. Influence of surfactant on dynamics of photoinduced motions and light emission of a dye-doped deoxyribonucleic acid

    Science.gov (United States)

    Sznitko, Lech; Parafiniuk, Kacper; Miniewicz, Andrzej; Rau, Ileana; Kajzar, Francois; Niziol, Jacek; Hebda, Edyta; Pielichowski, Jan; Sahraoui, Bouchta; Mysliwiec, Jaroslaw

    2013-10-01

    Pure deoxyribonucleic acid (DNA) is known to be soluble in water only and exhibits poor temperature stability. In contrary, it is well known that the complex of DNA - with cetyltrimethyl ammonium (CTMA) is insoluble in water but soluble in alcohols and can be processed into very good optical quality thin films by solution casting or spin deposition. Despite the success of DNA-CTMA, there is still need for new cationic surfactants which would extend the range of available solvents for DNA complex. We test and present experimental results of influence of new surfactants replacing CTMA in the DNA complex and based on benzalkonium chloride (BA) and didecyldimethylammonium chloride (DDCA) on their optical properties. Particularly, we were interested in all optical switching and light generation in amplified spontaneous emission process in these materials.

  5. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase.

    Science.gov (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias

    2017-06-02

    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.

    2002-01-01

    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit...

  7. Formation and rejoining of deoxyribonucleic acid double-strand breaks induced in isolated cell nuclei by antineoplastic intercalating agents.

    Science.gov (United States)

    Pommier, Y; Schwartz, R E; Kohn, K W; Zwelling, L A

    1984-07-03

    The biochemical characteristics of the formation and disappearance of intercalator-induced DNA double-strand breaks (DSB) were studied in nuclei from mouse leukemia L1210 cells by using filter elution methodology [Bradley, M. O., & Kohn, K.W. (1979) Nucleic Acids Res. 7, 793-804]. The three intercalators used were 4'-(9-acridinylamino)-methanesulfon-m-anisidide (m-AMSA), 5-iminodaunorubicin (5-ID), and ellipticine. These compounds differ in that they produced predominantly DNA single-strand breaks (SSB) (m-AMSA) or predominantly DNA double-strand breaks (ellipticine) or a mixture of both SSB and DSB (5-ID) in whole cells. In isolated nuclei, each intercalator produced DSB at a frequency comparable to that which is produced in whole cells. Moreover, these DNA breaks reversed within 30 min after drug removal. It thus appeared that neither ATP nor other nucleotides were necessary for intercalator-dependent DNA nicking-closing reactions. The formation of the intercalator-induced DSB was reduced at ice temperature. Break formation was also reduced in the absence of magnesium, at a pH above 6.4 and at NaCl concentrations above 200 mM. In the presence of ATP and ATP analogues, the intercalator-induced cleavage was enhanced. These results suggest that the intercalator-induced DSB are enzymatically mediated and that the enzymes involved in these reactions can catalyze DNA double-strand cleavage and rejoining in the absence of ATP, although the occupancy of an ATP binding site might convert the enzyme to a form more reactive to intercalators. Three inhibitors of DNA topoisomerase II--novobiocin, nalidixic acid, and norfloxacin--reduced the formation of DNA strand breaks.(ABSTRACT TRUNCATED AT 250 WORDS)

  8. Physical size of the donor locus and transmission of Haemophilus influenzae ampicillin resistance genes by deoxyribonucleic acid-mediated transformation

    International Nuclear Information System (INIS)

    Bendler, J.W. III

    1976-01-01

    The properties of donor deoxyribonucleic acid (DNA) from three clinical isolates and its ability to mediate the transformation of competent Rd strains to ampicillin resistance were examined. A quantitative technique for determining the resistance of individual Haemophilus influenzae cells to ampicillin was developed. When this technique was used, sensitive cells failed to tolerate levels of ampicillin greater than 0.1 to 0.2 μg/ml, whereas three resistant type b β-lactamase-producing strains could form colonies 1- to 3-μg/ml levels of the antibiotic. DNA extracted from the resistant strains elicited transformation of the auxotrophic genes in a multiply auxotrophic Rd strain. For two of the donors, transformation to ampicillin resistance occurred after the uptake of a single DNA molecule approximately 10 4 -fold less frequently than transformation of auxotrophic loci and was not observed to occur at all with the third. The frequency of transformation to ampicillin resistance was two- to fivefold higher in strain BC200 (Okinaka and Barnhart, 1974), which was cured of a defective prophage. All three clinical ampicillin-resistant strains were poor recipients, but the presence of the ampicillin resistant genes in strain BC200 did not reduce its competence

  9. A polymerase chain reaction (PCR) method for sex and species determination with novel controls for deoxyribonucleic acid (DNA) template length.

    Science.gov (United States)

    Gaensslen, R E; Berka, K M; Grosso, D A; Ruano, G; Pagliaro, E M; Messina, D; Lee, H C

    1992-01-01

    Human X and Y chromosome alpha-satellite sequences lying within higher order repeats were amplified by the polymerase chain reaction (PCR) in genomic deoxyribonucleic acid (DNA) isolated from blood, bone, and several other tissues and specimens of potential forensic science interest. X and Y sequences could be coamplified under some of the PCR conditions employed. Monomorphic sequences in the 3'-apolipoprotein B gene (designated "H") and in an alpha-satellite higher order repeat on Chromosome 17 (p17H8, D17Z1) were likewise amplified in the specimens. X and Y sequence amplification can provide information about the sex of origin. Amplification of the X, H, and D17Z1 sequences was found to be primate-specific among the common animals tested and can thus provide species of origin information about a specimen. The authors suggest that amplification of X and D17Z1 or H sequences might provide "relaxed" and "stringent" controls for appropriate PCR amplification tests on forensic science specimens. Testing was carried out using PCR protocols that employed Thermophilus aquaticus (Taq) and Thermus flavis (Replinase) thermostable DNA polymerases.

  10. Deoxyribonucleic Acid Damage and Repair: Capitalizing on Our Understanding of the Mechanisms of Maintaining Genomic Integrity for Therapeutic Purposes

    Directory of Open Access Journals (Sweden)

    Jolene Michelle Helena

    2018-04-01

    Full Text Available Deoxyribonucleic acid (DNA is the self-replicating hereditary material that provides a blueprint which, in collaboration with environmental influences, produces a structural and functional phenotype. As DNA coordinates and directs differentiation, growth, survival, and reproduction, it is responsible for life and the continuation of our species. Genome integrity requires the maintenance of DNA stability for the correct preservation of genetic information. This is facilitated by accurate DNA replication and precise DNA repair. DNA damage may arise from a wide range of both endogenous and exogenous sources but may be repaired through highly specific mechanisms. The most common mechanisms include mismatch, base excision, nucleotide excision, and double-strand DNA (dsDNA break repair. Concurrent with regulation of the cell cycle, these mechanisms are precisely executed to ensure full restoration of damaged DNA. Failure or inaccuracy in DNA repair contributes to genome instability and loss of genetic information which may lead to mutations resulting in disease or loss of life. A detailed understanding of the mechanisms of DNA damage and its repair provides insight into disease pathogeneses and may facilitate diagnosis and the development of targeted therapies.

  11. Detection of Low Level Microwave Radiation Induced Deoxyribonucleic Acid Damage Vis-à-vis Genotoxicity in Brain of Fischer Rats

    Science.gov (United States)

    Deshmukh, Pravin Suryakantrao; Megha, Kanu; Banerjee, Basu Dev; Ahmed, Rafat Sultana; Chandna, Sudhir; Abegaonkar, Mahesh Pandurang; Tripathi, Ashok Kumar

    2013-01-01

    Background: Non-ionizing radiofrequency radiation has been increasingly used in industry, commerce, medicine and especially in mobile phone technology and has become a matter of serious concern in present time. Objective: The present study was designed to investigate the possible deoxyribonucleic acid (DNA) damaging effects of low-level microwave radiation in brain of Fischer rats. Materials and Methods: Experiments were performed on male Fischer rats exposed to microwave radiation for 30 days at three different frequencies: 900, 1800 and 2450 MHz. Animals were divided into 4 groups: Group I (Sham exposed): Animals not exposed to microwave radiation but kept under same conditions as that of other groups, Group II: Animals exposed to microwave radiation at frequency 900 MHz at specific absorption rate (SAR) 5.953 × 10−4 W/kg, Group III: Animals exposed to 1800 MHz at SAR 5.835 × 10−4 W/kg and Group IV: Animals exposed to 2450 MHz at SAR 6.672 × 10−4 W/kg. At the end of the exposure period animals were sacrificed immediately and DNA damage in brain tissue was assessed using alkaline comet assay. Results: In the present study, we demonstrated DNA damaging effects of low level microwave radiation in brain. Conclusion: We concluded that low SAR microwave radiation exposure at these frequencies may induce DNA strand breaks in brain tissue. PMID:23833433

  12. Ion assisted structural collapse of a single stranded DNA: A molecular dynamics approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Soumadwip; Dixit, Himanshu; Chakrabarti, Rajarshi, E-mail: rajarshi@chem.iitb.ac.in

    2015-09-28

    Highlights: • The dynamics of a single-stranded DNA in presence of different concentrations of Mg{sup 2+} is investigated. • The initial DNA chain collapse is characterized by the formation of non-sequentially stacked base pairs. • The DNA chain re-swells at high concentrations of Mg{sup 2+} as a consequence of overcharging. - Abstract: The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counterions. It is well known that the structural collapse of DNA is favoured in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl{sub 2}) single stranded DNA with base sequence 5′-CGCGAATTCGCG-3′ (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  13. Intercalation of single-strand oligonucleotides between nucleolipid anionic membranes: a neutron diffraction study.

    Science.gov (United States)

    Milani, Silvia; Berti, Debora; Dante, Silvia; Hauss, Thomas; Baglioni, Piero

    2009-04-07

    This contribution presents a neutron diffraction investigation of anionic lamellar phases composed of mixtures of 1-palmitoyl, 2-oleoyl phosphatidyl-nucleosides (POPN, where N is either adenosine or uridine), and POPC (1-palmitoyl,2-oleoyl-phosphatidyl-choline). Their behavior is studied for two different mole ratios and in the presence of nucleic acids. The samples are formed by the evaporation of liposomal dispersions prepared in water or in solutions containing single-strand oligonucleotides. Previous small angle X-ray scattering (SAXS) experiments on the system POPA/polyU (polyuridylic acid, high degree of polymerization, synthetic ribonucleic acid) proved that the insertion and ordering of the biopolymer in the phospholipid lamellae were driven by molecular recognition. In the present study, we extend the previous investigation to single-strand monodisperse oligonucleotides (50-mers). Structural details of the membranes were obtained from the analysis of the neutron diffraction scattering length density profiles. The evidence of direct and specific interactions, driven by molecular recognition between the nucleic polar heads of the nucleolipid and the single-strand nucleic acid, is strengthened by the comparison with identically charged bilayers formed by POPG/POPC. These results contribute to the understanding of the parameters governing the interactions between nucleolipid membranes and oligonucleotides, providing a novel strategy for the design of lipid-based vehicles for nucleic acids.

  14. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    Science.gov (United States)

    Hong, Ka Lok

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  15. Clonal origin of multiple lung cancers: K-ras and p53 mutations determined by nonradioisotopic single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Lau, D H; Yang, B; Hu, R; Benfield, J R

    1997-08-01

    Disease stage is the most important factor in determining prognosis and treatment of lung cancer. Staging of lung cancer is complicated by presentation of multiple pulmonary malignant lesions with a similar histology. It is a dilemma to decide if these lesions are synchronous primaries arising from different malignant clones or metastases from a single clone. Lung cancer is associated with multiple genetic abnormalities including mutations of K-ras and p53, which are believed to occur prior to onset of metastasis. To determine the clonal origin of multiple pulmonary malginant nodules, we analyzed point-mutations of K-ras and p53 by microdissection, polymerase chain reactions (PCR), nonradioisotopic single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. Each pulmonary lesion was microdissected from paraffin slides. Genomic DNA was amplified by two sequential PCRs followed by electrophoresis in a minigel and silver staining. Deoxyribonucleic acid sequencing was performed if necessary to confirm a mutation found upon SSCP analysis. Applying this molecular approach, we were able to differentiate the clonal origins of multiple malignant nodules of the lung as exemplified by the two cases presented.

  16. Inhibition of Hsp27 Radiosensitizes Head-and-Neck Cancer by Modulating Deoxyribonucleic Acid Repair

    Energy Technology Data Exchange (ETDEWEB)

    Guttmann, David M.; Hart, Lori [Department of Radiation Oncology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania (United States); Du, Kevin [Department of Radiation Oncology, New York University School of Medicine, New York, New York (United States); Seletsky, Andrew [Department of Biology, Drexel University, Philadelphia, Pennsylvania (United States); Koumenis, Constantinos, E-mail: koumenis@xrt.upenn.edu [Department of Radiation Oncology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania (United States)

    2013-09-01

    Purpose: To present a novel method of tumor radiosensitization through Hsp27 knockdown using locked nucleic acid (LNA) and to investigate the role of Hsp27 in DNA double strand break (DSB) repair. Methods and Materials: Clonogenic survival assays, immunoblotting, the proximity ligation assay, and γH2AX foci analysis were conducted in SQ20B and FaDu human head-and-neck cancer cell lines treated with Hsp27 LNA and Hsp27 short hairpin RNA (shRNA). Additionally, nude mice with FaDu flank tumors were treated with fractionated radiation therapy after pretreatment with Hsp27 LNA and monitored for tumor growth. Results: Hsp27 LNA and Hsp27 shRNA radiosensitized head-and-neck cancer cell lines in an Hsp27-dependent manner. Ataxia-Telangectasia Mutated-mediated DNA repair signaling was impaired in irradiated cells with Hsp27 knockdown. ATM kinase inhibition abrogated the radiosensitizing effect of Hsp27. Furthermore, Hsp27 LNA and shRNA both attenuated DNA repair kinetics after radiation, and Hsp27 was found to colocalize with ATM in both untreated and irradiated cells. Last, combined radiation and Hsp27 LNA treatment in tumor xenografts in nude mice suppressed tumor growth compared with either treatment alone. Conclusions: These results support a radiosensitizing property of Hsp27 LNA in vitro and in vivo, implicate Hsp27 in double strand break repair, and suggest that Hsp27 LNA might eventually serve as an effective clinical agent in the radiotherapy of head-and-neck cancer.

  17. In vitro antioxidant potential and deoxyribonucleic acid protecting activity of CNB-001, a novel pyrazole derivative of curcumin

    Directory of Open Access Journals (Sweden)

    Richard L Jayaraj

    2014-01-01

    Full Text Available Background: Free radicals are underpinned to initiate cascade of toxic events leading to oxidative stress and resultant cell death in many neurodegenerative disorders. Now-a-days antioxidants have become mandatory in the treatment of various diseases apart from the drug′s modes of action. CNB-001, a novel hybrid molecule synthesized by combining curcumin and cyclohexyl bisphenol A is known to possess various biological activities, but the antioxidative property of the compound has not yet been elucidated. Aim: The present study is aimed to analyze various free radicals scavenging by employing in vitro antioxidant assays and to evaluate the deoxyribonucleic acid (DNA protecting the ability of CNB-001 against hydroxyl radicals. Materials and methods: The in vitro antioxidant potential of CNB-001 was evaluated by analyzing its ability to scavenge DPPH, ABTS, nitric oxide, superoxide, hydrogen peroxide, superoxide anion, hydroxyl, hydrogen peroxide radicals and reducing power using spectroscopic method. The DNA protecting activity of CNB-001 was also evaluated on pUC19 plasmid DNA subjected to hydroxyl radicals using standard agarose gel electrophoresis. Results: From the assays, it was observed that CNB-001 scavenged free radicals effectively in a dose dependent manner. CNB-001 scavenged 2,2-diphenyl-1-picrylhydrazyl (IC50 = 44.99 μg/ml, 2,2-azinobis (3-ethylbenzothiazoline-6-sulfonic acid (IC50 = 17.99 μg/ml, nitric oxide (IC50 = 1.36 μg/ml, superoxide radical (IC50 = 77.17 μg/ml, hydrogen peroxide (IC50 = 492.7 μg/ml, superoxide (IC50 = 36.92 μg/ml and hydroxyl (IC50 = 456.5 μg/ml radicals effectively and the reducing power was found to be 11.53 μg/ml. CNB-001 showed considerable protecting activity against plasmid DNA (pUC19 strand scission by ·OH at dose dependent manner. Conclusion: Results from these assays concluded that CNB-001 has a good antioxidant potential by reducing reactive oxygen and reactive nitrogen radicals and it

  18. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    Science.gov (United States)

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  19. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.

    1985-01-01

    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  20. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis.

    Science.gov (United States)

    Olszewski, Marcin; Mickiewicz, Małgorzata; Kur, Józef

    2008-07-01

    The thermophilic bacterium Thermoanaerobacter tengcongensis has two single-stranded DNA-binding (SSB) proteins, designated TteSSB2 and TteSSB3. In a SSB complementation assay in Escherichia coli, only TteSSB3 took over the in vivo function of EcoSSB. We have cloned the ssb genes obtained by PCR and have developed E. coli overexpression systems. The TteSSB2 and TteSSB3 consist of 153 and 150 amino acids with a calculated molecular mass of 17.29 and 16.96 kDa, respectively. They are the smallest known bacterial SSB proteins. The homology between amino acid sequences of these proteins is 40% identity and 53% similarity. They are functional as homotetramers, with each monomer encoding one single-stranded DNA binding domain (OB-fold). In fluorescence titrations with poly(dT), both proteins bind single-stranded DNA with a binding site size of about 40 nt per homotetramer. Thermostability with half-life of about 30 s at 95 degrees C makes TteSSB3 similar to the known SSB of Thermus aquaticus (TaqSSB). The TteSSB2 was fully active even after 6 h incubation at 100 degrees C. Here, we show for the first time paralogous thermostable homotetrameric SSBs, which could be an attractive alternative for known homodimeric thermostable SSB proteins in their applications for molecular biology methods and analytical purposes.

  1. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana.

    Science.gov (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L

    2005-04-01

    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  2. Improved single-strand DNA sizing accuracy in capillary electrophoresis.

    OpenAIRE

    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B

    1997-01-01

    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  3. Immobilization mechanisms of deoxyribonucleic acid (DNA) to hafnium dioxide (HfO2) surfaces for biosensing applications.

    Science.gov (United States)

    Fahrenkopf, Nicholas M; Rice, P Zachary; Bergkvist, Magnus; Deskins, N Aaron; Cady, Nathaniel C

    2012-10-24

    Immobilization of biomolecular probes to the sensing substrate is a critical step for biosensor fabrication. In this work we investigated the phosphate-dependent, oriented immobilization of DNA to hafnium dioxide surfaces for biosensing applications. Phosphate-dependent immobilization was confirmed on a wide range of hafnium oxide surfaces; however, a second interaction mode was observed on monoclinic hafnium dioxide. On the basis of previous materials studies on these films, DNA immobilization studies, and density functional theory (DFT) modeling, we propose that this secondary interaction is between the exposed nucleobases of single stranded DNA and the surface. The lattice spacing of monoclinic hafnium dioxide matches the base-to-base pitch of DNA. Monoclinic hafnium dioxide is advantageous for nanoelectronic applications, yet because of this secondary DNA immobilization mechanism, it could impede DNA hybridization or cause nonspecific surface intereactions. Nonetheless, DNA immobilization on polycrystalline and amorphous hafnium dioxide is predominately mediated by the terminal phosphate in an oriented manner which is desirable for biosensing applications.

  4. Study of the interaction of enzyme Heparanase 1 (HPSE1) active with deoxyribonucleic acids; Estudo de interacao da enzima Heparanase 1 (HPSE 1) ativa com acido desoxirribonucleicos

    Energy Technology Data Exchange (ETDEWEB)

    Cid, Gisele da Silva

    2016-07-01

    The human heparanase 1 (HPSE 1) is a protein with multiple functions and has emerged as a promising therapeutic target in the context of antitumor therapy. This fact is due to its clinical relevance in the tumor development and progression, as determined by their enzymatic ability to degrade heparan sulfate (HS), the main constituent of the extracellular matrix, providing a tumor microenvironment to tumor dissemination. In addition, this protein plays a significant role in the increase of tumor cells migration ionizing radiation dose delivery in radiotherapy from the increase in the expression levels of HPSE1. In order to evaluate in more detail the functions of active HPSE1, it has been proposed to characterize the interaction of human heparanase protein 1 with deoxyribonucleic acids. Our results are original and point to a new function of HPSE1 of the endonuclease type. (author)

  5. Effects of 5 Thio-D-Glucose on cellular adenosine triphosphate levels and deoxyribonucleic acid rejoining in hypoxic and aerobic Chinese hamster cells

    International Nuclear Information System (INIS)

    Nagle, W.A.; Moss, A.J. Jr.; Roberts, H.G. Jr.; Baker, M.L.

    1980-01-01

    Intracellular adenosine triphosphate (ATP) levels were measured in both hypoxic and aerobic cultures of V79 Chinese hamster cells treated with 5-thio-D-glucose (5-SH-D-Glc). This glucose analog, a known inhibitor of D-glucose transport and metabolism, reduced ATP in cell cultures allowed to become hypoxic by cell metabolism, but not in aerobic cultures treated similarly. Cells depleted of ATP were unable to rejoin x-ray induced deoxyribonucleic acid (DNA) strand breaks as measured by the alkaline sucrose gradient sedimentation technique. The inference for radiation therapy is that inhibition of glucose metabolism selectively depletes energy reserves in hypoxic cells, rendering these cells more radiosensitive and leading to a more effective tumor treatment

  6. Evaluation of Deoxyribonucleic Acid Toxicity Induced by the Radiopharmaceutical 99mTechnetium-Methylenediphosphonic Acid and by Stannous Chloride in Wistar Rats

    Directory of Open Access Journals (Sweden)

    Adriano Caldeira-de-Araujo

    2012-11-01

    Full Text Available Radiopharmaceuticals are employed in patient diagnostics and disease treatments. Concerning the diagnosis aspect, technetium-99m (99mTc is utilized to label radiopharmaceuticals for single photon computed emission tomography (SPECT due to its physical and chemical characteristics. 99mTc fixation on pharmaceuticals depends on a reducing agent, stannous chloride (SnCl2 being the most widely-utilized. The genotoxic, clastogenic and anegenic properties of the 99mTc-MDP(methylene diphosphonate used for bone SPECT and SnCl2 were evaluated in Wistar rat blood cells using the Comet assay and micronucleus test. The experimental approach was to endovenously administer NaCl 0.9% (negative control, cyclophosphamide 50 mg/kg b.w. (positive control, SnCl2 500 μg/mL or 99mTc-MDP to animals and blood samples taken immediately before the injection, 3, and 24 h after (in the Comet assay and 36 h after, for micronucleus test. The data showed that both SnCl2 and 99mTc-MDP-induced deoxyribonucleic acid (DNA strand breaks in rat total blood cells, suggesting genotoxic potential. The 99mTc-MDP was not able to induce a significant DNA strand breaks increase in in vivo assays. Taken together, the data presented here points to the formation of a complex between SnCl2 in the radiopharmaceutical 99mTc-MDP, responsible for the decrease in cell damage, compared to both isolated chemical agents. These findings are important for the practice of nuclear medicine.

  7. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  8. Programmable autonomous synthesis of single-stranded DNA

    Science.gov (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

    2018-02-01

    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  9. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    Science.gov (United States)

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  10. Elastic properties of alternative versus single-stranded leveling archwires.

    Science.gov (United States)

    Rucker, Brian K; Kusy, Robert P

    2002-11-01

    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  11. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    Science.gov (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Kinetics of viral deoxyribonucleic acid, protein, and infectious particle production and alterations in host macromolecular syntheses in equine abortion (herpes) virus-infected cells.

    Science.gov (United States)

    O'Callaghan, D J; Hyde, J M; Gentry, G A; Randall, C C

    1968-08-01

    Infection of exponential-phase suspension cultures of mouse fibroblast cells (L-M) with equine abortion virus (EAV) resulted in inhibition of cell growth and marked alterations in host metabolic processes. The synthesis of deoxyribonucleic acid (DNA) and ribonucleic acid was inhibited within 4 hr after infection and was suppressed by more than 90% by the time of maximal virus replication (14 to 18 hr). The overall rate of protein synthesis, however, was similar in uninfected and virus-producing cells as determined by measurements of net protein and isotope incorporation. The time course of viral DNA and protein synthesis and assembly into mature virus was determined with the inhibitors 5-fluorodeoxyuridine (FUdR) and cycloheximide, respectively. Thus, viral DNA synthesis was essentially completed at 14 hr, and viral protein and infectious virus synthesis was completed at 18 hr. Although the number of plaque-forming units (PFU) produced by FUdR-treated cells (10(3) to 10(4) PFU/ml) was at least 3 logs less than that produced by untreated cells, the yield of physical particles (as determined by electron microscopy) was approximately the same at 30 hr after infection. Besides being relatively non-infective, the particles produced in FUdR-treated cells appeared morphologically incomplete as they contained little or no nucleoid material.

  13. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian

    2012-07-06

    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  14. Evidence for a relationship between equine abortion (herpes) virus deoxyribonucleic acid synthesis and the S phase of the KB cell mitotic cycle.

    Science.gov (United States)

    Lawrence, W C

    1971-06-01

    Autoradiographic analyses of deoxyribonucleic acid (DNA) synthesis in randomly growing KB cell cultures infected with equine abortion virus (EAV) suggested that viral DNA synthesis was initiated only at times that coincided with the entry of noninfected control cells into the S phase of the cell cycle. Synchronized cultures of KB cells were infected at different stages of the cell cycle, and rates of synthesis of cellular and viral DNA were measured. When cells were infected at different times within the S phase, viral DNA synthesis was initiated 2 to 3 hr after infection. However, when cells in G1 and G2 were infected, the initiation of viral DNA synthesis was delayed and occurred only at times corresponding to the S phase. The times when viral DNA synthesis began were independent of the time of infection and differed by as much as 5 hr, depending on the stage of the cell cycle at which cells were infected. Viral one-step growth curves were also related to the S phase in a manner which indicated a relationship between the initiation of viral DNA synthesis and the S phase. These data support the concept that initiation of EAV DNA synthesis is dependent upon some cellular function(s) which is related to the S phase of the cell cycle.

  15. Detection of maternal deoxyribonucleic acid in umbilical cord plasma by using fluorescent polymerase chain reaction amplification of short tandem repeat sequences.

    Science.gov (United States)

    Bauer, Margit; Orescovic, Irmgard; Schoell, Wolfgang M; Bianchi, Diana W; Pertl, Barbara

    2002-01-01

    Umbilical cord blood is a source of hematopoietic stem cells for transplantation. Although the first clinical applications have been encouraging, concern has been raised about contamination of umbilical blood by maternal cells, which might constitute a theoretical risk of graft-versus-host disease. The aim of this study was to assess the frequency of maternal deoxyribonucleic acid (DNA) contamination in umbilical cord plasma by using fluorescent polymerase chain reaction amplification of highly polymorphic short tandem repeat DNA markers. Fifty-seven mother/child pairs were tested for the presence of maternal DNA sequences in cord plasma. After delivery, cord blood samples were collected via gravity. Maternal specific alleles were detected by using polymerase chain reaction amplification of 9 highly polymorphic short tandem repeat markers (D21S11, D21S1411, D21S1412, D18S386, D18S535, MBP-A, MBP-B, D13S631, and D13S634). All 57 mother-child pairs were informative for the identification of uniquely maternal alleles in at least 2 of 9 different short tandem repeat markers used per case. Uniquely maternal DNA sequences were found in 43 of 57 (75%) cord plasma samples. The results of our study demonstrate that maternal DNA is present in the majority of umbilical cord blood plasma samples. The technique described herein might have application in the screening of umbilical cord blood samples for the presence of contaminating maternal genetic material.

  16. Development of a chamber system for rapid, high yield and cost-effective purification of deoxyribonucleic acid fragments from agarose gel.

    Science.gov (United States)

    Eslami, Gilda; Salehi, Rasoul

    2014-01-01

    There are several methods commonly practicing for deoxyribonucleic acid (DNA) purification from agarose gel. In most laboratories, especially in developing countries, present methods for recovering of DNA fragments from the gel are mostly involved organic solvents. However, manual purification using organic solvents are toxic, labor intensive, time consuming and prone to contamination owing to several handling steps. The above mentioned burdens as well as cost and long time to import them, especially in developing countries, prompted us to design and develop a chamber system for rapid, non-toxic, cost-effective and user friendly device for polymerase chain reaction (PCR) products purification from agarose gel. The device was made from plexiglass plates. After amplification of two fragments of 250 and 850 bp, PCR products were electrophoresed. Subsequently, the desired bands were excised and purified with three method: HiPer Mini chamber, phenol extraction method and spin column procedure. To assess the suitability of the purified DNAs, restriction digestion was applied. Results showed that the yield of recovered DNA in our method was above 95%, whereas the yields obtained with conventional phenol extraction and spin column methods were around 60%. In conclusion, the current method for DNA elution is quick, inexpensive and robust and it does not require the use of toxic organic solvents. In addition, the purified DNA was well has suited for further manipulations such as restriction digestion, ligation, cloning, sequencing and hybridization.

  17. Carcinogenic damage to deoxyribonucleic acid is induced by near-infrared laser pulses in multiphoton microscopy via combination of two- and three-photon absorption

    Science.gov (United States)

    Nadiarnykh, Oleg; Thomas, Giju; Van Voskuilen, Johan; Sterenborg, Henricus J. C. M.; Gerritsen, Hans C.

    2012-11-01

    Nonlinear optical imaging modalities (multiphoton excited fluorescence, second and third harmonic generation) applied in vivo are increasingly promising for clinical diagnostics and the monitoring of cancer and other disorders, as they can probe tissue with high diffraction-limited resolution at near-infrared (IR) wavelengths. However, high peak intensity of femtosecond laser pulses required for two-photon processes causes formation of cyclobutane-pyrimidine-dimers (CPDs) in cellular deoxyribonucleic acid (DNA) similar to damage from exposure to solar ultraviolet (UV) light. Inaccurate repair of subsequent mutations increases the risk of carcinogenesis. In this study, we investigate CPD damage that results in Chinese hamster ovary cells in vitro from imaging them with two-photon excited autofluorescence. The CPD levels are quantified by immunofluorescent staining. We further evaluate the extent of CPD damage with respect to varied wavelength, pulse width at focal plane, and pixel dwell time as compared with more pronounced damage from UV sources. While CPD damage has been expected to result from three-photon absorption, our results reveal that CPDs are induced by competing two- and three-photon absorption processes, where the former accesses UVA absorption band. This finding is independently confirmed by nonlinear dependencies of damage on laser power, wavelength, and pulse width.

  18. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.

    1987-01-01

    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  19. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.

    1984-01-01

    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  20. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  1. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela

    2010-01-01

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  2. Ionizing radiation damage to the folded chromosome of Escherichia coli K-12: repair of double-strand breaks in deoxyribonucleic acid

    International Nuclear Information System (INIS)

    Ulmer, M.K.; Gomez, R.F.; Sinskevy, A.J.

    1979-01-01

    The extremely gentle lysis and unfolding procedures that have been developed for the isolation of nucleoid deoxyribonucleic acid yield undamaged, replicating genomes, thus permitting direct measurement of the formation and repair of DNA double-strand breaks at biologically significant doses of ionizing radiation. Repair of ionizing radiation damage to folded chromosomes of Escherichia coli K-12 strain AB2497 was observed within 2 to 3 h of post-irradiation incubation in growth medium. Such behavior was not observed after post-irradiation incubation in growth medium of a recA13 strain (strain AB2487). A model based on recombinational repair is proposed to explain the formation of 2,200 to 2,300S material during early stages of incubation and to explain subsequent changes in the gradient profiles. Association of unrepaired DNA with the plasma membrane is proposed to explain the formation of a peak of rapidly sedimenting material (greater than 3,100S) during the later stage of repair. Direct evidence of repair of double-strand breaks during post-irradiation incubation in growth medium was obtained from gradient profiles of DNA from ribonuclease-digested chromosomes. The sedimentation coefficient of broken molecules was restored to the value of unirradiated DNA after 2 to 3 h of incubation, and the fraction of the DNA repaired in this fashion was equal to the fraction of cells that survived at the same dose. An average of 2.7 double-strand breaks per genome per lethal event was observed, suggesting that one to two double-strand breaks per genome are repairable in E. coli K-12 strain AB2497

  3. Methylation changes in mature sperm deoxyribonucleic acid from oligozoospermic men: assessment of genetic variants and assisted reproductive technology outcome.

    Science.gov (United States)

    Montjean, Debbie; Ravel, Célia; Benkhalifa, Moncef; Cohen-Bacrie, Paul; Berthaut, Isabelle; Bashamboo, Anu; McElreavey, Kenneth

    2013-11-01

    To characterize a potential genetic cause for methylation errors described in oligozoospermia. Analysis of PEG1/MEST-DMR and H19-DMR methylation level in sperm, in parallel with the study of several genes on the Y chromosome, DNMT3A, and DNMT3L. Clinical outcome was also looked at regarding PEG1/MEST-DMR and H19-DMR methylation level in sperm. Research and diagnostic laboratories. One hundred nineteen normospermic and 175 oligozoospermic men consulting for couple infertility. We studied PEG1/MEST-DMR and H19-DMR methylation profiles in 294 men. We searched for Y chromosome gene aberrations and for mutations in both DNMT3A and DNMT3L genes in men showing epimutations. Assisted reproductive technology (ART) outcomes were also investigated. Sperm samples were collected from 294 volunteers for genomic DNA isolation that was used to study methylation profiles in imprinted loci and Y chromosome SMCY, DNMT3A, and DNMT3L genes. Pregnancy rate was also studied after ART treatment using sperm showing epimutations. Epimutations in H19-DMR and PEG1/MEST-DMR were found in 20% and 3% of oligozoospermic men, respectively. We identified an amino acid change in DNMT3A in one case and in DNMT3L in eight men with altered methylation profiles. No mutations were detected in SMCY or in selected Y chromsome genes. No correlation between ART outcome and epimutations was found. We observed epimethylations in spermatozoa of oligozoospermic individuals, but no association was found with genetic variants or in the ART outcome. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  4. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2003-01-01

    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  5. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.

    OpenAIRE

    Barany, F; Boeke, J D

    1983-01-01

    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  6. Constituents of the leaves of Woodfordia fruticosa Kurz. I. Isolation, structure, and proton and carbon-13 nuclear magnetic resonance signal assignments of woodfruticosin (woodfordin C), an inhibitor of deoxyribonucleic acid topoisomerase II.

    Science.gov (United States)

    Kadota, S; Takamori, Y; Nyein, K N; Kikuchi, T; Tanaka, K; Ekimoto, H

    1990-10-01

    Woodfruticosin (woodfordin C), a new cyclic dimeric hydrolyzable tannin having an inhibitory activity toward deoxyribonucleic acid (DNA) topoisomerase II, has been isolated from the leaves of Woodfordia fruticosa Kurz (Lythraceae) along with three known flavonol glycosides and three known flavonol glycoside gallates. The structure of wood fruticosin (woodfordin C) was determined by the use of two-dimensional nuclear magnetic resonance (2-D NMR) spectroscopy including heteronuclear multiple quantum coherence (HMQC) and heteronuclear multiple bond connectivity (HMBC) techniques. Detailed analyses of the proton and carbon-13 NMR (1H- and 13C-NMR) spectra of six known flavonoids were performed.

  7. Nucleic acid-binding glycoproteins which solubilize nucleic acids in dilute acid: re-examination of the Ustilago maydis glycoproteins

    Energy Technology Data Exchange (ETDEWEB)

    Unrau, P.; Champ, D.R.; Young, J.L.; Grant, C.E.

    1980-01-01

    Holloman reported the isolation from Ustilago maydis of a glycoprotein which prevented the precipitation of nucleic acids in cold 5% trichloroacetic acid. Two glycoprotein fractions from U. maydis with this nucleic acid-solubilizing activity were isolated in our laboratory using improved purification procedures. The activity was not due to nuclease contamination. The glycoproteins are distinguished by: their ability to bind to concanavalin A-Sepharose; their differential binding to double- and single-stranded deoxyribonucleic acid, and to ribonucleic acid; their molecular weights (46,000 and 69,000); and the relative amounts present in growing versus nongrowing cells. Both fractions required sulfhydryl-reducing conditions for optimal yields, specific activity, and stability. Nucleic acid binding was cooperative, the minimum number of glycoproteins required to make a native T7 DNA molecule soluble in dilute acid being estimated at 2 and 15, respectively.

  8. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol

    2010-05-01

    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  9. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks.

    Science.gov (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P

    2012-09-01

    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  10. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  11. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi

    1990-01-01

    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  12. A high throughput system for the preparation of single stranded templates grown in microculture.

    Science.gov (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M

    1994-01-01

    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  13. Complex shapes self-assembled from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng

    2012-05-30

    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  14. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)

    1994-09-01

    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  15. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der

    1988-01-01

    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  16. Dynamics of RecA filaments on single-stranded DNA

    NARCIS (Netherlands)

    Van Loenhout, M.T.J.; Van der Heijden, T.; Kanaar, R.; Wyman, C.; Dekker, C.

    2009-01-01

    RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on

  17. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2001-01-01

    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  18. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP

    1996-01-01

    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  19. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  20. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket.

    Science.gov (United States)

    Pham, Hanh T; Bergoin, Max; Tijssen, Peter

    2013-03-14

    The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  1. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket

    OpenAIRE

    Pham, Hanh T.; Bergoin, Max; Tijssen, Peter

    2013-01-01

    International audience; The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  2. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.

    1983-01-01

    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  3. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B

    2006-01-01

    by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  4. Theoretical Study of the Transpore Velocity Control of Single-Stranded DNA

    Directory of Open Access Journals (Sweden)

    Weixin Qian

    2014-08-01

    Full Text Available The electrokinetic transport dynamics of deoxyribonucleic acid (DNA molecules have recently attracted significant attention in various fields of research. Our group is interested in the detailed examination of the behavior of DNA when confined in micro/nanofluidic channels. In the present study, the translocation mechanism of a DNA-like polymer chain in a nanofluidic channel was investigated using Langevin dynamics simulations. A coarse-grained bead-spring model was developed to simulate the dynamics of a long polymer chain passing through a rectangular cross-section nanopore embedded in a nanochannel, under the influence of a nonuniform electric field. Varying the cross-sectional area of the nanopore was found to allow optimization of the translocation process through modification of the electric field in the flow channel, since a drastic drop in the electric potential at the nanopore was induced by changing the cross-section. Furthermore, the configuration of the polymer chain in the nanopore was observed to determine its translocation velocity. The competition between the strength of the electric field and confinement in the small pore produces various transport mechanisms and the results of this study thus represent a means of optimizing the design of nanofluidic devices for single molecule detection.

  5. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample.

    Science.gov (United States)

    Cui, Lunbiao; Wu, Binyao; Zhu, Xiaojuan; Guo, Xiling; Ge, Yiyue; Zhao, Kangchen; Qi, Xian; Shi, Zhiyang; Zhu, Fengcai; Sun, Lixin; Zhou, Minghao

    2017-11-01

    Metagenomic analysis through high-throughput sequencing is a tool for detecting both known and novel viruses. Using this technique, a novel circular single-stranded DNA (ssDNA) virus genome was discovered in respiratory secretions from a febrile traveler. The virus, named human respiratory-associated PSCV-5-like virus (HRAPLV), has a genome comprising 3,018 bases, with two major putative ORFs inversely encoding capsid (Cap) and replicase (Rep) protein and separated by two intergenic regions. One stem-loop structure was predicted in the larger intergenic region (LIR). The predicted amino acid sequences of the Cap and Rep proteins of HRAPLV showed highest identity to those of porcine stool-associated circular virus 5 isolate CP3 (PoSCV 5) (53.0% and 48.9%, respectively). The host tropism of the virus is unknown, and further study is warranted to determine whether this novel virus is associated with human disease.

  6. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Vrushali S. [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Gokhale, Suresh P.; Patil, Kashinath R. [Physical and Material Chemistry Division, National Chemical Laboratory, Pune (India); Haram, Santosh K., E-mail: haram@chem.unipune.ernet.i [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)

    2010-02-15

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 +- 2 mum and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, alpha-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k{sup 0}) and electron transfer coefficient (alpha) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  7. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    International Nuclear Information System (INIS)

    Joshi, Vrushali S.; Gokhale, Suresh P.; Patil, Kashinath R.; Haram, Santosh K.

    2010-01-01

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 ± 2 μm and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, α-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k 0 ) and electron transfer coefficient (α) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  8. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana.

