WorldWideScience

Sample records for single-stranded amplicons accessible

  1. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.

    1978-01-01

    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  2. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    Science.gov (United States)

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    accessible for use in microarrays to detect target single strands.

  3. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  4. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.

    1985-01-01

    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  5. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)

    student

    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  6. Improved single-strand DNA sizing accuracy in capillary electrophoresis.

    OpenAIRE

    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B

    1997-01-01

    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  7. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  8. Programmable autonomous synthesis of single-stranded DNA

    Science.gov (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

    2018-02-01

    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  9. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  10. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol

    2010-05-01

    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  11. Elastic properties of alternative versus single-stranded leveling archwires.

    Science.gov (United States)

    Rucker, Brian K; Kusy, Robert P

    2002-11-01

    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  12. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.

    1976-02-01

    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  13. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.

    1984-01-01

    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  14. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  15. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela

    2010-01-01

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  16. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2003-01-01

    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  17. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.

    OpenAIRE

    Barany, F; Boeke, J D

    1983-01-01

    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  18. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity.

    Science.gov (United States)

    Monnet, Jordan; Kozelka, Jiří

    2012-10-01

    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  20. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase.

    Science.gov (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias

    2017-06-02

    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi

    1990-01-01

    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  2. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der

    1988-01-01

    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  3. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.

    2002-01-01

    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit...

  4. Ion assisted structural collapse of a single stranded DNA: A molecular dynamics approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Soumadwip; Dixit, Himanshu; Chakrabarti, Rajarshi, E-mail: rajarshi@chem.iitb.ac.in

    2015-09-28

    Highlights: • The dynamics of a single-stranded DNA in presence of different concentrations of Mg{sup 2+} is investigated. • The initial DNA chain collapse is characterized by the formation of non-sequentially stacked base pairs. • The DNA chain re-swells at high concentrations of Mg{sup 2+} as a consequence of overcharging. - Abstract: The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counterions. It is well known that the structural collapse of DNA is favoured in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl{sub 2}) single stranded DNA with base sequence 5′-CGCGAATTCGCG-3′ (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  5. Dynamics of RecA filaments on single-stranded DNA

    NARCIS (Netherlands)

    Van Loenhout, M.T.J.; Van der Heijden, T.; Kanaar, R.; Wyman, C.; Dekker, C.

    2009-01-01

    RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on

  6. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2001-01-01

    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  7. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP

    1996-01-01

    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  8. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  9. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket.

    Science.gov (United States)

    Pham, Hanh T; Bergoin, Max; Tijssen, Peter

    2013-03-14

    The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  10. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket

    OpenAIRE

    Pham, Hanh T.; Bergoin, Max; Tijssen, Peter

    2013-01-01

    International audience; The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  11. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.

    1983-01-01

    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  12. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B

    2006-01-01

    by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  13. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud

    2012-06-01

    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  14. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.

    1985-01-01

    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  15. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    Science.gov (United States)

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  16. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.

    1982-01-01

    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  17. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    Science.gov (United States)

    Hong, Ka Lok

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  18. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification

    OpenAIRE

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-01-01

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen...

  19. In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides

    International Nuclear Information System (INIS)

    Oppenheim, Amos B.; Rattray, Alison J.; Bubunenko, Mikhail; Thomason, Lynn C.; Court, Donald L.

    2004-01-01

    We demonstrate that the bacteriophage λ Red functions efficiently recombine linear DNA or single-strand oligonucleotides (ss-oligos) into bacteriophage λ to create specific changes in the viral genome. Point mutations, deletions, and gene replacements have been created. While recombineering with oligonucleotides, we encountered other mutations accompanying the desired point mutational change. DNA sequence analysis suggests that these unwanted mutations are mainly frameshift deletions introduced during oligonucleotide synthesis

  20. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis.

    Science.gov (United States)

    Olszewski, Marcin; Mickiewicz, Małgorzata; Kur, Józef

    2008-07-01

    The thermophilic bacterium Thermoanaerobacter tengcongensis has two single-stranded DNA-binding (SSB) proteins, designated TteSSB2 and TteSSB3. In a SSB complementation assay in Escherichia coli, only TteSSB3 took over the in vivo function of EcoSSB. We have cloned the ssb genes obtained by PCR and have developed E. coli overexpression systems. The TteSSB2 and TteSSB3 consist of 153 and 150 amino acids with a calculated molecular mass of 17.29 and 16.96 kDa, respectively. They are the smallest known bacterial SSB proteins. The homology between amino acid sequences of these proteins is 40% identity and 53% similarity. They are functional as homotetramers, with each monomer encoding one single-stranded DNA binding domain (OB-fold). In fluorescence titrations with poly(dT), both proteins bind single-stranded DNA with a binding site size of about 40 nt per homotetramer. Thermostability with half-life of about 30 s at 95 degrees C makes TteSSB3 similar to the known SSB of Thermus aquaticus (TaqSSB). The TteSSB2 was fully active even after 6 h incubation at 100 degrees C. Here, we show for the first time paralogous thermostable homotetrameric SSBs, which could be an attractive alternative for known homodimeric thermostable SSB proteins in their applications for molecular biology methods and analytical purposes.

  1. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana.

    Science.gov (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L

    2005-04-01

    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  2. Intercalation of single-strand oligonucleotides between nucleolipid anionic membranes: a neutron diffraction study.

    Science.gov (United States)

    Milani, Silvia; Berti, Debora; Dante, Silvia; Hauss, Thomas; Baglioni, Piero

    2009-04-07

    This contribution presents a neutron diffraction investigation of anionic lamellar phases composed of mixtures of 1-palmitoyl, 2-oleoyl phosphatidyl-nucleosides (POPN, where N is either adenosine or uridine), and POPC (1-palmitoyl,2-oleoyl-phosphatidyl-choline). Their behavior is studied for two different mole ratios and in the presence of nucleic acids. The samples are formed by the evaporation of liposomal dispersions prepared in water or in solutions containing single-strand oligonucleotides. Previous small angle X-ray scattering (SAXS) experiments on the system POPA/polyU (polyuridylic acid, high degree of polymerization, synthetic ribonucleic acid) proved that the insertion and ordering of the biopolymer in the phospholipid lamellae were driven by molecular recognition. In the present study, we extend the previous investigation to single-strand monodisperse oligonucleotides (50-mers). Structural details of the membranes were obtained from the analysis of the neutron diffraction scattering length density profiles. The evidence of direct and specific interactions, driven by molecular recognition between the nucleic polar heads of the nucleolipid and the single-strand nucleic acid, is strengthened by the comparison with identically charged bilayers formed by POPG/POPC. These results contribute to the understanding of the parameters governing the interactions between nucleolipid membranes and oligonucleotides, providing a novel strategy for the design of lipid-based vehicles for nucleic acids.

  3. Stretching and controlled motion of single-stranded DNA in locally heated solid-state nanopores.

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B; Aksimentiev, Aleksei

    2013-08-27

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4-8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA.

  4. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA.

    Science.gov (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi

    2008-03-28

    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  5. Repair of ultraviolet light damage in Saccharomyces cerevisiae as studied with double- and single-stranded incoming DNAs

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, D.; Hieda, K.

    1992-01-01

    Purified double- and single-stranded DNAs of the autonomously replicating vector M13RK9-T were irradiated with ultraviolet light (UV) in vitro and introduced into competent whole cells of Saccharomyces cerevisiae. Incoming double-stranded DNA was more sensitive to UV in excision repair-deficient rad2-1 cells than in proficient repair RAD + cells, while single-stranded DNA exhibited high sensitivity in both host cells. The results indicate that in yeast there is no effective rescue of UV-incoming single-stranded DNA by excision repair or other constitutive dark repair processes

  6. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks.

    Science.gov (United States)

    Pachkowski, Brian; Nakamura, Jun

    2013-01-01

    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  7. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.

    1980-01-01

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  8. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth

    2014-01-01

    . We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices......Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells...

  9. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela

    2015-01-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  10. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted

    2014-01-01

    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  11. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams

    2014-01-01

    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  12. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng

    2015-05-08

    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  13. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    Science.gov (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora.

    Science.gov (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E

    2003-08-01

    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  15. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Science.gov (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  16. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification.

    Science.gov (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-10-07

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  17. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)

    2012-04-04

    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  18. Empirical model for matching spectrophotometric reflectance of yarn windings and multispectral imaging reflectance of single strands of yarns.

    Science.gov (United States)

    Luo, Lin; Shen, Hui-Liang; Shao, Si-Jie; Xin, John

    2015-08-01

    The state-of-the-art multispectral imaging system can directly acquire the reflectance of a single strand of yarn that is impossible for traditional spectrophotometers. Instead, the spectrophotometric reflectance of a yarn winding, which is constituted by yarns wound on a background card, is regarded as the yarn reflectance in textile. While multispectral imaging systems and spectrophotometers can be separately used to acquire the reflectance of a single strand of yarn and corresponding yarn winding, the quantitative relationship between them is not yet known. In this paper, the relationship is established based on models that describe the spectral response of a spectrophotometer to a yarn winding and that of a multispectral imaging system to a single strand of yarn. The reflectance matching function from a single strand of yarn to corresponding yarn winding is derived to be a second degree polynomial function, which coefficients are the solutions of a constrained nonlinear optimization problem. Experiments on 100 pairs of samples show that the proposed approach can reduce the color difference between yarn windings and single strands of yarns from 2.449 to 1.082 CIEDE2000 units. The coefficients of the optimal reflection matching function imply that the reflectance of a yarn winding measured by a spectrophotometer consists of not only the intrinsic reflectance of yarn but also the nonignorable interreflection component between yarns.

  19. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  20. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan

    2015-01-01

    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  1. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik

    1992-04-01

    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  2. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.

    1987-01-01

    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  3. Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Gust, I.D.; Feinstone, S.M.; Purcell, R.H.; Alter, H.J.