    Science.gov (United States)

    Olszewski, Marcin; Grot, Anna; Wojciechowski, Marek; Nowak, Marta; Mickiewicz, Małgorzata; Kur, Józef

    2010-10-15

    In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. We report the characterization of single-stranded DNA binding proteins (SSBs) from the thermophilic bacteria Thermotoga maritima (TmaSSB) and Thermotoga neapolitana (TneSSB). They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively). They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold) in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC) the melting temperature (Tm) was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR).

  9. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata

    2010-10-01

    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  10. The Adsorption of Short Single-Stranded DNA Oligomers on Mineral Surfaces

    Science.gov (United States)

    Kopstein, M.; Sverjensky, D. A.; Hazen, R. M.; Cleaves, H. J.

    2009-12-01

    Previous studies have described feasible pathways for the synthesis of simple organic building blocks such as formaldehyde and hydrogen cyanide, and their reaction to form more complex biomolecules such as nucleotide bases, amino acids and sugars (Miller and Orgel 1974, Miller and Cleaves 2006). However, the polymerization of monomers into a useful genetic material remains problematic (Orgel 2004). Organic building blocks were unlikely to polymerize from very dilute aqueous solution in the primitive oceans. Mineral surface adsorption has been suggested as a possible mechanism for concentrating the necessary building blocks (Bernal 1951). This study focused on the adsorption behavior of single-stranded DNA homo-oligomers of adenine and thymine (including the monomers, dimers, tetramers, hexamers, octomers, and decamers) with five different mineral surfaces (pyrite, rutile, hematite, olivine and calcite). Adsorption was studied in 0.1 M pH 8.1 KHCO3 with0.05 M NaCl as background electrolyte. Solutions were mixed for 24 hours at room temperature, centrifuged and the supernatants analyzed by UV/visible spectrophotometry. Equilibrium solution concentrations were measured and used to determine the number of moles adsorbed per square meter. Langmuir isotherms were constructed using the experimental data. It was found that adenine-containing molecules tend to bind much more strongly than thymine-containing molecules. It was also found that the number of moles adsorbed at saturation tends to fall with increasing chain length, while adsorption affinity tends to rise. Oligomer length appears to affect adsorption more than the mineral type. These results may have implications for the primordial organization of the first nucleic acid molecules as the persistence of extra-cellular nucleic acids in the environment. References Bernal, J. D. (1951) The Physical Basis of Life (Routledge, London). Miller S.L. and Cleaves, H.J. (2006) Prebiotic chemistry on the primitive Earth. In

  11. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud

    2012-06-01

    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  12. Molecular cloning of otoconin-22 complementary deoxyribonucleic acid in the bullfrog endolymphatic sac: effect of calcitonin on otoconin-22 messenger ribonucleic acid levels.

    Science.gov (United States)

    Yaoi, Yuichi; Suzuki, Masakazu; Tomura, Hideaki; Sasayama, Yuichi; Kikuyama, Sakae; Tanaka, Shigeyasu

    2003-08-01

    Anuran amphibians have a special organ called the endolymphatic sac (ELS), containing many calcium carbonate crystals, which is believed to have a calcium storage function. The major protein of aragonitic otoconia, otoconin-22, which is considered to be involved in the formation of calcium carbonate crystals, has been purified from the saccule of the Xenopus inner ear. In this study, we cloned a cDNA encoding otoconin-22 from the cDNA library constructed for the paravertebral lime sac (PVLS) of the bullfrog, Rana catesbeiana, and sequenced it. The bullfrog otoconin-22 encoded a protein consisting of 147 amino acids, including a signal peptide of 20 amino acids. The protein had cysteine residues identical in a number and position to those conserved among the secretory phospholipase A(2) family. The mRNA of bullfrog otoconin-22 was expressed in the ELS, including the PVLS and inner ear. This study also revealed the presence of calcitonin receptor-like protein in the ELS, with the putative seven-transmembrane domains of the G protein-coupled receptors. The ultimobranchialectomy induced a prominent decrease in the otoconin-22 mRNA levels of the bullfrog PVLS. Supplementation of the ultimobranchialectomized bullfrogs with synthetic salmon calcitonin elicited a significant increase in the mRNA levels of the sac. These findings suggest that calcitonin secreted from the ultimobranchial gland, regulates expression of bullfrog otoconin-22 mRNA via calcitonin receptor-like protein on the ELS, thereby stimulating the formation of calcium carbonate crystals in the lumen of the ELS.

  13. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids.

    Science.gov (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R

    2015-04-08

    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  14. Charge enhancement of single-stranded DNA in negative electrospray ionization using the supercharging reagent meta-nitrobenzyl alcohol.

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1% m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1% m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  15. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  16. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.

    1985-01-01

    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  17. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.

    1982-01-01

    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  18. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification

    OpenAIRE

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-01-01

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen...

  19. In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides

    International Nuclear Information System (INIS)

    Oppenheim, Amos B.; Rattray, Alison J.; Bubunenko, Mikhail; Thomason, Lynn C.; Court, Donald L.

    2004-01-01

    We demonstrate that the bacteriophage λ Red functions efficiently recombine linear DNA or single-strand oligonucleotides (ss-oligos) into bacteriophage λ to create specific changes in the viral genome. Point mutations, deletions, and gene replacements have been created. While recombineering with oligonucleotides, we encountered other mutations accompanying the desired point mutational change. DNA sequence analysis suggests that these unwanted mutations are mainly frameshift deletions introduced during oligonucleotide synthesis

  20. Stretching and controlled motion of single-stranded DNA in locally heated solid-state nanopores.

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B; Aksimentiev, Aleksei

    2013-08-27

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4-8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA.

  1. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples.

    Science.gov (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J

    2006-03-01

    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  2. Repair of ultraviolet light damage in Saccharomyces cerevisiae as studied with double- and single-stranded incoming DNAs

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, D.; Hieda, K.

    1992-01-01

    Purified double- and single-stranded DNAs of the autonomously replicating vector M13RK9-T were irradiated with ultraviolet light (UV) in vitro and introduced into competent whole cells of Saccharomyces cerevisiae. Incoming double-stranded DNA was more sensitive to UV in excision repair-deficient rad2-1 cells than in proficient repair RAD + cells, while single-stranded DNA exhibited high sensitivity in both host cells. The results indicate that in yeast there is no effective rescue of UV-incoming single-stranded DNA by excision repair or other constitutive dark repair processes

  3. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks.

    Science.gov (United States)

    Pachkowski, Brian; Nakamura, Jun

    2013-01-01

    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  4. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy

    OpenAIRE

    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried

    2013-01-01

    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  5. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.

    1980-01-01

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  6. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth

    2014-01-01

    . We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices......Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells...

  7. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela

    2015-01-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  8. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted

    2014-01-01

    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  9. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams

    2014-01-01

    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  10. Identification and characterization of single-stranded DNA-binding protein from the facultative psychrophilic bacteria Pseudoalteromonas haloplanktis.

    Science.gov (United States)

    Olszewski, Marcin; Nowak, Marta; Cyranka-Czaja, Anna; Kur, Józef

    2014-01-01

    Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism such as DNA replication, repair, and recombination, and is essential for cell survival. This study reports on the ssb-like gene cloning, gene expression and characterization of a single-stranded DNA-binding protein of Pseudoalteromonas haloplanktis (PhaSSB) and is the first report of such a protein from psychrophilic microorganism. PhaSSB possesses a high sequence similarity to Escherichia coli SSB (48% identity and 57% similarity) and has the longest amino acid sequence (244 amino acid residues) of all the known bacterial SSBs with one OB-fold per monomer. An analysis of purified PhaSSB by means of chemical cross-linking experiments, sedimentation analysis and size exclusion chromatography revealed a stable tetramer in solution. Using EMSA, we characterized the stoichiometry of PhaSSB complexed with a series of ssDNA homopolymers, and the size of the binding site was determined as being approximately 35 nucleotides long. In fluorescence titrations, the occluded site size of PhaSSB on poly(dT) is 34 nucleotides per tetramer under low-salt conditions (2mM NaCl), but increases to 54-64 nucleotides at higher-salt conditions (100-300mM NaCl). This suggests that PhaSSB undergoes a transition between ssDNA binding modes, which is observed for EcoSSB. The binding properties of PhaSSB investigated using SPR technology revealed that the affinity of PhaSSB to ssDNA is typical of SSB proteins. The only difference in the binding mode of PhaSSB to ssDNA is a faster association phase, when compared to EcoSSB, though compensated by faster dissociation rate. When analyzed by differential scanning calorimetry (DSC), the melting temperature (Tm) was determined as 63 °C, which is only a few degrees lower than for EcoSSB. Copyright © 2013 Elsevier GmbH. All rights reserved.

  11. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng

    2015-05-08

    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  12. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora.

    Science.gov (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E

    2003-08-01

    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  13. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Science.gov (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  14. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification.

    Science.gov (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-10-07

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  15. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  16. Capillary electrophoresis ribosomal RNA single-stranded conformation polymorphism: a new approach for characterization of low-diversity microbial communities.

    Science.gov (United States)

    Nai, Yi H; Zemb, Oliver; Gutierrez-Zamora, Maria-Luisa; Manefield, Mike; Powell, Shane M; Breadmore, Michael C

    2012-10-01

    Capillary electrophoresis (CE) has been the principle system for nucleic acid analysis since the early 1990s due to its inherent advantages such as fast analysis time, high resolution and efficiency, minimal sample requirement, high detection sensitivity, and automation. In the past few decades, microbial community fingerprinting methods such as terminal restriction fragment length polymorphism and single-stranded conformation polymorphism (SSCP) have migrated to CE to utilize its advantages over conventional slab gel electrophoresis. Recently, a gel-based direct rRNA fingerprint method was demonstrated. Different from other existing microbial community characterization approaches, this novel approach is polymerase chain reaction free and capable of providing information on the relative abundance of rRNA from individual phylotypes in low-diversity samples. As a gel-based method, it has a long analysis time and relatively large reagent and sample requirements. Here, we addressed these limitations by transferring the RNA fingerprint approach to the CE platform. Analysis time significantly improved from 24 h to 60 min, and the use of a fluorescently labeled hybridization probe as the detection strategy decreased the sample requirement by ten-fold. The combination of fast analysis time, low sample requirement, and sensitive fluorescence detection makes CE-RNA-SSCP an appealing new approach for characterizing low-diversity microbial communities.

  17. Empirical model for matching spectrophotometric reflectance of yarn windings and multispectral imaging reflectance of single strands of yarns.

    Science.gov (United States)

    Luo, Lin; Shen, Hui-Liang; Shao, Si-Jie; Xin, John

    2015-08-01

    The state-of-the-art multispectral imaging system can directly acquire the reflectance of a single strand of yarn that is impossible for traditional spectrophotometers. Instead, the spectrophotometric reflectance of a yarn winding, which is constituted by yarns wound on a background card, is regarded as the yarn reflectance in textile. While multispectral imaging systems and spectrophotometers can be separately used to acquire the reflectance of a single strand of yarn and corresponding yarn winding, the quantitative relationship between them is not yet known. In this paper, the relationship is established based on models that describe the spectral response of a spectrophotometer to a yarn winding and that of a multispectral imaging system to a single strand of yarn. The reflectance matching function from a single strand of yarn to corresponding yarn winding is derived to be a second degree polynomial function, which coefficients are the solutions of a constrained nonlinear optimization problem. Experiments on 100 pairs of samples show that the proposed approach can reduce the color difference between yarn windings and single strands of yarns from 2.449 to 1.082 CIEDE2000 units. The coefficients of the optimal reflection matching function imply that the reflectance of a yarn winding measured by a spectrophotometer consists of not only the intrinsic reflectance of yarn but also the nonignorable interreflection component between yarns.

  18. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  19. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan

    2015-01-01

    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  20. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik

    1992-04-01

    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  1. Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Gust, I.D.; Feinstone, S.M.; Purcell, R.H.; Alter, H.J.

    1980-01-01

    A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

  2. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata).

    Science.gov (United States)

    Jackson, Elliot W; Bistolas, Kalia S I; Button, Jason B; Hewson, Ian

    2016-01-01

    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates.

  3. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.

    1980-01-01

    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  4. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux

    2016-12-01

    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  5. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  6. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif

    Science.gov (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  7. Isolation and characterization of a single-stranded DNA virus infecting the marine diatom Chaetoceros sp. strain SS628-11 isolated from western Japan.

    Directory of Open Access Journals (Sweden)

    Kei Kimura

    Full Text Available Diatoms are significant organisms for primary production in the earth's aquatic environment. Hence, their dynamics are an important focus area in current studies. Viruses are a great concern as potential factors of diatom mortality, along with other physical, chemical, and biological factors. We isolated and characterized a new diatom virus (Csp07DNAV that lyses the marine planktonic diatom Chaetoceros sp. strain SS628-11. This paper examines the physiological, morphological, and genomic characteristics of Csp07DNAV. The virus was isolated from a surface water sample that was collected at Hiroshima Bay, Japan. It was icosahedral, had a diameter of 34 nm, and accumulated in the nuclei of host cells. Rod-shaped virus particles also coexisted in the host nuclei. The latent period and burst size were estimated to be <12 h and 29 infectious units per host cell, respectively. Csp07DNAV had a closed circular single-stranded DNA genome (5,552 nucleotides, which included a double-stranded region and 3 open reading frames. The monophyly of Csp07DNAV and other Bacilladnavirus group single-stranded DNA viruses was supported by phylogenetic analysis that was based on the amino acid sequence of each virus protein. On the basis of these results, we considered Csp07DNAV to be a new member of the genus Bacilladnavirus.

  8. Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1

    DEFF Research Database (Denmark)

    Yang, Jay; Bachrati, Csanad Z; Ou, Jiongwen

    2010-01-01

    -passage mechanism. We generated single-stranded catenanes that resemble the proposed dissolution intermediate recognized by human topoisomerase IIIalpha. We demonstrate that human topoisomerase IIIalpha is a single-stranded DNA decatenase that is specifically stimulated by the BLM-RMI1 pair. In addition, RMI1......Human topoisomerase IIIalpha is a type IA DNA topoisomerase that functions with BLM and RMI1 to resolve DNA replication and recombination intermediates. BLM, human topoisomerase IIIalpha, and RMI1 catalyze the dissolution of double Holliday junctions into noncrossover products via a strand...

  9. Synthesis of a wild-type and three mutant Cucurbita maxima trypsin inhibitor-encoding genes by a single-strand approach.

    Science.gov (United States)

    Botes, D P; Qobose, M D; Corfield, V A

    1991-09-15

    A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.

  10. A comparative study on the interaction of phenazinium dyes with low pH induced protonated structure and B-form structure of naturally occurring deoxyribonucleic acid

    International Nuclear Information System (INIS)

    Pradhan, Ankur Bikash; Das, Shubhajit; Haque, Lucy; Bhuiya, Sutanwi; Das, Suman

    2016-01-01

    The interaction of two phenazinium dyes namely Phenosafranine (PSF) and Safranin T (ST) with right-handed B-form and left-handed protonated form of Calf Thymus (CT) DNA was investigated using different spectroscopic techniques. Both the dyes have been shown to bind strongly to the right-handed B-form of DNA by the mechanism intercalation as revealed from fluorescence quenching, circular dichroism (CD) and viscosity measurement. From circular dichroic studies it was evidenced that both of them convert the low pH induced left-handed protonated form of DNA back to the bound right-handed form. Scatchard analysis showed that both the dyes bound strongly to B-form of DNA in a non-cooperative manner. In case of protonated form, there was sequential conversion of the polynucleotide from left-handed to the bound right-handed conformation. Our results suggest that the binding environment of the dyes in the two forms of DNA is similar and our data predict that PSF is more effective in the conversion than ST. Experimental data enabled the calculation of the number of base pairs of protonated-form that adopted a right-handed conformation for each bound dye. Our data revealed that PSF is more effective in the conversion compard to that of ST. These results are attributed to greater steric crowd in ST compared to PSF which restricts the former to intercalate between DNA base pairs. The results of these studies allow a better understanding of dye-polymorphic nucleic acid interactions at a molecular level.

  11. Single stranded loops of quadruplex DNA as key benchmark for testing nucleic acids force fields

    Czech Academy of Sciences Publication Activity Database

    Fadrná, E.; Špačková, Naďa; Sarzynska, J.; Koča, J.; Orozco, M.; Cheatham III, T.E.; Kulinski, T.; Šponer, Jiří

    2009-01-01

    Roč. 5, č. 9 (2009), s. 2514-2530 ISSN 1549-9618 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802 Grant - others:GA ČR(CZ) GA203/09/1476 Program:GA Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA quadruplex * MD simulation * force fields Subject RIV: BO - Biophysics Impact factor: 4.804, year: 2009

  12. Assessing single-stranded oligonucleotide drug-induced effects in vitro reveals key risk factors for thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Sabine Sewing

    Full Text Available Single-stranded oligonucleotides (ON comprise a promising therapeutic platform that enables selective modulation of currently undruggable targets. The development of novel ON drug candidates has demonstrated excellent efficacy, but in certain cases also some safety liabilities were reported. Among them are events of thrombocytopenia, which have recently been evident in late stage trials with ON drugs. The underlying mechanisms are poorly understood and the risk for ON candidates causing such events cannot be sufficiently assessed pre-clinically. We investigated potential thrombocytopenia risk factors of ONs and implemented a set of in vitro assays to assess these risks. Our findings support previous observations that phosphorothioate (PS-ONs can bind to platelet proteins such as platelet collagen receptor glycoprotein VI (GPVI and activate human platelets in vitro to various extents. We also show that these PS-ONs can bind to platelet factor 4 (PF4. Binding to platelet proteins and subsequent activation correlates with ON length and connected to this, the number of PS in the backbone of the molecule. Moreover, we demonstrate that locked nucleic acid (LNA ribosyl modifications in the wings of the PS-ONs strongly suppress binding to GPVI and PF4, paralleled by markedly reduced platelet activation. In addition, we provide evidence that PS-ONs do not directly affect hematopoietic cell differentiation in culture but at higher concentrations show a pro-inflammatory potential, which might contribute to platelet activation. Overall, our data confirm that certain molecular attributes of ONs are associated with a higher risk for thrombocytopenia. We propose that applying the in vitro assays discussed here during the lead optimization phase may aid in deprioritizing ONs with a potential to induce thrombocytopenia.

  13. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.

    1988-01-01

    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  14. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.

    2012-01-01

    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  15. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues

    Science.gov (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak

    2006-01-01

    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  16. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes

    Science.gov (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.

    2015-01-01

    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  17. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos

    2015-09-01

    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  18. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair

    Science.gov (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.

    2009-01-01

    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  19. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-05

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity*

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.

    2015-01-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  1. Substrate-assisted 2D DNA lattices and algorithmic lattices from single-stranded tiles.

    Science.gov (United States)

    Kim, Junghoon; Ha, Tai Hwan; Park, Sung Ha

    2015-08-07

    We present a simple route to circumvent kinetic traps which affect many types of DNA nanostructures in their self-assembly process. Using this method, a new 2D DNA lattice made up of short, single-stranded tile (SST) motifs was created. Previously, the growth of SST DNA assemblies was restricted to 1D (tubes and ribbons) or finite-sized 2D (molecular canvases). By utilizing the substrate-assisted growth method, sets of SSTs were designed as unit cells to self-assemble into periodic and aperiodic 2D lattices which continuously grow both along and orthogonal to the helical axis. Notably, large-scale (∼1 μm(2)) fully periodic 2D lattices were fabricated using a minimum of just 2 strand species. Furthermore, the ability to create 2D lattices from a few motifs enables certain rules to be encoded into these SSTs to carry out algorithmic self-assembly. A set of these motifs was designed to execute simple 1-input 1-output COPY and NOT algorithms, the space-time manifestations which were aperiodic 2D algorithmic SST lattices. The methodology presented here can be straightforwardly applied to other motifs which fall into this type of kinetic trap to create novel DNA crystals.

  2. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.

    2007-01-01

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  3. Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems.

    Science.gov (United States)

    Musumeci, Domenica; Rozza, Lucia; Merlino, Antonello; Paduano, Luigi; Marzo, Tiziano; Massai, Lara; Messori, Luigi; Montesarchio, Daniela

    2015-08-21

    The interaction of the anticancer Ru(iii) complex AziRu - in comparison with its analogue NAMI-A, currently in advanced clinical trials as an antimetastatic agent - with DNA model systems, both single stranded and duplex oligonucleotides, was investigated using a combined approach, including absorption UV-vis spectroscopy, circular dichroism (CD) and electrospray mass spectrometry (ESI-MS) techniques. UV-vis absorption spectra of the Ru complexes were recorded at different times in a pseudo-physiological solution, to monitor the ligand exchange processes in the absence and in the presence of the examined oligonucleotides. CD experiments provided information on the overall conformational changes of the DNA model systems induced by these metal complexes. UV- and CD-monitored thermal denaturation studies were performed to analyse the effects of AziRu and NAMI-A on the stability of the duplex structures. ESI-MS experiments, carried out on the oligonucleotide/metal complex mixtures under investigation, allowed us to detect the formation of stable adducts between the guanine-containing oligomers and the ruthenium complexes. These data unambiguously demonstrate that both AziRu and NAMI-A can interact with the DNA model systems. Although very similar in their structures, the two metal compounds manifest a markedly different reactivity with the examined sequences, respectively, with either a naked Ru(3+) ion or a Ru(Im)(3+) (Im = imidazole) fragment being incorporated into the oligonucleotide structure via stable linkages.

  4. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop.

    Science.gov (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S

    2009-05-01

    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  5. Biophysical characterization of the association of histones with single-stranded DNA.

    Science.gov (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier

    2017-11-01

    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong

    2008-01-01

    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  7. Effect of Conformational Entropy on the Nanomechanics of Microcantilever-Based Single-Stranded DNA Sensors

    Directory of Open Access Journals (Sweden)

    Zou-Qing Tan

    2014-09-01

    Full Text Available An entropy-controlled bending mechanism is presented to study the nanomechanics of microcantilever-based single-stranded DNA (ssDNA sensors. First; the conformational free energy of the ssDNA layer is given with an improved scaling theory of thermal blobs considering the curvature effect; and the mechanical energy of the non-biological layer is described by Zhang’s two-variable method for laminated beams. Then; an analytical model for static deflections of ssDNA microcantilevers is formulated by the principle of minimum energy. The comparisons of deflections predicted by the proposed model; Utz–Begley’s model and Hagan’s model are also examined. Numerical results show that the conformational entropy effect on microcantilever deflections cannot be ignored; especially at the conditions of high packing density or long chain systems; and the variation of deflection predicted by the proposed analytical model not only accords with that observed in the related experiments qualitatively; but also appears quantitatively closer to the experimental values than that by the preexisting models. In order to improve the sensitivity of static-mode biosensors; it should be as small as possible to reduce the substrate stiffness.

  8. In vitro selection and characterization of single stranded DNA aptamers for luteolin: A possible recognition tool.

    Science.gov (United States)

    Tuma Sabah, Jinan; Zulkifli, Razauden Mohamed; Shahir, Shafinaz; Ahmed, Farediah; Abdul Kadir, Mohammed Rafiq; Zakaria, Zarita

    2018-03-06

    Distinctive bioactivities possessed by luteolin (3', 4', 5, 7-tetrahydroxy-flavone) are advantageous for sundry practical applications. This paper reports the in vitro selection and characterization of single stranded-DNA (ssDNA) aptamers, specific for luteolin (LUT). 76-mer library containing 1015 randomized ssDNA were screened via systematic evolution of ligands by exponential enrichment (SELEX). The recovered ssDNA pool from the 8th round was amplified with unlabeled primers and cloned into PSTBlue-1 vector prior to sequencing. 22 of LUT-binding aptamer variants were further classified into one of the seven groups based on their N40 random sequence regions, wherein one representative from each group was characterized. The dissociation constant of aptamers designated as LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively with high binding affinity towards LUT. Prediction analysis of the secondary structure suggested discrete features with typical loop and stem motifs. Furthermore, LUT#3 displayed higher specificity with insignificant binding toward kaempferol and quercetin despite its structural and functional similarity compared to LUT#28 and LUT#20. Further LUT#3 can detect free luteolin within 0.2-1 mM in solution. It was suggested that LUT#3 aptamer were the most suitable for LUT recognition tool at laboratory scale based on the condition tested. Copyright © 2018. Published by Elsevier Inc.

  9. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska

    2017-12-01

    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  10. Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages.

    Science.gov (United States)

    Kodaira, K; Godson, N G; Taketo, A

    1995-01-25

    The minus origins for complementary strand DNA synthesis (-ori) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, phi K, alpha 3, and St-1 closely resemble each other in DNA structure and contain two potential secondary hairpin loops (I and II) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the -ori regions of phi K and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the phi K mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several phi K and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway.

  11. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.

    1985-01-01

    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  12. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  13. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.

    1987-01-01

    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  14. Protocol optimization for deoxyribonucleic acid (DNA) extraction ...

    African Journals Online (AJOL)

    Arachis hypogaea L.) is particularly problematic due to the presence of phenolic compounds and polysaccharides. Inconsistencies in extraction results can be attributed to the age and growth stages of the plant material analyzed. Mature leaves ...

  15. Protocol optimization for deoxyribonucleic acid (DNA) extraction ...

    African Journals Online (AJOL)

    MUNAWAR ROOMI

    2013-12-18

    Dec 18, 2013 ... with three different methods cetyltrimethylammonium bromide (CTAB), sodium dodecyl sulfate (SDS), and cesium chloride ... The SDS based methodology give large quantities of DNA contaminated with polysaccharides. Fresh leaves also gave ... (added to the buffer just before use). Also with pure cold ...

  16. Protocol optimization for deoxyribonucleic acid (DNA) extraction ...

    African Journals Online (AJOL)

    MUNAWAR ROOMI

    2013-12-18

    Dec 18, 2013 ... canbeefficientlyremovedwithdoublewashingwithphenol: chloroform:isoamyl alcohol (Dipankar et al., 2006). The polyvinylpyrrolidone (PVP) containing modified CTAB buffer was also used for extraction of DNA from Tagetes minuta. In SDS-based extraction methodology, SDS does not bind with protein, thus ...

  17. Isolation of deoxyribonucleic acids (A Review)

    International Nuclear Information System (INIS)

    Garcia Pineda, M. de

    1974-01-01

    The criteria of choice in this Review have been to gather some of the last advances in the methodology of DNAs isolation; also the description of the generally accepted procedures has been emphasized. Only papers published before March 1974 are reviewed, because this work has been finished during this month. (Author) 109 refs

  18. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  19. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.

    1995-01-01

    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  20. Distinct circular single-stranded DNA viruses exist in different soil types.

    Science.gov (United States)

    Reavy, Brian; Swanson, Maud M; Cock, Peter J A; Dawson, Lorna; Freitag, Thomas E; Singh, Brajesh K; Torrance, Lesley; Mushegian, Arcady R; Taliansky, Michael

    2015-06-15

    The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  1. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  2. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

    Science.gov (United States)

    Richardson, Tomas T; Harran, Omar; Murray, Heath

    2016-06-16

    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

  3. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses.

    Science.gov (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn

    2011-06-01

    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  4. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  5. Electrical conduction and photoresponses of gamma-ray-irradiated single-stranded DNA/single-walled carbon nanotube composite systems

    Energy Technology Data Exchange (ETDEWEB)

    Hong, W.; Lee, E.M.; Kim, D.W.; Lee, Cheol Eui, E-mail: rscel@korea.ac.kr

    2015-04-15

    Highlights: •Effects of gamma-ray irradiation on single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. •Barrier for thermally activated conduction in the composite systems modified by the gamma-ray irradiation. •Photoresponses reveal photoexcitation and oxygen photodesorption modified by gamma-ray irradiation. -- Abstract: Effects of gamma-ray irradiation on the electrical conductivity and photoresponse have been studied for single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. The temperature-dependent electrical conductivity of the ssDNA/SWNT composite films, well described by a fluctuation-induced tunneling model, indicated modification of the barrier for thermally activated conduction by the gamma-ray irradiation. Besides, the photoresponse measurements indicated modified photoexcited charge carrier generation and oxygen photodesorption in the composite systems due to the gamma-ray irradiation.

  6. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.

    2006-01-01

    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  7. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    Science.gov (United States)

    2014-09-30

    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  8. Selective binding and reverse transcription inhibition of single-strand poly(A) RNA by metal TMPyP complexes.

    Science.gov (United States)

    Zhou, Zhu-Xin; Gao, Feng; Chen, Xing; Tian, Xiang-Jing; Ji, Liang-Nian

    2014-10-06

    Ni-, Cu-, and Zn-TMPyP are capable of binding to single-strand poly(A) RNA with high preference and affinity and inhibiting the reverse transcription of RNA by both M-MuLV and HIV-1 reverse transcriptase. With 10 nM azidothymidine, the IC50 value of M-TMPyP could be lowered to 10(-1) μM order.

  9. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.

    2013-01-01

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  10. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.

    1977-01-01

    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  11. Role of electrostatics in the assembly pathway of a single-stranded RNA virus.

    Science.gov (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M

    2014-09-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  12. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong

    2011-04-01

    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  13. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes

    OpenAIRE

    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  14. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity.

    Science.gov (United States)

    Monnet, Jordan; Kozelka, Jiří

    2012-10-01

    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris

    2016-01-01

    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA-binding pro......Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...... leads to enhanced cooperative binding to DNA.Conclusions: Our findings contribute to the emerging picture that bacterial proteins, exemplified here by SsbA, undergo phosphorylation at multiple residues. This results in a complex regulation of cellular functions, and suggests that the complexity...

  16. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  17. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide

    Science.gov (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio

    1998-01-01

    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  18. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism.

    Science.gov (United States)

    Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong

    2016-07-01

    A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.

  19. Characterization of the single-stranded DNA binding protein pV(VGJΦ) of VGJΦ phage from Vibrio cholerae.

    Science.gov (United States)

    Falero, Alina; Caballero, Andy; Trigueros, Sonia; Pérez, Celso; Campos, Javier; Marrero, Karen; Fando, Rafael

    2011-09-01

    pV(VGJΦ), a single-stranded DNA binding protein of the vibriophage VGJΦ was subject to biochemical analysis. Here, we show that this protein has a general affinity for single-stranded DNA (ssDNA) as documented by Electrophoretic Mobility Shift Assay (EMSA). The apparent molecular weight of the monomer is about 12.7kDa as measured by HPLC-SEC. Moreover, isoelectrofocusing showed an isoelectric point for pV(VGJΦ) of 6.82 pH units. Size exclusion chromatography in 150mM NaCl, 50mM sodium phosphate buffer, pH 7.0 revealed a major protein species of 27.0kDa, suggesting homodimeric protein architecture. Furthermore, pV(VGJΦ) binds ssDNA at extreme temperatures and the complex was stable after extended incubation times. Upon frozen storage at -20°C for a year the protein retained its integrity, biological activity and oligomericity. On the other hand, bioinformatics analysis predicted that pV(VGJΦ) protein has a disordered C-terminal, which might be involved in its functional activity. All the aforementioned features make pV(VGJΦ) interesting for biotechnological applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles.

    Science.gov (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng

    2015-11-21

    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  1. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  2. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.

    1978-01-01

    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  3. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: skim1@lsuhsc.edu [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  4. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee

    2012-01-01

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  5. Selection and Characterization of Single-Stranded DNA Aptamers Binding Human B-Cell Surface Protein CD20 by Cell-SELEX

    Directory of Open Access Journals (Sweden)

    Mansoureh Haghighi

    2018-03-01

    Full Text Available The B-lymphocyte antigen (CD20 is a suitable target for single-stranded (ss nucleic acid oligomer (aptamers. The aim of study was selection and characterization of a ssDNA aptamer against CD20 using Cell-Systematic Evolution of Ligands by Exponential Enrichment (Cell-SELEX. The cDNA clone of CD20 (pcDNA-CD20 was transfected to human embryonic kidney (HEK293T cells. Ten rounds of Cell-SELEX was performed on recombinant HEK-CD20 cells. The final eluted ssDNA pool was amplified and ligated in T/A vector for cloning. The plasmids of positive clones were extracted, sequenced and the secondary structures of the aptamers predicted using DNAMAN® software. The sequencing results revealed 10 different types; three of them had the highest thermodynamic stability, named AP-1, AP-2 and AP-3. The AP-1 aptamer was the most thermodynamically stable one (ΔGAP-1 = −10.87 kcal/mol with the highest binding affinity to CD20 (96.91 ± 4.5 nM. Since, the CD20 is a suitable target for recognition of B-Cell. The selected aptamers could be comparable to antibodies with many advantages. The AP-1, AP-2 and AP-3 could be candidate instead of antibodies for diagnostic and therapeutic applications in immune deficiency, autoimmune diseases, leukemia and lymphoma.

  6. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    Science.gov (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system.

    Science.gov (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus

    2011-04-06

    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  8. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail: meicun2006@163.com; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

    2016-12-01

    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  9. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  10. Metallization of Single-Stranded Polyl by Zn2+ Ions in Neutral Solutions

    Czech Academy of Sciences Publication Activity Database

    Sorokin, V. A.; Valeev, V. A.; Usenko, E. L.; Andrushchenko, Valery

    2014-01-01

    Roč. 118, č. 43 (2014), s. 12360-12365 ISSN 1520-6106 Institutional support: RVO:61388963 Keywords : nucleic acid metallization * zinc ion * differential UV spectroscopy Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.302, year: 2014

  11. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  12. Quenching of Single-Walled Carbon Nanotube Fluorescence by Dissolved Oxygen Reveals Selective Single-Stranded DNA Affinities.

    Science.gov (United States)

    Zheng, Yu; Bachilo, Sergei M; Weisman, R Bruce

    2017-05-04

    The selective interactions between short oligomers of single-stranded DNA (ssDNA) and specific structures of single-walled carbon nanotubes have been exploited in powerful methods for nanotube sorting. We report here that nanotubes coated with ssDNA also display selective interactions through the selective quenching of nanotube fluorescence by dissolved oxygen. In aqueous solutions equilibrated under 1 atm of O 2 , emission intensity from semiconducting nanotubes is reduced by between 9 and 40%, varying with the combination of ssDNA sequence and nanotube structure. This quenching reverses promptly and completely on the removal of dissolved O 2 and may be due to physisorption on nanotube surfaces. Fluorescence quenching offers a simple, nondestructive approach for studying the structure-selective interactions of ssDNA with single-walled carbon nanotubes and identifying recognition sequences.

  13. Surface treatment on amorphous InGaZnO4 thin film for single-stranded DNA biosensing

    Science.gov (United States)

    Sun, Dali; Matsui, Hiroaki; Wu, Chun-Nan; Tabata, Hitoshi

    2015-01-01

    Amorphous InGaZnO4 (aIGZO) has been widely used as a transparent semiconductor. However, no research has been found yet applying aIGZO to biosensing. This paper examined the single strand DNA (ssDNA) immobilization on aIGZO by absorption with a comparison to ITO, which is the first step for many biosensing schemas. The DNA quantification by florescence intensity shows that the absorption capacity of aIGZO film to ssDNA is 6.7 times greater than that of ITO. XPS and contact angle analysis proved the high DNA absorption affinity on aIGZO film is related to its high effectiveness to OH- attachment. A feasible method to immobilized ssDNA on aIGZO thin film is evaluated in this paper, and consequently, enables a possible approach to apply aIGZO in biosensing.

  14. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol

    2013-01-01

    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  15. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB).

    Science.gov (United States)

    van Loon, Barbara; Samson, Leona D

    2013-03-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  16. Aptamer based voltammetric determination of ampicillin using a single-stranded DNA binding protein and DNA functionalized gold nanoparticles.

    Science.gov (United States)

    Wang, Jun; Ma, Kui; Yin, Huanshun; Zhou, Yunlei; Ai, Shiyun

    2017-12-20

    An aptamer based method is described for the electrochemical determination of ampicillin. It is based on the use of DNA aptamer, DNA functionalized gold nanoparticles (DNA-AuNPs), and single-stranded DNA binding protein (ssDNA-BP). When the aptamer hybridizes with the target DNA on the AuNPs, the ssDNA-BP is captured on the electrode surface via its specific interaction with ss-DNA. This results in a decreased electrochemical signal of the redox probe Fe(CN) 6 3- which is measured best at a voltage of 0.188 mV (vs. reference electrode). In the presence of ampicillin, the formation of aptamer-ampicillin conjugate blocks the further immobilization of DNA-AuNPs and ssDNA-BP, and this leads to an increased response. The method has a linear reposne that convers the 1 pM to 5 nM ampicillin concentration range, with a 0.38 pM detection limit (at an S/N ratio of 3). The assay is selective, stable and reproducible. It was applied to the determination of ampicillin in spiked milk samples where it gave recoveries ranging from 95.5 to 105.5%. Graphical abstract Schematic of a simple and sensitive electrochemical apta-biosensor for ampicillin detection. It is based on the use of gold nanoparticles (AuNPs), DNA aptamer, DNA functionalized AuNPs (DNA-AuNPs), and single-strand DNA binding protein (SSBP).

  17. Nanopore sensors for nucleic acid analysis

    International Nuclear Information System (INIS)

    Nakane, Jonathan J; Akeson, Mark; Marziali, Andre

    2003-01-01

    In the past decade, nanometre-scale pores have been explored as the basis for technologies to analyse and sequence single nucleic acid molecules. Most approaches involve using such a pore to localize single macromolecules and interact with them to garner some information on their composition. Though nanopore sensors cannot yet claim success at deoxyribonucleic acid (DNA) sequencing, nanopore-based technologies offer one of the most promising approaches to single molecule detection and analysis. The majority of experimental work with nanopore detection of nucleic acids has involved the α-haemolysin (alpha-HL) ion channel a heptameric protein with a ∼2 nm diameter inner pore which allows translocation of single-stranded DNA. Analysis of externally induced ion current through the pore during its interaction with DNA can provide information about the DNA molecule, including length and base composition. This review focuses on alpha-HL and its applications to single-molecule detection. Modified alpha-HL and other biological and synthetic pores for macromolecule detection are also discussed, along with a brief summary of relevant theoretical work and numerical modelling of polymer-pore interaction. (topical review)

  18. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.

    1994-01-01

    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  19. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Genetic evidence for single-strand lesions initiating Nbs1-dependent homologous recombination in diversification of Ig v in chicken B lymphocytes.

    Directory of Open Access Journals (Sweden)

    Makoto Nakahara

    2009-01-01

    Full Text Available Homologous recombination (HR is initiated by DNA double-strand breaks (DSB. However, it remains unclear whether single-strand lesions also initiate HR in genomic DNA. Chicken B lymphocytes diversify their Immunoglobulin (Ig V genes through HR (Ig gene conversion and non-templated hypermutation. Both types of Ig V diversification are initiated by AID-dependent abasic-site formation. Abasic sites stall replication, resulting in the formation of single-stranded gaps. These gaps can be filled by error-prone DNA polymerases, resulting in hypermutation. However, it is unclear whether these single-strand gaps can also initiate Ig gene conversion without being first converted to DSBs. The Mre11-Rad50-Nbs1 (MRN complex, which produces 3' single-strand overhangs, promotes the initiation of DSB-induced HR in yeast. We show that a DT40 line expressing only a truncated form of Nbs1 (Nbs1(p70 exhibits defective HR-dependent DSB repair, and a significant reduction in the rate--though not the fidelity--of Ig gene conversion. Interestingly, this defective gene conversion was restored to wild type levels by overproduction of Escherichia coli SbcB, a 3' to 5' single-strand-specific exonuclease, without affecting DSB repair. Conversely, overexpression of chicken Exo1 increased the efficiency of DSB-induced gene-targeting more than 10-fold, with no effect on Ig gene conversion. These results suggest that Ig gene conversion may be initiated by single-strand gaps rather than by DSBs, and, like SbcB, the MRN complex in DT40 may convert AID-induced lesions into single-strand gaps suitable for triggering HR. In summary, Ig gene conversion and hypermutation may share a common substrate-single-stranded gaps. Genetic analysis of the two types of Ig V diversification in DT40 provides a unique opportunity to gain insight into the molecular mechanisms underlying the filling of gaps that arise as a consequence of replication blocks at abasic sites, by HR and error

  1. A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B.

    Directory of Open Access Journals (Sweden)

    Jeffrey A DeGrasse

    Full Text Available The bacterium Staphylococcus aureus is a common foodborne pathogen capable of secreting a cocktail of small, stable, and strain-specific, staphylococcal enterotoxins (SEs. Staphylococcal food poisoning (SFP results when improperly handled food contaminated with SEs is consumed. Gastrointestinal symptoms of SFP include emesis, diarrhea and severe abdominal pain, which manifest within hours of ingesting contaminated food. Immuno-affinity based methods directly detect, identify, and quantify several SEs within a food or clinical sample. However, the success of these assays depends upon the availability of a monoclonal antibody, the development of which is non-trivial and costly. The current scope of the available immuno-affinity based methods is limited to the classical SEs and does not encompass all of the known or emergent SEs. In contrast to antibodies, aptamers are short nucleic acids that exhibit high affinity and specificity for their targets without the high-costs and ethical concerns of animal husbandry. Further, researchers may choose to freely distribute aptamers and develop assays without the proprietary issues that increase the per-sample cost of immuno-affinity assays. This study describes a novel aptamer, selected in vitro, with affinity to staphylococcal enterotoxin B (SEB that may be used in lieu of antibodies in SE detection assays. The aptamer, designated APT(SEB1, successfully isolates SEB from a complex mixture of SEs with extremely high discrimination. This work sets the foundation for future aptamer and assay development towards the entire family of SEs. The rapid, robust, and low-cost identification and quantification of all of the SEs in S. aureus contaminated food is essential for food safety and epidemiological efforts. An in vitro generated library of SE aptamers could potentially allow for the comprehensive and cost-effective analysis of food samples that immuno-affinity assays currently cannot provide.

  2. Detection of hybridization of single-strand DNA PCR products in temperature change process by a novel metal-clamping piezoelectric sensor.

    Science.gov (United States)

    Chen, Qinghai; Bian, Zhiheng; Hua, Xing; Yao, Chunyan; Wu, Wei; Zhang, Xue; Zhang, Bo; Huang, Junfu; Tang, Wanli; Fu, Weiling

    2010-05-15

    Oligonucleotide probes on the sensor surface can be hybridized with single-strand DNA (ssDNA) that is formed from PCR products in ice bath after degeneration. Thus, detection of PCR products by piezoelectric sensors requires the participation of ssDNA PCR products in ice bath. When PCR products in ice bath are added into the buffer of the sensor well at room temperature, there will be a temperature change process during mixing. However, it still remains unclear whether the temperature change affects the frequency baseline stability of the sensor and the result judgment, which is the basic condition for detecting hybridization of nucleic acid. In this study, we detected the hybridization of HPV PCR products during temperature change process by a self-designed adjustable metal-clamping piezoelectric sensor. The study mainly involves sensor adjustment, probe immobilization and ice bath sample addition (at different concentrations and different volumes). The response curve of basic frequency in temperature change process showed three stages, i.e., increase, decrease to baseline, and continuous decrease to stability. The early increase of frequency and duration of the time can reach 55+/-7.4 Hz and 39 min when 40 microL sample (0-1 degrees C) was added into 110 microL buffer (25 degrees C). The frequency increase effect caused by temperature difference at early stage depends on the volume ratio of two liquids and on the temperature difference. The results indicate that we should pay more attention to possibly small volume of PCR products in ice bath and minor temperature difference of two liquids in operation. 2010 Elsevier B.V. All rights reserved.

  3. Gauging the Nanotoxicity of h2D-C2N toward Single-Stranded DNA: An in Silico Molecular Simulation Approach.

    Science.gov (United States)

    Mukhopadhyay, Titas Kumar; Bhattacharyya, Kalishankar; Datta, Ayan

    2018-04-12

    Recent toxicological assessments of graphene, graphene oxides, and some other two-dimensional (2D) materials have shown them to be substantially toxic at the nanoscale, where they inhibit and eventually disrupt biological processes. These shortfalls of graphene and analogs have resulted in a quest for novel biocompatible 2D materials with minimum cytotoxicity. In this article, we demonstrate C 2 N (h2D-C 2 N), a newly synthesized 2D porous graphene analog, to be non-nanotoxic toward genetic materials from an "in-silico" point of view through sequence-dependent binding of different polynucleotide single-stranded DNA (ssDNA) onto it. The calculated binding energy of nucleobases and the free energy of binding of polynucleotides follow the common trait, cytosine > guanine > adenine > thymine, and are well within the limits of physisorption. Ab-initio simulations completely exclude the possibility of any chemical reaction, demonstrating purely noncovalent binding of nucleobases with C 2 N through a crucial interplay between hydrogen bonding and π-stacking interactions with the surface. Further, we show that the extent of distortion inflicted upon ssDNA by C 2 N is negligible. Analysis of the density of states of the nucleobase-C 2 N hybrids confirms minimum electronic perturbation of the bases after adsorption. Most importantly, we demonstrate the potency of C 2 N in nucleic acid transportation via reversible binding of ssDNA. The plausible use of C 2 N as a template for DNA repair is illustrated through an example of C 2 N-assisted complementary ssDNA winding.

  4. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii.

    Science.gov (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten

    2012-01-01

    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  5. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der

    1978-01-01

    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  6. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.

    1982-01-01

    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  7. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

    1982-01-01

    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  8. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.

    2006-01-01

    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  9. Functional analysis of multiple single-stranded DNA-binding proteins from Methanosarcina acetivorans and their effects on DNA synthesis by DNA polymerase BI.

    Science.gov (United States)

    Robbins, Justin B; Murphy, Mary C; White, Bryan A; Mackie, Roderick I; Ha, Taekjip; Cann, Isaac K O

    2004-02-20

    Single-stranded DNA-binding proteins and their functional homologs, replication protein A, are essential components of cellular DNA replication, repair and recombination. We describe here the isolation and characterization of multiple replication protein A homologs, RPA1, RPA2, and RPA3, from the archaeon Methanosarcina acetivorans. RPA1 comprises four single-stranded DNA-binding domains, while RPA2 and RPA3 are each composed of two such domains and a zinc finger domain. Gel filtration analysis suggested that RPA1 exists as homotetramers and homodimers in solution, while RPA2 and RPA3 form only homodimers. Unlike the multiple RPA proteins found in other Archaea and eukaryotes, each of the M. acetivorans RPAs can act as a distinct single-stranded DNA-binding protein. Fluorescence resonance energy transfer and fluorescence polarization anisotropy studies revealed that the M. acetivorans RPAs bind to as few as 10 single-stranded DNA bases. However, more stable binding is achieved with single-stranded DNA of 18-23 bases, and for such substrates the estimated Kd was 3.82 +/- 0.28 nM, 173.6 +/- 105.17 nM, and 5.92 +/- 0.23 nM, for RPA1, RPA2, and RPA3, respectively. The architectures of the M. acetivorans RPAs are different from those of hitherto reported homologs. Thus, these proteins may represent novel forms of replication protein A. Most importantly, our results show that the three RPAs and their combinations highly stimulate the primer extension capacity of M. acetivorans DNA polymerase BI. Although bacterial SSB and eukaryotic RPA have been shown to stimulate DNA synthesis by their cognate DNA polymerases, our findings provide the first in vitro biochemical evidence for the conservation of this property in an archaeon.

  10. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  11. EFFECTOR OF TRANSCRIPTION2 is involved in xylem differentiation and includes a functional DNA single strand cutting domain.

    Science.gov (United States)

    Ivanov, Rumen; Tiedemann, Jens; Czihal, Andreas; Schallau, Anna; Diep, Le Hong; Mock, Hans-Peter; Claus, Bernhard; Tewes, Annegret; Bäumlein, Helmut

    2008-01-01

    EFFECTORS OF TRANSCRIPTION2 (ET) are plant-specific regulatory proteins characterized by the presence of two to five C-terminal DNA- and Zn-binding repeats, and a highly conserved cysteine pattern. We describe the structural characterization of the three member Arabidopsis thaliana ET gene family and reveal some allelic sequence polymorphisms. A mutation analysis showed that AtET2 affects the expression of various KNAT genes involved in the maintenance of the undifferentiated state of cambial meristem cells. It also plays a role in the regulation of GA5 (gibberellin 3-beta-dioxygenase) and the cell-cycle-related GASA4. A correlation was established between AtET2 expression and the cellular differentiation state. AtET-GFP fusion proteins shuttle between the cytoplasm and nucleus, with the AtET2 product prevented from entering the nucleus in non-differentiating cells. Within the nucleus, AtET2 probably acts via a single strand cutting domain. A more general regulatory role for ET factors is proposed, governing cell differentiation in cambial meristems, a crucial process for the development of plant vascular tissues.

  12. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)

    2012-04-04

    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  13. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)

    2015-04-22

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  14. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.

    1985-01-01

    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  15. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA

    Science.gov (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana

    2009-04-01

    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  16. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia

    2009-01-01

    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  17. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))

    1993-03-01

    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  18. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA.

    Science.gov (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi

    2008-03-28

    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  19. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  20. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  1. Alpha-Helical Fragaceatoxin C Nanopore Engineered for Double-Stranded and Single-Stranded Nucleic Acid Analysis

    NARCIS (Netherlands)

    Wloka, Carsten; Mutter, Natalie Lisa; Soskine, Misha; Maglia, Giovanni

    2016-01-01

    Nanopores are used in single-molecule DNA analysis and sequencing. Herein, we show that Fragaceatoxin C (FraC), an α-helical pore-forming toxin from an actinoporin protein family, can be reconstituted in sphingomyelin-free standard planar lipid bilayers. We engineered FraC for DNA analysis and show

  2. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA.

    Science.gov (United States)

    Rogers, Cody M; Bochman, Matthew L

    2017-05-13

    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold.

    Science.gov (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G

    2005-05-24

    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  4. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage

    Science.gov (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio

    1998-01-01

    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  5. Slowing single-stranded DNA translocation through a solid-state nanopore by decreasing the nanopore diameter.

    Science.gov (United States)

    Akahori, Rena; Haga, Takanobu; Hatano, Toshiyuki; Yanagi, Itaru; Ohura, Takeshi; Hamamura, Hirotaka; Iwasaki, Tomio; Yokoi, Takahide; Anazawa, Takashi

    2014-07-11

    To slow the translocation of single-stranded DNA (ssDNA) through a solid-state nanopore, a nanopore was narrowed, and the effect of the narrowing on the DNA translocation speed was investigated. In order to accurately measure the speed, long (5.3 kb) ssDNA (namely, ss-poly(dA)) with uniform length (±0.4 kb) was synthesized. The diameters of nanopores fabricated by a transmission electron microscope were controlled by atomic-layer deposition. Reducing the nanopore diameter from 4.5 to 2.3 nm slowed down the translocation of ssDNA by more than 16 times (to 0.18 μs base(-1)) when 300 mV was applied across the nanopore. It is speculated that the interaction between the nanopore and the ssDNA dominates the translocation speed. Unexpectedly, the translocation speed of ssDNA through the 4.5 nm nanopore is more than two orders of magnitude higher than that of double-stranded DNA (dsDNA) through a nanopore of almost the same size. The cause of such a faster translocation of ssDNA can be explained by the weaker drag force inside the nanopore. Moreover, the measured translocation speeds of ssDNA and dsDNA agree well with those calculated by molecular-dynamics (MD) simulation. The MD simulation predicted that reducing the nanopore diameter to almost the same as that of ssDNA (i.e. 1.4 nm) decreases the translocation speed (to 1.4 μs base(-1)). Narrowing the nanopore is thus an effective approach for accomplishing nanopore DNA sequencing.

  6. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  7. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler

    2007-12-01

    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  8. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines.

    Science.gov (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao

    2017-07-01

    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  9. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA.

    Science.gov (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee

    2011-03-24

    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  10. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis.

    Science.gov (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J

    2012-01-01

    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  12. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.

    1992-01-01

    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  13. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  14. Synthesis of a gene for the HIV transactivator protein TAT by a novel single stranded approach involving in vivo gap repair.

    OpenAIRE

    Adams, S E; Johnson, I D; Braddock, M; Kingsman, A J; Kingsman, S M; Edwards, R M

    1988-01-01

    The synthesis of a gene for the HIV TAT protein is described using a novel approach that capitalises on the ability to synthesise oligonucleotides of greater than 100 bp in length. It involves the synthesis of large oligomers covering one strand of the desired gene in its entirety and the use of small complementary bridging and adapter oligonucleotides to direct the assembly and cloning of the large oligomers. After ligation to the cloning vector the partially single stranded intermediate is ...

  15. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers

    OpenAIRE

    Antolin, M. F.; Bosio, C. F.; Cotton, J.; Sweeney, W.; Strand, M. R.; Black-IV, W. C.

    1996-01-01

    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  16. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr

    2015-01-01

    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single- strand ed DNA -binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  17. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.

    1979-10-01

    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  18. Escherichia coli Single-Stranded DNA-Binding Protein: NanoESI-MS Studies of Salt-Modulated Subunit Exchange and DNA Binding Transactions

    Science.gov (United States)

    Mason, Claire E.; Jergic, Slobodan; Lo, Allen T. Y.; Wang, Yao; Dixon, Nicholas E.; Beck, Jennifer L.

    2013-02-01

    Single-stranded DNA-binding proteins (SSBs) are ubiquitous oligomeric proteins that bind with very high affinity to single-stranded DNA and have a variety of essential roles in DNA metabolism. Nanoelectrospray ionization mass spectrometry (nanoESI-MS) was used to monitor subunit exchange in full-length and truncated forms of the homotetrameric SSB from Escherichia coli. Subunit exchange in the native protein was found to occur slowly over a period of hours, but was significantly more rapid in a truncated variant of SSB from which the eight C-terminal residues were deleted. This effect is proposed to result from C-terminus mediated stabilization of the SSB tetramer, in which the C-termini interact with the DNA-binding cores of adjacent subunits. NanoESI-MS was also used to examine DNA binding to the SSB tetramer. Binding of single-stranded oligonucleotides [one molecule of (dT)70, one molecule of (dT)35, or two molecules of (dT)35] was found to prevent SSB subunit exchange. Transfer of SSB tetramers between discrete oligonucleotides was also observed and is consistent with predictions from solution-phase studies, suggesting that SSB-DNA complexes can be reliably analyzed by ESI mass spectrometry.

  19. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  20. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.

    1992-01-01

    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  1. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  2. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: simonaclichici@yahoo.com [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)

    2012-03-15

    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  3. Cytotoxicity of alkylating agents towards sensitive and resistant strains of Escherichia coli in relation to extent and mode of alkylation of cellular macromolecules and repair of alkylation lesions in deoxyribonucleic acids.

    Science.gov (United States)

    Lawley, P D; Brookes, P

    1968-09-01

    1. A quantitative study was made of the relationship between survival of colony-forming ability in Escherichia coli strains B/r and B(s-1) and the extents of alkylation of cellular DNA, RNA and protein after treatment with mono- or di-functional sulphur mustards, methyl methanesulphonate or iodoacetamide. 2. The mustards and methyl methanesulphonate react with nucleic acids in the cells, in the same way as found previously from chemical studies in vitro, and with proteins. Iodoacetamide reacts only with protein, principally with the thiol groups of cysteine residues. 3. The extents of alkylation of cellular constituents required to prevent cell division vary widely according to the strain of bacteria and the nature of the alkylating agent. 4. The extents of alkylation of the sensitive and resistant strains at a given dose of alkylating agent do not differ significantly. 5. Removal of alkyl groups from DNA of cells of the resistant strains B/r and 15T(-) after alkylation with difunctional sulphur mustard was demonstrated; the product di(guanin-7-ylethyl) sulphide, characteristic of di- as opposed to mono-functional alkylation, was selectively removed; the time-scale of this effect suggests an enzymic rather than a chemical mechanism. 6. The sensitive strain B(s-1) removed alkyl groups from DNA in this way only at very low extents of alkylation. When sensitized to mustard action by treatment with iodoacetamide, acriflavine or caffeine, the extent of alkylation of cellular DNA corresponding to a mean lethal dose was decreased to approximately 3 molecules of di(guanin-7-ylethyl) sulphide in the genome of this strain. 7. Relatively large numbers of monofunctional alkylations per genome can be withstood by this sensitive strain. Iodoacetamide had the weakest cytotoxic action of the agents investigated; methyl methanesulphonate was significantly weaker in effect than the monofunctional sulphur mustard, which was in turn weaker than the difunctional sulphur mustard. 8

  4. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus

    Science.gov (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.

    2016-01-01

    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  5. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  6. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.

    1989-01-01

    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  7. A single-stranded RNA copy of the Giardia lamblia virus double-stranded RNA genome is present in the infected Giardia lamblia.

    OpenAIRE

    Furfine, E S; White, T C; Wang, A L; Wang, C C

    1989-01-01

    An isolate of Giardia lamblia infected with the double-stranded RNA virus (GLV) has two major species of RNA that are not present in an uninfected isolate. One of these species is the previously characterized double-stranded RNA genome of GLV (1). The second species of RNA appears to be a full length copy of one strand of the double-stranded RNA genome. This full length single-stranded RNA is not present in viral particles isolated from the growth medium. The cellular concentration of the sin...

  8. Amplification of deoxyribonucleic acid (DNA) fragment using two ...

    African Journals Online (AJOL)

    user

    2011-04-11

    Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

  9. The effects of ionizing radiation on deoxyribonucleic acid

    International Nuclear Information System (INIS)

    Cullis, P.M.; Jones, G.D.D.; Lea, J.; Symons, M.C.R.; Sweeney, M.

    1987-01-01

    Exposure of frozen, deoxygenated, aqueous solutions of DNA to 60 Co γ-rays at 77 K results in the formation of guanine-centred radical-cations (Gsup(radical +)) and thymine-centred radical-anions (Tsup(radical -)). Both these primary centres are thought to be capable of inducing DNA strand-breaks, both single (SSB) and double (DSB). When low concentrations of a range of water-soluble thiols were added, there was no change in the initial yield of Gsup(radical +) and Tsup(radical -) as judged from the e.s.r. spectra. However, on annealing, the normal pattern of radical reactions was abruptly modified at ca. 200 ± 5 K, with the DNA-centred radicals being dramatically reduced in concentration with the concomitant growth of e.s.r. signals characteristic of RSsup(radical) - SR - radical-anions. For example, for solutions containing one thiol molecule per 25 base-pairs, there was a loss of ca. 50% in the concentration of DNA radicals at this temperature. Using plasmid DNA, the change in the numbers of SSBs and DSBs was monitored when various thiols were present. There was a marked fall in the yields of both these events, in accord with the e.s.r. results. It is concluded that these thiols react by hydrogen-atom donation to various DNA radicals thereby forming RSsup(radical) radicals which rapidly form RSsup(radical)SR - radical-anions. It seems that, under our conditions, neither of these sulphur radicals is able to react with DNA. In the presence of oxygen, the results are less definitive, the degree of repair being a function of the relative concentrations of oxygen and thiol. E.s.r. evidence for the formation of DNA-centred peroxy radicals and their reaction with thiols is presented, and also there is evidence for the addition of oxygen to RSsup(radical) radicals to give RSOsup(anion radical) 2 radicals. The latter are probably able to react with DNA. (author)

  10. DeNAno: selectable deoxyribonucleic acid nanoparticle libraries

    Science.gov (United States)

    Steiner, Jason M; Sartor, Marta; Sanchez, Ana B; Messmer, Davorka; Freed, Anna; Esener, Sadik; Messmer, Bradley T

    2009-01-01

    DNA nanoparticles of approximately 250nm were produced by rolling circle replication of circular oligonucleotide templates which results in highly condensed DNA particulates presenting concatemeric sequence repeats. Using templates containing randomized sequences, high diversity libraries of particles were produced. A biopanning method that iteratively screens for binding and uses PCR to recover selected particles was developed. The initial application of this technique was the selection of particles that bound to human dendritic cells (DCs). Following 9 rounds of selection the population of particles was enriched for particles that bound DCs, and individual binding clones were isolated and confirmed by flow cytometry and microscopy. This process, which we have termed DeNAno, represents a novel library technology akin to aptamer and phage display, but unique in that the selected moiety is a multivalent nanoparticle whose activity is intrinsic to its sequence. Cell targeted DNA nanoparticles may have applications in cell imaging, cell sorting, and cancer therapy. PMID:19963022

  11. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  12. Oxidized base damage and single-strand break repair in mammalian genomes: role of disordered regions and posttranslational modifications in early enzymes.

    Science.gov (United States)

    Hegde, Muralidhar L; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic endonuclease 1 (APE1), form complexes with downstream repair (and other noncanonical) proteins via pairwise interactions. Furthermore, a unique feature of mammalian early BER/SSBR enzymes is the presence of a disordered terminal extension that is absent in their Escherichia coli prototypes. These nonconserved segments usually contain organelle-targeting signals, common interaction interfaces, and sites of posttranslational modifications that may be involved in regulating their repair function including lesion scanning. Finally, the linkage of BER/SSBR deficiency to cancer, aging, and human neurodegenerative diseases, and therapeutic targeting of BER/SSBR are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast.

    Science.gov (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A

    2010-08-05

    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  14. Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library.

    Directory of Open Access Journals (Sweden)

    Sumate Pengpumkiat

    Full Text Available Chemical synthesis of oligonucleotides is a widely used tool in the field of biochemistry. Several methods for gene synthesis have been introduced in the growing area of genomics. In this paper, a novel method of constructing dsDNA is proposed. Short (28-mer oligo fragments from a library were assembled through successive annealing and ligation processes, followed by PCR. First, two oligo fragments annealed to form a dsDNA molecule. The double-stranded oligo was immobilized onto magnetic beads (solid support via streptavidin-biotin binding. Next, single-stranded oligo fragments were added successively through ligation to form the complete DNA molecule. The synthesized DNA was amplified through PCR and gel electrophoresis was used to characterize the product. Sanger sequencing showed that more than 97% of the nucleotides matched the expected sequence. Extending the length of the DNA molecule by adding single-stranded oligonucleotides from a basis set (library via ligation enables a more convenient and rapid mechanism for the design and synthesis of oligonucleotides on the go. Coupled with an automated dispensing system and libraries of short oligo fragments, this novel DNA synthesis method would offer an efficient and cost-effective method for producing dsDNA.

  15. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  16. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H

    2012-02-22

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  17. On-site detection of Phytophthora spp.—single-stranded target DNA as the limiting factor to improve on-chip hybridization

    International Nuclear Information System (INIS)

    Schwenkbier, Lydia; Pollok, Sibyll; Popp, Jürgen; Weber, Karina; König, Stephan; Wagner, Stefan; Werres, Sabine; Weber, Jörg; Hentschel, Martin

    2014-01-01

    We report on a lab-on-a-chip approach for on-site detection of Phytophthora species that allows visual signal readout. The results demonstrate the significance of single-stranded DNA (ssDNA) generation in terms of improving the intensity of the hybridization signal and to improve the reliability of the method. Conventional PCR with subsequent heat denaturation, sodium hydroxide-based denaturation, lambda exonuclease digestion and two asymmetric PCR methods were investigated for the species P. fragariae, P. kernoviae, and P. ramorum. The positioning of the capture probe within the amplified yeast GTP-binding protein (YPT1) target DNA was also of interest because it significantly influences the intensity of the signal. Statistical tests were used to validate the impact of the ssDNA generation methods and the capture-target probe position. The single-stranded target DNA generated by Linear-After-The-Exponential PCR (LATE-PCR) was found to produce signal intensities comparable to post-PCR exonuclease treatment. The LATE-PCR is the best method for the on-site detection of Phytophthora because the enzymatic digestion after PCR is more laborious and time-consuming. (author)

  18. Guanine quadruplex monoclonal antibody 1H6 cross-reacts with restrained thymidine-rich single stranded DNA

    NARCIS (Netherlands)

    Kazemier, Hinke G.; Paeschke, Katrin; Lansdorp, Peter M.

    2017-01-01

    Previously we reported the production and characterization of monoclonal antibody 1H6 raised against (T(4)G(4))(2) intermolecular guanine quadruplex (G4) DNA structures (Henderson A. et al. (2014) Nucleic Acids Res., 42, 860-869; Hoffmann R. F. et al. (2016) Nucleic Acids Res., 44, 152-163). It was

  19. The casein genes in goat breeds from different Continents: analysis by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP

    Directory of Open Access Journals (Sweden)

    A. Caroli

    2010-04-01

    Full Text Available A screening of casein gene variability was carried out by Polymerase Chain Reaction – Single Strand Conformation Polymorphism in 8 goat breeds from Sudan (Nubian goat, Turkey (Angora Goat Lalahan Tiftic, Angora Goat Yerkoy, Hair goat and India (Jammu, Maharashtra, Rajasthan, South Goat. A total of 16 different alleles or groups of alleles were found, showing conspicuous differences among breeds. The allele frequencies were submitted to cluster analysis in order to highlight differences between breeds, also including data from Red Sokoto, West African Dwarf Nigeria, West African Dwarf Cameroon, and Borno Goat. The tree obtained from the cluster analysis showed two main lineages. The West African goat clustered together, the Indian and Turkish breeds were in the other group. Nubian goat was found in an intermediate position.

  20. Investigation of single-strand conformational polymorphism of the TP53 gene in women with a family history of breast cancer

    Directory of Open Access Journals (Sweden)

    R.R. Burbano

    2000-11-01

    Full Text Available Breast cancer in families with germ line mutations in the TP53 gene has been described in the medical literature. Mutation screening for susceptibility genes should allow effective prophylactic and preventive measures. Using single-strand conformational polymorphism, we screened for mutations in exons 5, 6, 7 and 8 of gene TP53 in the peripheral blood of 8 young non-affected members (17 to 36 years old of families with a history of breast cancer. Studies of this type on young patients (mean age, 25 years are very rare in the literature. The identification of these mutations would contribute to genetic counseling of members of families with predisposition to breast cancer. The results obtained did not show any polymorphism indicating mutation. In our sample, the familial tumorigenesis is probably related to other gene etiologies.

  1. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.

    1994-01-01

    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  2. Influence of the single-strand linker composition on the structural/dynamical properties of a truncated octahedral DNA nano-cage family.

    Science.gov (United States)

    Iacovelli, Federico; Alves, Cassio; Falconi, Mattia; Oteri, Francesco; de Oliveira, Cristiano L P; Desideri, Alessandro

    2014-10-01

    The structural/dynamical properties of three truncated octahedral DNA nano-cages composed by identical double helices but single strand linkers with different composition, namely 7 thymidines, 7 adenines, and 7 alternated thymidines and adenines, have been investigated through classical molecular dynamics simulations. Trajectories have been analyzed to investigate the role of the linkers in defining nano-cages stability and flexibility, including possible influence on the internal cages motions. The data indicate that the cages behavior is almost identical and that the structural/dynamical parameters measured along the trajectories are not particularly affected by the presence of different bases. These results demonstrate that the constraints imposed by the nano-structure geometry are the main factor in modulating these properties

  3. Localization of specific sequences and DNA single-strand breaks in individual UV-A-irradiated human lymphocytes by COMET FISH

    Science.gov (United States)

    Bock, Claudia; Rapp, Alexander; Dittmar, Heike; Monajembashi, Shamci; Greulich, Karl-Otto

    1999-01-01

    The COMET assay, a single cell electrophoresis technique which allows to separate electrophoretically fractionated DNA according to size has been combined with fluorescence in situ hybridization (FISH) which allows to localize specific genes or gene regions. This combination (COMET FISH) allows the detection of DNA single strand breaks in specific regions of the genome of human lymphocytes at the single cell level. Various types of DNA probes, e.g. centromere-, (alpha) - satellite-, telomere-, whole chromosome-, single copy- and region specific DNA probes have been used to investigate whether the UV-A induced DNA single strand breaks are distributed randomly all over the human genome or induced at specific sites ('hot spots'). In the investigated human peripheral blood lymphocytes all but one centromere reveal low sensitivity for UV-A irradiation (500 kJ/m2), while telomeres are randomly distributed over COMET heads and tails. The human chromosome 1 is fractionated by irradiation, but remains in the COMET head, indicating an only moderate degree of fractionation. Among three tested single copy probes, c- myc, p53 and p58, the p53 gene located on chromosome 17p13.1 and the p58 gene (1p36) appear to be located in UV-A stable regions of the human genome in 95% of 65 investigated lymphocytes. In contrast, the c-myc proto-oncogene (8q24) is found in the COMET tail in 90% of the 27 investigated lymphocytes and thus appears to be more sensitive to UV-A irradiation.

  4. Evidence that single-stranded DNA breaks are a normal feature of koala sperm chromatin, while double-stranded DNA breaks are indicative of DNA damage.

    Science.gov (United States)

    Zee, Yeng Peng; López-Fernández, Carmen; Arroyo, F; Johnston, Stephen D; Holt, William V; Gosalvez, Jaime

    2009-08-01

    In this study, we have used single and double comet assays to differentiate between single- and double-stranded DNA damage in an effort to refine the interpretation of DNA damage in mature koala spermatozoa. We have also investigated the likelihood that single-stranded DNA breakage is part of the natural spermiogenic process in koalas, where its function would be the generation of structural bends in the DNA molecule so that appropriate packaging and compaction can occur. Koala spermatozoa were examined using the sperm chromatin dispersion test (SCDt) and comet assays to investigate non-orthodox double-stranded DNA. Comet assays were conducted under 1) neutral conditions; and 2) neutral followed by alkaline conditions (double comet assay); the latter technique enabled simultaneous visualisation of both single-stranded and double-stranded DNA breaks. Following the SCDt, there was a continuum of nuclear morphotypes, ranging from no apparent DNA fragmentation to those with highly dispersed and degraded chromatin. Dispersion morphotypes were mirrored by a similar diversity of comet morphologies that could be further differentiated using the double comet assay. The majority of koala spermatozoa had nuclei with DNA abasic-like residues that produced single-tailed comets following the double comet assay. The ubiquity of these residues suggests that constitutive alkali-labile sites are part of the structural configuration of the koala sperm nucleus. Spermatozoa with 'true' DNA fragmentation exhibited a continuum of comet morphologies, ranging from a more severe form of alkaline-susceptible DNA with a diffuse single tail to nuclei that exhibited both single- and double-stranded breaks with two comet tails.

  5. Functional roles of the N- and C-terminal regions of the human mitochondrial single-stranded DNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Marcos T Oliveira

    2010-10-01

    Full Text Available Biochemical studies of the mitochondrial DNA (mtDNA replisome demonstrate that the mtDNA polymerase and the mtDNA helicase are stimulated by the mitochondrial single-stranded DNA-binding protein (mtSSB. Unlike Escherichia coli SSB, bacteriophage T7 gp2.5 and bacteriophage T4 gp32, mtSSBs lack a long, negatively charged C-terminal tail. Furthermore, additional residues at the N-terminus (notwithstanding the mitochondrial presequence are present in the sequence of species across the animal kingdom. We sought to analyze the functional importance of the N- and C-terminal regions of the human mtSSB in the context of mtDNA replication. We produced the mature wild-type human mtSSB and three terminal deletion variants, and examined their physical and biochemical properties. We demonstrate that the recombinant proteins adopt a tetrameric form, and bind single-stranded DNA with similar affinities. They also stimulate similarly the DNA unwinding activity of the human mtDNA helicase (up to 8-fold. Notably, we find that unlike the high level of stimulation that we observed previously in the Drosophila system, stimulation of DNA synthesis catalyzed by human mtDNA polymerase is only moderate, and occurs over a narrow range of salt concentrations. Interestingly, each of the deletion variants of human mtSSB stimulates DNA synthesis at a higher level than the wild-type protein, indicating that the termini modulate negatively functional interactions with the mitochondrial replicase. We discuss our findings in the context of species-specific components of the mtDNA replisome, and in comparison with various prokaryotic DNA replication machineries.

  6. RNA binding to APOBEC3G induces the disassembly of functional deaminase complexes by displacing single-stranded DNA substrates

    Science.gov (United States)

    Polevoda, Bogdan; McDougall, William M.; Tun, Bradley N.; Cheung, Michael; Salter, Jason D.; Friedman, Alan E.; Smith, Harold C.

    2015-01-01

    APOBEC3G (A3G) DNA deaminase activity requires a holoenzyme complex whose assembly on nascent viral reverse transcripts initiates with A3G dimers binding to ssDNA followed by formation of higher-order A3G homo oligomers. Catalytic activity is inhibited when A3G binds to RNA. Our prior studies suggested that RNA inhibited A3G binding to ssDNA. In this report, near equilibrium binding and gel shift analyses showed that A3G assembly and disassembly on ssDNA was an ordered process involving A3G dimers and multimers thereof. Although, fluorescence anisotropy showed that A3G had similar nanomolar affinity for RNA and ssDNA, RNA stochastically dissociated A3G dimers and higher-order oligomers from ssDNA, suggesting a different modality for RNA binding. Mass spectrometry mapping of A3G peptides cross-linked to nucleic acid suggested ssDNA only bound to three peptides, amino acids (aa) 181–194 in the N-terminus and aa 314–320 and 345–374 in the C-terminus that were part of a continuous exposed surface. RNA bound to these peptides and uniquely associated with three additional peptides in the N- terminus, aa 15–29, 41–52 and 83–99, that formed a continuous surface area adjacent to the ssDNA binding surface. The data predict a mechanistic model of RNA inhibition of ssDNA binding to A3G in which competitive and allosteric interactions determine RNA-bound versus ssDNA-bound conformational states. PMID:26424853

  7. Characterization of a novel single-stranded RNA virus, closely related to fusariviruses, infecting the plant pathogenic fungus Alternaria brassicicola.

    Science.gov (United States)

    Zhong, Jie; Shang, Hong Hong; Zhu, Chuan Xia; Zhu, Jun Zi; Zhu, Hong Jian; Hu, Yan; Gao, Bi Da

    2016-06-02

    The alternaria blackspot of rapeseed is one of the most prominent diseases of rapeseed. It is caused by three species of the genus Alternaria: Alternaria brassicicola, Alternaria brassicae, and Alternaria raphanin. Here we report a novel positive-sense RNA virus from an A. brassicicola strain 817-14. The virus has a 6639 nucleotide (nt) long genome, excluding a poly (A)-tail, and was predicted to contain three putative open reading frames (ORF1, ORF2, and ORF3). The large ORF1 encoded a 174-kDa polyprotein (composed of 1522 amino acid residues) containing a conserved RNA-dependent RNA polymerase (RdRp) domain and a helicase domain. The other two smaller ORFs encoded polypeptides with unknown function. Homology search and phylogenetic analysis, based on the RdRp and helicase domains, suggest that this virus is related to and grouped with Sclerotinia sclerotiorum fusarivirus 1 (SsFV1), Rosellinia necatrix fusarivirus 1 (RnFV1), Fusarium graminearum virus-DK21 (FgV1), and Penicillium roqueforti RNA mycovirus 1 (PrRV1), all of which belong to a newly proposed family Fusariviridae. For this study, we designed the virus as "Alternaria brassicicola fusarivirus 1" (AbFV1). Virus elimination revealed that AbFV1 has no conspicuous impact on the biological properties of its host. Copyright © 2016. Published by Elsevier B.V.

  8. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes.

    Science.gov (United States)

    Pietilä, Maija K; Roine, Elina; Sencilo, Ana; Bamford, Dennis H; Oksanen, Hanna M

    2016-01-01

    Viruses infecting archaea show a variety of virion morphotypes, and they are currently classified into more than ten viral families or corresponding groups. A pleomorphic virus morphotype is very common among haloarchaeal viruses, and to date, several such viruses have been isolated. Here, we propose the classification of eight such viruses and formation of a new family, Pleolipoviridae (from the Greek pleo for more or many and lipos for lipid), containing three genera, Alpha-, Beta-, and Gammapleolipovirus. The proposal is currently under review by the International Committee on Taxonomy of Viruses (ICTV). The members of the proposed family Pleolipoviridae infect halophilic archaea and are nonlytic. They share structural and genomic features and differ from any other classified virus. The virion of pleolipoviruses is composed of a pleomorphic membrane vesicle enclosing the genome. All pleolipoviruses have two major structural protein species, internal membrane and spike proteins. Although the genomes of the pleolipoviruses are single- or double-stranded, linear or circular DNA molecules, they share the same genome organization and gene synteny and show significant similarity at the amino acid level. The canonical features common to all members of the proposed family Pleolipoviridae show that they are closely related and thus form a new viral family.

  9. The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange.

    Science.gov (United States)

    Qian, Yufeng; Johnson, Kenneth A

    2017-08-04

    The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB-ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB) 30 and (SSB) 60 , defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB) 60 and (SSB) 30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 10 9 m -1 s -1 ) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide

    2015-10-01

    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  11. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2016-05-28

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  12. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy

    2008-01-01

    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  13. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray.

    Science.gov (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino

    2008-08-25

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  14. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Science.gov (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino

    2008-01-01

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  15. A biomarker model of sublethal genotoxicity (DNA single-strand breaks and adducts) using the sentinel organism Aporrectodea longa in spiked soil

    International Nuclear Information System (INIS)

    Martin, Francis L.; Piearce, Trevor G.; Hewer, Alan; Phillips, David H.; Semple, Kirk T.

    2005-01-01

    There is a need to develop risk biomarkers during the remediation of contaminated land. We employed the earthworm, Aporrectodea longa (Ude), to determine whether genotoxicity measures could be applied to this organism's intestinal tissues. Earthworms were added, for 24 h or 7 days, to soil samples spiked with benzo[a]pyrene (B[a]P) and/or lindane. After exposure, intestinal tissues (crop/gizzard or intestine) were removed prior to the measurement in disaggregated cells of DNA single-strand breaks (SSBs) by the alkaline comet assay. Damage was quantified by comet tail length (CTL, μm). B[a]P 24-h exposure induced dose-related increases (P 32 P-postlabelling, showed a two-adduct-spot pattern. This preliminary investigation suggests that earthworm tissues may be incorporated into genotoxicity assays to facilitate hazard identification within terrestrial ecosystems. - Sublethal genotoxicity in the sentinel organism A. longa can be used to monitor the effects of contaminants in soil

  16. Conformation effects of CpG methylation on single-stranded DNA oligonucleotides: analysis of the opioid peptide dynorphin-coding sequences.

    Directory of Open Access Journals (Sweden)

    Malik Mumtaz Taqi

    Full Text Available Single-stranded DNA (ssDNA is characterized by high conformational flexibility that allows these molecules to adopt a variety of conformations. Here we used native polyacrylamide gel electrophoresis (PAGE, circular dichroism (CD spectroscopy and nuclear magnetic resonance (NMR spectroscopy to show that cytosine methylation at CpG sites affects the conformational flexibility of short ssDNA molecules. The CpG containing 37-nucleotide PDYN (prodynorphin fragments were used as model molecules. The presence of secondary DNA structures was evident from differences in oligonucleotide mobilities on PAGE, from CD spectra, and from formation of A-T, G-C, and non-canonical G-T base pairs observed by NMR spectroscopy. The oligonucleotides displayed secondary structures at 4°C, and some also at 37°C. Methylation at CpG sites prompted sequence-dependent formation of novel conformations, or shifted the equilibrium between different existing ssDNA conformations. The effects of methylation on gel mobility and base pairing were comparable in strength to the effects induced by point mutations in the DNA sequences. The conformational effects of methylation may be relevant for epigenetic regulatory events in a chromatin context, including DNA-protein or DNA-DNA recognition in the course of gene transcription, and DNA replication and recombination when double-stranded DNA is unwinded to ssDNA.

  17. Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Krzysztof Lepek

    2015-01-01

    Full Text Available Monitoring and control of infections are key parts of surveillance systems and epidemiological risk prevention. In the case of influenza A viruses (IAVs, which show high variability, a wide range of hosts, and a potential of reassortment between different strains, it is essential to study not only people, but also animals living in the immediate surroundings. If understated, the animals might become a source of newly formed infectious strains with a pandemic potential. Special attention should be focused on pigs, because of the receptors specific for virus strains originating from different species, localized in their respiratory tract. Pigs are prone to mixed infections and may constitute a reservoir of potentially dangerous IAV strains resulting from genetic reassortment. It has been reported that a quadruple reassortant, A(H1N1pdm09, can be easily transmitted from humans to pigs and serve as a donor of genetic segments for new strains capable of infecting humans. Therefore, it is highly desirable to develop a simple, cost-effective, and rapid method for evaluation of IAV genetic variability. We describe a method based on multitemperature single-strand conformational polymorphism (MSSCP, using a fragment of the hemagglutinin (HA gene, for detection of coinfections and differentiation of genetic variants of the virus, difficult to identify by conventional diagnostic.

  18. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS.

    Science.gov (United States)

    Pachkowski, Brian F; Tano, Keizo; Afonin, Valeriy; Elder, Rhoderick H; Takeda, Shunichi; Watanabe, Masami; Swenberg, James A; Nakamura, Jun

    2009-12-01

    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase beta.

  19. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against the Pesticide Fipronil and Sensitive Detection in River Water

    Directory of Open Access Journals (Sweden)

    Ka L. Hong

    2017-12-01

    Full Text Available Fipronil is a commonly used insecticide that has been shown to have environmental and human health risks. The current standard methods of detection for fipronil and its metabolites, such as GC-MS, are time consuming and labor intensive. In this study, a variant of systematic evolution of ligands by exponential enrichment (SELEX, was utilized to identify the first single-stranded DNA (ssDNA molecular recognition element (MRE that binds to fipronil with high affinity (Kd = 48 ± 8 nM. The selected MRE displayed low cross binding activity on various environmentally relevant, structurally unrelated herbicides and pesticides, in addition to broad-spectrum binding activity on major metabolites of fipronil and a structurally similar pesticide in prepared river samples. Additionally, a proof-of-principle fluorescent detection assay was developed by using the selected ssDNA MRE as a signal-reporting element, with a limit of detection of 105 nM in a prepared river water sample.