    1980-01-01

    A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

  4. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata).

    Science.gov (United States)

    Jackson, Elliot W; Bistolas, Kalia S I; Button, Jason B; Hewson, Ian

    2016-01-01

    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates.

  5. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.

    1980-01-01

    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  6. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux

    2016-12-01

    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  7. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  8. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif

    Science.gov (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  9. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  10. (SELAX strain) B2 amplicon

    African Journals Online (AJOL)

    USER

    2010-07-12

    Jul 12, 2010 ... Restriction enzyme digests of the clones suggested that the cloned portion of the B2 amplicon was 16 kb. Key words: B2 gene, A2B2 esterase, insecticide resistance. INTRODUCTION. Organophosphate resistance in Culex pipiens complex mosquitoes has been shown to be correlated with the presence of ...

  11. Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1

    DEFF Research Database (Denmark)

    Yang, Jay; Bachrati, Csanad Z; Ou, Jiongwen

    2010-01-01

    -passage mechanism. We generated single-stranded catenanes that resemble the proposed dissolution intermediate recognized by human topoisomerase IIIalpha. We demonstrate that human topoisomerase IIIalpha is a single-stranded DNA decatenase that is specifically stimulated by the BLM-RMI1 pair. In addition, RMI1......Human topoisomerase IIIalpha is a type IA DNA topoisomerase that functions with BLM and RMI1 to resolve DNA replication and recombination intermediates. BLM, human topoisomerase IIIalpha, and RMI1 catalyze the dissolution of double Holliday junctions into noncrossover products via a strand...

  12. Removing Noise From Pyrosequenced Amplicons

    Directory of Open Access Journals (Sweden)

    Davenport Russell J

    2011-01-01

    Full Text Available Abstract Background In many environmental genomics applications a homologous region of DNA from a diverse sample is first amplified by PCR and then sequenced. The next generation sequencing technology, 454 pyrosequencing, has allowed much larger read numbers from PCR amplicons than ever before. This has revolutionised the study of microbial diversity as it is now possible to sequence a substantial fraction of the 16S rRNA genes in a community. However, there is a growing realisation that because of the large read numbers and the lack of consensus sequences it is vital to distinguish noise from true sequence diversity in this data. Otherwise this leads to inflated estimates of the number of types or operational taxonomic units (OTUs present. Three sources of error are important: sequencing error, PCR single base substitutions and PCR chimeras. We present AmpliconNoise, a development of the PyroNoise algorithm that is capable of separately removing 454 sequencing errors and PCR single base errors. We also introduce a novel chimera removal program, Perseus, that exploits the sequence abundances associated with pyrosequencing data. We use data sets where samples of known diversity have been amplified and sequenced to quantify the effect of each of the sources of error on OTU inflation and to validate these algorithms. Results AmpliconNoise outperforms alternative algorithms substantially reducing per base error rates for both the GS FLX and latest Titanium protocol. All three sources of error lead to inflation of diversity estimates. In particular, chimera formation has a hitherto unrealised importance which varies according to amplification protocol. We show that AmpliconNoise allows accurate estimates of OTU number. Just as importantly AmpliconNoise generates the right OTUs even at low sequence differences. We demonstrate that Perseus has very high sensitivity, able to find 99% of chimeras, which is critical when these are present at high

  13. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.

    1988-01-01

    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  14. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.

    2012-01-01

    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  15. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues

    Science.gov (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak

    2006-01-01

    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  16. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes

    Science.gov (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.

    2015-01-01

    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  17. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos

    2015-09-01

    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  18. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair

    Science.gov (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.

    2009-01-01

    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  19. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-05

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity*

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.

    2015-01-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  1. Substrate-assisted 2D DNA lattices and algorithmic lattices from single-stranded tiles.

    Science.gov (United States)

    Kim, Junghoon; Ha, Tai Hwan; Park, Sung Ha

    2015-08-07

    We present a simple route to circumvent kinetic traps which affect many types of DNA nanostructures in their self-assembly process. Using this method, a new 2D DNA lattice made up of short, single-stranded tile (SST) motifs was created. Previously, the growth of SST DNA assemblies was restricted to 1D (tubes and ribbons) or finite-sized 2D (molecular canvases). By utilizing the substrate-assisted growth method, sets of SSTs were designed as unit cells to self-assemble into periodic and aperiodic 2D lattices which continuously grow both along and orthogonal to the helical axis. Notably, large-scale (∼1 μm(2)) fully periodic 2D lattices were fabricated using a minimum of just 2 strand species. Furthermore, the ability to create 2D lattices from a few motifs enables certain rules to be encoded into these SSTs to carry out algorithmic self-assembly. A set of these motifs was designed to execute simple 1-input 1-output COPY and NOT algorithms, the space-time manifestations which were aperiodic 2D algorithmic SST lattices. The methodology presented here can be straightforwardly applied to other motifs which fall into this type of kinetic trap to create novel DNA crystals.

  2. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.

    2007-01-01

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  3. Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems.

    Science.gov (United States)

    Musumeci, Domenica; Rozza, Lucia; Merlino, Antonello; Paduano, Luigi; Marzo, Tiziano; Massai, Lara; Messori, Luigi; Montesarchio, Daniela

    2015-08-21

    The interaction of the anticancer Ru(iii) complex AziRu - in comparison with its analogue NAMI-A, currently in advanced clinical trials as an antimetastatic agent - with DNA model systems, both single stranded and duplex oligonucleotides, was investigated using a combined approach, including absorption UV-vis spectroscopy, circular dichroism (CD) and electrospray mass spectrometry (ESI-MS) techniques. UV-vis absorption spectra of the Ru complexes were recorded at different times in a pseudo-physiological solution, to monitor the ligand exchange processes in the absence and in the presence of the examined oligonucleotides. CD experiments provided information on the overall conformational changes of the DNA model systems induced by these metal complexes. UV- and CD-monitored thermal denaturation studies were performed to analyse the effects of AziRu and NAMI-A on the stability of the duplex structures. ESI-MS experiments, carried out on the oligonucleotide/metal complex mixtures under investigation, allowed us to detect the formation of stable adducts between the guanine-containing oligomers and the ruthenium complexes. These data unambiguously demonstrate that both AziRu and NAMI-A can interact with the DNA model systems. Although very similar in their structures, the two metal compounds manifest a markedly different reactivity with the examined sequences, respectively, with either a naked Ru(3+) ion or a Ru(Im)(3+) (Im = imidazole) fragment being incorporated into the oligonucleotide structure via stable linkages.

  4. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop.

    Science.gov (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S

    2009-05-01

    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  5. Biophysical characterization of the association of histones with single-stranded DNA.

    Science.gov (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier

    2017-11-01

    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong

    2008-01-01

    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  7. Effect of Conformational Entropy on the Nanomechanics of Microcantilever-Based Single-Stranded DNA Sensors

    Directory of Open Access Journals (Sweden)

    Zou-Qing Tan

    2014-09-01

    Full Text Available An entropy-controlled bending mechanism is presented to study the nanomechanics of microcantilever-based single-stranded DNA (ssDNA sensors. First; the conformational free energy of the ssDNA layer is given with an improved scaling theory of thermal blobs considering the curvature effect; and the mechanical energy of the non-biological layer is described by Zhang’s two-variable method for laminated beams. Then; an analytical model for static deflections of ssDNA microcantilevers is formulated by the principle of minimum energy. The comparisons of deflections predicted by the proposed model; Utz–Begley’s model and Hagan’s model are also examined. Numerical results show that the conformational entropy effect on microcantilever deflections cannot be ignored; especially at the conditions of high packing density or long chain systems; and the variation of deflection predicted by the proposed analytical model not only accords with that observed in the related experiments qualitatively; but also appears quantitatively closer to the experimental values than that by the preexisting models. In order to improve the sensitivity of static-mode biosensors; it should be as small as possible to reduce the substrate stiffness.

  8. In vitro selection and characterization of single stranded DNA aptamers for luteolin: A possible recognition tool.

    Science.gov (United States)

    Tuma Sabah, Jinan; Zulkifli, Razauden Mohamed; Shahir, Shafinaz; Ahmed, Farediah; Abdul Kadir, Mohammed Rafiq; Zakaria, Zarita

    2018-03-06

    Distinctive bioactivities possessed by luteolin (3', 4', 5, 7-tetrahydroxy-flavone) are advantageous for sundry practical applications. This paper reports the in vitro selection and characterization of single stranded-DNA (ssDNA) aptamers, specific for luteolin (LUT). 76-mer library containing 1015 randomized ssDNA were screened via systematic evolution of ligands by exponential enrichment (SELEX). The recovered ssDNA pool from the 8th round was amplified with unlabeled primers and cloned into PSTBlue-1 vector prior to sequencing. 22 of LUT-binding aptamer variants were further classified into one of the seven groups based on their N40 random sequence regions, wherein one representative from each group was characterized. The dissociation constant of aptamers designated as LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively with high binding affinity towards LUT. Prediction analysis of the secondary structure suggested discrete features with typical loop and stem motifs. Furthermore, LUT#3 displayed higher specificity with insignificant binding toward kaempferol and quercetin despite its structural and functional similarity compared to LUT#28 and LUT#20. Further LUT#3 can detect free luteolin within 0.2-1 mM in solution. It was suggested that LUT#3 aptamer were the most suitable for LUT recognition tool at laboratory scale based on the condition tested. Copyright © 2018. Published by Elsevier Inc.

  9. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska

    2017-12-01

    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  10. Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages.

    Science.gov (United States)

    Kodaira, K; Godson, N G; Taketo, A

    1995-01-25

    The minus origins for complementary strand DNA synthesis (-ori) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, phi K, alpha 3, and St-1 closely resemble each other in DNA structure and contain two potential secondary hairpin loops (I and II) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the -ori regions of phi K and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the phi K mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several phi K and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway.

  11. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.

    1985-01-01

    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  12. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  13. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.