  20. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Boye, E.; Johansen, I.; Brustad, T.

    1976-01-01

    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 2 0 C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 2 0 C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  1. Simultaneous identification of seven foodborne pathogens and Escherichia coli (pathogenic and nonpathogenic) using capillary electrophoresis-based single-strand conformation polymorphism coupled with multiplex PCR.

    Science.gov (United States)

    Oh, Mi-Hwa; Paek, Se-Hee; Shin, Gi Won; Kim, Hae-Yeong; Jung, Gyoo Yeol; Oh, Sangsuk

    2009-06-01

    The objective of this study was to develop a novel technique for parallel analysis of eight important foodborne microbes using capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) coupled with multiplex PCR. Specific primers for multiplex PCR amplification of the 16S rRNA gene were designed, corresponding to eight species of bacteria, including Escherichia coli, Clostridium perfringens, Campylobacter jejuni, Salmonella enterica, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Bacillus cereus, for the species-specific identification and optimal separation of their PCR products in subsequent analysis by CE-SSCP. Multiplex PCR conditions including annealing temperature, extension time, the number of PCR cycles, and primer concentrations were then optimized for simultaneous detection of all target foodborne bacteria. The diagnostic system using CE-SSCP combined with multiplex PCR developed here can be used for rapid investigation of causative agents of foodborne illness. The simplicity and high sensitivity of the method may lead to improved management of safety and illness related to food.

  2. Integrative modelling coupled with ion mobility mass spectrometry reveals structural features of the clamp loader in complex with single-stranded DNA binding protein.

    Science.gov (United States)

    Politis, Argyris; Park, Ah Young; Hall, Zoe; Ruotolo, Brandon T; Robinson, Carol V

    2013-11-29

    DNA polymerase III, a decameric 420-kDa assembly, simultaneously replicates both strands of the chromosome in Escherichia coli. A subassembly of this holoenzyme, the seven-subunit clamp loader complex, is responsible for loading the sliding clamp (β2) onto DNA. Here, we use structural information derived from ion mobility mass spectrometry (IM-MS) to build three-dimensional models of one form of the full clamp loader complex, γ3δδ'ψχ (254 kDa). By probing the interaction between the clamp loader and a single-stranded DNA (ssDNA) binding protein (SSB4) and by identifying two distinct conformational states, with and without ssDNA, we assemble models of ψχ-SSB4 (108 kDa) and the clamp loader-SSB4 (340 kDa) consistent with IM data. A significant increase in measured collision cross-section (~10%) of the clamp loader-SSB4 complex upon DNA binding suggests large conformational rearrangements. This DNA bound conformation represents the active state and, along with the presence of ψχ, stabilises the clamp loader-SSB4 complex. Overall, this study of a large heteromeric complex analysed by IM-MS, coupled with integrative modelling, highlights the potential of such an approach to reveal structural features of previously unknown complexes of high biological importance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. porphyrin with single strand DNAs

    Indian Academy of Sciences (India)

    for organization of porphyrin molecules into extended assemblies, providing opportunities for construction of supramolecular structures.6–8 Among the porphyrin .... and consequently the mono- and bi-exponential nature of the decays were judged by the reduced chi-square. (χ2) values and distribution of the weighted ...

  4. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA.

    Science.gov (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S

    2000-09-20

    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  5. Flow cytometry analysis of single-strand DNA damage in neuroblastoma cell lines using the F7-26 monoclonal antibody.

    Science.gov (United States)

    Grigoryan, Rita S; Yang, Bo; Keshelava, Nino; Barnhart, Jerry R; Reynolds, C Patrick

    2007-11-01

    The F7-26 monoclonal antibody (Mab) has been reported to be specific for single-strand DNA damage (ssDNA) and to also identify cells in apoptosis. We carriedout studies to determine if F7-26 binding measured by flow cytometry was able to specifically identify exogenous ssDNA as opposed to DNA damage from apoptosis. Neuroblastoma cells were treated with melphalan (L-PAM), fenretinide, 4-hydroperoxycyclophosphamide (4-HC)+/-pan-caspase inhibitor BOC-d-fmk, topotecan or with 10Gy gamma radiation+/-hydrogen peroxide (H2O2) and fixed immediately postradiation. Cytotoxicity was measured by DIMSCAN digital imaging fluorescence assay. The degree of ssDNA damage was analyzed by flow cytometry using Mab F7-26, with DNA visualized by propidium iodide counterstaining. Flow cytometry was used to measure apoptosis detected by terminal deoxynucleotidyltransferase (TUNEL) assay and reactive oxygen species (ROS) by carboxy-dichlorofluorescein diacetate. Irradiated and immediately fixed neuroblastoma cells showed increased ssDNA, but not apoptosis by TUNEL (TUNEL-negative). 4-HC or L-PAM+/-BOC-d-fmk increased ssDNA (F7-26-positive), but BOC-d-fmk prevented TUNEL staining. Fenretinide increased apoptosis by TUNEL but not ssDNA damage detected with F7-26. Enhanced ssDNA in neuroblastoma cells treated with radiation+H2O2 was associated with increased ROS. Topotecan increased both ssDNA and cytotoxicity in 4-HC-treated cells. These data demonstrate that Mab F7-26 recognized ssDNA due to exogenous DNA damage, rather than apoptosis. This assay should be useful to characterize the mechanism of action of antineoplastic drugs. Copyright (c) 2007 International Society for Analytical Cytology.

  6. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani

    2006-09-01

    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  7. Detection of p53 mutations by single-strand conformation polymorphisms (SSCP) gel electrophoresis. A comparative study of radioactive and nonradioactive silver-stained SSCP analysis.

    Science.gov (United States)

    Bosari, S; Marchetti, A; Buttitta, F; Graziani, D; Borsani, G; Loda, M; Bevilacqua, G; Coggi, G

    1995-12-01

    p53 mutations are the most common genetic abnormality in humans tumors, but their clinical significance remains to be precisely elucidated. Conventional single-strand conformation polymorphism (SSCP) analysis, a well-established technique for detecting p53 mutations, uses radioactively labeled polymerase chain reaction (PCR) products, which migrate abnormally in the presence of mutations. We performed radioactive PCR-SSCP analysis in a series of 30 formalin-fixed, paraffin-embedded ovarian carcinomas and two cell lines (SW480 and Caov4) harboring known homozygous p53 mutations and compared the results with nonradioactive silver-stained SSCP. The purpose was to assess whether nonradioactive SSCP is suitable for detecting p53 mutations in a rapid, sensitive, cost-effective fashion, without the need of radioactive isotopes. We accomplished PCR amplification of p53 exons 5 through 8 in 26 carcinomas, and radioactive SSCP detected p53 mutations in 13 tumors; three mutations were localized in exon 5, six in exon 6, two in exon 7, and two in exon 8. All mutations were correctly identified with nonradioactive SSCP, except for one exon 8 mutation. To establish the sensitivity of nonradioactive SSCP, DNA samples of SW480 and Caov4 were mixed with increasing amounts (0-90%) of normal DNA and subjected to PCR-SSCP analysis. Mutations were detected until the concentration of SW480 and Caov4 was 15% and 10%, respectively, of the total sample. The results of our investigation demonstrate that nonradioactive silver-stained SSCP is a sensitive, rapid, and simple technique to detect p53 mutations, even in formalin-fixed tissues, and could be easily used to investigate large series of patients to assess the clinical significance of p53 mutations in human tumors.

  8. Ampelomyces mycoparasites from apple powdery mildew identified as a distinct group based on single-stranded conformation polymorphism analysis of the rDNA ITS region.

    Science.gov (United States)

    Szentiványi, Orsolya; Kiss, Levente; Russell, John C; Kovács, Gábor M; Varga, Krisztina; Jankovics, Tünde; Lesemann, Silke; Xu, Xiang-Ming; Jeffries, Peter

    2005-04-01

    Pycnidial fungi belonging to the genus Ampelomyces are the most common natural antagonists of powdery mildews worldwide. During a study of the interactions between apple powdery mildew (Podosphaera leucotricha) and Ampelomyces mycoparasites, 52 new Ampelomyces isolates were obtained from P. leucotricha and, in addition, 13 new isolates from other species of the Erysiphaceae in four European countries. Their genetic diversity was screened using single-stranded conformation polymorphism (SSCP) analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). For comparison, 24 isolates obtained from genetic resource collections or other sources were included in this study. Based on the ITS-SSCP patterns, the isolates were placed in eight groups. The isolates belonged to two types based on their growth in culture. The faster-growing and the slower-growing isolates were included in different SSCP groups. A phylogenetic analysis of the ITS sequences of representatives of these groups confirmed the results obtained with the SSCP method, and showed that the faster-growing isolates do not belong to Ampelomyces as suggested by earlier studies. All the isolates from P. leucotricha fell into a distinct SSCP group of genetically homogeneous isolates. This suggests that Ampelomyces mycoparasites which occur in apple powdery mildew are slightly different from the other Ampelomyces groups which contain mycoparasites from various powdery mildew species. This may be because the main growth period of Ampelomyces mycoparasites in apple powdery mildew is isolated in time from that of Ampelomyces isolates that occur in other species of the Erysiphaceae. P. leucotricha starts its life-cycle early in the season, usually in March-April, while most powdery mildews are active in the same environments only late in the year.

  9. Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody: a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody.

    Science.gov (United States)

    Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua

    2018-02-01

    Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.

  10. Variabilidad genética de Aedes aegypti en algunas áreas del Perú usando Single Stranded Conformational Polymorphism (SSCP

    Directory of Open Access Journals (Sweden)

    Nélida Leiva G

    2004-07-01

    Full Text Available Aedes aegypti es el vector responsable de la transmisión del virus del dengue, su distribución geográfica se ha ampliado rápidamente debido principalmente a la intervención de los seres humanos. Objetivo: Analizar la variabilidad genética de este mosquito mediante la comparación del Segundo Espaciador Transcrito Interno (ITS 2 perteneciente al ADN ribosomal (rADN. Materiales y Métodos: Se analizaron muestras de ocho localidades (Jaén, Tingo María, Iquitos, Lambayeque, el distrito de El Rimac, Sullana y Zarumilla y uno de la provincia de Huaquillas (Ecuador. El análisis de la variabilidad se determinó usando la técnica conocida como SSCP (Single Stranded Conformation Polymorphism. Resultados: El estudio muestra que existe variabilidad genética entre las poblaciones analizadas, principalmente entre las muestras localizadas en la costa del Perú (Zarumilla, El Rímac, Sullana y Huaquillas y las muestras del nororiente (Tingo María, Iquitos, Jaén y Lambayeque Conclusión: Se determinaron dos variantes genéticas entre las poblaciones de Aedes aegypti: Costeña y Nororiental, que probablemente provienen de dos ancestros diferentes y cuyo ancestro común sufrió de aislamiento por distancia. Se observó que no existe relación entre las distancias genéticas y las distancias geográficas indicando que la migración de estas poblaciones es el resultado de la intervención de los seres humanos que diseminan al vector y no por la migración activa del mosquito. Se plantea el papel de la Cordillera de los Andes en la migración y separación de las poblaciones de Aedes.

  11. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms.

    Science.gov (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A

    2012-05-01

    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    Science.gov (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Conformationally locked aryl C-nucleosides: synthesis of phosphoramidite monomers and incorporation into single-stranded DNA and LNA (locked nucleic acid)

    DEFF Research Database (Denmark)

    Babu, B. Ravindra; Prasad, Ashok K.; Trikha, Smriti

    2002-01-01

    . The phosphoramidite approach was used for automated incorporation of the LNA-type beta-configured C-aryl monomers 17a-17e into short DNA and 2'-OMe-RNA/LNA strands. It is shown that universal hybridization can be obtained with a conformationally restricted monomer as demonstrated most convincingly for the pyrene LNA...... monomer 17d, both in a DNA context and in an RNA-like context. Increased binding affinity of oligonucleotide probes for universal hybridization can be induced by combining the pyrene LNA monomer 17d with affinity-enhancing 2'-OMe-RNA/LNA monomers....

  14. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W

    2009-12-23

    Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation

  15. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  16. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  17. Contribution of single-strand breaks and alkali-labile bonds to the loss of infectivity of γ-irradiated phiX174 RF-DNA in E. coli cells mutant in various repair functions

    International Nuclear Information System (INIS)

    McKee, R.H.

    1975-01-01

    Twenty-one radiation sensitive mutants have been examined for their capacity to support gamma-irradiated phiX174 RF-DNA. The survival of phiX174 RF-DNA was reduced in essentially all of the sensitive mutants. The irradiated phiX174 RF-DNA was then separated into populations containing either single-strand breaks or alkali-labile bonds to examine the capacity of the mutants to repair each of the classes of lesions. It was found that all E. coli strains are unable to repair 22 percent of the single-strand breaks and all sensitive mutants are unable to repair an additional 10 percent of the breaks. All the repair functions examined are involved in single-strand break repair and none are more or less necessary than any of the others. PhiX174 RF-DNA is also inactivated by alkali-labile bonds. In the normal strains the inactivation efficiency is 0.16 lethal events per lesion with a threshold dose of 15 to 20 krads. The mutants are divided into two classes by their sensitivity to alkali-labile bonds. Both classes of mutants are also inactivated by alkali-labile bonds with efficiencies of about 0.17 and 0.29 lethal events per lesion, respectively. It is proposed that the differences seen in survival curves of phiX174 measured in the sensitive mutants is due to this difference. Although in normal cells the efficiency of inactivation of phiX174 by single-strand breaks is 50 percent greater than by alkali-labile bonds, alkali-labile bonds are produced at approximately twice the rate of single-strand breaks so alkali-labile bonds account for about 61 percent of the overall inactivation. In the mutants of least sensitivity alkali-labile bonds account for about 54 percent of the inactivating events and in the most sensitive about 67 percent

  18. Characterization of a Novel Megabirnavirus from Sclerotinia sclerotiorum Reveals Horizontal Gene Transfer from Single-Stranded RNA Virus to Double-Stranded RNA Virus.

    Science.gov (United States)

    Wang, Minghong; Wang, Yong; Sun, Xiangzhong; Cheng, Jiasen; Fu, Yanping; Liu, Huiquan; Jiang, Daohong; Ghabrial, Said A; Xie, Jiatao

    2015-08-01

    Mycoviruses have been detected in all major groups of filamentous fungi, and their study represents an important branch of virology. Here, we characterized a novel double-stranded RNA (dsRNA) mycovirus, Sclerotinia sclerotiorum megabirnavirus 1 (SsMBV1), in an apparently hypovirulent strain (SX466) of Sclerotinia sclerotiorum. Two similarly sized dsRNA segments (L1- and L2-dsRNA), the genome of SsMBV1, are packaged in rigid spherical particles purified from strain SX466. The full-length cDNA sequence of L1-dsRNA/SsMBV1 comprises two large open reading frames (ORF1 and ORF2), which encode a putative coat protein and an RNA-dependent RNA polymerase (RdRp), respectively. Phylogenetic analysis of the RdRp domain clearly indicates that SsMBV1 is related to Rosellinia necatrix megabirnavirus 1 (RnMBV1). L2-dsRNA/SsMBV1 comprises two nonoverlapping ORFs (ORFA and ORFB) encoding two hypothetical proteins with unknown functions. The 5'-terminal regions of L1- and L2-dsRNA/SsMBV1 share strictly conserved sequences and form stable stem-loop structures. Although L2-dsRNA/SsMBV1 is dispensable for replication, genome packaging, and pathogenicity of SsMBV1, it enhances transcript accumulation of L1-dsRNA/SsMBV1 and stability of virus-like particles (VLPs). Interestingly, a conserved papain-like protease domain similar to a multifunctional protein (p29) of Cryphonectria hypovirus 1 was detected in the ORFA-encoded protein of L2-dsRNA/SsMBV1. Phylogenetic analysis based on the protease domain suggests that horizontal gene transfer may have occurred from a single-stranded RNA (ssRNA) virus (hypovirus) to a dsRNA virus, SsMBV1. Our results reveal that SsMBV1 has a slight impact on the fundamental biological characteristics of its host regardless of the presence or absence of L2-dsRNA/SsMBV1. Mycoviruses are widespread in all major fungal groups, and they possess diverse genomes of mostly ssRNA and dsRNA and, recently, circular ssDNA. Here, we have characterized a novel dsRNA virus

  19. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D

    2010-01-01

    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  20. Increased type I collagen content and DNA binding activity of a single-stranded, cytosine-rich sequence in the high-salt buffer protein extract of the copper-deficient rat heart.

    Science.gov (United States)

    Zeng, Huawei; Saari, Jack T

    2004-11-01

    Dietary copper (Cu) deficiency not only causes a hypertrophic cardiomyopathy but also increases cancer risk in rodent models. However, a possible alteration in gene expression has not been fully examined. The present study was undertaken to determine the effect of Cu deficiency on protein profiles in rat heart tissue. Male Sprague-Dawley rats were fed diets that were either a Cu-adequate diet (6.0 microg Cu/g diet, n = 6) or a Cu-deficient diet (0.3 microg Cu/g diet, n = 6) for 5 weeks. The high-salt buffer (HSB) protein extract from heart tissue of Cu-deficient, but not Cu-adequate rats showed a 132 kDa protein band by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. This protein band stained pink with Coomassie Blue, suggesting the presence of collagens or other proline-rich proteins. Dot immunoblotting demonstrated that total type I collagen was increased by 110% in HSB protein extract from Cu-deficient, relative to Cu-adequate, rats. Liquid chromatography with mass spectrometry analysis indicated that the 132 kDa protein band contained a collagen alpha (I) chain precursor as well as a leucine-rich protein 130 (LRP130) in HSB protein extract from Cu-deficient but not Cu-adequate rats. A gel shift assay showed that HSB protein extract from Cu-deficient rats bound to a single-stranded cytosine-rich DNA with higher affinity than the extract of Cu-adequate rats, similar to reports of an increase in LRP130 single-stranded DNA binding activity in several types of tumor cells. Collectively, these results not only suggest an additional feature of altered collagen metabolism with Cu deficiency but also demonstrate for the first time an increase in single-stranded cytosine-rich DNA binding in Cu-deficient rat heart.

  1. End-joining long nucleic acid polymers

    NARCIS (Netherlands)

    Van den Hout, M.; Hage, S.; Dekker, C.; Dekker, N.H.

    2008-01-01

    Many experiments involving nucleic acids require the hybridization and ligation of multiple DNA or RNA molecules to form a compound molecule. When one of the constituents is single stranded, however, the efficiency of ligation can be very low and requires significant individually tailored

  2. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: tcheng@ntu.edu.tw [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)

    2013-02-01

    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ► To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ► ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ► PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ► The findings

  3. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  4. Nucleic Acid Backbone Structure Variations: Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    Nielsen, Peter E.

    2010-01-01

    Synthetic analogues and mimics of the natural genetic material deoxyribonucleic acid (DNA) are potential gene therapeutic (antisense or antigene) drugs. One of these mimics, peptide nucleic acids (PNAs), are chemically closer to peptides and proteins than to DNA, but nonetheless have retained many...

  5. Locked nucleic acid (LNA): High affinity targeting of RNA for diagnostics and therapeutics

    DEFF Research Database (Denmark)

    Kauppinen, S.; Vester, Birte; Wengel, Jesper

    2005-01-01

    Locked nucleic acid (LNA) is a nucleic acid analogue containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA mimicking sugar conformation. This conformational restriction results in unprecedented hybridization affinity towards complementary single stranded RN...

  6. Engineering BspQI nicking enzymes and application of N.BspQI in DNA labeling and production of single-strand DNA.

    Science.gov (United States)

    Zhang, Penghua; Too, Priscilla Hiu-Mei; Samuelson, James C; Chan, Siu-Hong; Vincze, Tamas; Doucette, Stephanie; Bäckström, Stefan; Potamousis, Konstantinos D; Schramm, Timothy M; Forrest, Dan; Schwartz, David C; Xu, Shuang-yong

    2010-02-01

    BspQI is a thermostable Type IIS restriction endonuclease (REase) with the recognition sequence 5'GCTCTTC N1/N4 3'. Here we report the cloning and expression of the bspQIR gene for the BspQI restriction enzyme in Escherichia coli. Alanine scanning of the BspQI charged residues identified a number of DNA nicking variants. After sampling combinations of different amino acid substitutions, an Nt.BspQI triple mutant (E172A/E248A/E255K) was constructed with predominantly top-strand DNA nicking activity. Furthermore, a triple mutant of BspQI (Nb.BspQI, N235A/K331A/R428A) was engineered to create a bottom-strand nicking enzyme. In addition, we demonstrated the application of Nt.BspQI in optical mapping of single DNA molecules. Nt or Nb.BspQI-nicked dsDNA can be further digested by E. coli exonuclease III to create ssDNA for downstream applications. BspQI contains two potential catalytic sites: a top-strand catalytic site (Ct) with a D-H-N-K motif found in the HNH endonuclease family and a bottom-strand catalytic site (Cb) with three scattered Glu residues. BlastP analysis of proteins in GenBank indicated a putative restriction enzyme with significant amino acid sequence identity to BspQI from the sequenced bacterial genome Croceibacter atlanticus HTCC2559. This restriction gene was amplified by PCR and cloned into a T7 expression vector. Restriction mapping and run-off DNA sequencing of digested products from the partially purified enzyme indicated that it is an EarI isoschizomer with 6-bp recognition, which we named CatHI (CTCTTC N1/N4).

  7. Phenolic extracts of brewers' spent grain (BSG) as functional ingredients - assessment of their DNA protective effect against oxidant-induced DNA single strand breaks in U937 cells.

    Science.gov (United States)

    McCarthy, Aoife L; O'Callaghan, Yvonne C; Connolly, Alan; Piggott, Charles O; Fitzgerald, Richard J; O'Brien, Nora M

    2012-09-15

    Brewers' spent grain (BSG), a by-product of the brewing industry, contains high amounts of phenolic acids, which have antioxidant effects. The present study examined the ability of BSG extracts to protect against the genotoxic effects of oxidants, hydrogen peroxide (H(2)O(2)), 3-morpholinosydnonimine hydrochloride (SIN-1), 4-nitroquinoline 1-oxide (4-NQO) and tert-butylhydroperoxide (t-BOOH) in U937 cells. Four pale (P1-P4) and four black (B1-B4) BSG extracts were investigated. U937 cells were pre-incubated with BSG extracts, exposed to the oxidants and the DNA damage was measured by the Comet assay. The black BSG extracts (B1-B4) significantly protected against H(2)O(2)-induced DNA damage. Extract B2, which had the highest phenol content, provided the greatest protection. Extracts P2, B2, B3 and B4 provided significant protection against SIN-1-induced DNA damage. None of the extracts protected against DNA damage induced by t-BOOH and 4-NQO. The DNA protective effects of the BSG phenolic extracts may be related to iron chelation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. A novel single-stranded RNA virus isolated from a phytopathogenic filamentous fungus, Rosellinia necatrix, with similarity to hypo-like viruses

    Directory of Open Access Journals (Sweden)

    Rui eZhang

    2014-07-01

    Full Text Available Here we report a biological and molecular characterization of a novel positive-sense RNA virus isolated from a field isolate (NW10 of a filamentous phytopathogenic fungus, the white root rot fungus that is designated as Rosellinia necatrix fusarivirus 1 (RnFV1. A recently developed technology using zinc ions allowed us to transfer RnFV1 to two mycelially incompatible Rosellinia necatrix strains. A biological comparison of the virus-free and -recipient isogenic fungal strains suggested that RnFV1 infects latently and thus has no potential as a virocontrol agent. The virus has an undivided positive-sense RNA genome of 6286 nucleotides excluding a poly (A tail. The genome possesses two non-overlapping open reading frames (ORFs: a large ORF1 that encodes polypeptides with RNA replication functions and a smaller ORF2 that encodes polypeptides of unknown function. A lack of coat protein genes was suggested by the failure of virus particles from infected mycelia. No evidence was obtained by Northern analysis or classical 5'-RACE for the presence of subgenomic RNA for the downstream ORF. Sequence similarities were found in amino-acid sequence between RnFV1 putative proteins and counterparts of a previously reported mycovirus, Fusarium graminearum virus 1 (FgV1. Interestingly, several related sequences were detected by BLAST searches of independent transcriptome assembly databases one of which probably represents an entire virus genome. Phylogenetic analysis based on the conserved RNA-dependent RNA polymerase showed that RnFV1, FgV1, and these similar sequences are grouped in a cluster distinct from distantly related hypoviruses. It is proposed that a new taxonomic family termed Fusariviridae be created to include RnFV1and FgV1.

  9. Elastic Properties of Nucleic Acids by Single-Molecule Force Spectroscopy.

    Science.gov (United States)

    Camunas-Soler, Joan; Ribezzi-Crivellari, Marco; Ritort, Felix

    2016-07-05

    We review the current knowledge on the use of single-molecule force spectroscopy techniques to extrapolate the elastic properties of nucleic acids. We emphasize the lesser-known elastic properties of single-stranded DNA. We discuss the importance of accurately determining the elastic response in pulling experiments, and we review the simplest models used to rationalize the experimental data as well as the experimental approaches used to pull single-stranded DNA. Applications used to investigate DNA conformational transitions and secondary structure formation are also highlighted. Finally, we provide an overview of the effects of salt and temperature and briefly discuss the effects of contour length and sequence dependence.

  10. The Rev1 interacting region (RIR) motif in the scaffold protein XRCC1 mediates a low-affinity interaction with polynucleotide kinase/phosphatase (PNKP) during DNA single-strand break repair.

    Science.gov (United States)

    Breslin, Claire; Mani, Rajam S; Fanta, Mesfin; Hoch, Nicolas; Weinfeld, Michael; Caldecott, Keith W

    2017-09-29

    The scaffold protein X-ray repair cross-complementing 1 (XRCC1) interacts with multiple enzymes involved in DNA base excision repair and single-strand break repair (SSBR) and is important for genetic integrity and normal neurological function. One of the most important interactions of XRCC1 is that with polynucleotide kinase/phosphatase (PNKP), a dual-function DNA kinase/phosphatase that processes damaged DNA termini and that, if mutated, results in ataxia with oculomotor apraxia 4 (AOA4) and microcephaly with early-onset seizures and developmental delay (MCSZ). XRCC1 and PNKP interact via a high-affinity phosphorylation-dependent interaction site in XRCC1 and a forkhead-associated domain in PNKP. Here, we identified using biochemical and biophysical approaches a second PNKP interaction site in XRCC1 that binds PNKP with lower affinity and independently of XRCC1 phosphorylation. However, this interaction nevertheless stimulated PNKP activity and promoted SSBR and cell survival. The low-affinity interaction site required the highly conserved Rev1-interacting region (RIR) motif in XRCC1 and included three critical and evolutionarily invariant phenylalanine residues. We propose a bipartite interaction model in which the previously identified high-affinity interaction acts as a molecular tether, holding XRCC1 and PNKP together and thereby promoting the low-affinity interaction identified here, which then stimulates PNKP directly. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  12. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  13. OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

    Directory of Open Access Journals (Sweden)

    Kevin M. Bradley

    2014-08-01

    Full Text Available Synthetic biologists wishing to self-assemble large DNA (L-DNA constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson–Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS, and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting" software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

  14. The interaction of hyperthermophilic TATA-box binding protein with single-stranded DNA is entropically favorable and exhibits a large negative heat capacity change at high salt concentration.

    Science.gov (United States)

    Nagatoishi, Satoru; Tanaka, Yoshikazu; Kudou, Motonori; Tsumoto, Kouhei

    2009-09-01

    We have investigated the thermodynamics of the interaction between the TATA-box-binding protein from Pyrococcus horikoshii (PhoTBP) and its target DNA (TATA-1). The interaction between PhoTBP and double-stranded DNA (dsDNA) is entropically favorable and enthalpically unfavorable. The thermodynamic parameters for TATA-1 duplex formation in the presence of PhoTBP, that is, ternary PhoTBP-dsDNA complexation, are similar to those for TATA-1 duplex formation, which is enthalpically favorable. Surface plasmon resonance analysis indicates that the interaction between PhoTBP and single-stranded DNA (ssDNA) of TATA-1 is entropy driven and has a large negative heat capacity change (-1.19 kcal mol(-1) K(-1)) at high salt concentration (800 mM NaCl). These results suggest that the favorable entropic effect corresponding to the interaction between PhoTBP and dsDNA is due not to ternary complexation but to the interaction between PhoTBP and ssDNA. This report is the first to describe the thermodynamics of the interaction between TBP and ssDNA.

  15. Solubilization of the carcinogen nickel subsulfide and its interaction with deoxyribonucleic acid and protein

    Energy Technology Data Exchange (ETDEWEB)

    Lee, J.E.; Ciccarelli, R.B.; Jennette, K.W.

    1982-02-16

    Significant concentrations (1-10 mM) of nickel(II) were found in solution after incubation of the potent carcinogen nickel subsulfide in 0.05 M Tris-HCl, pH 7.4, solutions containing DNA, rat liver microsomes, and NADPH. The presence of NADPH decreased the rate of solubilization of nickel subsulfide. The solubilized nickel exhibited electronic absorption spectra and magnetic moments characteristic of octahedral nickel(II). The solubilized nickel(II) bound to DNA with an apparent equilibrium constant of 730 M/sup -1/ and with a saturation binding value of one nickel per 2.4 nucleotides. Microsomes lowered the saturation binding of nickel to DNA but dramatically increased the amount of nickel-DNA complex stable to precipitation with salt and poly-(ethylene glycol). The amount of protein associated with DNA precipitated from protein-extracted solutions correlated with the amount of nickel bound to DNA. These results suggest that microsomes mediate the binding of nickel to DNA by forming a stable ternary protein-nickel(II)-DNA complex.

  16. THE SYNTHESES OF DEOXYRIBONUCLEIC ACID AND HISTONE IN THE ONION ROOT MERISTEM

    Science.gov (United States)

    Bloch, David P.; MacQuigg, Robert A.; Brack, Sheilah D.; Wu, Jung-Rung

    1967-01-01

    A comparison of the times necessary to incorporate tritium-labeled lysine and arginine into histones and tritium-labeled thymidine into DNA indicates that the periods of DNA and histone synthesis prior to division closely coincide. (The comparison was made by determining the times necessary, after pulse labeling, for cells with marked chromosomes to enter and then leave the division stages.) An additional period of chromosomal protein synthesis, of short duration, occurs late in interphase. Most of the chromosomal proteins appear either to be synthesized in the nucleus or to migrate there shortly after synthesis. Much of this protein is conserved from one division to the next. Studies of the effects of puromycin and fluorodeoxyuridine on the syntheses of DNA and histone suggest that continuation of DNA synthesis is dependent on a concurrent protein synthesis. Histone synthesis, on the other hand, can proceed at a normal rate under conditions in which DNA synthesis is inhibited. PMID:4226960

  17. Isolation of deoxyribonucleic acids (A Review); Aislamiento de los acidos desoxiribonucleicos. Revision Bibliografica

    Energy Technology Data Exchange (ETDEWEB)

    Garcia de Pineda, M. de

    1974-07-01

    The criteria of choice in this Review have been to gather some of the last advances in the methodology of DNAs isolation; also the description of the generally accepted procedures has been emphasized. Only papers published before March 1974 are reviewed, because this work has been finished during this month. (Author) 109 refs.

  18. Dynamics of water in deoxyribonucleic acid studied by neutron inelastic scattering

    International Nuclear Information System (INIS)

    Walder, V.S.; Vinhas, L.A.; Fulfaro, R.

    1980-01-01

    In order to study the dynamics of water present in biological molecules neutron inelastic scattering measurements were performed on natural and dehydrated DNA samples, using a cold neutron time-of-flight spectrometer. The water frequency spectrum obtained by difference from the natural and the dehydrated DNA spectra indicates that water molecule motions in the helicoidal DNA structure are quite similar to those in liquid water. (Author) [pt

  19. Method for detection of a suspect viral deoxyribonucleic acid in an acellular biological fluid

    International Nuclear Information System (INIS)

    Berninger, M.S.

    1982-01-01

    A method for evaluating an acellular biological fluid for the presence of a suspect viral DNA, such as DNA of the Hepatitis-B virus, is described. The acellular biological fluid is treated to immobilize in denatured form the DNAs including the suspect viral DNA on a solid substrate. This substrate is contacted with a solution including radioisotopically-labelled suspect viral denatured DNA to renature the immobilized suspect viral native DNA. The solid substrate is then evaluated for radioisotopically-labelled suspect viral renatured DNA. (author)

  20. Deoxyribonucleic acid damage in Iranian veterans 25 years after wartime exposure to sulfur mustard

    Directory of Open Access Journals (Sweden)

    Effat Behravan

    2013-01-01

    Full Text Available Background : More than 100,000 Iranian veterans and civilians still suffer from various long-term complications due to their exposure to sulfur mustard (SM during the Iran-Iraq war in 1983-88. The aim of the study was to investigate DNA damage of SM in veterans who were exposed to SM, 23-27 years prior to this study. Materials and Methods: Blood samples were obtained from the veterans and healthy volunteers as negative controls. Lymphocytes were isolated from blood samples and DNA breaks were measured using single-cell microgel electrophoresis technique under alkaline conditions (comet assay. Single cells were analyzed with "Tri Tek Comet Score version 1.5" software and DNA break was measured based on the percentage of tail DNA alone, or in the presence of H 2 O 2 (25 μM as a positive control. Results: A total of 25 SM exposed male veterans and 25 male healthy volunteers with similar ages (44.66 ± 6.2 and 42.12 ± 5.75 years, respectively were studied. Percentage of the lymphocyte DNA damage was significantly (P < 0.01 higher in the SM-exposed individuals than in the controls (6.47 ± 0.52 and 1.31 ± 0.35, respectively. Percentages of DNA damage in the different age groups of 35-39, 40-44, 45-49, and 50-54 years in SM-exposed veterans (5.48 ± 0.17, 6.7 3 ± 1.58, 6.42 ± 0.22, and 7.27 ± 0.38, respectively were all significantly (P < 0.05 higher than the controls (1.18 ± 0.25, 1.53 ± 0.22, 1.27 ± 0.20, and 1.42 ± 0.10, respectively. The lymphocytes incubated with H 2 O 2 had much higher DNA damage as expected. The average of tail DNA is 42.12 ± 2.75% for control cells + H 2 O 2 and 18.48 ± 2.14% for patients cells + H 2 O 2 ; P < 0.001. Conclusion: SM exposure of the veterans revealed DNA damage as judged by the comet assay.

  1. Four Proteins Synthesized in Response to Deoxyribonucleic Acid Damage in Micrococcus Radiodurans

    DEFF Research Database (Denmark)

    Hansen, M. T.

    1980-01-01

    Four proteins, alpha beta, gamma, and delta, preferentially synthesized in ultraviolet light-treated cells of Micrococcus radiodurans, were characterized in terms of their molecular weights and isoelectric points. Within the sublethal-dose range, the differential rate of synthesis for these prote......Four proteins, alpha beta, gamma, and delta, preferentially synthesized in ultraviolet light-treated cells of Micrococcus radiodurans, were characterized in terms of their molecular weights and isoelectric points. Within the sublethal-dose range, the differential rate of synthesis...

  2. Determination of mammalian deoxyribonucleic acid (DNA) in commercial vegetarian and vegan diets for dogs and cats.

    Science.gov (United States)

    Kanakubo, K; Fascetti, A J; Larsen, J A

    2017-02-01

    The determination of undeclared ingredients in pet food using different analytical methods has been reported in recent years, raising concerns regarding adequate quality control, dietary efficacy and the potential for purposeful adulteration. The objective of this study was to determine the presence or absence of mammalian DNA using multiplex polymerase chain reaction (PCR) on diets marketed as vegetarian or vegan for dogs and cats. The diets were tested in duplicate; two samples were purchased approximately 3 to 4 months apart with different lot numbers. Multiplex PCR-targeted mitochondrial DNA with two species-specific primers was used to amplify and sequence two sections of the cytochrome b gene for each of the 11 mammalian species. Half of the diets assessed (7/14) were positive for one or more undeclared mammalian DNA source (bovine, porcine, or ovine), and the result was repeatable for one or more species in six diets. While most of the detected DNA was found at both time points, in some cases, the result was positive only at one time point, suggesting the presence may have been due to unintentional cross-contact with animal-sourced ingredients. DNA from feline, cervine, canine, caprine, equine, murine (mouse and rat) and leporine was not identified in any samples. However, evidence of mammalian DNA does not confirm adulteration by the manufacturer nor elucidate its clinical significance when consumed by animals that may benefit from a vegetarian or vegan diet. Journal of Animal Physiology and Animal Nutrition © 2016 Blackwell Verlag GmbH.

  3. Study of deoxyribonucleic acid-ligand interactions by partial filling affinity capillary electrophoresis

    Czech Academy of Sciences Publication Activity Database

    Růžička, Martin; Čížková, Martina; Jirásek, Michael; Teplý, Filip; Koval, Dušan; Kašička, Václav

    2014-01-01

    Roč. 1349, Jul (2014), s. 116-121 ISSN 0021-9673. [ITP 2013. International Symposium on Electro- and Liquid Phase- Separation Techniques /20./. Puerto de la Cruz, 06.10.2013-09.10.2013] R&D Projects: GA ČR(CZ) GAP206/12/0453; GA ČR(CZ) GA13-17224S; GA ČR GA13-32974S; GA ČR GA13-19213S Institutional support: RVO:61388963 Keywords : affinity capillary electrophoresis * stability constant * DNA * ethidium bromide * oligophenylene derivatives * partial filling Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 4.169, year: 2014

  4. Pellet pestle homogenization of agarose gel slices at 45 degrees C for deoxyribonucleic acid extraction.

    Science.gov (United States)

    Kurien, B T; Kaufman, K M; Harley, J B; Scofield, R H

    2001-09-15

    A simple method for extracting DNA from agarose gel slices is described. The extraction is rapid and does not involve harsh chemicals or sophisticated equipment. The method involves homogenization of the excised gel slice (in Tris-EDTA buffer), containing the DNA fragment of interest, at 45 degrees C in a microcentrifuge tube with a Kontes pellet pestle for 1 min. The "homogenate" is then centrifuged for 30 s and the supernatant is saved. The "homogenized" agarose is extracted one more time and the supernatant obtained is combined with the previous supernatant. The DNA extracted using this method lent itself to restriction enzyme analysis, ligation, transformation, and expression of functional protein in bacteria. This method was found to be applicable with 0.8, 1.0, and 2.0% agarose gels. DNA fragments varying from 23 to 0.4 kb were extracted using this procedure and a yield ranging from 40 to 90% was obtained. The yield was higher for fragments 2.0 kb and higher (70-90%). This range of efficiency was maintained when the starting material was kept between 10 and 300 ng. The heat step was found to be critical since homogenization at room temperature failed to yield any DNA. Extracting DNA with our method elicited an increased yield (up to twofold) compared with that extracted with a commercial kit. Also, the number of transformants obtained using the DNA extracted with our method was at least twice that obtained using the DNA extracted with the commercial kit. Copyright 2001 Academic Press.

  5. Identification of Biological Warfare (BW) Threat Agents Using Deoxyribonucleic Acid (DNA) Microarrays

    National Research Council Canada - National Science Library

    Schaudies, Paul R

    2005-01-01

    ...) antibiotic resistance genes, 4) virulence plasmid sequences and 5) ribosomal genes, we are in a unique position to develop a novel method for the identification and characterization of microorganism...

  6. Studies on the interaction of the food colorant tartrazine with double stranded deoxyribonucleic acid.

    Science.gov (United States)

    Basu, Anirban; Suresh Kumar, Gopinatha

    2016-05-01

    Interaction of the food additive tartrazine with double-stranded DNA was studied by spectroscopic and calorimetric techniques. Absorbance studies revealed that tartrazine exhibited hypochromism in the presence of DNA without any bathochromic effects. Minor groove displacement assay of DAPI and Hoechst 33258 suggested that tartrazine binds in the minor groove of DNA. The complexation was predominantly entropy driven with a smaller but favorable enthalpic contribution to the standard molar Gibbs energy. The equilibrium constant was evaluated to be (3.68 ± .08) × 10(4) M(-1) at 298.15 K. The negative standard molar heat capacity value along with an enthalpy-entropy compensation phenomenon proposed the involvement of dominant hydrophobic forces in the binding process. Tartrazine enhanced the thermal stability of DNA by 7.53 K under saturation conditions.

  7. Spermine induced reversible collapse of deoxyribonucleic acid-bridged nanoparticle-based assemblies

    NARCIS (Netherlands)

    Göeken, Kristian L.; Schasfoort, Richardus B.M.; Subramaniam, Vinod; Gill, Ron

    DNA-linked 2D and 3D nano-assemblies find use in a diverse set of applications, ranging from DNA-origami in drug delivery and medical imaging, to DNA-linked nanoparticle structures for use in plasmonics and (bio)sensing. However, once these structures have been fully assembled, few options are

  8. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

    2003-01-01

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  9. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  10. A G-C-rich palindromic structural motif and a stretch of single-stranded purines are required for optimal packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA.