    1987-01-01

    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  14. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks.

    Science.gov (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P

    2012-09-01

    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  15. Multiplex PCR, amplicon size and hybridization efficiency on the NanoChip electronic microarray

    DEFF Research Database (Denmark)

    Børsting, Claus; Sanchez, Juan J; Morling, Niels

    2004-01-01

    . Hybridization to individual amplicons in multiplexes was less efficient suggesting that intramolecular and intermolecular interactions may block access to the target sequence on the NanoChip array. We observed a high risk of contamination with amplicons shorter than 60 bp and therefore, we recommend the use...

  16. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani

    2006-09-01

    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  17. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W

    2009-12-23

    Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation

  18. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  19. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.

    1995-01-01

    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  20. Distinct circular single-stranded DNA viruses exist in different soil types.

    Science.gov (United States)

    Reavy, Brian; Swanson, Maud M; Cock, Peter J A; Dawson, Lorna; Freitag, Thomas E; Singh, Brajesh K; Torrance, Lesley; Mushegian, Arcady R; Taliansky, Michael

    2015-06-15

    The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  1. A high throughput system for the preparation of single stranded templates grown in microculture.

    Science.gov (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M

    1994-01-01

    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  2. Complex shapes self-assembled from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng

    2012-05-30

    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  3. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)

    1994-09-01

    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  4. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  5. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

    Science.gov (United States)

    Richardson, Tomas T; Harran, Omar; Murray, Heath

    2016-06-16

    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

  6. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses.

    Science.gov (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn

    2011-06-01

    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  7. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  8. Simultaneous analysis of multiple PCR amplicons enhances capillary SSCP discrimination of MHC alleles.

    Science.gov (United States)

    Alcaide, Miguel; López, Lidia; Tanferna, Alessandro; Blas, Julio; Sergio, Fabrizio; Hiraldo, Fernando

    2010-04-01

    Major histocompatibility complex (MHC) genotyping still remains one of the most challenging issues for evolutionary ecologists. To date, none of the proposed methods have proven to be perfect, and all provide both important pros and cons. Although denaturing capillary electrophoresis has become a popular alternative, allele identification commonly relies upon conformational polymorphisms of two single-stranded DNA molecules at the most. Using the MHC class II (beta chain, exon 2) of the black kite (Aves: Accipitridae) as our model system, we show that the simultaneous analysis of overlapping PCR amplicons from the same target region substantially enhances allele discrimination. To cover this aim, we designed a multiplex PCR capable to generate four differentially sized and labeled amplicons from the same allele. Informative peaks to assist allele calling then fourfold those generated by the analysis of single PCR amplicons. Our approach proved successful to differentiate all the alleles (N=13) isolated from eight unrelated birds at a single optimal run temperature and electrophoretic conditions. In particular, we emphasize that this approach may constitute a straightforward and cost-effective alternative for the genotyping of single or duplicated MHC genes displaying low to moderate sets of divergent alleles.

  9. Electrical conduction and photoresponses of gamma-ray-irradiated single-stranded DNA/single-walled carbon nanotube composite systems

    Energy Technology Data Exchange (ETDEWEB)

    Hong, W.; Lee, E.M.; Kim, D.W.; Lee, Cheol Eui, E-mail: rscel@korea.ac.kr

    2015-04-15

    Highlights: •Effects of gamma-ray irradiation on single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. •Barrier for thermally activated conduction in the composite systems modified by the gamma-ray irradiation. •Photoresponses reveal photoexcitation and oxygen photodesorption modified by gamma-ray irradiation. -- Abstract: Effects of gamma-ray irradiation on the electrical conductivity and photoresponse have been studied for single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. The temperature-dependent electrical conductivity of the ssDNA/SWNT composite films, well described by a fluctuation-induced tunneling model, indicated modification of the barrier for thermally activated conduction by the gamma-ray irradiation. Besides, the photoresponse measurements indicated modified photoexcited charge carrier generation and oxygen photodesorption in the composite systems due to the gamma-ray irradiation.

  10. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.

    2006-01-01

    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  11. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    Science.gov (United States)

    2014-09-30

    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  12. Selective binding and reverse transcription inhibition of single-strand poly(A) RNA by metal TMPyP complexes.

    Science.gov (United States)

    Zhou, Zhu-Xin; Gao, Feng; Chen, Xing; Tian, Xiang-Jing; Ji, Liang-Nian

    2014-10-06

    Ni-, Cu-, and Zn-TMPyP are capable of binding to single-strand poly(A) RNA with high preference and affinity and inhibiting the reverse transcription of RNA by both M-MuLV and HIV-1 reverse transcriptase. With 10 nM azidothymidine, the IC50 value of M-TMPyP could be lowered to 10(-1) μM order.

  13. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.

    2013-01-01

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  14. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.

    1977-01-01

    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  15. The Adsorption of Short Single-Stranded DNA Oligomers on Mineral Surfaces

    Science.gov (United States)

    Kopstein, M.; Sverjensky, D. A.; Hazen, R. M.; Cleaves, H. J.