    Science.gov (United States)

    Jaballah, Soumeya Ali; Aktar, Suriya J; Ali, Jahabar; Phillip, Pretty Susan; Al Dhaheri, Noura Salem; Jabeen, Aayesha; Rizvi, Tahir A

    2010-09-03

    During retroviral RNA packaging, two copies of genomic RNA are preferentially packaged into the budding virus particles whereas the spliced viral RNAs and the cellular RNAs are excluded during this process. Specificity towards retroviral RNA packaging is dependent upon sequences at the 5' end of the viral genome, which at times extend into Gag sequences. It has earlier been suggested that the Mason-Pfizer monkey virus (MPMV) contains packaging sequences within the 5' untranslated region (UTR) and Gag. These studies have also suggested that the packaging determinants of MPMV that lie in the UTR are bipartite and are divided into two regions both upstream and downstream of the major splice donor. However, the precise boundaries of these discontinuous regions within the UTR and the role of the intervening sequences between these dipartite sequences towards MPMV packaging have not been investigated. Employing a combination of genetic and structural prediction analyses, we have shown that region "A", immediately downstream of the primer binding site, is composed of 50 nt, whereas region "B" is composed of the last 23 nt of UTR, and the intervening 55 nt between these two discontinuous regions do not contribute towards MPMV RNA packaging. In addition, we have identified a 14-nt G-C-rich palindromic sequence (with 100% autocomplementarity) within region A that has been predicted to fold into a structural motif and is essential for optimal MPMV RNA packaging. Furthermore, we have also identified a stretch of single-stranded purines (ssPurines) within the UTR and 8 nt of these ssPurines are duplicated in region B. The native ssPurines or its repeat in region B when predicted to refold as ssPurines has been shown to be essential for RNA packaging, possibly functioning as a potential nucleocapsid binding site. Findings from this study should enhance our understanding of the steps involved in MPMV replication including RNA encapsidation process. Copyright (c) 2010 Elsevier Ltd

  11. A single-stranded conformational polymorphism (SSCP)-derived quantitative variable to monitor the virulence of a Barley yellow dwarf virus-PAV (BYDV-PAV) isolate during adaptation to the TC14 resistant wheat line.

    Science.gov (United States)

    Delaunay, Agnes; Lacroix, Christelle; Morliere, Stephanie; Riault, Gerard; Chain, Florian; Trottet, Maxime; Jacquot, Emmanuel

    2010-09-01

    A standardized single-stranded conformational polymorphism (SSCP) procedure is proposed as an alternative to the time-consuming biological characterization of Barley yellow dwarf virus-PAV (BYDV-PAV) isolates. Using this procedure, six of 21 overlapping regions used to scan the viral genome gave patterns specific to '4E' (avirulent) or '4T' ('4E'-derived virulent) isolates. The calibration of samples and integration of SSCP patterns corresponding to the nucleotide region 1482-2023 allowed the estimation of P(T) values that reflect the proportions of a '4T'-specific band. Analysis of the biological (area under the pathogen progress curve) and molecular (P(T)) data suggested a positive linear relation between these variables. Moreover, sequence analysis of the nucleotide region 1482-2023 highlighted the presence of a nucleotide polymorphism (C/A(1835)) which can be considered as a candidate for virus-host interactions linked to the monitored virulence. According to these parameters, P(T) values associated with '4E'- and '4T'-derived populations show that: (i) long-term infection of a BYDV-PAV isolate on the 'TC14' resistant host leads to the fixation of virulent individuals in viral populations; and (ii) the introduction of susceptible hosts in successive 'TC14' infections results in the maintenance of low virulence of the populations. Thus, the presented study demonstrates that SSCP is a useful tool for monitoring viral populations during the host adaptation process. The described impact of host alternation provides new opportunities for the use of the 'TC14' resistance source in BYDV-resistant breeding programmes. This study is part of the global effort made by the scientific community to propose sustainable alternatives to the chemical control of this viral disease.

  12. Mutagenesis of the Agrobacterium VirE2 single-stranded DNA-binding protein identifies regions required for self-association and interaction with VirE1 and a permissive site for hybrid protein construction.

    Science.gov (United States)

    Zhou, X R; Christie, P J

    1999-07-01

    The VirE2 single-stranded DNA-binding protein (SSB) of Agrobacterium tumefaciens is required for delivery of T-DNA to the nuclei of susceptible plant cells. By yeast two-hybrid and immunoprecipitation analyses, VirE2 was shown to self-associate and to interact with VirE1. VirE2 mutants with small deletions or insertions of a 31-residue oligopeptide (i31) at the N or C terminus or with an i31 peptide insertion at Leu236 retained the capacity to form homomultimers. By contrast, VirE2 mutants with modifications outside a central region located between residues 320 and 390 retained the capacity to interact with VirE1. These findings suggest the tertiary structure of VirE2 is important for homomultimer formation whereas a central domain mediates formation of a complex with VirE1. The capacity of VirE2 mutants to interact with full-length VirE2 in the yeast Saccharomyces cerevisiae correlated with the abundance of the mutant proteins in A. tumefaciens, suggesting that VirE2 is stabilized by homomultimerization in the bacterium. We further characterized the promoter and N- and C-terminal sequence requirements for synthesis of functional VirE2. A PvirB::virE2 construct yielded functional VirE2 protein as defined by complementation of a virE2 null mutation. By contrast, PvirE or Plac promoter constructs yielded functional VirE2 only if virE1 was coexpressed with virE2. Deletion of 10 or 9 residues from the N or C terminus of VirE2, respectively, or addition of heterologous peptides or proteins to either terminus resulted in a loss of protein function. However, an i31 peptide insertion at Tyr39 had no effect on protein function as defined by the capacity of the mutant protein to (i) interact with native VirE2, (ii) interact with VirE1, (iii) accumulate at abundant levels in A. tumefaciens, and (iv) restore wild-type virulence to a virE2 null mutant. We propose that Tyr39 of VirE2 corresponds to a permissive site for insertion of heterologous peptides or proteins of interest

  13. Karyotype and nucleic acid content in Zantedeschia aethiopica Spr ...

    African Journals Online (AJOL)

    Analysis of karyotype, nucleic deoxyribonucleic acid (DNA) content and sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) were performed in Zantedeschia aethiopica and Zantedeschia elliottiana. Mitotic metaphase in both species showed 2n=32. The chromosomes of both species were quite similar ...

  14. Karyotype and nucleic acid content in Zantedeschia aethiopica Spr ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-07-03

    Jul 3, 2012 ... Analysis of karyotype, nucleic deoxyribonucleic acid (DNA) content and sodium dodecyl sulfate polyacrylamide ... base pairs) for Z. aethiopica and 1144.26 ± 0.05 picograms (equivalent to 1144.26 mega base pairs) for Z. elliottiana. ... ml ice-cold nuclei-isolation buffer A of the Partec high resolution. DNA kit ...

  15. Nucleic acid detection system and method for detecting influenza

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Hong; Song, Jian

    2015-03-17

    The invention provides a rapid, sensitive and specific nucleic acid detection system which utilizes isothermal nucleic acid amplification in combination with a lateral flow chromatographic device, or DNA dipstick, for DNA-hybridization detection. The system of the invention requires no complex instrumentation or electronic hardware, and provides a low cost nucleic acid detection system suitable for highly sensitive pathogen detection. Hybridization to single-stranded DNA amplification products using the system of the invention provides a sensitive and specific means by which assays can be multiplexed for the detection of multiple target sequences.

  16. Recent Advances in Chemical Modification of Peptide Nucleic Acids

    Directory of Open Access Journals (Sweden)

    Eriks Rozners

    2012-01-01

    Full Text Available Peptide nucleic acid (PNA has become an extremely powerful tool in chemistry and biology. Although PNA recognizes single-stranded nucleic acids with exceptionally high affinity and sequence selectivity, there is considerable ongoing effort to further improve properties of PNA for both fundamental science and practical applications. The present paper discusses selected recent studies that improve on cellular uptake and binding of PNA to double-stranded DNA and RNA. The focus is on chemical modifications of PNA's backbone and heterocyclic nucleobases. The paper selects representative recent studies and does not attempt to provide comprehensive coverage of the broad and vibrant field of PNA modification.

  17. Methods of introducing nucleic acids into cellular DNA

    Energy Technology Data Exchange (ETDEWEB)

    Lajoie, Marc J.; Gregg, Christopher J.; Mosberg, Joshua A.; Church, George M.

    2017-06-27

    A method of introducing a nucleic acid sequence into a cell is provided where the cell has impaired or inhibited or disrupted DnaG primase activity or impaired or inhibited or disrupted DnaB helicase activity, or larger or increased gaps or distance between Okazaki fragments or lowered or reduced frequency of Okazaki fragment initiation, or the cell has increased single stranded DNA (ssDNA) on the lagging strand of the replication fork including transforming the cell through recombination with a nucleic acid oligomer.

  18. Psoralen-deoxyribonucleic acid photoreaction. Characterization of the monoaddition products from 8-methoxypsoralen and 4,5',8-trimethylpsoralen

    International Nuclear Information System (INIS)

    Kanne, D.; Straub, K.; Rapoport, H.; Hearst, J.E.

    1982-01-01

    The isolation and structural characterization are described of the major monoaddition products formed in the photoreaction of two naturally occurring psoralens, 8-methoxypsoralen and 4,5',8-trimethylpsoralen, with high molecular weight, double-stranded DNA. Hydrolysis of the psoralen-modified DNA and subsequent chromatography resulted in the isolation of four modified nucleosides from each psoralen. Structural characterization was accomplished by mass spectrometry and 1 H NMR analysis. The major products, accounting for 44 to 52% of the covalently bound psoralen, are two diastereomeric thymidine adducts formed by cycloaddition between the 5,6 double bond of the pyrimidine and the 4',5' (furan) double bond of the psoralen. All of the isolated adducts have cis-syn stereochemistry. The stereochemistry and product distribution of the adducts are determined in part by the constraints imposed by the DNA helix on the geometry of the noncovalent intercalation complex formed by psoralen and DNA prior to irradiation

  19. Value of high-risk human papillomavirus 16 deoxyribonucleic acid testing with cytological entities in peri and postmenopausal women

    Directory of Open Access Journals (Sweden)

    Veena Kashyap

    2013-01-01

    Conclusions: There is not much variation in HPV 16 positive cases in peri and postmenopausal women. By combining HPV DNA testing with Pap smear more cases having potential for pre-cancer lesions may be detected; however, HPV test cannot replace the Pap smear in low resource setting.

  20. Effects of polyamines and methylglyoxal bis(guanylhydrazone) on hepatic nuclear structure and deoxyribonucleic acid template activity.

    Science.gov (United States)

    Brown, K B; Nelson, N F; Brown, D G

    1975-12-01

    1. The interaction of polyamines and methylglyoxal bis(guanythydrazone) (1, 1'-[(methylethanediylidene)-dinitrilo]diguanidine) with isolated rat liver nuclei was investigated by electron microscopy. 2. At 4mM, putrescine was without effect; however, spermidine, spermine or methylglyoxal bis(guanythydrazone) resulted in dispersed chromatin and alterations in nucleolar structure. In addition, spermidine or methylglyoxal bis(guanylhydrazone) caused marked aggregation of interchromatin granules. 3. The DNA template property of calf thymus DNA was examined by using DNA polymerases from Escherichia coli, Micrococcus lysodeikticus and calf thymus in the presence of 0-5 mM-amine. 4. In the presence of DNA polymerase, spermine or methylglyoxal bis(guanylhydrazone) inhibited activity, whereas putrescine or spermidine had much less effect or in some cases stimulated [3H]dTMP incorporation. 5. Template activity which was inhibited by spermine or methylglyoxal bis(guanylhydrazone) could be partially restored by additional DNA or enzyme. 6. When mixed with calf thymus DNA, calf thymus histone inhibited template activity as measured with E. coli DNA polymerase. The template activity of such a 'histone-nucleate' could not be restored by putrescine, spermidine, spermine or methylglyoxal bis(guanylhydrazone). 7. DNA template activity of isolated rat liver nuclei was tested by using E. coli DNA polymerase. None of the amines was able to increase the template activity of the nuclear DNA in vitro.

  1. Different reparability of the chromosomal and cytoplasmic deoxyribonucleic acid in Escherichia coli damaged by γ and ultraviolet irradiation

    International Nuclear Information System (INIS)

    Petranovic, D.; Petranovic, M.; Nozinic, R.; Trgovcevic, Z.

    1978-01-01

    The relative efficiencies by which chromosomal and extrachromosomal DNAs are repaired in irradiated bacteria were assayed. Repair-proficient Escherichia coli C600 cells lysogenic for, or infected with, the thermoinducible phage lambdacI857 ind were exposed to γ or uv radiation and then tested for colony- and plaque-forming ability. The results show that the bacterial cell is about 5 times more sensitive to γ rays and about 1.5 times more sensitive to uv light, if compared to either (1) the prophage that is irradiated in the bacterial chromosome and, on heat induction, repaired in the cytoplasm or (2) the infecting phage that is irradiated and repaired in the cytoplasm. Since the bacterial DNA is about 80 times larger than the phage DNA, it is inferred that repair processes operating along the chromosomal DNA are one order of magnitude more efficient than those operating along the extrachromosomal DNA. This conclusion is reinforced by the fact that the absence of repair in the system Escherichia coli AB2480 uvrA recA-lambdacI857 ind red gives the expected ratio of 80/1 for the uv sensitivity of cells and that of intracellular phage

  2. Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

    International Nuclear Information System (INIS)

    Rude, J.M.; Friedberg, E.C.

    1977-01-01

    Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to UV radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a UV fluence of 5 J/m 2 . At this same UV fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the UV fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in UV-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semiconservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity

  3. Quality and Quantity of Extracted Deoxyribonucleic Acid (DNA) from Preserved Soft Tissues of Putrefied Unidentifiable Human Corpse

    OpenAIRE

    Pooniya, Shashank; Lalwani, Sanjeev; Raina, Anupuma; Millo, Tabin; Dogra, Tirath Das

    2014-01-01

    Context: The appropriate collection and preservation of soft tissues from putrefied unidentifiable human corpse for the purpose of identification using DNA profiling technique is critically important especially in developing countries like India having different levels of health-care set ups with largely varying facilities and varying climatic conditions. Aims: The present study was carried out, mainly focusing on quality and quantity of extracted DNA from the soft tissues of putrefied uniden...

  4. Quality and quantity of extracted deoxyribonucleic Acid (DNA) from preserved soft tissues of putrefied unidentifiable human corpse.

    Science.gov (United States)

    Pooniya, Shashank; Lalwani, Sanjeev; Raina, Anupuma; Millo, Tabin; Dogra, Tirath Das

    2014-01-01

    The appropriate collection and preservation of soft tissues from putrefied unidentifiable human corpse for the purpose of identification using DNA profiling technique is critically important especially in developing countries like India having different levels of health-care set ups with largely varying facilities and varying climatic conditions. The present study was carried out, mainly focusing on quality and quantity of extracted DNA from the soft tissues of putrefied unidentifiable human corpse stored upto 4 weeks at 4°C and at -80°C for DNA analysis. The present study was conducted on 16 different putrefied unidentifiable human corpses after getting approval from institutional ethical committee. Around 2 g of four different tissues (brain, kidney, heart and muscle) were collected and preserved for one month followed by DNA extraction using the organic method, the quality and quantity of high molecular weight-DNA was estimated using the spectrophotometer and gel electrophoresis. Further, the amplification polymerase chain reaction (PCR) was also performed (AmpFLSTR(®) Indentifiler™ PCR Amplification kit for multiple loci, of Applied Biosystems, Lab India) and was checked using continuous PAGE. The yield of DNA was significantly higher at -80°C for all the four tissues collected and was best for brain followed by heart, kidney and worst for muscles in all cases. It is suggested that the brain tissue preserved at -80°C is the best among soft issues for DNA extraction. Refrigeration or deep freezing facility should be available at all the centers.

  5. Inflammation but no DNA (deoxyribonucleic acid) damage in mice exposed to airborne dust from a biofuel plant

    DEFF Research Database (Denmark)

    Madsen, Anne Mette; Saber, Anne Thoustrup; Nordly, Pernille

    2008-01-01

    Objectives Particles in ambient air are associated with such health effects as lung diseases and cancer of the lung. Exposure to bioaerosols has been found to be associated with respiratory symptoms. The toxic properties of exposure to combustion and bioaerosol particles from biofuel plants have ...

  6. Simulation model of converging-diverging (CD) nozzle to improve particle delivery system of deoxyribonucleic acid (DNA)

    Science.gov (United States)

    Sumarsono, Danardono A.; Ibrahim, Fera; Santoso, Satria P.; Sari, Gema P.

    2018-02-01

    Gene gun is a mechanical device which has been used to deliver DNA vaccine into the cells and tissues by increasing the uptake of DNA plasmid so it can generate a high immune response with less amount of DNA. Nozzle is an important part of the gene gun which used to accelerate DNA in particle form with a gas flow to reach adequate momentum to enter the epidermis of human skin and elicit immune response. We developed new designs of nozzle for gene gun to make DNA uptake more efficient in vaccination. We used Computational Fluid Dynamics (CFD) by Autodesk® Simulation 2015 to simulate static fluid pressure and velocity contour of supersonic wave and parametric distance to predict the accuracy of the new nozzle. The result showed that the nozzle could create a shockwave at the distance parametric to the object from 4 to 5 cm using fluid pressure varied between 0.8-1.2 MPa. This is indication a possibility that the DNA particle could penetrate under the mammalian skin. For the future research step, this new nozzle model could be considered for development the main component of the DNA delivery system in vaccination in vivo

  7. Anti-nucleosome antibodies in systemic lupus erythematosus patients: Relation to anti-double stranded deoxyribonucleic acid and disease activity

    Directory of Open Access Journals (Sweden)

    Mayada Ali Abdalla

    2018-01-01

    Conclusion: Anti-NCS antibodies could play a role in the pathogenesis of SLE and is related to disease activity. Its association with anti-dsDNA antibodies and its presence in those with negative anti-ds DNA may aid in the diagnosis of SLE.

  8. Fate of transgenic deoxyribonucleic acid fragments in digesta and tissues of rabbits fed genetically modified soybean meal.

    Science.gov (United States)

    Morera, P; Basiricò, L; Ronchi, B; Bernabucci, U

    2016-03-01

    Numerous animal feeding studies have investigated the presence of DNA from transgenic plants in tissues from different animal species, but the data reported are sometimes controversial. The aim of this study was to investigate the presence of transgenic DNA (tDNA) in the digesta and tissues of a meat rabbit breed fed genetically modified (GM) soybean meal. Fifteen male New Zealand White rabbits were used for the experimental trial. Ten rabbits (treated group [TG]) were fed a mixed feed containing 10% GM soybean meal and 5 rabbits (control group [CG]) received a mixed feed containing conventional soybean meal, both from weaning (28 d of age) to slaughter (80 ± 3 d). Samples of blood, liver, kidney, heart, stomach, intestine (jejunum), lateral quadricep muscle, longissimus muscle, and perirenal adipose tissue were collected to assess the possible DNA transfer from GM feed to animal tissues. Samples of stomach contents and feces were also taken to study the degradability of ingested tDNA from feed in the digestive tract of rabbit. Moreover, samples of hair were collected to determine the possible environmental contamination from feed powders present on the farm. The DNA extraction was performed using specific genomic DNA kits. All samples were monitored, by using real-time PCR, for oligonucleotide primers and probes specific for the transgenic Roundup Ready soybean 40-3-2 and for the endogenous () gene. As an internal control of rabbit tissues, the presence of the () gene was used. In this study, no fragments of tDNA were detectable in tissue DNA samples of rabbits except in the extracted DNA from stomach digesta, feces, and hair of rabbits fed with GM soybean. Similar results were found for the reference gene, whereas the presence of the gene was detected in all rabbit tissues. The lack of tDNA of soybean in rabbit tissues represents an important result, which demonstrates that meat from rabbits fed a diet containing GM feed is as that derived from rabbits fed conventional crops. The recombinant DNA recovered in the stomach digesta and in feces indicates an incomplete digestion of the soybean DNA in the gastrointestinal tract of the rabbit, whereas the presence of trace soybean transgene in the hair of the TG rabbits is suggestive of an environmental contamination.

  9. Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Rude' e, J.M.; Friedberg, E.C.

    1977-03-01

    Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to uv radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a uv fluence of 5 J/m2. At this same uv fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the uv fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in uv-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semi-conservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity.

  10. In vitro stimulation of stage-specific deoxyribonucleic acid synthesis in rat seminiferous tubule segments by interleukin-1 α

    International Nuclear Information System (INIS)

    Parvinen, M.; Soeder, O.M.; Mali, P.; Froeysa, B.R.; Ritzen, E.M.

    1991-01-01

    Levels of rat testicular interleukin-1-like factor (tIL-1) have been shown to correlate with DNA synthetic activity during the cycle of the rat seminiferous epithelium, suggesting its role as a spermatogonial or meiotic growth factor. To explore this further, a new in vitro model system was developed. Rat seminiferous tubule segments from stages I, V, VIIa, and VIII-IX of the cycle were isolated by transillumination-assisted microdissection, cultured in chemically defined serum-free medium supplemented with human recombinant IL-1 α, and labeled with [3H]thymidine. During incubation, spontaneous progression of spermatogenesis was noted. Inactive stage VIIa tubule segments differentiated to stage VIII and initiated DNA synthesis, and concomitantly started to secrete IL-1-like factor. DNA synthesis of stages VIII-IX ceased through differentiation of spermatocytes to leptotene-zygotene (stages XII-XIII of the cycle). IL-1 α stimulated DNA synthesis significantly in spermatogonia of stage I. Meiotic DNA synthesis at stage VIIa was stimulated (48 h/34 C) and maintained at stages VIII-IX (48 h/34 C). IL-1 α seems to act as a regulator of spermatogenic DNA synthesis in both mitotic and meiotic phases. It has mainly stimulating and maintaining effects, but it may also be inhibitory under certain conditions

  11. Reaction of single-standard DNA with hydroxyl radical generated by iron(II)-ethylenediaminetetraacetic acid

    International Nuclear Information System (INIS)

    Prigodich, R.V.; Martin, C.T.

    1990-01-01

    This study demonstrates that the reaction of Fe(II)-EDTA and hydrogen peroxide with the single-stranded nucleic acids d(pT) 70 and a 29-base sequence containing a mixture of bases results in substantial damage which is not directly detected by gel electrophoresis. Cleavage of the DNA sugar backbone is enhanced significantly after the samples are incubated at 90 degree C in the presence of piperidine. The latter reaction is used in traditional Maxam-Gilbert DNA sequencing to detect base damage, and the current results are consistent with reaction of the hydroxyl radical with the bases in single-stranded DNA (although reaction with sugar may also produce adducts that are uncleaved but labile to cleavage by piperidine). We the authors propose that hydroxyl radicals may react preferentially with the nucleic acid bases in ssDNA and that reaction of the sugars in dsDNA is dominant because the bases are sequestered within the double helix. These results have implications both for the study of single-stranded DNA binding protein binding sites and for the interpretation of experiments using the hydroxyl radical to probe DNA structure or to footprint double-stranded DNA binding protein binding sites

  12. DNA degradation, UV sensitivity and SOS-mediated mutagenesis in strains of Escherichia coli deficient in single-strand DNA binding protein: Effects of mutations and treatments that alter levels of exonuclease V or RecA protein

    International Nuclear Information System (INIS)

    Lieberman, H.B.; Witkin, E.M.

    1983-01-01

    Certain strains suppress the temperature-sensitivity caused by ssb-1, which encodes a mutant ssDNA binding protein (SSB). At 42 0 C, such strains are extremely UV-sensitive, degrade their DNA extensively after UV irradiation, and are defficient in UV mutability and UV induction of recA protein synthesis. We transduced recC22, which eliminates Exonuclease V activity, and recAo281, which causes operator-constitutive synthesis of recA protein, into such an ssb-1 strain. Both double mutants degraded their DNA extensively at 42 0 C after UV irradiation, and both were even more UV-sensitive than the ssb-1 single mutant. We conclude that one or more nucleases other than Exonuclease V degrades DNA in the ssb recC strain, and that recA protein, even if synthesized copiously, can function efficiently in recombinational DNA repair and in control of post-UV DNA degradation only if normal SSB is also present. Pretreatment with nalidixic acid at 30 0 C restored normal UV mutability at 42 0 C, but did not increase UV resistance, in an ssb-1 strain. Another ssb allele, ssb-113, which blocks SOS induction at 30 0 C, increases spontaneous mutability more than tenfold. The ssb-113 allele was transduced into the SOS-constitutive recA730 strain SC30. This double mutant expressed the same elevated spontaneous and UV-induced mutability at 30 0 C as the ssb + recA730 strain, and was three times more UV-resistant than its ssb-113 recA + parent. We conclude that ssb-1 at 42 0 C and ssb-113 at 30 0 C block UV-induced activation of recA protease, but that neither allele interferes with subsequent steps in SOS-mediated mutagenesis. (orig.)

  13. Inititation and termination of chromosome replication in Escherichia coli subjected to amino acid starvation.

    OpenAIRE

    Marsh, R C; Hepburn, M L

    1980-01-01

    Initiation and termination of chromosome replication in an Escherichia coli auxotroph subjected to amino acid starvation were examined by following the incorporation of [3H]thymidine into the EcoRI restriction fragments of the chromosome. The pattern of incorporation observed upon restoration of the amino acid showed that starvation blocks the process of initiation prior to deoxyribonucleic acid synthesis within any significant portion of the EcoRI fragment which contains the origin of replic...

  14. Spectrofluorometric study on photochemical interaction between chlorpromazine and nucleic acids

    International Nuclear Information System (INIS)

    Fujita, H.; Hayashi, H.; Suzuki, K.

    1981-01-01

    Near-UV irradiation of a mixture of chlorpromazine and single-stranded nucleic acids produced a non-dialyzable photoproduct which emitted characteristic fluorescence at around 520 nm. The same fluorescent species was also formed by the photoreaction with purine nucleotides but not with pyrimidine nucleotide. The highest photoreactivity was observed with GMP. Smaller amounts of the species were formed in a solution with a high salt concentration than in that with a low salt concentration. A higher rate was observed under anaerobic conditions than under aerobic conditions. (author)

  15. Injury-induced inhibition of small intestinal protein and nucleic acid synthesis

    International Nuclear Information System (INIS)

    Carter, E.A.; Hatz, R.A.; Yarmush, M.L.; Tompkins, R.G.

    1990-01-01

    Small intestinal mucosal weight and nutrient absorption are significantly diminished early after cutaneous thermal injuries. Because these intestinal properties are highly dependent on rates of nucleic acid and protein synthesis, in vivo incorporation of thymidine, uridine, and leucine into small intestinal deoxyribonucleic acid, ribonucleic acid, and proteins were measured. Deoxyribonucleic acid synthesis was markedly decreased with the lowest thymidine incorporation in the jejunum (p less than 0.01); these findings were confirmed by autoradiographic identification of radiolabeled nuclei in the intestinal crypts. Protein synthesis was decreased by 6 h postinjury (p less than 0.01) but had returned to normal by 48 h. Consistent with a decreased rate of protein synthesis, ribonucleic acid synthesis was also decreased 18 h postinjury (p less than 0.01). These decreased deoxyribonucleic acid, ribonucleic acid, and protein synthesis rates are not likely a result of ischemia because in other studies of this injury model, intestinal blood flow was not significantly changed by the burn injury. Potentially, factors initiating the acute inflammatory reaction may directly inhibit nucleic acid and protein synthesis and lead to alterations in nutrient absorption and intestinal barrier function after injury

  16. Leptin gene polymorphism in Indian Sahiwal cattle by single strand ...

    African Journals Online (AJOL)

    These leptin gene variants can be sequenced and screened in the entire population to develop single nucleotide polymorphisms (SNPs) for association studies with different productive and reproductive performances and marker assisted selection. Keywords: Leptin gene, PCR-SSCP, genetic variability, dairy cattle

  17. Effect of Thymine Starvation on Messenger Ribonucleic Acid Synthesis in Escherichia coli

    Science.gov (United States)

    Luzzati, Denise

    1966-01-01

    Luzzati, Denise (Institut de Biologie Physico-Chimique, Paris, France). Effect of thymine starvation on messenger ribonucleic acid synthesis in Escherichia coli. J. Bacteriol. 92:1435–1446. 1966.—During the course of thymine starvation, the rate of synthesis of messenger ribonucleic acid (mRNA, the rapidly labeled fraction of the RNA which decays in the presence of dinitrophenol or which hybridizes with deoxyribonucleic acid) decreases exponentially, in parallel with the viability of the thymine-starved bacteria. The ability of cell-free extracts of starved bacteria to incorporate ribonucleoside triphosphates into RNA was determined; it was found to be inferior to that of extracts from control cells. The analysis of the properties of cell-free extracts of starved cells shows that their decreased RNA polymerase activity is the consequence of a modification of their deoxyribonucleic acid, the ability of which to serve as a template for RNA polymerase decreases during starvation. PMID:5332402

  18. Mechanism of thermal renaturation and hybridization of nucleic acids: Kramers' process and universality in Watson-Crick base pairing.

    Science.gov (United States)

    Sikorav, Jean-Louis; Orland, Henri; Braslau, Alan

    2009-03-26

    Renaturation and hybridization reactions lead to the pairing of complementary single-stranded nucleic acids. We present here a theoretical investigation of the mechanism of these reactions in vitro under thermal conditions (dilute solutions of single-stranded chains, in the presence of molar concentrations of monovalent salts and at elevated temperatures). The mechanism follows a Kramers' process, whereby the complementary chains overcome a potential barrier through Brownian motion. The barrier originates from a single rate-limiting nucleation event in which the first complementary base pairs are formed. The reaction then proceeds through a fast growth of the double helix. For the DNA of bacteriophages T7, T4, and phiX174, as well as for Escherichia coli DNA, the bimolecular rate k2 of the reaction increases as a power law of the average degree of polymerization of the reacting single-strands: k2 is proportional to alpha. This relationship holds for 100 < or = 50,000 with an experimentally determined exponent alpha = 0.51 +/- 0.01. The length dependence results from a thermodynamic excluded-volume effect. The reacting single-stranded chains are predicted to be in universal good solvent conditions, and the scaling law is determined by the relevant equilibrium monomer contact probability. The value theoretically predicted for the exponent is alpha = 1 - nutheta2, where nu is Flory's swelling exponent (nu approximately equal 0.588), and theta2 is a critical exponent introduced by des Cloizeaux (theta2 approximately equal 0.82), yielding alpha = 0.52 +/- 0.01, in agreement with the experimental results.

  19. Nucleic Acid Aptamers as Novel Class of Therapeutics to Mitigate Alzheimer's Disease Pathology

    DEFF Research Database (Denmark)

    K. Tannenberg, Rudi; Al. Shamaileh, Hadi; Lauridsen, Lasse Holm

    2013-01-01

    Deposition of amyloid-beta (A beta) peptides in the brain is a central event in the pathogenesis of Alzheimer's disease (AD), which makes A beta peptides a crucial target for therapeutic intervention. Significant efforts have been made towards the development of ligands that bind to A beta peptides...... with a goal of early detection of amyloid aggregation and the neutralization of A toxicity. Short single-stranded oligonucleotide aptamers bind with high affinity and specificity to their targets. Aptamers that specifically bind to A beta monomers, specifically the 40 and 42 amino acid species (A beta(1...

  20. Relevance of DNA repair pathways on ascorbic acid effects on Echerichia Coli K-12 cells

    International Nuclear Information System (INIS)

    Slyus, M.A. van; Oliveira, R.L.B. da C.; Felzenszwalb, I.; Gomes, R.A.; Menck, C.F.

    1985-01-01

    Inactivation kinetics were performed with repair proficient and deficient Escherichia coli K-12 cells treated with oxidized solutions of ascorbic acid. The repair pathways controlled by the recA and uvrA gene products are essential for cell survival to the treatment. However, SOS chromotest result indicates that the SOS functions are only induced at high and toxic concentrations of the drug. Moreover, single strand breaks in DNA from treated cells are detected, demonstrating genome damage promoted by oxidized solutions of ascorbate. (M.A.C.) [pt

  1. Bis-pyrene-modified unlocked nucleic acids: synthesis, hybridization studies, and fluorescent properties

    DEFF Research Database (Denmark)

    Perlíková, Pavla; Ejlersen, Maria; Langkjaer, Niels

    2014-01-01

    Efficient synthesis of a building block for the incorporation of a bis-pyrene-modified unlocked nucleic acid (UNA) into oligonucleotides (DNA*) was developed. The presence of bis-pyrene-modified UNA within a duplex leads to duplex destabilization that is more profound in DNA*/RNA and less distinct......)uracil:pyrene exciplex emission in the single-stranded form. Such fluorescent properties enable the application of bis-pyrene-modified UNA in the development of fluorescence probes for DNA/RNA detection and for detection of deletions at specific positions....

  2. Microbial dynamics in anaerobic enrichment cultures degrading di-n-butyl phthalic acid ester

    DEFF Research Database (Denmark)

    Trably, Eric; Batstone, Damien J.; Christensen, Nina

    2008-01-01

    in enrichment cultures degrading phthalic acid esters under methanogenic conditions. A selection pressure was applied by adding DBP at 10 and 200 mg L(-1) in semi-continuous anaerobic reactors. The microbial dynamics were monitored using single strand conformation polymorphism (SSCP). While only limited abiotic...... losses were observed in the sterile controls (20-22%), substantial DBP biodegradation was found in the enrichment cultures (90-99%). In addition, significant population changes were observed. The dominant bacterial species in the DBP-degrading cultures was affiliated to Soehngenia saccharolytica...

  3. Small, acid-soluble proteins bound to DNA protect Bacillus subtilis spores from killing by dry heat.

    OpenAIRE

    Setlow, B; Setlow, P

    1995-01-01

    Dry Bacillus subtilis spores lacking their two major DNA-binding proteins (small, acid-soluble proteins [SASP] alpha and beta) were much more sensitive to dry heat than were wild-type spores. Survivors of dry heat treatment of both wild-type and mutant spores exhibited a high frequency of mutations, and the DNA from the heated spores had increased numbers of single-strand breaks. These data indicate that SASP alpha and beta provide significant protection to spore DNA against the damaging effe...

  4. Deoxyribonucleic Acid and Other Words Students Avoid Speaking Aloud: Evaluating the Role of Pronunciation on Participation in Secondary School Science Classroom Conversations

    Science.gov (United States)

    Beck, Stacie Elizabeth

    Student's verbal participation in science classrooms is an essential element in building the skills necessary for proficiency in scientific literacy and discourse. The myriad of new, multisyllabic vocabulary terms introduced in one year of secondary school biology instruction can overwhelm students and further impede the self-efficacy needed for concise constructions of scientific explanations and arguments. Factors inhibiting students' inclination to answer questions, share ideas and respond to peers in biology classrooms include confidence and self-perceived competence in appropriately speaking the language of science. Providing students with explicit, engaging instruction in methods to develop vocabulary for use in expressing conclusions is critical for expanding comprehension of science concepts. This study fused the recommended strategies for engaging vocabulary instruction with linguistic practices for teaching pronunciation to examine the relationship between a student's ability to pronounce challenging bio-terminology and their propensity to speak in teacher-led, guided classroom discussions. Interviews, surveys, and measurements quantifying and qualifying students' participation in class discussions before and after explicit instruction in pronunciation were used to evaluate the potential of this strategy as an appropriate tool for increasing students' self-efficacy and willingness to engage in biology classroom conversations. The findings of this study showed a significant increase in student verbal participation in classroom discussions after explicit instruction in pronunciation combined with vocabulary literacy strategies. This research also showed an increase in the use of vocabulary words in student comments after the intervention.

  5. Effects of growth hormone, prolactin, and placental lactogen on insulin content and release, and deoxyribonucleic acid synthesis in cultured pancreatic islets

    DEFF Research Database (Denmark)

    Nielsen, Jens Høiriis

    1982-01-01

    The direct effects of human GH (hGH), ovine pituitary PRL (oPRL), and human chorionic somatomammotropin [placental lactogen (hPL)] on the endocrine pancreas were studied in isolated pancreatic islets maintained in tissue culture. Islets of Langerhans were isolated by collagenase treatment of panc...

  6. Binding of the biogenic polyamines to deoxyribonucleic acids of varying base composition: base specificity and the associated energetics of the interaction.

    Science.gov (United States)

    Kabir, Ayesha; Suresh Kumar, Gopinatha

    2013-01-01

    The thermodynamics of the base pair specificity of the binding of the polyamines spermine, spermidine, putrescine, and cadaverine with three genomic DNAs Clostridium perfringens, 27% GC, Escherichia coli, 50% GC and Micrococcus lysodeikticus, 72% GC have been studied using titration calorimetry and the data supplemented with melting studies, ethidium displacement and circular dichroism spectroscopy results. Isothermal titration calorimetry, differential scanning calorimetry, optical melting studies, ethidium displacement, circular dichroism spectroscopy are the various techniques employed to characterize the interaction of four polyamines, spermine, spermidine, putersine and cadaverine with the DNAs. Polyamines bound stronger with AT rich DNA compared to the GC rich DNA and the binding varied depending on the charge on the polyamine as spermine>spermidine >putrescine>cadaverine. Thermodynamics of the interaction revealed that the binding was entropy driven with small enthalpy contribution. The binding was influenced by salt concentration suggesting the contribution from electrostatic forces to the Gibbs energy of binding to be the dominant contributor. Each system studied exhibited enthalpy-entropy compensation. The negative heat capacity changes suggested a role for hydrophobic interactions which may arise due to the non polar interactions between DNA and polyamines. From a thermodynamic analysis, the AT base specificity of polyamines to DNAs has been elucidated for the first time and supplemented by structural studies.

  7. High-Sensitivity C-Reactive Protein Complements Plasma Epstein-Barr Virus Deoxyribonucleic Acid Prognostication in Nasopharyngeal Carcinoma: A Large-Scale Retrospective and Prospective Cohort Study

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Lin-Quan [Sun Yat-sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University, Guangzhou (China); Department of Nasopharyngeal Carcinoma, Sun Yat-sen University, Guangzhou (China); Li, Chao-Feng [Sun Yat-sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University, Guangzhou (China); Department of Information Technology, Sun Yat-sen University, Guangzhou (China); Chen, Qiu-Yan; Zhang, Lu [Sun Yat-sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University, Guangzhou (China); Department of Nasopharyngeal Carcinoma, Sun Yat-sen University, Guangzhou (China); Lai, Xiao-Ping; He, Yun; Xu, Yun-Xiu-Xiu; Hu, Dong-Peng; Wen, Shi-Hua; Peng, Yu-Tuan [ZhongShan School of Medicine, Sun Yat-sen University, Guangzhou (China); Chen, Wen-Hui [Sun Yat-sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University, Guangzhou (China); Liu, Huai; Guo, Shan-Shan; Liu, Li-Ting [Sun Yat-sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University, Guangzhou (China); Department of Nasopharyngeal Carcinoma, Sun Yat-sen University, Guangzhou (China); Li, Jing [Sun Yat-sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University, Guangzhou (China); Zhang, Jing-Ping [Sun Yat-sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University, Guangzhou (China); Department of Clinical Laboratory, Sun Yat-sen University, Guangzhou (China); and others

    2015-02-01

    Purpose: To evaluate the effects of combining the assessment of circulating high-sensitivity C-reactive protein (hs-CRP) with that of Epstein-Barr virus DNA (EBV DNA) in the pretherapy prognostication of nasopharyngeal carcinoma (NPC). Patients and Methods: Three independent cohorts of NPC patients (training set of n=3113, internal validation set of n=1556, and prospective validation set of n=1668) were studied. Determinants of disease-free survival, distant metastasis–free survival, and overall survival were assessed by multivariate analysis. Hazard ratios and survival probabilities of the patient groups, segregated by clinical stage (T1-2N0-1M0, T3-4N0-1M0, T1-2N2-3M0, and T3-4N2-3M0) and EBV DNA load (low or high) alone, and also according to hs-CRP level (low or high), were compared. Results: Elevated hs-CRP and EBV DNA levels were significantly correlated with poor disease-free survival, distant metastasis–free survival, and overall survival in both the training and validation sets. Associations were similar and remained significant after excluding patients with cardiovascular disease, diabetes, and chronic hepatitis B. Patients with advanced-stage disease were segregated by high EBV DNA levels and high hs-CRP level into a poorest-risk group, and participants with either high EBV DNA but low hs-CRP level or high hs-CRP but low EBV DNA values had poorer survival compared with the bottom values for both biomarkers. These findings demonstrate a significant improvement in the prognostic ability of conventional advanced NPC staging. Conclusion: Baseline plasma EBV DNA and serum hs-CRP levels were significantly correlated with survival in NPC patients. The combined interpretation of EBV DNA with hs-CRP levels led to refinement of the risks for the patient subsets, with improved risk discrimination in patients with advanced-stage disease.

  8. Binding of the biogenic polyamines to deoxyribonucleic acids of varying base composition: base specificity and the associated energetics of the interaction.

    Directory of Open Access Journals (Sweden)

    Ayesha Kabir

    Full Text Available BACKGROUND: The thermodynamics of the base pair specificity of the binding of the polyamines spermine, spermidine, putrescine, and cadaverine with three genomic DNAs Clostridium perfringens, 27% GC, Escherichia coli, 50% GC and Micrococcus lysodeikticus, 72% GC have been studied using titration calorimetry and the data supplemented with melting studies, ethidium displacement and circular dichroism spectroscopy results. METHODOLOGY/PRINCIPAL FINDINGS: Isothermal titration calorimetry, differential scanning calorimetry, optical melting studies, ethidium displacement, circular dichroism spectroscopy are the various techniques employed to characterize the interaction of four polyamines, spermine, spermidine, putersine and cadaverine with the DNAs. Polyamines bound stronger with AT rich DNA compared to the GC rich DNA and the binding varied depending on the charge on the polyamine as spermine>spermidine >putrescine>cadaverine. Thermodynamics of the interaction revealed that the binding was entropy driven with small enthalpy contribution. The binding was influenced by salt concentration suggesting the contribution from electrostatic forces to the Gibbs energy of binding to be the dominant contributor. Each system studied exhibited enthalpy-entropy compensation. The negative heat capacity changes suggested a role for hydrophobic interactions which may arise due to the non polar interactions between DNA and polyamines. CONCLUSION/SIGNIFICANCE: From a thermodynamic analysis, the AT base specificity of polyamines to DNAs has been elucidated for the first time and supplemented by structural studies.

  9. Metronomic Adjuvant Chemotherapy Improves Treatment Outcome in Nasopharyngeal Carcinoma Patients With Postradiation Persistently Detectable Plasma Epstein-Barr Virus Deoxyribonucleic Acid

    Energy Technology Data Exchange (ETDEWEB)

    Twu, Chih-Wen [Institute of Clinical Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Department of Otorhinolaryngology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Wang, Wen-Yi [Section of Basic Medicine, Department of Nursing, Hung Kuang University, Taichung, Taiwan (China); Chen, Chien-Chih [Department of Radiation Oncology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Liang, Kai-Li; Jiang, Rong-San [Department of Otorhinolaryngology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Wu, Ching-Te [Department of Radiation Oncology, Taichung Veterans General Hospital–Chiayi Branch, Chiayi, Taiwan (China); Shih, Yi-Ting [Department of Radiation Oncology, St. Martin De Porres Hospital, Chiayi, Taiwan (China); Lin, Po-Ju; Liu, Yi-Chun [Department of Radiation Oncology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Lin, Jin-Ching, E-mail: jclin@vghtc.gov.tw [Institute of Clinical Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Department of Radiation Oncology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Department of Medicine, China Medical University, Taichung, Taiwan (China)

    2014-05-01

    Purpose: To investigate the effects of adjuvant chemotherapy in nasopharyngeal carcinoma (NPC) patients with persistently detectable plasma Epstein-Barr virus DNA (pEBV DNA) after curative radiation therapy plus induction/concurrent chemotherapy. Methods and Materials: The study population consisted of 625 NPC patients with available pEBV DNA levels before and after treatment. Eighty-five patients with persistently detectable pEBV DNA after 1 week of completing radiation therapy were eligible for this retrospective study. Of the 85 patients, 33 were administered adjuvant chemotherapy consisting of oral tegafur-uracil (2 capsules twice daily) for 12 months with (n=4) or without (n=29) preceding intravenous chemotherapy of mitomycin-C, epirubicin, and cisplatin. The remaining 52 patients who did not receive adjuvant chemotherapy served as the control group. Results: Baseline patient characteristics at diagnosis (age, sex, pathologic type, performance status, T classification, N classification, and overall stage), as well as previous treatment modality, were comparable in both arms. After a median follow-up of 70 months for surviving patients, 45.5% (15 of 33 patients) with adjuvant chemotherapy and 71.2% (37 of 52 patients) without adjuvant chemotherapy experienced tumor relapses (P=.0323). There were a significant reduction in distant failure (P=.0034) but not in local or regional recurrence. The 5-year overall survival rate was 71.6% for patients with adjuvant chemotherapy and 28.7% for patients without adjuvant chemotherapy (hazard ratio 0.27; 95% confidence interval 0.17-0.55; P<.0001). Conclusions: Our retrospective data showed that adjuvant chemotherapy can reduce distant failure and improve overall survival in NPC patients with persistently detectable pEBV DNA after curative radiation therapy plus induction/concurrent chemotherapy.

  10. DUAL PARAMETER FLOW-CYTOMETRY FOR DEOXYRIBONUCLEIC-ACID AND INTERMEDIATE FILAMENT PROTEINS OF RESIDUAL MATURE TERATOMA - ALL TUMOR-CELLS ARE ANEUPLOID

    NARCIS (Netherlands)

    LOOIJENGA, LHJ; OOSTERHUIS, JW; RAMAEKERS, FCS; DEJONG, B; BECK, JLM; SLEIJFER, DT; KOOPS, HS; Dam, A.

    Most testicular germ cell tumors of adults are presumably derived from polyploid carcinoma in situ. Thus, one would expect that even highly differentiated teratoma components are aneuploid and that it is unlikely to find diploid tumor cell (sub)populations. We studied 10 residual mature teratomas

  11. Deoxyribonucleic acid telomere length shortening can predict the incidence of non-alcoholic fatty liver disease in patients with type 2 diabetes mellitus.

    Science.gov (United States)

    Ping, Fan; Li, Zeng-Yi; Lv, Ke; Zhou, Mei-Cen; Dong, Ya-Xiu; Sun, Qi; Li, Yu-Xiu

    2017-03-01

    To investigate the effect of telomere shortening and other predictive factors of non-alcoholic fatty liver disease (NAFLD) in type 2 diabetes mellitus patients in a 6-year prospective cohort study. A total of 70 type 2 diabetes mellitus (mean age 57.8 ± 6.7 years) patients without NAFLD were included in the study, and 64 of them were successfully followed up 6 years later, excluding four cases with significant alcohol consumption. NAFLD was diagnosed by the hepatorenal ratio obtained by a quantitative ultrasound method using NIH image analysis software. The 39 individuals that developed NAFLD were allocated to group A, and the 21 individuals that did not develop NAFLD were allocated to group B. Fluorescent real-time quantitative polymerase chain reaction was used to measure telomere length. There was no significant difference between the two groups in baseline telomere length; however, at the end of the 6th year, telomere length had become shorter in group A compared with group B. There were significant differences between these two groups in baseline body mass index, waistline, systolic blood pressure, glycated hemoglobin and fasting C-peptide level. In addition, the estimated indices of baseline insulin resistance increased in group A. Fasting insulin level, body mass index, systolic blood pressure at baseline and the shortening of telomere length were independent risk factors of NAFLD in type 2 diabetes mellitus patients. Telomere length became shorter in type 2 diabetes mellitus patients who developed NAFLD over the course of 6 years. Type 2 diabetes mellitus patients who developed NAFLD had more serious insulin resistance compared with those who did not develop NAFLD a long time ago. © 2016 The Authors. Journal of Diabetes Investigation published by Asian Association for the Study of Diabetes (AASD) and John Wiley & Sons Australia, Ltd.

  12. New 1,4-Dihydropyridines Down-regulate Nitric Oxide in Animals with Streptozotocin-induced Diabetes Mellitus and Protect Deoxyribonucleic Acid against Peroxynitrite Action.

    Science.gov (United States)

    Leonova, Elina; Sokolovska, Jelizaveta; Boucher, Jean-Luc; Isajevs, Sergejs; Rostoka, Evita; Baumane, Larisa; Sjakste, Tatjana; Sjakste, Nikolajs

    2016-07-01

    Diabetes mellitus (DM) and its complications cause numerous health and social problems throughout the world. Pathogenic actions of nitric oxide (NO) are responsible to a large extent for development of complications of DM. Search for compounds regulating NO production in patients with DM is thus important for the development of pharmacological drugs. Dihydropyridines (1,4-DHPs) are prospective compounds from this point of view. The goals of this study were to study the in vivo effects of new DHPs on NO and reactive nitrogen and oxygen species production in a streptozotocin (STZ)-induced model of DM in rats and to study their ability to protect DNA against nocive action of peroxynitrite. STZ-induced diabetes caused an increase in NO production in the liver, kidneys, blood and muscles, but a decrease in NO in adipose tissue of STZ-treated animals. Cerebrocrast treatment was followed by normalization of NO production in the liver, kidneys and blood. Two other DHPs, etaftorone and fenoftorone, were effective in decreasing NO production in kidneys, blood and muscles of diabetic animals. Furthermore, inhibitors of nitric oxide synthase (NOS) and an inhibitor of xanthine oxidoreductase (XOR) decreased NO production in kidneys of diabetic animals. Treatment with etaftorone decreased expression of inducible NOS and XOR in kidneys, whereas it increased the expression of endothelial NOS. In vitro, the studied DHPs did not significantly inhibit the activities of NOS and XOR but affected the reactivity of peroxynitrite with DNA. These new DHPs thus appear of strong interest for treatment of DM complications. © 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society).

  13. Existing and emerging detection technologies for DNA (Deoxyribonucleic Acid) finger printing, sequencing, bio- and analytical chips: a multidisciplinary development unifying molecular biology, chemical and electronics engineering.

    Science.gov (United States)

    Kumar Khanna, Vinod

    2007-01-01

    The current status and research trends of detection techniques for DNA-based analysis such as DNA finger printing, sequencing, biochips and allied fields are examined. An overview of main detectors is presented vis-à-vis these DNA operations. The biochip method is explained, the role of micro- and nanoelectronic technologies in biochip realization is highlighted, various optical and electrical detection principles employed in biochips are indicated, and the operational mechanisms of these detection devices are described. Although a diversity of biochips for diagnostic and therapeutic applications has been demonstrated in research laboratories worldwide, only some of these chips have entered the clinical market, and more chips are awaiting commercialization. The necessity of tagging is eliminated in refractive-index change based devices, but the basic flaw of indirect nature of most detection methodologies can only be overcome by generic and/or reagentless DNA sensors such as the conductance-based approach and the DNA-single electron transistor (DNA-SET) structure. Devices of the electrical detection-based category are expected to pave the pathway for the next-generation DNA chips. The review provides a comprehensive coverage of the detection technologies for DNA finger printing, sequencing and related techniques, encompassing a variety of methods from the primitive art to the state-of-the-art scenario as well as promising methods for the future.

  14. Effects of growth hormone, prolactin, and placental lactogen on insulin content and release, and deoxyribonucleic acid synthesis in cultured pancreatic islets

    DEFF Research Database (Denmark)

    Nielsen, Jens Høiriis

    1982-01-01

    The direct effects of human GH (hGH), ovine pituitary PRL (oPRL), and human chorionic somatomammotropin [placental lactogen (hPL)] on the endocrine pancreas were studied in isolated pancreatic islets maintained in tissue culture. Islets of Langerhans were isolated by collagenase treatment...... of insulin, glucagon, and DNA after culture were determined. The DNA synthesis in the newborn rat islets was evaluated by the incorporation of [methyl-3H]thymidine into islet cell DNA. In mouse islets, 1 micrograms/ml hGH, oPRL, or hPL markedly stimulated insulin release during a 2-week culture period...... and caused a significant increase in the insulin content in the islets after culture. While hGH did not affect the DNA content in adult mouse islets, an increase was observed in adult rat islets after 2-3 weeks of culture. In islets isolated from 3- to 5-day-old rats cultured for 2 weeks with hGH...

  15. Recombinant deoxyribonucleic acid-derived 22K- and 20K-human growth hormone generate equivalent diabetogenic effects during chronic infusion in dogs.

    Science.gov (United States)

    Ader, M; Agajanian, T; Finegood, D T; Bergman, R N

    1987-02-01

    Chronic administration of human GH (mol wt, 22,000; 22K-hGH) is known to generate insulin resistance in dogs. However, recent hypotheses claim that diabetogenicity may be attributable to smaller weight contaminants or fragments not found in purified lower weight hGH (mol wt, 20,000; 20K-hGH) also secreted by the pituitary. In this study, we examined the effects of chronic (12-day) low dose (0.02 mg/kg X day) infusion of recombinant DNA-derived methionyl 22K- and 20K-hGH on glucose tolerance in conscious dogs. Minimal model analysis of the frequently sampled iv glucose tolerance tests quantified insulin sensitivity and glucose effectiveness, the ability of glucose per se to normalize its own concentration. Infusion of 22K-hGH, raising plasma hGH levels to 3.8 +/- 0.6 ng/ml, resulted in an elevation in fasting glucose levels after 2 days of infusion (104 +/- 1 vs. pre-hGH 97 +/- 2 mg/dl; P less than 0.01), but the effect was transient. No change was noted during 20K-hGH treatment (P greater than 0.2). Mildly elevated fasting insulin levels were observed in both 22K- and 20K-hGH-treated dogs (P less than 0.04 and 0.03, respectively). However, despite maintenance of adequate glucose tolerance during both infusions (P greater than 0.07), marked insulin resistance was apparent; insulin sensitivity dropped from 9.7 +/- 2.4 and 11.2 +/- 2.1 X 10(-4) min-1/(microU/ml) in 22K- and 20K-hGH-treated dogs, to 2.5 and 2.8 X 10(-4) min-1/(microU/ml), a drop of 75% (P less than 0.01 and 0.001). Insulin resistance persisted throughout the infusion period, slowly returning to pre-hGH treatment levels in 22K-hGH-treated dogs during recovery. Insulin resistance persisted 3 days after cessation of 20K-hGH treatment (day 15), but returned to pre-hGH levels by day 25. Integrated glucose-stimulated insulin release was enhanced after 2 days of 22K- or 20K-hGH treatment (P less than 0.03 and less than 0.05), but the effect was transient. Maintenance of normal glucose tolerance in the face of severe insulin resistance and only transiently elevated insulin response was possible because glucose effectiveness remained unchanged. In conclusion, despite minimal effects of low dose hGH infusion on glucose tolerance and fasting glucose and insulin levels, 22K- and 20K-hGH are equipotent in generating severe insulin resistance and potentiating glucose-stimulated insulin release.

  16. Study of nucleic acid-gold nanorod interactions and detecting nucleic acid hybridization using gold nanorod solutions in the presence of sodium citrate.

    Science.gov (United States)

    Kanjanawarut, Roejarek; Su, Xiaodi

    2010-09-01

    In this study, the authors report that sodium citrate can aggregate hexadecyl-trimethyl-ammonium ion(+)-coated gold nanorods (AuNRs), and nucleic acids of different charge and structure properties, i.e., single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), single-stranded peptide nucleic acid (PNA), and PNA-DNA complex, can bind to the AuNRs and therefore retard the sodium citrate-induced aggregation to different extents. The discovery that hybridized dsDNA (and the PNA-DNA complex) has a more pronounced protection effect than ssDNA (and PNA) allows the authors to develop a homogeneous phase AuNRs-based UV-visible (UV-vis) spectral assay for detecting specific sequences of oligonucleotides (20 mer) with a single-base-mismatch selectivity and a limit of detection of 5 nM. This assay involves no tedious bioconjugation and on-particle hybridization. The simple "set and test" format allows for a highly efficient hybridization in a homogeneous phase and a rapid display of the results in less than a minute. By measuring the degree of reduction in AuNR aggregation in the presence of different nucleic acid samples, one can assess how different nucleic acids interact with the AuNRs to complement the knowledge of spherical gold nanoparticles. Besides UV-vis characterization, transmission electron microscopy and zeta potential measurements were conduced to provide visual evidence of the particle aggregation and to support the discussion of the assay principle.

  17. Geometric Patterns for Neighboring Bases Near the Stacked State in Nucleic Acid Strands.

    Science.gov (United States)

    Sedova, Ada; Banavali, Nilesh K

    2017-03-14

    Structural variation in base stacking has been analyzed frequently in isolated double helical contexts for nucleic acids, but not as often in nonhelical geometries or in complex biomolecular environments. In this study, conformations of two neighboring bases near their stacked state in any environment are comprehensively characterized for single-strand dinucleotide (SSD) nucleic acid crystal structure conformations. An ensemble clustering method is used to identify a reduced set of representative stacking geometries based on pairwise distances between select atoms in consecutive bases, with multiple separable conformational clusters obtained for categories divided by nucleic acid type (DNA/RNA), SSD sequence, stacking face orientation, and the presence or absence of a protein environment. For both DNA and RNA, SSD conformations are observed that are either close to the A-form, or close to the B-form, or intermediate between the two forms, or further away from either form, illustrating the local structural heterogeneity near the stacked state. Among this large variety of distinct conformations, several common stacking patterns are observed between DNA and RNA, and between nucleic acids in isolation or in complex with proteins, suggesting that these might be stable stacking orientations. Noncanonical face/face orientations of the two bases are also observed for neighboring bases in the same strand, but their frequency is much lower, with multiple SSD sequences across categories showing no occurrences of such unusual stacked conformations. The resulting reduced set of stacking geometries is directly useful for stacking-energy comparisons between empirical force fields, prediction of plausible localized variations in single-strand structures near their canonical states, and identification of analogous stacking patterns in newly solved nucleic acid containing structures.

  18. Natural and artificial binders of polyriboadenylic acid and their effect on RNA structure

    Directory of Open Access Journals (Sweden)

    Giovanni N. Roviello

    2015-06-01

    Full Text Available The employment of molecular tools with nucleic acid binding ability to specifically control crucial cellular functions represents an important scientific area at the border between biochemistry and pharmaceutical chemistry. In this review we describe several molecular systems of natural or artificial origin, which are able to bind polyriboadenylic acid (poly(rA both in its single-stranded or structured forms. Due to the fundamental role played by the poly(rA tail in the maturation and stability of mRNA, as well as in the initiation of the translation process, compounds able to bind this RNA tract, influencing the mRNA fate, are of special interest for developing innovative biomedical strategies mainly in the field of anticancer therapy.

  19. Cross-coupling reactions of nucleoside triphosphates followed by polymerase incorporation. Construction and applications of base-functionalized nucleic acids.

    Science.gov (United States)

    Hocek, Michal; Fojta, Miroslav

    2008-07-07

    Construction of functionalized nucleic acids (DNA or RNA) via polymerase incorporation of modified nucleoside triphosphates is reviewed and selected applications of the modified nucleic acids are highlighted. The classical multistep approach for the synthesis of modified NTPs by triphosphorylation of modified nucleosides is compared to the novel approach consisting of direct aqueous cross-coupling reactions of unprotected halogenated nucleoside triphosphates. The combination of cross-coupling of NTPs with polymerase incorporation gives an efficient and straightforward two-step synthesis of modified nucleic acids. Primer extension using biotinylated templates followed by separation using streptavidine-coated magnetic beads and DNA duplex denaturation is used for preparation of modified single stranded oligonucleotides. Examples of using this approach for electrochemical DNA labelling and bioanalytical applications are given.

  20. Electrostatic effects on hyaluronic acid configuration

    Science.gov (United States)

    Berezney, John; Saleh, Omar

    2015-03-01

    In systems of polyelectrolytes, such as solutions of charged biopolymers, the electrostatic repulsion between charged monomers plays a dominant role in determining the molecular conformation. Altering the ionic strength of the solvent thus affects the structure of such a polymer. Capturing this electrostatically-driven structural dependence is important for understanding many biological systems. Here, we use single molecule manipulation experiments to collect force-extension behavior on hyaluronic acid (HA), a polyanion which is a major component of the extracellular matrix in all vertebrates. By measuring HA elasticity in a variety of salt conditions, we are able to directly assess the contribution of electrostatics to the chain's self-avoidance and local stiffness. Similar to recent results from our group on single-stranded nucleic acids, our data indicate that HA behaves as a swollen chain of electrostatic blobs, with blob size proportional to the solution Debye length. Our data indicate that the chain structure within the blob is not worm-like, likely due to long-range electrostatic interactions. We discuss potential models of this effect.

  1. Terbium fluorescence as a sensitive, inexpensive probe for UV-induced damage in nucleic acids

    International Nuclear Information System (INIS)

    El-Yazbi, Amira F.; Loppnow, Glen R.

    2013-01-01

    Graphical abstract: -- Highlights: •Simple, inexpensive, mix-and-read assay for positive detection of DNA damage. •Recognition of undamaged DNA via hybridization to a hairpin probe. •Terbium(III) fluorescence reports the amount of damage by binding to ssDNA. •Tb/hairpin is a highly selective and sensitive fluorescent probe for DNA damage. -- Abstract: Much effort has been focused on developing methods for detecting damaged nucleic acids. However, almost all of the proposed methods consist of multi-step procedures, are limited, require expensive instruments, or suffer from a high level of interferences. In this paper, we present a novel simple, inexpensive, mix-and-read assay that is generally applicable to nucleic acid damage and uses the enhanced luminescence due to energy transfer from nucleic acids to terbium(III) (Tb 3+ ). Single-stranded oligonucleotides greatly enhance the Tb 3+ emission, but duplex DNA does not. With the use of a DNA hairpin probe complementary to the oligonucleotide of interest, the Tb 3+ /hairpin probe is applied to detect ultraviolet (UV)-induced DNA damage. The hairpin probe hybridizes only with the undamaged DNA. However, the damaged DNA remains single-stranded and enhances the intrinsic fluorescence of Tb 3+ , producing a detectable signal directly proportional to the amount of DNA damage. This allows the Tb 3+ /hairpin probe to be used for sensitive quantification of UV-induced DNA damage. The Tb 3+ /hairpin probe showed superior selectivity to DNA damage compared to conventional molecular beacons probes (MBs) and its sensitivity is more than 2.5 times higher than MBs with a limit of detection of 4.36 ± 1.2 nM. In addition, this probe is easier to synthesize and more than eight times cheaper than MBs, which makes its use recommended for high-throughput, quantitative analysis of DNA damage

  2. Screening of specific nucleic acid aptamers binding tumor markers in the serum of the lung cancer patients and identification of their activities.

    Science.gov (United States)

    Li, Kun; Xiu, Chen-Lin; Gao, Li-Ming; Liang, Hua-Gang; Xu, Shu-Feng; Shi, Ming; Li, Jian; Liu, Zhi-Wei

    2017-07-01

    Lung cancer is by far the leading cause of cancer death in the world. Despite the improvements in diagnostic methods, the status of early detection was not achieved. So, a new diagnostic method is needed. The aim of this study is to obtain the highly specific nucleic acid aptamers with strong affinity to tumor markers in the serum of the lung cancer patients for targeting the serum. Aptamers specifically binding to tumor markers in the serum of the lung cancer patients were screened from the random single-stranded DNA library with agarose beads as supports and the serum as a target by target-substituting subtractive SELEX technique and real-time quantitative polymerase chain reaction technique. Subsequently, the secondary single-stranded DNA library obtained by 10 rounds of screening was amplified to double-stranded DNA, followed by high-throughput genome sequence analysis to screen aptamers with specific affinity to tumor markers in the serum of the lung cancer patients. Finally, six aptamers obtained by 10 rounds of screening were identified with high specific affinity to tumor markers in the serum of the lung cancer patients. Compared with other five aptamers, the aptamer 43 was identified both with the highest specificity to bind target molecule and without any obvious affinity to non-specific proteins. The screened aptamers have relatively high specificity to combine tumor markers in the serum of the lung cancer patients, which provides breakthrough points for early diagnosis and treatment of lung cancer.

  3. BIOPHYSICAL PROPERTIES OF NUCLEIC ACIDS AT SURFACES RELEVANT TO MICROARRAY PERFORMANCE

    Science.gov (United States)

    Rao, Archana N.; Grainger, David W.

    2014-01-01

    Both clinical and analytical metrics produced by microarray-based assay technology have recognized problems in reproducibility, reliability and analytical sensitivity. These issues are often attributed to poor understanding and control of nucleic acid behaviors and properties at solid-liquid interfaces. Nucleic acid hybridization, central to DNA and RNA microarray formats, depends on the properties and behaviors of single strand (ss) nucleic acids (e.g., probe oligomeric DNA) bound to surfaces. ssDNA’s persistence length, radius of gyration, electrostatics, conformations on different surfaces and under various assay conditions, its chain flexibility and curvature, charging effects in ionic solutions, and fluorescent labeling all influence its physical chemistry and hybridization under assay conditions. Nucleic acid (e.g., both RNA and DNA) target interactions with immobilized ssDNA strands are highly impacted by these biophysical states. Furthermore, the kinetics, thermodynamics, and enthalpic and entropic contributions to DNA hybridization reflect global probe/target structures and interaction dynamics. Here we review several biophysical issues relevant to oligomeric nucleic acid molecular behaviors at surfaces and their influences on duplex formation that influence microarray assay performance. Correlation of biophysical aspects of single and double-stranded nucleic acids with their complexes in bulk solution is common. Such analysis at surfaces is not commonly reported, despite its importance to microarray assays. We seek to provide further insight into nucleic acid-surface challenges facing microarray diagnostic formats that have hindered their clinical adoption and compromise their research quality and value as genomics tools. PMID:24765522

  4. Electrostatic-assembly-driven formation of supramolecular rhombus microparticles and their application for fluorescent nucleic acid detection.

    Directory of Open Access Journals (Sweden)

    Hailong Li

    Full Text Available In this paper, we report on the large-scale formation of supramolecular rhombus microparticles (SRMs driven by electrostatic assembly, carried out by direct mixing of an aqueous HAuCl(4 solution and an ethanol solution of 4,4'-bipyridine at room temperature. We further demonstrate their use as an effective fluorescent sensing platform for nucleic acid detection with a high selectivity down to single-base mismatch. The general concept used in this approach is based on adsorption of the fluorescently labeled single-stranded DNA (ssDNA probe by SRM, which is accompanied by substantial fluorescence quenching. In the following assay, specific hybridization with its target to form double-stranded DNA (dsDNA results in desorption of ssDNA from SRM surface and subsequent fluorescence recovery.

  5. Techniques of DNA hybridization detect small numbers of mycobacteria with no cross-hybridization with non-mycobacterial respiratory organisms

    International Nuclear Information System (INIS)

    Shoemaker, S.A.; Fisher, J.H.; Scoggin, C.H.

    1985-01-01

    The traditional methods used in identifying mycobacteria, such as acid-fast bacillus stains and culture, are often time-consuming, insensitive, and nonspecific. As part of an ongoing program to improve diagnosis and characterization of mycobacteria, the authors have found that deoxyribonucleic acid (DNA) hybridization techniques using isotopically labeled, single-stranded, total DNA can be used to detect as little as 10(-4) micrograms of Mycobacterium tuberculosis (MTb) DNA. This amount of DNA represents approximately 2 X 10(4) genomes. They have also shown the MTb DNA is sufficiently different from the DNA of non-mycobacterial microorganisms such that cross-hybridization with MTb DNA does not occur under the hybridization conditions employed. The authors speculate that DNA hybridization techniques may allow the rapid, sensitive, and specific identification of mycobacteria

  6. The colorimetric determination of selectively cleaved adenosines and guanosines in DNA oligomers using bicinchoninic acid and copper.

    Science.gov (United States)

    Thomas, Elizabeth M; Testa, Stephen M

    2017-01-01

    Colorimetric methods combined with color-changing chemical probes are widely used as simple yet effective tools for identifying and quantifying a wide variety of molecules in solution. For nucleic acids (DNA and RNA), perhaps the most commonly used colorimetric probe is potassium permanganate, which can be used to identify single-stranded pyrimidines (thymine and cytosine) in polymers. Unfortunately, permanganate is not an effective probe for identifying purines (adenine and guanine), especially in the presence of the more reactive pyrimidines. Therefore, robust methods for discriminating between the purines remain elusive, thereby creating a barrier toward developing more complex colorimetric applications. In this proof-of-principle study, we demonstrate that bicinchoninic acid (BCA) and copper, when combined with purine-specific chemical cleavage reactions, can be a colorimetric probe for the identification and quantification of adenosines and/or guanosines in single-stranded DNA oligomers, even in the presence of pyrimidines. Furthermore, the reactions are stoichiometric, which allows for the quantification of the number of adenosines and/or guanosines in these oligomers. Because the BCA/copper reagent detects the reducing sugar, 2-deoxyribose, that results from the chemical cleavage of a given nucleotide's N-glycosidic bond, these colorimetric assays are effectively detecting apurinic sites in DNA oligomers, which are known to occur via DNA damage in biological systems. We demonstrate that simple digital analysis of the color-changing chromophore (BCA/copper) is all that is necessary to obtain quantifiable and reproducible data, which indicates that these assays should be broadly accessible.

  7. Oligo(dT) is not a correct native PAGE marker for single-stranded DNA

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Kypr, Jaroslav; Vorlíčková, Michaela

    2007-01-01

    Roč. 353, č. 3 (2007), s. 776-779 ISSN 0006-291X R&D Projects: GA AV ČR(CZ) IAA4004201; GA AV ČR(CZ) IAA1004201 Institutional research plan: CEZ:AV0Z50040702 Keywords : polyacrylamide gel electrophoresis * DNA length markers * oligo(dT) Subject RIV: BO - Biophysics Impact factor: 2.749, year: 2007

  8. Determination of nanogram quantities of osmium-labeled single stranded DNA by differential pulse stripping voltammetry

    Czech Academy of Sciences Publication Activity Database

    Kizek, René; Havran, Luděk; Fojta, Miroslav; Paleček, Emil

    2002-01-01

    Roč. 55, 1/2 (2002), s. 199-121 ISSN 1567-5394 R&D Projects: GA ČR GV204/97/K084; GA ČR GA204/00/D049; GA AV ČR IAA4004108 Institutional research plan: CEZ:AV0Z5004920 Keywords : differential pulse stripping voltammetry * microdetermination of DNA * chemical modification of DNA Subject RIV: BO - Biophysics Impact factor: 1.463, year: 2002

  9. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-01

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  10. Absorption by DNA single strands of adenine isolated in vacuo: The role of multiple chromophores

    DEFF Research Database (Denmark)

    Nielsen, L.M.; Pedersen, S.O.; Kirketerp, M.-B.S.

    2012-01-01

    to that for the adenine molecule and the dAMP mononucleotide. Desolvation has little effect on the bandwidth, which implies that inhomogenous broadening of the absorption bands in aqueous solution is of minor importance compared to, e.g., conformational disorder. Finally, at high photon energies, internal conversion...

  11. RADX interacts with single-stranded DNA to promote replication fork stability

    DEFF Research Database (Denmark)

    Schubert, Lisa; Ho, Teresa; Hoffmann, Saskia

    2017-01-01

    has an essential genome maintenance role, protecting ssDNA regions from nucleolytic degradation and providing a recruitment platform for proteins involved in responses to replication stress and DNA damage. Here, we identify the uncharacterized protein RADX (CXorf57) as an ssDNA-binding factor in human...... cells. RADX binds ssDNA via an N-terminal OB fold cluster, which mediates its recruitment to sites of replication stress. Deregulation of RADX expression and ssDNA binding leads to enhanced replication fork stalling and degradation, and we provide evidence that a balanced interplay between RADX and RPA...

  12. Heterochromatin Reorganization during Early Mouse Development Requires a Single-Stranded Noncoding Transcript

    Directory of Open Access Journals (Sweden)

    Miguel Casanova

    2013-09-01

    Full Text Available The equalization of pericentric heterochromatin from distinct parental origins following fertilization is essential for genome function and development. The recent implication of noncoding transcripts in this process raises questions regarding the connection between RNA and the nuclear organization of distinct chromatin environments. Our study addresses the interrelationship between replication and transcription of the two parental pericentric heterochromatin (PHC domains and their reorganization during early embryonic development. We demonstrate that the replication of PHC is dispensable for its clustering at the late two-cell stage. In contrast, using parthenogenetic embryos, we show that pericentric transcripts are essential for this reorganization independent of the chromatin marks associated with the PHC domains. Finally, our discovery that only reverse pericentric transcripts are required for both the nuclear reorganization of PHC and development beyond the two-cell stage challenges current views on heterochromatin organization.

  13. Role of Electrostatics in the assembly pathway of a single-stranded RNA virus

    NARCIS (Netherlands)

    Garmann, R.F.; Comas-Garcia, M.; Koay, M.S.T.; Cornelissen, Jeroen Johannes Lambertus Maria; Knobler, C.M.; Gelbart, W.M.

    2014-01-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318–3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of

  14. Comment on "Monomer Dynamics in Double- and Single-Stranded DNA Polymers"

    OpenAIRE

    Tothova, J.; Brutovsky, B.; Lisy, V.

    2005-01-01

    It is discussed that the kinetics observed by Shusterman et al. [Phys. Rev. Lett. 92, 048303] for long dsDNA is not the Rouse one and, in fact, the macromolecule behaves (approximately) as the Zimm polymer.

  15. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-04-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  16. Toxin MqsR Cleaves Single-Stranded mRNA with Various 5 Ends

    Science.gov (United States)

    2016-08-24

    decreases persisence about 2400- fold (Harrison et al. 2009). Another type II TA toxin, MazF, induces growth arrest that results in up to a 700- fold...Life Technologies, Waltham, MA). In brief, 25 pmol of RNA was first treated with 0.1 U of calf intestine alkaline phosphatase (CIP, 0.1 U/μL) for 1...MqsR/MqsA regulate toxin CspD. Environ. Microbiol. 12:1105–1121. Kwan, B. W., J. A. Valenta, M. J. Benedik, and T. K. Wood. 2013. Arrested protein

  17. Detection of short single-strand DNA homopolymers with ultrathin Si3N4 nanopores.

    Science.gov (United States)

    Ma, Jian; Qiu, Yinghua; Yuan, Zhishan; Zhang, Yin; Sha, Jingjie; Liu, Lei; Sun, Litao; Ni, Zhonghua; Yi, Hong; Li, Deyu; Chen, Yunfei

    2015-08-01

    A series of nanopores with diameters ranging from 2.5 to 63 nm are fabricated on a reduced Si3N4 membrane by focused ion beam and high energy electron beam. Through measuring the blocked ionic currents for DNA strands threading linearly through those solid-state nanopores, it is found that the blockade ionic current is proportional to the square of the hydrodynamic diameter of the DNA strand. With the nanopore diameter reduced to be comparable with that of DNA strands, the hydrodynamic diameter of the DNA becomes smaller, which is attributed to the size confinement effects. The duration time for the linear DNA translocation events increases monotonically with the nanopore length. By comparing the spatial configurations of DNA strands through nanopores with different diameters, it is found that the nanopore with large diameter has enough space to allow the DNA strand to translocate through with complex conformation. With the decrease of the nanopore diameter, the folded part of the DNA is prone to be straightened by the nanopore, which leads to the increase in the occurrence frequency of the linear DNA translocation events. Reducing the diameter of the nanopore to 2.5 nm allows the detection and discrimination of three nucleotide "G" and three nucleotide "T" homopolymer DNA strands based on differences in their physical dimensions.

  18. Differentiation of Short Single-Stranded DNA Homopolymers in Solid-State Nanopores

    Science.gov (United States)

    Venta, Kimberly; Shemer, Gabriel; Puster, Matthew; Rodríguez-Manzo, Julio A.; Balan, Adrian; Rosenstein, Jacob K.; Shepard, Ken; Drndić, Marija

    2013-01-01

    In the last two decades, new techniques that monitor ionic current modulations as single molecules pass through a nanoscale pore have enabled numerous single-molecule studies. While biological nanopores have recently shown the ability to resolve single nucleotides within individual DNA molecules, similar developments with solid-state nanopores have lagged, due to challenges both in fabricating stable nanopores of similar dimensions as biological nanopores and in achieving sufficiently low-noise and high-bandwidth recordings. Here we show that small silicon nitride nanopores (0.8 to 2-nm-diameter in 5 to 8-nm-thick membranes) can resolve differences between ionic current signals produced by short (30 base) ssDNA homopolymers (poly(dA), poly(dC), poly(dT)), when combined with measurement electronics that allow a signal-to-noise ratio of better than 10 to be achieved at 1 MHz bandwidth. While identifying intramolecular DNA sequences with silicon nitride nanopores will require further improvements in nanopore sensitivity and noise levels, homopolymer differentiation represents an important milestone in the development of solid-state nanopores. PMID:23621759

  19. Source-based nomenclature for single-strand homopolymers and copolymers (IUPAC Recommendations 2016)

    Czech Academy of Sciences Publication Activity Database

    Jones, R. G.; Kitayama, T.; Hellwich, K. H.; Hess, M.; Jenkins, A. D.; Kahovec, Jaroslav; Kratochvíl, Pavel; Mita, I.; Mormann, W.; Ober, C. K.; Penczek, S.; Stepto, R. F. T.; Thurlow, K.; Vohlídal, J.; Wilks, E. S.

    2016-01-01

    Roč. 88, 10-11 (2016), s. 1073-1100 ISSN 0033-4545 Institutional support: RVO:61389013 Keywords : apparent monomer * copolymer * end-groups Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.626, year: 2016

  20. Mismatched single stranded antisense oligonucleotides can induce efficient dystrophin splice switching

    Directory of Open Access Journals (Sweden)

    Kole Ryszard

    2011-10-01

    Full Text Available Abstract Background Antisense oligomer induced exon skipping aims to reduce the severity of Duchenne muscular dystrophy by redirecting splicing during pre-RNA processing such that the causative mutation is by-passed and a shorter but partially functional Becker muscular dystrophy-like dystrophin isoform is produced. Normal exons are generally targeted to restore the dystrophin reading frame however, an appreciable subset of dystrophin mutations are intra-exonic and therefore have the potential to compromise oligomer efficiency, necessitating personalised oligomer design for some patients. Although antisense oligomers are easily personalised, it remains unclear whether all patient polymorphisms within antisense oligomer target sequences will require the costly process of producing and validating patient specific compounds. Methods Here we report preclinical testing of a panel of splice switching antisense oligomers, designed to excise exon 25 from the dystrophin transcript, in normal and dystrophic patient cells. These patient cells harbour a single base insertion in exon 25 that lies within the target sequence of an oligomer shown to be effective at removing exon 25. Results It was anticipated that such a mutation would compromise oligomer binding and efficiency. However, we show that, despite the mismatch an oligomer, designed and optimised to excise exon 25 from the normal dystrophin mRNA, removes the mutated exon 25 more efficiently than the mutation-specific oligomer. Conclusion This raises the possibility that mismatched AOs could still be therapeutically applicable in some cases, negating the necessity to produce patient-specific compounds.

  1. Telomerase suppresses formation of ALT-associated single-stranded telomeric C-circles.

    Science.gov (United States)

    Plantinga, Matthew J; Pascarelli, Kara M; Merkel, Anna S; Lazar, Alexander J; von Mehren, Margaret; Lev, Dina; Broccoli, Dominique

    2013-06-01

    Telomere maintenance is an essential characteristic of cancer cells, most commonly achieved by activation of telomerase. Telomeres can also be maintained by a recombination-based mechanism, alternative lengthening of telomeres (ALT). Cells using ALT are characterized by the presence of ALT-associated promyelocytic leukemia (PML) bodies (APB), long, heterogeneously sized telomeres, extrachromosomal telomeric circular DNA, and elevated telomeric recombination. Consistent with other reports, we found that liposarcomas containing APBs, but lacking telomerase expression, always contained C-rich circles (C-circles), and these C-circles were never present in the absence of APBs, indicating a tight link between these features in ALT cells. However, a rare subgroup of tumors showing evidence of telomere maintenance by both telomerase and ALT did not contain C-circles. To test the hypothesis that telomerase expression disrupts the tight link between APBs and C-circles, we used ALT cell lines that were engineered to express telomerase. Introduction of telomerase activity in these ALT cells resulted in, on average, shorter telomeres with retention of APBs. However, at high passage, the level of C-circles was significantly reduced, which was paralleled by a switch from C-strand overhangs to G-strand overhangs. We propose that by extending critically short telomeres in these cells, telomerase is disrupting a key step in the ALT pathway necessary for production and/or maintenance of C-circles. ©2013 AACR.

  2. Electric light scattering from single-stranded DNA in linear polyacrylamide solutions.

    Science.gov (United States)

    Todorov, R; Starchev, K; Stoylov, S P

    2001-01-01

    The electric light scattering (ELS) of ssDNA (calf thymus, 10 kbp, 55 micrograms/mL) in denaturing polyacrylamide (PAA) solutions was studied as a function of applied sinusoidal electric field and polymer concentration. Electric fields of strengths up to 300 V/cm and of frequencies between 100 and 5000 Hz were applied. It was found that the ELS effect increases with the field strength and decreases at high frequencies. The dependence of the ELS effect of ssDNA on polymer concentration passes through a maximum at 1% PAA. The relaxation times of decay of the ELS effect increase with increasing polymer concentrations. It was demonstrated that ELS is a useful method for investigation of ssDNA behavior in the course of pulse-field electrophoresis in polymer solutions.