    2009-12-01

    Previous studies have described feasible pathways for the synthesis of simple organic building blocks such as formaldehyde and hydrogen cyanide, and their reaction to form more complex biomolecules such as nucleotide bases, amino acids and sugars (Miller and Orgel 1974, Miller and Cleaves 2006). However, the polymerization of monomers into a useful genetic material remains problematic (Orgel 2004). Organic building blocks were unlikely to polymerize from very dilute aqueous solution in the primitive oceans. Mineral surface adsorption has been suggested as a possible mechanism for concentrating the necessary building blocks (Bernal 1951). This study focused on the adsorption behavior of single-stranded DNA homo-oligomers of adenine and thymine (including the monomers, dimers, tetramers, hexamers, octomers, and decamers) with five different mineral surfaces (pyrite, rutile, hematite, olivine and calcite). Adsorption was studied in 0.1 M pH 8.1 KHCO3 with0.05 M NaCl as background electrolyte. Solutions were mixed for 24 hours at room temperature, centrifuged and the supernatants analyzed by UV/visible spectrophotometry. Equilibrium solution concentrations were measured and used to determine the number of moles adsorbed per square meter. Langmuir isotherms were constructed using the experimental data. It was found that adenine-containing molecules tend to bind much more strongly than thymine-containing molecules. It was also found that the number of moles adsorbed at saturation tends to fall with increasing chain length, while adsorption affinity tends to rise. Oligomer length appears to affect adsorption more than the mineral type. These results may have implications for the primordial organization of the first nucleic acid molecules as the persistence of extra-cellular nucleic acids in the environment. References Bernal, J. D. (1951) The Physical Basis of Life (Routledge, London). Miller S.L. and Cleaves, H.J. (2006) Prebiotic chemistry on the primitive Earth. In

  16. Role of electrostatics in the assembly pathway of a single-stranded RNA virus.

    Science.gov (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M

    2014-09-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  17. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids.

    Science.gov (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R

    2015-04-08

    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  18. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong

    2011-04-01

    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  19. Pregnancy-associated glycoprotein (PAG) family: transcripts and gene amplicons in camelids.

    Science.gov (United States)

    Majewska, Marta; Panasiewicz, Grzegorz; Klisch, Karl; Olivera, Louis V M; Mamani, Javier M; Abd-Elnaeim, Mahmoud M; Szafranska, Bozena

    2009-07-01

    In this study, the placental localization of PAG-like transcripts and genomic existence of PAG-like amplicons in new-world (Lp, Lama pacos, alpaca) and old-world camelids (Cb, Camelus bactrianus, bactrian; Cd, Camelus dromedarius; dromedary) are reported for the first time. Sections of Lp (150-347 days post coitum), Cd (43-90 cm crown-rump length) and Cb (term) placentas were used for heterologous (ht; cross-species) autoradiographic in situ hybridization (aISH) with single-stranded diagnostic (antisense) or control (sense) [alpha-(35)S]dATP-labeled 323 nt porcine PAG8 (pPAG8) cDNA probes produced by asymmetric PCRs. The aISH with antisense (35)S-pPAG8 probe identified camelid PAG-like (LpPAG, CbPAG and CdPAG) mRNA expression restricted to chorionic epithelium cells within placentas of camelids. In addition, genomic DNA (gDNA), isolated from placental sections were used as templates for camelid PAG-like gene amplicon production by PCR. Specificity of the obtained multiple camelid gDNA PAG-like amplicons was confirmed by double ht-Southern hybridizations with [alpha-(32)P]dATP-labeled 611 bp pPAG5 and pPAG10 double-stranded cDNA probes. The double ht-Southern hybridizations of camelid gDNA amplicons (with pPAG5 and -10 probes) allowed the identification of length-polymorphism of LpPAG, CbPAG and CdPAG genes, coding catalytically active and potentially inactive forms. Such an application of porcine PAG probes may be advantageous for future identification of still undiscovered PAG-like families in other eutherian species.

  20. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes

    OpenAIRE

    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  1. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris

    2016-01-01

    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA-binding pro......Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...... leads to enhanced cooperative binding to DNA.Conclusions: Our findings contribute to the emerging picture that bacterial proteins, exemplified here by SsbA, undergo phosphorylation at multiple residues. This results in a complex regulation of cellular functions, and suggests that the complexity...

  2. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  3. Development of an Interaction Assay between Single-Stranded Nucleic Acids Trapped with Silica Particles and Fluorescent Compounds

    Directory of Open Access Journals (Sweden)

    R. Maeda

    2012-09-01

    Full Text Available Biopolymers are easily denatured by heating, a change in pH or chemical substances when they are immobilized on a substrate. To prevent denaturation of biopolymers, we developed a method to trap a polynucleotide on a substrate by hydrogen bonding using silica particles with surfaces modified by aminoalkyl chains ([A-AM silane]/SiO2. [A-AM silane]/SiO2 was synthesized by silane coupling reaction of N-2-(aminoethyl-3-aminopropyltrimethoxysilane (A-AM silane with SiO2 particles with a diameter of 5 μm at 100 °C for 20 min. The surface chemical structure of [A-AM silane]/SiO2 was characterized by Fourier transform infrared spectroscopy and molecular orbital calculations. The surface of the silica particles was modified with A-AM silane and primary amine groups were formed. [A-AM silane]/SiO2 was trapped with single-stranded nucleic acids [(Poly-X; X = A (adenine, G (guanine and C (cytosine] in PBS solution at 37 °C for 1 h. The single-stranded nucleic acids were trapped on the surface of the [A-AM silane]/SiO2 by hydrogen bonding to form conjugated materials. The resulting complexes were further conjugated by derivatives of acridine orange (AO as fluorescent labels under the same conditions to form [AO:Poly-X:A-AM silane]/SiO2 complexes. Changes in the fluorescence intensity of these complexes originating from interactions between the single-stranded nucleic acid and aromatic compounds were also evaluated. The change in intensity displayed the order [AO: Poly-G: A-AM silane]/SiO2 > [AO:Poly-A:A-AM silane]/SiO2 >> [AO:Poly-C:A-AM silane]/SiO2. This suggests that the single-stranded nucleic acids conjugated with aminoalkyl chains on the surfaces of SiO2 particles and the change in fluorescence intensity reflected the molecular interaction between AO and the nucleic-acid base in a polynucleotide.

  4. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide

    Science.gov (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio

    1998-01-01

    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  5. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism.

    Science.gov (United States)

    Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong

    2016-07-01

    A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.

  6. Characterization of the single-stranded DNA binding protein pV(VGJΦ) of VGJΦ phage from Vibrio cholerae.

    Science.gov (United States)

    Falero, Alina; Caballero, Andy; Trigueros, Sonia; Pérez, Celso; Campos, Javier; Marrero, Karen; Fando, Rafael

    2011-09-01

    pV(VGJΦ), a single-stranded DNA binding protein of the vibriophage VGJΦ was subject to biochemical analysis. Here, we show that this protein has a general affinity for single-stranded DNA (ssDNA) as documented by Electrophoretic Mobility Shift Assay (EMSA). The apparent molecular weight of the monomer is about 12.7kDa as measured by HPLC-SEC. Moreover, isoelectrofocusing showed an isoelectric point for pV(VGJΦ) of 6.82 pH units. Size exclusion chromatography in 150mM NaCl, 50mM sodium phosphate buffer, pH 7.0 revealed a major protein species of 27.0kDa, suggesting homodimeric protein architecture. Furthermore, pV(VGJΦ) binds ssDNA at extreme temperatures and the complex was stable after extended incubation times. Upon frozen storage at -20°C for a year the protein retained its integrity, biological activity and oligomericity. On the other hand, bioinformatics analysis predicted that pV(VGJΦ) protein has a disordered C-terminal, which might be involved in its functional activity. All the aforementioned features make pV(VGJΦ) interesting for biotechnological applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles.

    Science.gov (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng

    2015-11-21

    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  8. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  9. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.

    1978-01-01

    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  10. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail: meicun2006@163.com; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

    2016-12-01

    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  11. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  12. Highly stable triple helix formation by homopyrimidine (l)-acyclic threoninol nucleic acids with single stranded DNA and RNA

    DEFF Research Database (Denmark)

    Kumar, Vipin; Kesavan, Venkitasamy; Gothelf, Kurt Vesterager

    2015-01-01

    Acyclic (l)-threoninol nucleic acid (aTNA) containing thymine, cytosine and adenine nucleobases were synthesized and shown to form surprisingly stable triplexes with complementary single stranded homopurine DNA or RNA targets. The triplex structures consist of two (l)-aTNA strands and one DNA...... or RNA, and these triplexes are significantly stronger than the corresponding DNA or RNA duplexes as shown in competition experiments. As a unique property the (l)-aTNAs exclusively form triplex structures with DNA and RNA and no duplex structures are observed by gel electrophoresis. The results were...... compared to the known enantiomer (d)-aTNA, which forms much weaker triplexes depending upon temperature and time. It was demonstrated that (l)-aTNA triplexes are able to stop primer extension on a DNA template, showing the potential of (l)-aTNA for antisense applications....

  13. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample.

    Science.gov (United States)

    Cui, Lunbiao; Wu, Binyao; Zhu, Xiaojuan; Guo, Xiling; Ge, Yiyue; Zhao, Kangchen; Qi, Xian; Shi, Zhiyang; Zhu, Fengcai; Sun, Lixin; Zhou, Minghao

    2017-11-01

    Metagenomic analysis through high-throughput sequencing is a tool for detecting both known and novel viruses. Using this technique, a novel circular single-stranded DNA (ssDNA) virus genome was discovered in respiratory secretions from a febrile traveler. The virus, named human respiratory-associated PSCV-5-like virus (HRAPLV), has a genome comprising 3,018 bases, with two major putative ORFs inversely encoding capsid (Cap) and replicase (Rep) protein and separated by two intergenic regions. One stem-loop structure was predicted in the larger intergenic region (LIR). The predicted amino acid sequences of the Cap and Rep proteins of HRAPLV showed highest identity to those of porcine stool-associated circular virus 5 isolate CP3 (PoSCV 5) (53.0% and 48.9%, respectively). The host tropism of the virus is unknown, and further study is warranted to determine whether this novel virus is associated with human disease.