  3. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin.

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-13

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecule, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G • U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G • U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  4. Therapeutic Effect of Novel Single-Stranded RNAi Agent Targeting Periostin in Eyes with Retinal Neovascularization

    Directory of Open Access Journals (Sweden)

    Takahito Nakama

    2017-03-01

    Full Text Available Retinal neovascularization (NV due to retinal ischemia remains one of the principal causes of vision impairment in patients with ischemic retinal diseases. We recently reported that periostin (POSTN may play a role in the development of preretinal fibrovascular membranes, but its role in retinal NV has not been determined. The purpose of this study was to examine the expression of POSTN in the ischemic retinas of a mouse model of oxygen-induced retinal NV. We also studied the function of POSTN on retinal NV using Postn KO mice and human retinal endothelial cells (HRECs in culture. In addition, we used a novel RNAi agent, NK0144, which targets POSTN to determine its effect on the development of retinal NV. Our results showed that the expression of POSTN was increased in the vascular endothelial cells, pericytes, and M2 macrophages in ischemic retinas. POSTN promoted the ischemia-induced retinal NV by Akt phosphorylation through integrin αvβ3. NK0144 had a greater inhibitory effect than canonical double-stranded siRNA on preretinal pathological NV in vivo and in vitro. These findings suggest a causal relationship between POSTN and retinal NV, and indicate a potential therapeutic role of intravitreal injection of NK0144 for retinal neovascular diseases.

  5. Expansion during PCR of short single-stranded DNA fragments carrying nonselfcomplementary dinucleotide or trinucleotide repeats

    Czech Academy of Sciences Publication Activity Database

    Reichová, Naďa; Kypr, Jaroslav

    2003-01-01

    Roč. 30, č. 3 (2003), s. 155-163 ISSN 0301-4851 R&D Projects: GA ČR GA301/01/0590 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA * PCR * expansion Subject RIV: BO - Biophysics Impact factor: 0.565, year: 2003

  6. Double-stranded DNA dissociates into single strands when dragged into a poor solvent.

    Science.gov (United States)

    Cui, Shuxun; Yu, Jin; Kühner, Ferdinand; Schulten, Klaus; Gaub, Hermann E

    2007-11-28

    DNA displays a richness of biologically relevant supramolecular structures, which depend on both sequence and ambient conditions. The effect of dragging double-stranded DNA (dsDNA) from water into poor solvent on the double-stranded structure is still unclear because of condensation. Here, we employed single molecule techniques based on atomic force microscopy and molecular dynamics (MD) simulations to investigate the change in structure and mechanics of DNA during the ambient change. We found that the two strands are split apart when the dsDNA is pulled at one strand from water into a poor solvent. The findings were corroborated by MD simulations where dsDNA was dragged from water into poor solvent, revealing details of the strand separation at the water/poor solvent interface. Because the structure of DNA is of high polarity, all poor solvents show a relatively low polarity. We speculate that the principle of spontaneous unwinding/splitting of dsDNA by providing a low-polarity (in other word, hydrophobic) micro-environment is exploited as one of the catalysis mechanisms of helicases.

  7. Genomic analysis of Pseudomonas putida phage tf with localized single-strand DNA interruptions.

    Directory of Open Access Journals (Sweden)

    Anatoly S Glukhov

    Full Text Available The complete sequence of the 46,267 bp genome of the lytic bacteriophage tf specific to Pseudomonas putida PpG1 has been determined. The phage genome has two sets of convergently transcribed genes and 186 bp long direct terminal repeats. The overall genomic architecture of the tf phage is similar to that of the previously described Pseudomonas aeruginosa phages PaP3, LUZ24 and phiMR299-2, and 39 out of the 72 products of predicted tf open reading frames have orthologs in these phages. Accordingly, tf was classified as belonging to the LUZ24-like bacteriophage group. However, taking into account very low homology levels between tf DNA and that of the other phages, tf should be considered as an evolutionary divergent member of the group. Two distinguishing features not reported for other members of the group were found in the tf genome. Firstly, a unique end structure--a blunt right end and a 4-nucleotide 3'-protruding left end--was observed. Secondly, 14 single-chain interruptions (nicks were found in the top strand of the tf DNA. All nicks were mapped within a consensus sequence 5'-TACT/RTGMC-3'. Two nicks were analyzed in detail and were shown to be present in more than 90% of the phage population. Although localized nicks were previously found only in the DNA of T5-like and phiKMV-like phages, it seems increasingly likely that this enigmatic structural feature is common to various other bacteriophages.

  8. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-02-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  9. Ion Density Analysis of Single-Stranded DNA in Liquid Crystal

    Science.gov (United States)

    Iwabata, Kazuki; Seki, Yasutaka; Toizumi, Ryota; Shimada, Yuki; Furue, Hirokazu; Sakaguchi, Kengo

    2013-09-01

    With the widespread use of liquid crystals (LCs) in liquid crystal displays, we have looked into the application of liquid crystals in biotechnology. The purpose of the study described here is to investigate the physical properties of DNA using LCs. Synthetic oligonucleotide molecules were dispersed in MLC6884, the sample injected into antiparallel cells, and the amount of mobile ions was measured. The LC cell doped with oligonucleotide molecules showed a sequence-dependent, specific correlation between oligonucleotide concentration and the amount of mobile ions in the LC cells. In the framework of the Stokes model and polyacrylamide gel electrophoresis (PAGE) analysis, we speculate that this result arises from the difference in ion mobility, which is caused by the shape of the oligonucleotide molecule in the LC.

  10. Characterization of a crosslinked nucleic acid - helix destabilizing protein complex

    Energy Technology Data Exchange (ETDEWEB)

    Karpel, R.L.; Levin, V.Y.; Haley, B.E.

    1986-05-01

    They have enzymatically synthesized /sup 3/H- and /sup 32/P-poly(A,8N/sub 3/A) from 8-N/sub 3/ADP and radiolabeled ADP, and have used this polynucleotide to photoaffinity label T4 gene 32 protein, as well as several other helix-destabilizing proteins (HDPs). Irradiation of /sup 32/P-/sup 3/H-poly(A,N/sub 3/A) mixtures for short durations produces a covalent complex, seen as a high molecular weight, radioactive band on SDS-polyacrylamide gels. Preliminary experiments on other HDPs, from prokaryotic, eukaryotic and animal viral sources, show analogous results. Several successful control experiments indicate that this system is suitable for binding site localization on /sup 32/P. Single-stranded nucleic acids competitively inhibit photolabeling. The effect of NaCl on photolabeling parallels the salt-dependence of /sup 32/P-poly(A,N/sub 3/A) binding. Photolabeling reaches a plateau after approx.1 min, and the formation of the high molecular weight complex parallels the reduction of free /sup 32/P on SDS gels. Staph. nuclease digestion of crosslinked complexes produces a diffuse, radioactive band on SDS gels, migrating just behind free /sup 32/P. When these digested complexes are subjected to reverse-phase HPLC on a C3 Ultrapore column, the nucleic acid /sup 32/P-label is seen to coelute with protein. They are currently employing RP-HPLC methods to locate the label on tryptic peptides of nuclease-digested complexes.

  11. Nucleic acid binding and other biomedical properties of artificial oligolysines

    Directory of Open Access Journals (Sweden)

    Roviello GN

    2016-11-01

    Full Text Available Giovanni N Roviello,1 Caterina Vicidomini,1 Vincenzo Costanzo,1 Valentina Roviello2 1CNR Istituto di Biostrutture e Bioimmagini, Via Mezzocannone site and Headquarters, 2Centro Regionale di Competenza (CRdC Tecnologie, Via Nuova Agnano, Napoli, Italy Abstract: In the present study, we report the interaction of an artificial oligolysine (referred to as AOL realized in our laboratory with targets of biomedical importance. These included polyinosinic acid (poly rI and its complex with polycytidylic acid (poly I:C, RNAs with well-known interferon-inducing ability, and double-stranded (ds DNA. The ability of the peptide to bind both single-stranded poly rI and ds poly I:C RNAs emerged from our circular dichroism (CD and ultraviolet (UV studies. In addition, we found that AOL forms complexes with dsDNA, as shown by spectroscopic binding assays and UV thermal denaturation experiments. These findings are encouraging for the possible use of AOL in biomedicine for nucleic acid targeting and oligonucleotide condensation, with the latter being a key step preceding their clinical application. Moreover, we tested the ability of AOL to bind to proteins, using serum albumin as a model protein. We demonstrated the oligolysine–protein binding by CD experiments which suggested that AOL, positively charged under physiological conditions, binds to the protein regions rich in anionic residues. Finally, the morphology characterization of the solid oligolysine, performed by scanning electron microscopy, showed different crystal forms including cubic-shaped crystals confirming the high purity of AOL. Keywords: nucleic acid binding, polyinosinic acid, double-stranded nucleic acids, oligolysine, circular dichroism

  12. Nucleic acid-based fluorescent probes and their analytical potential.

    Science.gov (United States)

    Juskowiak, Bernard

    2011-03-01

    It is well known that nucleic acids play an essential role in living organisms because they store and transmit genetic information and use that information to direct the synthesis of proteins. However, less is known about the ability of nucleic acids to bind specific ligands and the application of oligonucleotides as molecular probes or biosensors. Oligonucleotide probes are single-stranded nucleic acid fragments that can be tailored to have high specificity and affinity for different targets including nucleic acids, proteins, small molecules, and ions. One can divide oligonucleotide-based probes into two main categories: hybridization probes that are based on the formation of complementary base-pairs, and aptamer probes that exploit selective recognition of nonnucleic acid analytes and may be compared with immunosensors. Design and construction of hybridization and aptamer probes are similar. Typically, oligonucleotide (DNA, RNA) with predefined base sequence and length is modified by covalent attachment of reporter groups (one or more fluorophores in fluorescence-based probes). The fluorescent labels act as transducers that transform biorecognition (hybridization, ligand binding) into a fluorescence signal. Fluorescent labels have several advantages, for example high sensitivity and multiple transduction approaches (fluorescence quenching or enhancement, fluorescence anisotropy, fluorescence lifetime, fluorescence resonance energy transfer (FRET), and excimer-monomer light switching). These multiple signaling options combined with the design flexibility of the recognition element (DNA, RNA, PNA, LNA) and various labeling strategies contribute to development of numerous selective and sensitive bioassays. This review covers fundamentals of the design and engineering of oligonucleotide probes, describes typical construction approaches, and discusses examples of probes used both in hybridization studies and in aptamer-based assays.

  13. Nucleic acid-binding properties of the RRM-containing protein RDM1

    International Nuclear Information System (INIS)

    Hamimes, Samia; Bourgeon, Dominique; Stasiak, Alicja Z.; Stasiak, Andrzej; Van Dyck, Eric

    2006-01-01

    RDM1 (RAD52 Motif 1) is a vertebrate protein involved in the cellular response to the anti-cancer drug cisplatin. In addition to an RNA recognition motif, RDM1 contains a small amino acid motif, named RD motif, which it shares with the recombination and repair protein, RAD52. RDM1 binds to single- and double-stranded DNA, and recognizes DNA distortions induced by cisplatin adducts in vitro. Here, we have performed an in-depth analysis of the nucleic acid-binding properties of RDM1 using gel-shift assays and electron microscopy. We show that RDM1 possesses acidic pH-dependent DNA-binding activity and that it binds RNA as well as DNA, and we present evidence from competition gel-shift experiments that RDM1 may be capable of discrimination between the two nucleic acids. Based on reported studies of RAD52, we have generated an RDM1 variant mutated in its RD motif. We find that the L 119 GF → AAA mutation affects the mode of RDM1 binding to single-stranded DNA

  14. Temperature and duration of heating of sunflower oil affect ruminal biohydrogenation of linoleic acid in vitro.

    Science.gov (United States)

    Privé, F; Combes, S; Cauquil, L; Farizon, Y; Enjalbert, F; Troegeler-Meynadier, A

    2010-02-01

    Sunflower oil heated at 110 or 150 degrees C for 1, 3, or 6h was incubated with ruminal content in order to investigate the effects of temperature and duration of heating of oil on the ruminal biohydrogenation of linoleic acid in vitro. When increased, these 2 parameters acted together to decrease the disappearance of linoleic acid in the media by inhibiting the isomerization of linoleic acid, which led to a decrease in conjugated linoleic acids and trans-C18:1 production. Nevertheless, trans-10 isomer production increased with heating temperature, suggesting an activation of Delta(9)-isomerization, whereas trans-11 isomer production decreased, traducing an inhibition of Delta(12)-isomerization. The amount of peroxides generated during heating was correlated with the proportions of biohydrogenation intermediates so that they might explain, at least in part, the observed effects. The effects of heating temperature and duration on ruminal bacteria community was assessed using capillary electrophoresis single-strand conformation polymorphism. Ruminal bacterial population significantly differed according to heating temperature, but was not affected by heating duration. Heating of fat affected ruminal biohydrogenation, at least in part because of oxidative products generated during heating, by altering enzymatic reactions and bacterial population. Copyright 2010 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  15. Nanostructured magnesium oxide biosensing platform for cholera detection

    Science.gov (United States)

    Patel, Manoj K.; Azahar Ali, Md.; Agrawal, Ved V.; Ansari, Z. A.; Ansari, S. G.; Malhotra, B. D.

    2013-04-01

    We report fabrication of highly crystalline nanostructured magnesium oxide (NanoMgO, size >30 nm) film electrophoretically deposited onto indium-tin-oxide (ITO) glass substrate for Vibrio cholerae detection. The single stranded deoxyribonucleic acid (ssDNA) probe, consisting of 23 bases (O1 gene sequence) immobilized onto NanoMgO/ITO electrode surface, has been characterized using electrochemical, Fourier Transform-Infra Red, and UltraViolet-visible spectroscopic techniques. The hybridization studies of ssDNA/NanoMgO/ITO bioelectrode with fragmented target DNA conducted using differential pulse voltammetry reveal sensitivity as 16.80 nA/ng/cm2, response time of 3 s, linearity as 100-500 ng/μL, and stability of about 120 days.

  16. Contributions of the Histidine Side Chain and the N-terminal α-Amino Group to the Binding Thermodynamics of Oligopeptides to Nucleic Acids as a Function of pH

    Science.gov (United States)

    Ballin, Jeff D.; Prevas, James P.; Ross, Christina R.; Toth, Eric A.; Wilson, Gerald M.; Record, M. Thomas

    2010-01-01

    Interactions of histidine with nucleic acid phosphates and histidine pKa shifts make important contributions to many protein-nucleic acid binding processes. To characterize these phenomena in simplified systems, we quantified binding of a histidine-containing model peptide HWKK (+NH3-His-Trp-Lys-Lys-NH2) and its lysine analog KWKK (+NH3-Lys-Trp-Lys-Lys-NH2) to a single-stranded RNA model, polyuridylate (polyU), by changes in tryptophan fluorescence as a function of salt concentration and pH. For both HWKK and KWKK, equilibrium binding constants, Kobs, and magnitudes of log-log salt derivatives SKobs ≡ (∂logKobs/∂log[Na+]), decreased with increasing pH in the manner expected for a titration curve model in which deprotonation of the histidine and α-amino groups weakens binding and reduces its salt-dependence. Fully protonated HWKK and KWKK exhibit the same Kobs and SKobs within uncertainty, and these SKobs values are consistent with limiting-law polyelectrolyte theory for +4 cationic oligopeptides binding to single-stranded nucleic acids. The pH-dependence of HWKK binding to polyU provides no evidence for pKa shifts nor any requirement for histidine protonation, in stark contrast to the thermodynamics of coupled protonation often seen for these cationic residues in the context of native protein structure where histidine protonation satisfies specific interactions (e.g., salt-bridge formation) within highly complementary binding interfaces. The absence of pKa shifts in our studies indicates that additional Coulombic interactions across the nonspecific-binding interface between RNA and protonated histidine or the α-amino group are not sufficient to promote proton uptake for these oligopeptides. We present our findings in the context of hydration models for specific versus nonspecific nucleic acid binding. PMID:20108951

  17. What controls the hybridization thermodynamics of spherical nucleic acids?

    Science.gov (United States)

    Randeria, Pratik S; Jones, Matthew R; Kohlstedt, Kevin L; Banga, Resham J; Olvera de la Cruz, Monica; Schatz, George C; Mirkin, Chad A

    2015-03-18

    The hybridization of free oligonucleotides to densely packed, oriented arrays of DNA modifying the surfaces of spherical nucleic acid (SNA)-gold nanoparticle conjugates occurs with negative cooperativity; i.e., each binding event destabilizes subsequent binding events. DNA hybridization is thus an ever-changing function of the number of strands already hybridized to the particle. Thermodynamic quantification of this behavior reveals a 3 orders of magnitude decrease in the binding constant for the capture of a free oligonucleotide by an SNA conjugate as the fraction of pre-hybridized strands increases from 0 to ∼30%. Increasing the number of pre-hybridized strands imparts an increasing enthalpic penalty to hybridization that makes binding more difficult, while simultaneously decreasing the entropic penalty to hybridization, which makes binding more favorable. Hybridization of free DNA to an SNA is thus governed by both an electrostatic barrier as the SNA accumulates charge with additional binding events and an effect consistent with allostery, where hybridization at certain sites on an SNA modify the binding affinity at a distal site through conformational changes to the remaining single strands. Leveraging these insights allows for the design of conjugates that hybridize free strands with significantly higher efficiencies, some of which approach 100%.

  18. Procedure for normalization of cDNA libraries

    Science.gov (United States)

    Bonaldo, Maria DeFatima; Soares, Marcelo Bento

    1997-01-01

    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

  19. Evolution of Arabidopsis protection of telomeres 1 alters nucleic acid recognition and telomerase regulation.

    Science.gov (United States)

    Arora, Amit; Beilstein, Mark A; Shippen, Dorothy E

    2016-11-16

    Protection of telomeres (POT1) binds chromosome ends, recognizing single-strand telomeric DNA via two oligonucleotide/oligosaccharide binding folds (OB-folds). The Arabidopsis thaliana POT1a and POT1b paralogs are atypical: they do not exhibit telomeric DNA binding, and they have opposing roles in regulating telomerase activity. AtPOT1a stimulates repeat addition processivity of the canonical telomerase enzyme, while AtPOT1b interacts with a regulatory lncRNA that represses telomerase activity. Here, we show that OB1 of POT1a, but not POT1b, has an intrinsic affinity for telomeric DNA. DNA binding was dependent upon a highly conserved Phe residue (F65) that in human POT1 directly contacts telomeric DNA. F65A mutation of POT1a OB1 abolished DNA binding and diminished telomerase repeat addition processivity. Conversely, AtPOT1b and other POT1b homologs from Brassicaceae and its sister family, Cleomaceae, naturally bear a non-aromatic amino acid at this position. By swapping Val (V63) with Phe, AtPOT1b OB1 gained the capacity to bind telomeric DNA and to stimulate telomerase repeat addition processivity. We conclude that, in the context of DNA binding, variation at a single amino acid position promotes divergence of the AtPOT1b paralog from the ancestral POT1 protein. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Molecular spectroscopic studies on the interaction of ferulic acid with calf thymus DNA

    Science.gov (United States)

    Zhang, Shufang; Sun, Xuejun; Qu, Fengli; Kong, Rongmei

    2013-08-01

    The interaction between ferulic acid and calf thymus deoxyribonucleic acid (ctDNA) under physiological conditions (Tris-HCl buffer solutions, pH 7.4) was investigated by UV-Vis spectroscopy, fluorescence spectroscopy, DNA melting techniques, and viscosity measurements. Results indicated that a complex of ferulic acid with ctDNA was formed with a binding constant of K290K = 7.60 × 104 L mol-1 and K310K = 4.90 × 104 L mol-1. The thermodynamic parameters enthalpy change (ΔH°), entropy change (ΔS°) and Gibbs free energy (ΔG°) were calculated to be -1.69 × 104 J mol-1, 35.36 J K-1 mol-1 and -2.79 × 104 J mol-1 at 310 K, respectively. The acting forces between ferulic acid and DNA mainly included hydrophobic interaction and hydrogen bonds. Acridine orange displacement studies revealed that ferulic acid can substitute for AO probe in the AO-DNA complex which was indicative of intercalation binding. Thermal denaturation study suggested that the interaction of ferulic acid with DNA could result in the increase of the denaturation temperature, which indicated that the stabilization of the DNA helix was increased in the presence of ferulic acid. Spectroscopic techniques together with melting techniques and viscosity determination provided evidences of intercalation mode of binding for the interaction between ferulic acid and ctDNA.

  1. Method for determining transcriptional linkage by means of inhibition of deoxyribonucleic acid transcription by ultraviolet irradiation: evaluation in application to the investigation of in vivo transcription in bacteriophage T7

    International Nuclear Information System (INIS)

    Brautigam, A.R.

    1975-01-01

    A technique is presented for mapping promotor sites that utilizes the introduction of transcription-terminating lesions in DNA through uv irradiation which prevents transcription of genes in proportion to their distance from the promotor. This technique was applied to and evaluated in investigations of the transcriptional linkage of bacteriophage T7. All results substantiate the hypothesis that transcription in vivo does not proceed beyond the first uv lesion encountered in the template DNA and that such premature termination of transcription is the principal effect of the uv irradiation on the transcriptional template function of DNA. UV-induced inhibition of the initiation of transcription is insignificant by comparison. Uv inactivation of expression of individual T7 genes was found to follow pseudo first-order kinetics, allowing a gene-specific uv inactivation cross section to be evaluated for each gene. Promotor locations were inferred from the discontinuity in the numerical values of inactivation cross sections arising at the start of each new unit. By such analysis the bacteriophage T7 genome was found to consist of seven transcription units. In vivo E. coli RNA polymerase transcribes the T7 early region as a single unit from a pomotor region located at the left end of the genome. The T7 late region was found to consist of six transcription units, with promotors located just ahead of genes 1.7, 7, 9, 11, 13 and 17

  2. Biphasic action of cyclic adenosine 3',5'- monophosphate in gonadotropin-releasing hormone (GnRH) analog-stimulated hormone release from GH3 cells stably transfected with GnRH receptor complementary deoxyribonucleic acid.

    Science.gov (United States)

    Stanislaus, D; Arora, V; Awara, W M; Conn, P M

    1996-03-01

    GH3 cells are a PRL-secreting adenoma cell line derived from pituitary lactotropes. These cells have been stably transfected with rat GnRH receptor complementary DNA to produce four cell lines: GGH(3)1', GGH(3)2', GGH(3)6', and GGH(3)12'. In response to either GnRH or Buserelin (a metabolically stable GnRH agonist), these cell lines synthesize PRL in a cAMP-dependent manner. Only GGH(3)6' cells desensitize in response to persistent treatment with 10(-7) g/ml Buserelin. GGH(3)1', GGH(3)2', and GGH(3)12' cells, however, can be made refractory to Buserelin stimulation by raising cAMP levels either by the addition of (Bu)2cAMP to the medium or by treatment with cholera toxin. In GGH(3) cells, low levels of cAMP fulfill the requirements for a second messenger, whereas higher levels appear to mediate the development of desensitization. The observation that in GGH(3)6' cells, cAMP production persists after the onset of desensitization is consistent with the view that the mechanism responsible for desensitization is distal to the production of cAMP. Moreover, the absence of any significant difference in the amount of cAMP produced per cell in GGH(3)2', GGH(3)6', or GGH(3)12' cells suggests that elevated cAMP production per cell does not explain the development of desensitization in GGH(3)6' cells. We suggest that Buserelin-stimulated PRL synthesis in GGH(3)6' cells is mediated by a different cAMP-dependent protein kinase pool(s) than that in nondesensitizing GGH(3) cells. Such a protein kinase A pool(s) may be more susceptible to degradation via cAMP-mediated mechanisms than the protein kinase pools mediating the Buserelin response in nondesensitizing GGH(3) cells. A similar mechanism has been reported in other systems.

  3. Deoxyribonucleic acid methylation and gene expression of PPARGC1A in human muscle is influenced by high-fat overfeeding in a birth-weight-dependent manner

    DEFF Research Database (Denmark)

    Brøns, Charlotte; Jacobsen, Stine; Nilsson, Emma

    2010-01-01

    ) in the development of T2D. Objective: Our objective was to investigate gene expression and DNA methylation of PPARGC1A and coregulated oxidative phosphorylation (OXPHOS) genes in LBW and normal birth weight (NBW) subjects during control and high-fat diets. Design, Subjects, and Main Outcome Measures: Twenty young...... bisulfite sequencing and quantitative real-time PCR, respectively. Results: When challenged with high-fat overfeeding, LBW subjects developed peripheral insulin resistance and reduced PPARGC1A and OXPHOS (P higher in LBW subjects (P = 0.......0002) during the control diet. However, PPARGC1A methylation increased in only NBW subjects after overfeeding in a reversible manner. DNA methylation of PPARGC1A did not correlate with mRNA expression. Conclusions: LBW subjects developed peripheral insulin resistance and decreased gene expression of PPARGC1A...

  4. A new point mutation in the deoxyribonuclic acid-binding domain of the vitamine D receptor in a kindred with hereditary 1,25-dihydroxyvitamin d-resistant rickets

    Energy Technology Data Exchange (ETDEWEB)

    Yagi, Hideki; Miyake, Hiroshi; Nagashima, Kanji; Kuroume, Takayoshi (Gunma Univ. School of Medicine (Japan)); Ozone, K.; Pike, J.W. (Baylor College of Medicine, Houston, TX (United States))

    1993-02-01

    Hereditary 1,25-dihydroxyvitamin D [1,25-(OH)[sub 2]D]-resistant rickets (HVDRR) is a rare disorder characterized by rickets, alopecia, hypocalcemia, secondary hyperparathyroidism, and normal or elevated serum 1,25-dihydroxyvitamin D levels. The authors describe a patient with typical clinical characteristics of HVDRR, except that elevated levels of serum phosphorus were present coincident with increased levels of serum intact PTH. The patient was treated with high dose calcium infusion after an ineffective treatment with 1[alpha]-hydroxyvitamin D[sub 3]; serum calcium and phosphorus as well as intact PTH and alkaline phosphatase levels were normalized. Evaluation of phytohemagglutinin-activated lymphocytes derived from this patient revealed that 1,25-(OH)[sub 2]D[sub 3] was unable to inhibit thymidine incooperation, a result that contrast with the capacity of 1,25-(OH)[sub 2]D[sub 3] to inhibit uptake into normal activated lymphocytes. 1,25-(OH)[sub 2]D[sub 3] did not induce human osteocalcin promoter activity after transfection of this DNA linked to a reporter gene into patient cells. Cointroduction of a human vitamin D receptor (VDR) cDNA expression vector with the reporter plasmid, however, restored the hormone response. Evaluation of extracts from the patient cells for VDR DNA binding revealed a defect in DNA binding. Analysis of genomic DNA from the patient's cells by PCR confirmed the presence of a point mutation in exon 2 of the VDR. This exon directs synthesis of a portion of the DNA-binding domain of the receptor. We conclude that the genetic basis for 1,25-(OH)[sub 2]D[sub 3] resistance in this kindred with VDR-positive HVDRR is due to a single base mutation in the VDR that leads to production of a receptor unable to interact appropriately with DNA. 20 refs., 3 figs., 1 tab.

  5. Probing the transition state for nucleic acid hybridization using phi-value analysis.

    Science.gov (United States)

    Kim, Jandi; Shin, Jong-Shik

    2010-04-27

    Genetic regulation by noncoding RNA elements such as microRNA and small interfering RNA (siRNA) involves hybridization of a short single-stranded RNA with a complementary segment in a target mRNA. The physical basis of the hybridization process between the structured nucleic acids is not well understood primarily because of the lack of information about the transition-state structure. Here we use transition-state theory, inspired by phi-value analysis in protein folding studies, to provide quantitative analysis of the relationship between changes in the secondary structure stability and the activation free energy. Time course monitoring of the hybridization reaction was performed under pseudo-steady-state conditions using a single fluorophore. The phi-value analysis indicates that the native secondary structure remains intact in the transition state. The nativelike transition state was confirmed via examination of the salt dependence of the hybridization kinetics, indicating that the number of sodium ions associated with the transition state was not substantially affected by changes in the native secondary structure. These results propose that hybridization between structured nucleic acids undergoes a transition state leading to formation of a nucleation complex and then is followed by sequential displacement of preexisting base pairings involving successive small energy barriers. The proposed mechanism might provide new insight into physical processes during small RNA-mediated gene silencing, which is essential to selection of a target mRNA segment for siRNA design.

  6. Peptide nucleic acid as a selective recognition element for electrochemical determination of Hg2.

    Science.gov (United States)

    Bala, Agnieszka; Górski, Łukasz

    2018-02-01

    A novel electrochemical PNA-based biosensor for the determination of Hg 2+ is described. The receptor layer, containing single strands of polythymine PNA (peptide nucleic acid), was formed at the surface of gold electrode. Due to the presence of thymine bases and peptide bonds, an interaction between Hg 2+ ion and receptor layer occurs. The influence of chain modification - PNA vs. DNA - and type of redox marker - anionic AQMS-Na (sodium salt of anthraquinone-2-sulfonic acid) and Fe II/III (potassium ferri/ferrocyanide) or cationic MB (methylene blue) and RuHex (hexaammineruthenium(III) chloride) - were studied. Proposed PNA-based biosensor with anionic AQMS-Na as a redox marker demonstrated significantly better analytical parameters, as compared to results obtained for other tested redox markers (for measurements at pH6.0). The linear response towards Hg 2+ was in the range from 5 to 500nmol·L -1 with the detection limit of 4.5nmol·L -1 . The developed sensor distinguishes itself with high selectivity towards Hg 2+ , even for solutions containing several interfering cations. Interactions between Hg 2+ and PNA receptor layer were studied using square wave voltammetry (SWV) and electrochemical impedance spectroscopy (EIS). Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Frequent mutations of lysophosphatidic acid receptor-1 gene in rat liver tumors

    International Nuclear Information System (INIS)

    Obo, Yumi; Yamada, Takanori; Furukawa, Mami; Hotta, Mayuko; Honoki, Kanya; Fukushima, Nobuyuki; Tsujiuchi, Toshifumi

    2009-01-01

    Lysophosphatidic acid (LPA) is a bioactive phospholipid that stimulates cell proliferation, migration, and protects cells from apoptosis. It interacts with specific G protein-coupled transmembrane receptors, including LPA1 to LPA5. In the present study, to clarify an involvement of LPA1 gene alterations in the development of hepatocellular carcinomas (HCCs) we investigated the LPA1 mutations in rat HCCs induced by exogenous and endogenous liver carcinogenesis models. We induced HCCs in rats with N-nitrosodiethylamine (DEN) and a choline-deficient L-amino acid-defined (CDAA) diet. RNAs were extracted from 15 HCCs induced by DEN and 12 HCCs induced by the CDAA diet. To identify LPA1 mutations, reverse transcription (RT) - polymerase chain reaction (PCR) - single strand conformation polymorphism (SSCP) analysis, followed by nucleotide sequencing, was performed. Missense mutations were detected in 7 out of 15 HCCs (46.7%) induced by DEN. Five out of 12 HCCs (41.7%) induced by the CDAA diet also showed missense mutations. These results demonstrated that mutations in LPA1 gene occur in rat HCCs induced by DEN and the CDAA diet, suggesting that LPA1 mutations may be essentially involved in rat liver carcinogenesis

  8. Synthesis and optical properties of pyrrolidinyl peptide nucleic acid carrying a clicked Nile red label

    Directory of Open Access Journals (Sweden)

    Nattawut Yotapan

    2014-09-01

    Full Text Available DNA or its analogues with an environment-sensitive fluorescent label are potentially useful as a probe for studying the structure and dynamics of nucleic acids. In this work, pyrrolidinyl peptide nucleic acid (acpcPNA was labeled at its backbone with Nile red, a solvatochromic benzophenoxazine dye, by means of click chemistry. The optical properties of the Nile red-labeled acpcPNA were investigated by UV–vis and fluorescence spectroscopy in the absence and in the presence of DNA. In contrast to the usual quenching observed in Nile red-labeled DNA, the hybridization with DNA resulted in blue shifting and an enhanced fluorescence regardless of the neighboring bases. More pronounced blue shifts and fluorescence enhancements were observed when the DNA target carried a base insertion in close proximity to the Nile red label. The results indicate that the Nile red label is located in a more hydrophobic environment in acpcPNA–DNA duplexes than in the single-stranded acpcPNA. The different fluorescence properties of the acpcPNA hybrids of complementary DNA and DNA carrying a base insertion are suggestive of different interactions between the Nile red label and the duplexes.

  9. Kinetics and mechanism of the general-acid-catalyzed ring-closure of the malondialdehyde-DNA adduct, N2-(3-oxo-1-propenyl)deoxyguanosine (N2OPdG-), to 3-(2'-Deoxy-beta-D-erythro-pentofuranosyl)pyrimido[1,2-alpha]purin- 10(3H)-one (M1dG).

    Science.gov (United States)

    Riggins, James N; Pratt, Derek A; Voehler, Markus; Daniels, J Scott; Marnett, Lawrence J

    2004-09-01

    3-(2'-Deoxy-beta-D-erythro-pentofuranosyl)pyrimido[1,2-alpha]purin-10(3H)-one (M1dG) is the major product of the reaction of deoxyguanosine with malondialdehyde (MDA). M1dG blocks replication by DNA polymerases in vitro and is mutagenic in vivo. M1dG reacts with hydroxide to form the N2-(3-oxo-1-propenyl)deoxyguanosine anion (N2OPdG-). This reaction is pH-dependent and reverses under neutral and acidic conditions to form M1dG. Here we describe the kinetics and mechanism of the ring-closure reaction in both the nucleoside and oligonucleotides. Kinetic analysis of absorbance and fluorescence changes demonstrates that ring-closure is biphasic, leading to the rapid formation of an intermediate that slowly converts to M1dG in a general-acid-catalyzed reaction. The dependence of the rate of the rapid phase on pH reveals the pKa for protonated N2OPdG is 6.9. One-dimensional 1H NMR and DQF-COSY experiments identified two distinct intermediates, N2OPdG-H and 8-hydroxy-6,7-propenodeoxyguanosine (HO-Prene-dG), that are formed upon acidification of N2OPdG-. Characterization of ring-closure in single-stranded and in melted duplex oligonucleotides shows M1dG formation is also acid-catalyzed in single-stranded oligonucleotides and that the denaturation of an oligonucleotide duplex enhances ring-closure. This work details the complexity of ring-closure in the nucleoside and oligonucleotides and provides new insight into the role of duplex DNA in catalyzing ring-opening and ring-closing of M1dG and N2OPdG. Copyright 2004 American Chemical Society

  10. Patterning and Fabrication of Conductive Nanowires as Interconnects for Nanoelectronic Circuits Using Nucleic Acid Molecules as Templates

    National Research Council Canada - National Science Library

    Woolley, Adam T

    2005-01-01

    ...; this technique was applied in creating silver nanowires from single-stranded DNA. We further designed substrates with unique spatial addressing to allow the measurement of surface features repeatedly using complementary microscopic techniques (e.g...

  11. Role of recBC nuclease in Escherichia coli transformation.

    OpenAIRE

    Hoekstra, W P; Bergmans, J E; Zuidweg, E M

    1980-01-01

    In Escherichia coli transformation with linear donor deoxyribonucleic acid, the recBC pathway is functional, but genetic analysis shows that the recBC nuclease is deleterious to linear deoxyribonucleic acid.

  12. Effects of motexafin gadolinium on DNA damage and X-ray-induced DNA damage repair, as assessed by the Comet assay

    International Nuclear Information System (INIS)

    Donnelly, Erling T.; Liu Yanfeng; Paul, Tracy K.; Rockwell, Sara

    2005-01-01

    Purpose: To investigate the effects of motexafin gadolinium (MGd) on the levels of reactive oxygen species (ROS), glutathione (GSH), and DNA damage in EMT6 mouse mammary carcinoma cells. The ability of MGd to alter radiosensitivity and to inhibit DNA damage repair after X-ray irradiation was also evaluated. Methods and Materials: Reactive oxygen species and GSH levels were assessed by 2,7-dichlorofluorescein fluorescence flow cytometry and the Tietze method, respectively. Cellular radiosensitivity was assessed by clonogenic assays. Deoxyribonucleic acid damage and DNA damage repair were assessed in plateau-phase EMT6 cells by the Comet assay and clonogenic assays. Results: Cells treated with 100 μmol/L MGd plus equimolar ascorbic acid (AA) had significantly increased levels of ROS and a 58.9% ± 3.4% decrease in GSH levels, relative to controls. Motexafin gadolinium plus AA treatment increased the hypoxic, but not the aerobic, radiosensitivity of EMT6 cells. There were increased levels of single-strand breaks in cells treated with 100 μmol/L MGd plus equimolar AA, as evidenced by changes in the alkaline tail moment (MGd + AA, 6 h: 14.7 ± 1.8; control: 2.8 ± 0.9). The level of single-strand breaks was dependent on the length of treatment. Motexafin gadolinium plus AA did not increase double-strand breaks. The repair of single-strand breaks at 2 h, but not at 4 h and 6 h, after irradiation was altered significantly in cells treated with MGd plus AA (MGd + AA, 2 h: 15.8 ± 3.4; control: 5.8 ± 0.6). Motexafin gadolinium did not alter the repair of double-strand breaks at any time after irradiation with 10 Gy. Conclusions: Motexafin gadolinium plus AA generated ROS, which in turn altered GSH homeostasis and induced DNA strand breaks. The MGd plus AA-mediated alteration of GSH levels increased the hypoxic, but not aerobic, radiosensitivity of EMT6 cells. Motexafin gadolinium altered the kinetics of single-strand break repair soon after irradiation but did not

  13. Structural aspects of catalytic mechanisms of endonucleases and their binding to nucleic acids

    Energy Technology Data Exchange (ETDEWEB)

    Zhukhlistova, N. E.; Balaev, V. V.; Lyashenko, A. V.; Lashkov, A. A., E-mail: alashkov83@gmail.com [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

    2012-05-15

    Endonucleases (EC 3.1) are enzymes of the hydrolase class that catalyze the hydrolytic cleavage of deoxyribonucleic and ribonucleic acids at any region of the polynucleotide chain. Endonucleases are widely used both in biotechnological processes and in veterinary medicine as antiviral agents. Medical applications of endonucleases in human cancer therapy hold promise. The results of X-ray diffraction studies of the spatial organization of endonucleases and their complexes and the mechanism of their action are analyzed and generalized. An analysis of the structural studies of this class of enzymes showed that the specific binding of enzymes to nucleic acids is characterized by interactions with nitrogen bases and the nucleotide backbone, whereas the nonspecific binding of enzymes is generally characterized by interactions only with the nucleic-acid backbone. It should be taken into account that the specificity can be modulated by metal ions and certain low-molecular-weight organic compounds. To test the hypotheses about specific and nonspecific nucleic-acid-binding proteins, it is necessary to perform additional studies of atomic-resolution three-dimensional structures of enzyme-nucleic-acid complexes by methods of structural biology.

  14. Inducible Alkylation of DNA by a Quinone Methide-Peptide Nucleic Acid Conjugate†

    Science.gov (United States)

    Liu, Yang; Rokita, Steven E.

    2012-01-01

    The reversibility of alkylation by a quinone methide intermediate (QM) avoids the irreversible consumption that plagues most reagents based on covalent chemistry and allows for site specific reaction that is controlled by the thermodynamics rather than kinetics of target association. This characteristic was originally examined with an oligonucleotide QM conjugate but broad application depends on alternative derivatives that are compatible with a cellular environment. Now, a peptide nucleic acid (PNA) derivative has been constructed and shown to exhibit an equivalent ability to delivery the reactive QM in a controlled manner. This new conjugate demonstrates high selectivity for a complementary sequence of DNA even when challenged with an alternative sequence containing a single T/T mismatch. Alkylation of non-complementary sequences is only possible when a template strand is present to co-localize the conjugate and its target. For efficient alkylation in this example, a single-stranded region of the target is required adjacent to the QM conjugate. Most importantly, the intrastrand self adducts formed between the PNA and its attached QM remained active and reversible over more than eight days in aqueous solution prior to reaction with a chosen target added subsequently. PMID:22243337

  15. Intrinsic nucleic acid dynamics modulates HIV-1 nucleocapsid protein binding to its targets.

    Directory of Open Access Journals (Sweden)

    Ali Bazzi

    Full Text Available HIV-1 nucleocapsid protein (NC is involved in the rearrangement of nucleic acids occurring in key steps of reverse transcription. The protein, through its two zinc fingers, interacts preferentially with unpaired guanines in single-stranded sequences. In mini-cTAR stem-loop, which corresponds to the top half of the cDNA copy of the transactivation response element of the HIV-1 genome, NC was found to exhibit a clear preference for the TGG sequence at the bottom of mini-cTAR stem. To further understand how this site was selected among several potential binding sites containing unpaired guanines, we probed the intrinsic dynamics of mini-cTAR using (13C relaxation measurements. Results of spin relaxation time measurements have been analyzed using the model-free formalism and completed by dispersion relaxation measurements. Our data indicate that the preferentially recognized guanine in the lower part of the stem is exempt of conformational exchange and highly mobile. In contrast, the unrecognized unpaired guanines of mini-cTAR are involved in conformational exchange, probably related to transient base-pairs. These findings support the notion that NC preferentially recognizes unpaired guanines exhibiting a high degree of mobility. The ability of NC to discriminate between close sequences through their dynamic properties contributes to understanding how NC recognizes specific sites within the HIV genome.

  16. Intrinsic Nucleic Acid Dynamics Modulates HIV-1 Nucleocapsid Protein Binding to Its Targets

    Science.gov (United States)

    Bazzi, Ali; Zargarian, Loussiné; Chaminade, Françoise; De Rocquigny, Hugues; René, Brigitte; Mély, Yves; Fossé, Philippe; Mauffret, Olivier

    2012-01-01

    HIV-1 nucleocapsid protein (NC) is involved in the rearrangement of nucleic acids occurring in key steps of reverse transcription. The protein, through its two zinc fingers, interacts preferentially with unpaired guanines in single-stranded sequences. In mini-cTAR stem-loop, which corresponds to the top half of the cDNA copy of the transactivation response element of the HIV-1 genome, NC was found to exhibit a clear preference for the TGG sequence at the bottom of mini-cTAR stem. To further understand how this site was selected among several potential binding sites containing unpaired guanines, we probed the intrinsic dynamics of mini-cTAR using 13C relaxation measurements. Results of spin relaxation time measurements have been analyzed using the model-free formalism and completed by dispersion relaxation measurements. Our data indicate that the preferentially recognized guanine in the lower part of the stem is exempt of conformational exchange and highly mobile. In contrast, the unrecognized unpaired guanines of mini-cTAR are involved in conformational exchange, probably related to transient base-pairs. These findings support the notion that NC preferentially recognizes unpaired guanines exhibiting a high degree of mobility. The ability of NC to discriminate between close sequences through their dynamic properties contributes to understanding how NC recognizes specific sites within the HIV genome. PMID:22745685

  17. Two-state model for helicase translocation and unwinding of nucleic acids

    Science.gov (United States)

    Garai, Ashok; Chowdhury, Debashish; Betterton, M. D.

    2008-06-01

    Helicases are molecular motors that unwind double-stranded nucleic acids (dsNA), such as DNA and RNA. Typically a helicase translocates along one of the NA single strands while unwinding and uses adenosine triphosphate (ATP) hydrolysis as an energy source. Here we model a helicase motor that can switch between two states, which could represent two different points in the ATP hydrolysis cycle. Our model is an extension of the earlier Betterton-Jülicher model of helicases to incorporate switching between two states. The main predictions of the model are the speed of unwinding of the dsNA and fluctuations around the average unwinding velocity. Motivated by a recent claim that the NS3 helicase of Hepatitis C virus follows a flashing-ratchet mechanism, we have compared the experimental results for the NS3 helicase with a special limit of our model which corresponds to the flashing-ratchet scenario. Our model accounts for one key feature of the experimental data on NS3 helicase. However, contradictory observations in experiments carried out under different conditions limit the ability to compare the model to experiments.

  18. Native nucleic acid electrophoresis as an efficient alternative for genotyping method of influenza virus.

    Science.gov (United States)

    Pajak, Beata; Lepek, Krzysztof

    2014-01-01

    Influenza viruses are the worldwide major causative agents of human and animal acute respiratory infections. Some of the influenza subtypes have caused epidemics and pandemics among humans. The varieties of methods are available for the rapid isolation and identification of influenza viruses in clinical and environmental samples. Since nucleic acids amplification techniques such as RT-PCR have been adapted, fast and sensitive influenza type and subtype determination is possible. However, in some ambiguous cases other, more detailed assay might be desired. The genetic material of influenza virus is highly unstable and constantly mutates. It is known that single nucleotide polymorphisms (SNPs) results in resistance to commercially available anti-viral drugs. The genetic drift of the virus could also result in weakening of immune response to infection. Finally, in a substantial number of patients co-infection with various virus strains or types has been confirmed. Although the detection of co-infection or presence of minor genetic variants within flu-infected patients is not a routine procedure, a rapid and wide spectrum diagnostics of influenza virus infections could reveal an accurate picture of the disease and more importantly, is crucial for choosing the appropriate therapeutics and virus monitoring. Herein we present the evidences that native gel electrophoresis and MSSCP--a method based on multitemperature single strand conformation polymorphism could furnish a useful technique for minor variants, which escape discovery by conventional diagnostic assays.

  19. Molecular Biology of the Photoregulator of Photosynthetic Light- Harversting Complexes in Marine Dinoflagellates.

    Science.gov (United States)

    DINOFLAGELLATA, * MOLECULAR BIOLOGY , *PHOTOSYNTHESIS, ALGAE, CELLS, CLONES, DEOXYRIBONUCLEIC ACIDS, ENVIRONMENTS, GENES, LIGHT, NUTRIENTS, OCEANS, OPTICAL PROPERTIES, PHYTOPLANKTON, PRODUCTION, PROTEINS, REGULATIONS.

  20. Folic Acid

    Science.gov (United States)

    Folic acid is a B vitamin. It helps the body make healthy new cells. Everyone needs folic acid. For women who may get pregnant, it is really important. Getting enough folic acid before and during pregnancy can prevent major birth ...

  1. Hybridization properties of long nucleic acid probes for detection of variable target sequences, and development of a hybridization prediction algorithm

    Science.gov (United States)

    Öhrmalm, Christina; Jobs, Magnus; Eriksson, Ronnie; Golbob, Sultan; Elfaitouri, Amal; Benachenhou, Farid; Strømme, Maria; Blomberg, Jonas

    2010-01-01

    One of the main problems in nucleic acid-based techniques for detection of infectious agents, such as influenza viruses, is that of nucleic acid sequence variation. DNA probes, 70-nt long, some including the nucleotide analog deoxyribose-Inosine (dInosine), were analyzed for hybridization tolerance to different amounts and distributions of mismatching bases, e.g. synonymous mutations, in target DNA. Microsphere-linked 70-mer probes were hybridized in 3M TMAC buffer to biotinylated single-stranded (ss) DNA for subsequent analysis in a Luminex® system. When mismatches interrupted contiguous matching stretches of 6 nt or longer, it had a strong impact on hybridization. Contiguous matching stretches are more important than the same number of matching nucleotides separated by mismatches into several regions. dInosine, but not 5-nitroindole, substitutions at mismatching positions stabilized hybridization remarkably well, comparable to N (4-fold) wobbles in the same positions. In contrast to shorter probes, 70-nt probes with judiciously placed dInosine substitutions and/or wobble positions were remarkably mismatch tolerant, with preserved specificity. An algorithm, NucZip, was constructed to model the nucleation and zipping phases of hybridization, integrating both local and distant binding contributions. It predicted hybridization more exactly than previous algorithms, and has the potential to guide the design of variation-tolerant yet specific probes. PMID:20864443

  2. In Situ Localization of Barley Yellow Dwarf Virus-PAV 17-kDa Protein and Nucleic Acids in Oats.

    Science.gov (United States)

    Nass, P H; Domier, L L; Jakstys, B P; D'Arcy, C J

    1998-10-01

    ABSTRACT Barley yellow dwarf virus strain PAV (BYDV-PAV) RNA and the 17-kDa protein were localized in BYDV-PAV-infected oat cells using in situ hybridization and in situ immunolocalization assays, respectively. The in situ hybridization assay showed labeling of filamentous material in the nucleus, cytoplasm, and virus-induced vesicles with both sense and antisense nucleic acid probes, suggesting that the filamentous material found in BYDV-PAV-infected cells contains viral RNA. BYDV-PAV negative-strand RNA was detected before virus particles were observed, which indicates that RNA replication is initiated before synthesis of viral coat protein in the cytoplasm. The 17-kDa protein was associated with filamentous material in the cytoplasm, nucleus, and virus-induced vesicles. The labeling densities observed using antibodies against the 17-kDa protein were similar in the nucleus and cytoplasm. No labeling of the 17-kDa protein was observed in plasmodesmata, but filaments in the nuclear pores occasionally were labeled. Since BYDV-PAV RNA and 17-kDa protein colocalized within infected cells, it is possible that single-stranded viral RNA is always associated with the 17-kDa protein in vivo. The 17-kDa protein may be required for viral nucleic acid filaments to traverse the nuclear membrane or other membrane systems.

  3. Primordial soup or vinaigrette: did the RNA world evolve at acidic pH?

    Directory of Open Access Journals (Sweden)

    Bernhardt Harold S

    2012-01-01

    Full Text Available Abstract Background The RNA world concept has wide, though certainly not unanimous, support within the origin-of-life scientific community. One view is that life may have emerged as early as the Hadean Eon 4.3-3.8 billion years ago with an atmosphere of high CO2 producing an acidic ocean of the order of pH 3.5-6. Compatible with this scenario is the intriguing proposal that life arose within alkaline (pH 9-11 deep-sea hydrothermal vents like those of the 'Lost City', with the interface with the acidic ocean creating a proton gradient sufficient to drive the first metabolism. However, RNA is most stable at pH 4-5 and is unstable at alkaline pH, raising the possibility that RNA may have first arisen in the acidic ocean itself (possibly near an acidic hydrothermal vent, acidic volcanic lake or comet pond. As the Hadean Eon progressed, the ocean pH is inferred to have gradually risen to near neutral as atmospheric CO2 levels decreased. Presentation of the hypothesis We propose that RNA is well suited for a world evolving at acidic pH. This is supported by the enhanced stability at acidic pH of not only the RNA phosphodiester bond but also of the aminoacyl-(tRNA and peptide bonds. Examples of in vitro-selected ribozymes with activities at acid pH have recently been documented. The subsequent transition to a DNA genome could have been partly driven by the gradual rise in ocean pH, since DNA has greater stability than RNA at alkaline pH, but not at acidic pH. Testing the hypothesis We have proposed mechanisms for two key RNA world activities that are compatible with an acidic milieu: (i non-enzymatic RNA replication of a hemi-protonated cytosine-rich oligonucleotide, and (ii specific aminoacylation of tRNA/hairpins through triple helix interactions between the helical aminoacyl stem and a single-stranded aminoacylating ribozyme. Implications of the hypothesis Our hypothesis casts doubt on the hypothesis that RNA evolved in the vicinity of alkaline

  4. Cyclic voltammetry of echinomycin and its interaction with double-stranded and single-stranded DNA adsorbed at the electrode

    Czech Academy of Sciences Publication Activity Database

    Jelen, František; Erdem, A.; Paleček, Emil

    2002-01-01

    Roč. 55, 1/2 (2002), s. 165-167 ISSN 1567-5394 R&D Projects: GA AV ČR IAA4004901; GA ČR GV204/97/K084 Institutional research plan: CEZ:AV0Z5004920 Keywords : electrochemistry of DNA * interaction of DNA with echinomycin * hanging mercury drop electrode Subject RIV: BO - Biophysics Impact factor: 1.463, year: 2002

  5. Characterization of the Single Stranded DNA Binding Protein SsbB Encoded in the Gonoccocal Genetic Island

    NARCIS (Netherlands)

    Jain, Samta; Zweig, Maria; Peeters, Eveline; Siewering, Katja; Hackett, Kathleen T.; Dillard, Joseph P.; van der Does, Chris

    2012-01-01

    Background: Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in

  6. Human Rad51 filaments on double- and single-stranded DNA: correlating regular and irregular forms with recombination function.

    NARCIS (Netherlands)

    D. Ristic (Dejan); M. Modesti (Mauro); T. van der Heijden (Thijn); J. Noort (John); C. Dekker (Cees); R. Kanaar (Roland); C. Wyman (Claire)

    2005-01-01

    textabstractRecombinase proteins assembled into helical filaments on DNA are believed to be the catalytic core of homologous recombination. The assembly, disassembly and dynamic rearrangements of this structure must drive the DNA strand exchange reactions of homologous recombination. The sensitivity

  7. Genomic sequences of two novel Levivirus single-stranded RNA coliphages (family Leviviridae): Evidence for recombination in environmental strains

    Science.gov (United States)

    Bacteriophages are likely the most abundant entities in the aquatic environment, yet knowledge of their ecology is limited. During a fecal source-tracking study, two genetically novel Leviviridae strains were discovered. Although the novel strains were isolated from coastal wat...

  8. The Effectiveness of a Weight Maintenance Intervention for Adults with Intellectual Disabilities and Obesity: A Single Stranded Study

    Science.gov (United States)

    Spanos, Dimitrios; Hankey, Catherine R.; Melville, Craig A.

    2016-01-01

    Background: The evidence base for weight management programmes incorporating a weight loss and a weight maintenance phase for adults with intellectual disabilities (ID) is limited. This study describes the weight maintenance phase of a multicomponent weight management programme for adults with intellectual disability and obesity (TAKE 5).…

  9. Detection of benzo[a]pyrene-guanine adducts in single-stranded DNA using the α-hemolysin nanopore

    Science.gov (United States)

    Perera, Rukshan T.; Fleming, Aaron M.; Johnson, Robert P.; Burrows, Cynthia J.; White, Henry S.

    2015-02-01

    The carcinogenic precursor benzo[a]pyrene (BP), a polycyclic aromatic hydrocarbon, is released into the environment through the incomplete combustion of hydrocarbons. Metabolism of BP in the human body yields a potent alkylating agent (benzo[a]pyrene diol epoxide, BPDE) that reacts with guanine (G) in DNA to form an adduct implicated in cancer initiation. We report that the α-hemolysin (αHL) nanopore platform can be used to detect a BPDE adduct to G in synthetic oligodeoxynucleotides. Translocation of a 41-mer poly-2‧-deoxycytidine strand with a centrally located BPDE adduct to G through αHL in 1 M KCl produces a unique multi-level current signature allowing the adduct to be detected. This readily distinguishable current modulation was observed when the BPDE-adducted DNA strand translocated from either the 5‧ or 3‧ directions. This study suggests that BPDE adducts and other large aromatic biomarkers can be detected with αHL, presenting opportunities for the monitoring, quantification, and sequencing of mutagenic compounds from cellular DNA samples.

  10. Data mining cDNAs reveals three new single stranded RNA viruses in Nasonia (Hymenopetera:Pteromalidae)

    Science.gov (United States)

    Hymenopteran viruses may provide insights into colony collapse disorder in honey bees and other insect species. Three novel small RNA viruses were discovered during the genomics effort for the beneficial parasitoid of flies in the genus Nasonia (Hymenoptera). Genomics provides a great deal of inform...

  11. Cytogenetic Markers, DNA Single-Strand Breaks, Urinary Metabolites, and DNA Repair Rates in Styrene-Exposed Lamination Workers

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Tuimala, J.; Štětina, R.; Kumar, R.; Manini, P.; Naccarati, Alessio; Maestri, L.; Vodičková, L.; Kuricová, Miroslava; Jarventaus, H.; Majvalková, Z.; Hirvonen, A.; Imbriani, M.; Mutti, A.; Norppa, H.; Hemminki, K.

    2004-01-01

    Roč. 112, č. 8 (2004), s. 867-871 ISSN 0091-6765 R&D Projects: GA ČR GA310/03/0437; GA ČR GA310/01/0802 Institutional research plan: CEZ:AV0Z5039906 Keywords : DNA repair rates * genotoxicity Subject RIV: FM - Hygiene Impact factor: 3.929, year: 2004

  12. Activation of 2'-5' oligoadenylate synthetase by single-stranded and double-stranded RNA aptamers

    DEFF Research Database (Denmark)

    Hartmann, R; Norby, P L; Martensen, P M

    1998-01-01

    A number of small RNA molecules that are high affinity ligands for the 46-kDa form of human 2'-5' oligoadenylate synthetase have been identified by the SELEX method. Surface plasmon resonance analysis indicates that these RNAs bind to the enzyme with dissociation constants in the nanomolar range....... Competition experiments indicate that the binding site for the small RNAs on the 2'-5' oligoadenylate synthetase molecule at least partially overlaps that for the synthetic double-stranded RNA, poly(I).poly(C). Several of the RNAs function as potent activators of 2'-5' oligoadenylate synthetase in vitro......-stranded RNA, can also be activated by RNA ligands with little secondary structure. Since 2'-5' oligoadenylate synthetase possesses no homology to other known RNA-binding proteins, the development of small specific ligands by SELEX should facilitate studies of RNA-protein interactions and may reveal novel...

  13. Analysis of major histocompatibility complex class II gene in water voles using capillary electrophoresis-single stranded conformation polymorphism

    Czech Academy of Sciences Publication Activity Database

    Bryja, Josef; Galan, M.; Charbonnel, N.; Cosson, J.-F.

    2005-01-01

    Roč. 5, č. 1 (2005), s. 173-176 ISSN 1471-8278 Institutional research plan: CEZ:AV0Z6093917 Keywords : water vole * population genetics Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.219, year: 2005

  14. Effect of Zn2+ and temperature on the conformational equilibrium of single-stranded polyA in neutral solutions

    Czech Academy of Sciences Publication Activity Database

    Sorokin, V. A.; Valeev, V. A.; Usenko, E. L.; Andrushchenko, Valery

    2013-01-01

    Roč. 61, Oct (2013), s. 448-452 ISSN 0141-8130 R&D Projects: GA ČR GAP208/10/0559 Institutional support: RVO:61388963 Keywords : metal ions * polyA * metal lized form * differential UV spectroscopy * thermal denaturation * phase diagram Subject RIV: CE - Biochemistry Impact factor: 3.096, year: 2013

  15. Cuprolinic Blue: a specific dye for single-stranded RNA in the presence of magnesium chloride. I. Fundamental aspects

    NARCIS (Netherlands)

    Tas, J.; MENDELSON, D.; NOORDEN, C. J. F.

    1983-01-01

    Qualitative and quantitative aspects of the cationic dye Cuprolinic Blue were investigated with model films of polyacrylamide gel in which RNA, DNA and other biological polyanionic compounds had been incorporated. In the presence of 1 M MgCl2, Curpolinic Blue was found to bind specifically to

  16. Conformational Diversity of Single-Stranded DNA from Bacterial Repetitive Extragenic Palindromes: Implications for the DNA Recognition Elements of Transposases

    Czech Academy of Sciences Publication Activity Database

    Charnavets, Tatsiana; Nunvář, Jaroslav; Nečasová, Iva; Voelker, J.; Breslauer, K.J.; Schneider, Bohdan

    2015-01-01

    Roč. 103, č. 10 (2015), s. 585-596 ISSN 0006-3525 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109; GA ČR GAP305/12/1801; GA MŠk(CZ) EE2.3.30.0020 Institutional support: RVO:86652036 Keywords : bacterial repetitive extragenic palindromes (REP) * circular dichroism spectroscopy * REP associated tyrosine transposases (RAYTs) Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.248, year: 2015

  17. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB)

    OpenAIRE

    van Loon, Barbara; Samson, Leona D.

    2013-01-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known...

  18. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes

    Czech Academy of Sciences Publication Activity Database

    Pietilä, M.K.; Roine, E.; Sencilo, Ana; Bamford, D.H.; Oksanen, H.M.

    2016-01-01

    Roč. 161, č. 1 (2016), s. 249-256 ISSN 0304-8608 R&D Projects: GA ČR(CZ) GAP302/11/ 1940 Institutional support: RVO:61388971 Keywords : VIRION ARCHITECTURE * HALOVIRUSES * SPINDLE Subject RIV: EE - Microbiology, Virology Impact factor: 2.058, year: 2016

  19. Direct imaging of hexaamine-ruthenium(III) in domain boundaries in monolayers of single-stranded DNA

    DEFF Research Database (Denmark)

    Grubb, Mikala; Wackerbarth, Hainer; Wengel, J.

    2007-01-01

    We describe adsorption and identification of the binding sites of [Ru(NH3)(6)](3+) (RuHex) molecules in a closely packed monolayer of a 13-base ss-DNA on Au(111) electrodes by electrochemical in situ scanning tunneling microscopy (STM), cyclic voltammetry and interfacial capacitance data. In situ...

  20. Human Rad51 filaments on double- and single-stranded DNA : Correlating regular and irregular forms with recombination function

    NARCIS (Netherlands)

    Ristic, D.; Modesti, M.; Van der Heijden, T.; Van Noort, J.; Dekker, C.; Kanaar, R.; Wyman, C.

    Recombinase proteins assembled into helical filaments on DNA are believed to be the catalytic core of homologous recombination. The assembly, disassembly and dynamic rearrangements of this structure must drive the DNA strand exchange reactions of homologous recombination. The sensitivity of

  1. Interaction of Zn2+ Ions with Single-Stranded PolyU and PolyC in Neutral Solutions

    Czech Academy of Sciences Publication Activity Database

    Sorokin, V. A.; Usenko, E. L.; Valeev, V. A.; Berezniak, E. G.; Andrushchenko, Valery

    2015-01-01

    Roč. 119, č. 12 (2015), s. 4409-4416 ISSN 1520-6106 R&D Projects: GA ČR GAP208/11/0105; GA ČR GA15-09072S Institutional support: RVO:61388963 Keywords : metal ions * polyU * polyC * metallized DNA * differential UV spectroscopy * thermal denaturation * phase diagram Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.187, year: 2015

  2. Using single strand conformational polymorphisms (SSCP) to identify Phytophthora species in Oregon forests affected by sudden oak death

    Science.gov (United States)

    E. Hansen; C. Hesse; P. Reeser; W. Sutton; L. Winton

    2006-01-01

    Phytophthora species are abundant in streams, widespread in soils and occasionally found in diseased plants in the tanoak forests of southwestern Oregon. It is time-consuming and expensive to identify hundreds of isolates to species using morphology or internal transribed spacer (ITS) sequencing. We modified a published Phytophthora...

  3. Eubacterium rangiferina, a novel usnic acid-resistant bacterium from the reindeer rumen

    Science.gov (United States)

    Sundset, Monica A.; Kohn, Alexandra; Mathiesen, Svein D.; Præsteng, Kirsti E.

    2008-08-01

    Reindeer are able to eat and utilize lichens as an important source of energy and nutrients. In the current study, the activities of antibiotic secondary metabolites including usnic, antranoric, fumarprotocetraric, and lobaric acid commonly found in lichens were tested against a collection of 26 anaerobic rumen bacterial isolates from reindeer ( Rangifer tarandus tarandus) using the agar diffusion method. The isolates were identified based on their 16S ribosomal ribonucleic acid (rRNA) gene sequences. Usnic acid had a potent antimicrobial effect against 25 of the isolates, belonging to Clostridiales, Enterococci, and Streptococci. Isolates of Clostridia and Streptococci were also susceptible to atranoric and lobaric acid. However, one isolate (R3_91_1) was found to be resistant to usnic, antranoric, fumarprotocetraric, and lobaric acid. R3_91_1 was also seen invading and adhering to lichen particles when grown in a liquid anaerobic culture as demonstrated by transmission electron microscopy. This was a Gram-negative, nonmotile rod (0.2-0.7 × 2.0-3.5 μm) with a deoxyribonucleic acid G + C content of 47.0 mol% and main cellular fatty acids including 15:0 anteiso-dimethyl acetal (DMA), 16:0 iso-fatty acid methyl ester (FAME), 13:0 iso-3OH FAME, and 17:0 anteiso-FAME, not matching any of the presently known profiles in the MIDI database. Combined, the phenotypic and genotypic traits including the 16S rRNA gene sequence show that R3_91_1 is a novel species inside the order Clostridiales within the family Lachnospiraceae, for which we propose the name Eubacterium rangiferina. This is the first record of a rumen bacterium able to tolerate and grow in the presence of usnic acid, indicating that the rumen microorganisms in these animals have adapted mechanisms to deal with lichen secondary metabolites, well known for their antimicrobial and toxic effects.

  4. Ascorbic Acid

    Science.gov (United States)

    Ascorbic acid is used to prevent and treat scurvy, a disease caused by a lack of vitamin C in ... Ascorbic acid comes in extended-release (long-acting) capsules and tablets, lozenges, syrup, chewable tablets, and liquid drops to ...

  5. Obeticholic Acid

    Science.gov (United States)

    Obeticholic acid is used alone or in combination with ursodiol (Actigall, Urso) to treat primary biliary cholangitis (PBC; a ... were not treated successfully with ursodiol alone. Obeticholic acid is in a class of medications called farnesoid ...

  6. Aminocaproic Acid

    Science.gov (United States)

    Aminocaproic acid is used to control bleeding that occurs when blood clots are broken down too quickly. This type ... the baby is ready to be born). Aminocaproic acid is also used to control bleeding in the ...

  7. Ethacrynic Acid

    Science.gov (United States)

    Ethacrynic acid, a 'water pill,' is used to treat swelling and fluid retention caused by various medical problems. It ... Ethacrynic acid comes as a tablet to take by mouth. It is usually taken once or twice a day ...

  8. Mefenamic Acid

    Science.gov (United States)

    Mefenamic acid is used to relieve mild to moderate pain, including menstrual pain (pain that happens before or during a menstrual period). Mefenamic acid is in a class of medications called NSAIDs. ...

  9. Gold-mercaptopropionic acid-polyethylenimine composite based DNA sensor for early detection of rheumatic heart disease.

    Science.gov (United States)

    Singh, Swati; Kaushal, Ankur; Khare, Shashi; Kumar, Pradeep; Kumar, Ashok

    2014-07-21

    The first gold-mercaptopropionic acid-polyethylenimine composite based electrochemical DNA biosensor was fabricated for the early detection of Streptococcus pyogenes infection in humans causing rheumatic heart disease (heart valve damage). No biosensor is available for the detection of rheumatic heart disease (RHD). Therefore, the mga gene based sensor was developed by the covalent immobilization of a 5'-carboxyl modified single stranded DNA probe onto the gold composite electrode. The immobilized probe was hybridized with the genomic DNA (G-DNA) of S. pyogenes from throat swabs and the electrochemical response was measured by cyclic voltammetry (CV), differential pulse voltammetry (DPV) and electrochemical impedance (EI). Covalent immobilization of the probe onto the gold composite and its hybridization with G-DNA was characterized by FTIR and SEM. The sensitivity of the sensor was 110.25 μA cm(-2) ng(-1) with DPV and the lower limit of detection was 10 pg per 6 μL. The sensor was validated with patient throat swab samples and results were compared with available methods. The sensor is highly specific to S. pyogenes and can prevent damage to heart valves by the early detection of the infection in only 30 min.

  10. The impact of α-hydrazino acids embedded in short fluorescent peptides on peptide interactions with DNA and RNA.

    Science.gov (United States)

    Suć, Josipa; Tumir, Lidija-Marija; Glavaš-Obrovac, Ljubica; Jukić, Marijana; Piantanida, Ivo; Jerić, Ivanka

    2016-06-07

    A series of novel hydrazino-based peptidomimetics and analogues comprising N-terminal lysine and C-terminal phenanthridinyl-l-alanine were prepared. The presented results demonstrate the up to now unknown possibility to finely modulate peptide interactions with DNA/RNA by α-hydrazino group insertion and how the different positioning of two α-hydrazino groups in peptides controls binding to various double stranded and single stranded DNA and RNA. All peptidomimetics bind with 1-10 micromolar affinity to ds-DNA/RNA, whereby the binding mode is a combination of electrostatic interactions and hydrophobic interactions within DNA/RNA grooves. Insertion of the α-hydrazino group into the peptide systematically decreased its fluorimetric response to DNA/RNA binding in the order: mono-hydrazino < alternating-hydrazino < sequential-hydrazino group. Binding studies of ss-polynucleotides suggest intercalation of phenanthridine between polynucleotide bases, whereby affinity and fluorimetric response decrease with the number of α-hydrazino groups in the peptide sequence. Particularly interesting was the interaction of two sequential α-hydrazino acids-peptidomimetic with poly rG, characterised by a specific strong increase of CD bands, while all other peptide/ssRNA combinations gave only a CD-band decrease. All mentioned interactions could also be reversibly controlled by adjusting the pH, due to the protonation of the fluorophore.

  11. Ibotenic acid and thioibotenic acid

    DEFF Research Database (Denmark)

    Hermit, Mette B; Greenwood, Jeremy R; Nielsen, Birgitte

    2004-01-01

    In this study, we have determined and compared the pharmacological profiles of ibotenic acid and its isothiazole analogue thioibotenic acid at native rat ionotropic glutamate (iGlu) receptors and at recombinant rat metabotropic glutamate (mGlu) receptors expressed in mammalian cell lines....... Thioibotenic acid has a distinct pharmacological profile at group III mGlu receptors compared with the closely structurally related ibotenic acid; the former is a potent (low microm) agonist, whereas the latter is inactive. By comparing the conformational energy profiles of ibotenic and thioibotenic acid...... with the conformations preferred by the ligands upon docking to mGlu1 and models of the other mGlu subtypes, we propose that unlike other subtypes, group III mGlu receptor binding sites require a ligand conformation at an energy level which is prohibitively expensive for ibotenic acid, but not for thioibotenic acid...

  12. Okadaic acid

    DEFF Research Database (Denmark)

    Danielsen, E Michael; Hansen, Gert H; Severinsen, Mai C K

    2014-01-01

    Okadaic acid (OA) is a polyether fatty acid produced by marine dinoflagellates and the causative agent of diarrhetic shellfish poisoning. The effect of OA on apical endocytosis in the small intestine was studied in organ cultured porcine mucosal explants. Within 0.5-1 h of culture, the toxin caused...... in acidic organelles, implying a different toxic mechanism of action. We propose that rapid induction of LBs, an indicator of phospholipidosis, should be included in the future toxicity profile of OA....

  13. Interfacial transduction of nucleic acid hybridization using immobilized quantum dots as donors in fluorescence resonance energy transfer.

    Science.gov (United States)

    Algar, W Russ; Krull, Ulrich J

    2009-01-06

    Fluorescence resonance energy transfer (FRET) using immobilized quantum dots (QDs) as energy donors was explored as a transduction method for the detection of nucleic acid hybridization at an interface. This research was motivated by the success of the QD-FRET-based transduction of nucleic acid hybridization in solution-phase assays. This new work represents a fundamental step toward the assembly of a biosensor, where immobilization of the selective chemistry on a surface is desired. After immobilizing QD-probe oligonucleotide conjugates on optical fibers, a demonstration of the retention of selectivity was achieved by the introduction of acceptor (Cy3)-labeled single-stranded target oligonucleotides. Hybridization generated the proximity required for FRET, and the resulting fluorescence spectra provided an analytical signal proportional to the amount of target. This research provides an important framework for the future development of nucleic acid biosensors based on QDs and FRET. The most important findings of this work are that (1) a QD-FRET solid-phase hybridization assay is viable and (2) a passivating layer of denatured bovine serum albumin alleviates nonspecific adsorption, ultimately resulting in (3) the potential for a reusable assay format and mismatch discrimination. In this, the first incarnation of a solid-phase QD-FRET hybridization assay, the limit of detection was found to be 5 nM, and the dynamic range was almost 2 orders of magnitude. Selective discrimination of the target was shown using a three-base-pairs mismatch from a fully complementary sequence. Despite a gradual loss of signal, reuse of the optical fibers over multiple cycles of hybridization and dehybridization was possible. Directions for further improvement of the analytical performance by optimizing the design of the QD-probe oligonucleotide interface are identified.

  14. Method for introducing unidirectional nested deletions

    Science.gov (United States)

    Dunn, J.J.; Quesada, M.A.; Randesi, M.

    1999-07-27

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector. The cloning vector has an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe. 1 fig.

  15. DNA and protein binding, double-strand DNA cleavage and cytotoxicity of mixed ligand copper(II) complexes of the antibacterial drug nalidixic acid.

    Science.gov (United States)

    Loganathan, Rangasamy; Ganeshpandian, Mani; Bhuvanesh, Nattamai S P; Palaniandavar, Mallayan; Muruganantham, Amsaveni; Ghosh, Swapan K; Riyasdeen, Anvarbatcha; Akbarsha, Mohammad Abdulkader

    2017-09-01

    The water soluble mixed ligand complexes [Cu(nal)(diimine)(H 2 O)](ClO 4 ) 1-4, where H(nal) is nalidixic acid and diimine is 2,2'-bipyridine (1), 1,10-phenanthroline (2), 5,6-dimethyl-1,10-phenanthroline (3), and 3,4,7,8-tetramethyl-1,10-phenanthroline (4), have been isolated. The coordination geometry around Cu(II) in 1 and that in the Density Functional Theory optimized structures of 1-4 has been assessed as square pyramidal. The trend in DNA binding constants (K b ) determined using absorption spectral titration (K b : 1, 0.79±0.1base pair. In contrast, 3 and 4 are involved in intimate hydrophobic interaction with DNA through the methyl substituents on phen ring, which is supported by viscosity and protein binding studies. DNA docking studies imply that 4 is involved preferentially in DNA major groove binding while 1-3 in minor groove binding and that all the complexes, upon removing the axially coordinated water molecule, bind in the major groove. Interestingly, 3 and 4 display prominent double-strand DNA cleavage while 1 and 2 effect only single-strand DNA cleavage in the absence of an activator. The complexes 3 and 4 show cytotoxicity higher than 1 and 2 against human breast cancer cell lines (MCF-7). The complex 4 induces apoptotic mode of cell death in cancer cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. A Paper-Based Sandwich Format Hybridization Assay for Unlabeled Nucleic Acid Detection Using Upconversion Nanoparticles as Energy Donors in Luminescence Resonance Energy Transfer.

    Science.gov (United States)

    Zhou, Feng; Noor, M Omair; Krull, Ulrich J

    2015-09-24

    Bioassays based on cellulose paper substrates are gaining increasing popularity for the development of field portable and low-cost diagnostic applications. Herein, we report a paper-based nucleic acid hybridization assay using immobilized upconversion nanoparticles (UCNPs) as donors in luminescence resonance energy transfer (LRET). UCNPs with intense green emission served as donors with Cy3 dye as the acceptor. The avidin functionalized UCNPs were immobilized on cellulose paper and subsequently bioconjugated to biotinylated oligonucleotide probes. Introduction of unlabeled oligonucleotide targets resulted in a formation of probe-target duplexes. A subsequent hybridization of Cy3 labeled reporter with the remaining single stranded portion of target brought the Cy3 dye in close proximity to the UCNPs to trigger a LRET-sensitized emission from the acceptor dye. The hybridization assays provided a limit of detection (LOD) of 146.0 fmol and exhibited selectivity for one base pair mismatch discrimination. The assay was functional even in undiluted serum samples. This work embodies important progress in developing DNA hybridization assays on paper. Detection of unlabeled targets is achieved using UCNPs as LRET donors, with minimization of background signal from paper substrates owing to the implementation of low energy near-infrared (NIR) excitation.

  17. A Paper-Based Sandwich Format Hybridization Assay for Unlabeled Nucleic Acid Detection Using Upconversion Nanoparticles as Energy Donors in Luminescence Resonance Energy Transfer

    Science.gov (United States)

    Zhou, Feng; Noor, M. Omair; Krull, Ulrich J.

    2015-01-01

    Bioassays based on cellulose paper substrates are gaining increasing popularity for the development of field portable and low-cost diagnostic applications. Herein, we report a paper-based nucleic acid hybridization assay using immobilized upconversion nanoparticles (UCNPs) as donors in luminescence resonance energy transfer (LRET). UCNPs with intense green emission served as donors with Cy3 dye as the acceptor. The avidin functionalized UCNPs were immobilized on cellulose paper and subsequently bioconjugated to biotinylated oligonucleotide probes. Introduction of unlabeled oligonucleotide targets resulted in a formation of probe-target duplexes. A subsequent hybridization of Cy3 labeled reporter with the remaining single stranded portion of target brought the Cy3 dye in close proximity to the UCNPs to trigger a LRET-sensitized emission from the acceptor dye. The hybridization assays provided a limit of detection (LOD) of 146.0 fmol and exhibited selectivity for one base pair mismatch discrimination. The assay was functional even in undiluted serum samples. This work embodies important progress in developing DNA hybridization assays on paper. Detection of unlabeled targets is achieved using UCNPs as LRET donors, with minimization of background signal from paper substrates owing to the implementation of low energy near-infrared (NIR) excitation. PMID:28347081

  18. Formation and repair of gamma-ray induced nucleic acid base damage in bacteria and mammalian cells. Final report, September 1, 1973--August 31, 1976

    International Nuclear Information System (INIS)

    Cerutti, P.A.

    1976-01-01

    Results are summarized from a three-year study of the formation and repair of γ-ray induced thymine damage in bacteria and mammalian cells. A systematic study was made of the formation of a specific type of ionizing radiation induced base damage under in vivo conditions. Assay for the determination of γ-ray products of the 5,6-dihydroxy-dihydrothymine type (alkaline-acid degradation assay) and a method for the determination of the formation of 5-methylene-uracil radicals (formation of ( 3 H)H 2 O from thymine-methyl ( 3 H)) are discussed. The radiation-chemical reactivity of thymine decreased according to the following pattern in different biological systems: phi X174-DNA greater than E. coli DNA = phi X174 phage much greater than HeLa chromatin greater than E. coli cells greater than human fibroblasts WI-38. In WI-38 the efficiency of formation of 5-methylene-uracil radicals was 1.6 x 10 -3 per Krad and 10 6 daltons DNA and of products of the 5,6-dihydroxy-dihydrothymine type 0.54 x 10 -3 per Krad per 10 6 daltons DNA (uncorrected). It was concluded that γ-rays produce DNA single strand breaks and (total) base damage with comparable efficiencies under in vivo conditions in cultured cells. A list is included of 18 published papers that report the findings in detail

  19. The effect of gamma irradiation on the nucleic acids content of the mediterranean fruit fly ceratitis capitata (Wied)

    International Nuclear Information System (INIS)

    Fadel, A.M.; Amin, T.R.; Al-Elimi, M.H.

    1999-01-01

    This work was carried out study the effect of gamma irradiation on the deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) content in the whole body homogenate of the mediterranean fruit fly, ceratitis capitata (Wied.) pupae were gamma irradiated with different doses (o, 50, 70, 90 and 110 Gy) at two different pupal ages (2 and 4 days before adult emergence ) to estimate the nucleic acids in pupae and adult males, and females. Experimental results showed that gamma irradiation of pupae reduced RNA content, and this reduction was proportional with the applied dose and more pronounced in the younger pupae. However, DNA content was reduced only when the highest dose was applied to pupae irradiated 2 days before adult emergence (older pupae). Concerning adult insects which were gamma irradiated as pupae, the results revealed, generally, that males and females which were irradiated 2 days before adult emergence were more affected than those irradiated 4 days before adult emergence. The male DNA content and the female RNA content showed high degrees of reduction which, more or less, increased with increasing the dose used. On the other hand, female DNA and male RNA contents were slightly, changed. The significant importance of the results and some statistical interrelations were discussed

  20. In Vivo Genotoxic Evaluation of D-003, a Mixture of Very Long Chain Aliphatic Acids.

    Science.gov (United States)

    Gámez, Rafael; González, Jorge E.; Rodeiro, Idania; Fernández, Ivonne; Alemán, Celia; Rodríguez, María D.; Acosta, Pilar C.; García, Haydee

    2001-01-01

    D-003 is a mixture of very long chain aliphatic acids purified from sugar cane wax with cholesterol-lowering effects. The present study was undertaken to investigate the in vivo cytotoxic and genotoxic potential of D-003 using three established assays: bone marrow micronucleus, sperm morphology, and single cell gel electrophoresis (Comet) assay. In a first experimental series, CEN/NMRI mice (6-8 animals per sex per group) were administered D-003 by gastric gavage at 5, 50, or 500 mg/kg for 90 days, then sacrificed 24 hours after the last administration. The effects on bone marrow micronucleus were evaluated only in female mice. D-003 (5-500 mg/kg) did not increase the frequency of micronucleated polychromatic erythrocytes, nor the ratio of polychromatic to normochromatic erythrocytes, compared with the controls. The assessment of the effects on sperm morphology showed that D-003 did not change the sperm count or the frequency of all types of abnormal head shapes, compared with the controls. In a second series, the micronucleus assay was performed in mice of both sexes given 2,000 mg/kg for 6 days. Likewise, in this series, neither cytotoxic nor genotoxic effects were found. Finally, five male Sprague-Dawley rats were treated with D-003 (1,250 mg/kg) by oral gavage for 90 days, and Comet assay on liver cells was performed. No single-strand breaks or alkali-labile site induction on DNA was observed. These results indicate that D-003 does not show evidence of cytotoxic or genotoxic activity on either somatic or germ cells in rodents.