  14. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Vrushali S. [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Gokhale, Suresh P.; Patil, Kashinath R. [Physical and Material Chemistry Division, National Chemical Laboratory, Pune (India); Haram, Santosh K., E-mail: haram@chem.unipune.ernet.i [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)

    2010-02-15

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 +- 2 mum and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, alpha-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k{sup 0}) and electron transfer coefficient (alpha) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  15. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    International Nuclear Information System (INIS)

    Joshi, Vrushali S.; Gokhale, Suresh P.; Patil, Kashinath R.; Haram, Santosh K.

    2010-01-01

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 ± 2 μm and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, α-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k 0 ) and electron transfer coefficient (α) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  16. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  17. Quenching of Single-Walled Carbon Nanotube Fluorescence by Dissolved Oxygen Reveals Selective Single-Stranded DNA Affinities.

    Science.gov (United States)

    Zheng, Yu; Bachilo, Sergei M; Weisman, R Bruce

    2017-05-04

    The selective interactions between short oligomers of single-stranded DNA (ssDNA) and specific structures of single-walled carbon nanotubes have been exploited in powerful methods for nanotube sorting. We report here that nanotubes coated with ssDNA also display selective interactions through the selective quenching of nanotube fluorescence by dissolved oxygen. In aqueous solutions equilibrated under 1 atm of O 2 , emission intensity from semiconducting nanotubes is reduced by between 9 and 40%, varying with the combination of ssDNA sequence and nanotube structure. This quenching reverses promptly and completely on the removal of dissolved O 2 and may be due to physisorption on nanotube surfaces. Fluorescence quenching offers a simple, nondestructive approach for studying the structure-selective interactions of ssDNA with single-walled carbon nanotubes and identifying recognition sequences.

  18. Surface treatment on amorphous InGaZnO4 thin film for single-stranded DNA biosensing

    Science.gov (United States)

    Sun, Dali; Matsui, Hiroaki; Wu, Chun-Nan; Tabata, Hitoshi

    2015-01-01

    Amorphous InGaZnO4 (aIGZO) has been widely used as a transparent semiconductor. However, no research has been found yet applying aIGZO to biosensing. This paper examined the single strand DNA (ssDNA) immobilization on aIGZO by absorption with a comparison to ITO, which is the first step for many biosensing schemas. The DNA quantification by florescence intensity shows that the absorption capacity of aIGZO film to ssDNA is 6.7 times greater than that of ITO. XPS and contact angle analysis proved the high DNA absorption affinity on aIGZO film is related to its high effectiveness to OH- attachment. A feasible method to immobilized ssDNA on aIGZO thin film is evaluated in this paper, and consequently, enables a possible approach to apply aIGZO in biosensing.

  19. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol

    2013-01-01

    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  20. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana.

    Science.gov (United States)

    Olszewski, Marcin; Grot, Anna; Wojciechowski, Marek; Nowak, Marta; Mickiewicz, Małgorzata; Kur, Józef

    2010-10-15

    In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. We report the characterization of single-stranded DNA binding proteins (SSBs) from the thermophilic bacteria Thermotoga maritima (TmaSSB) and Thermotoga neapolitana (TneSSB). They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively). They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold) in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC) the melting temperature (Tm) was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR).

  1. Charge enhancement of single-stranded DNA in negative electrospray ionization using the supercharging reagent meta-nitrobenzyl alcohol.

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1% m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1% m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  2. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  3. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB).

    Science.gov (United States)

    van Loon, Barbara; Samson, Leona D

    2013-03-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  4. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata

    2010-10-01

    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  5. Aptamer based voltammetric determination of ampicillin using a single-stranded DNA binding protein and DNA functionalized gold nanoparticles.

    Science.gov (United States)

    Wang, Jun; Ma, Kui; Yin, Huanshun; Zhou, Yunlei; Ai, Shiyun

    2017-12-20

    An aptamer based method is described for the electrochemical determination of ampicillin. It is based on the use of DNA aptamer, DNA functionalized gold nanoparticles (DNA-AuNPs), and single-stranded DNA binding protein (ssDNA-BP). When the aptamer hybridizes with the target DNA on the AuNPs, the ssDNA-BP is captured on the electrode surface via its specific interaction with ss-DNA. This results in a decreased electrochemical signal of the redox probe Fe(CN) 6 3- which is measured best at a voltage of 0.188 mV (vs. reference electrode). In the presence of ampicillin, the formation of aptamer-ampicillin conjugate blocks the further immobilization of DNA-AuNPs and ssDNA-BP, and this leads to an increased response. The method has a linear reposne that convers the 1 pM to 5 nM ampicillin concentration range, with a 0.38 pM detection limit (at an S/N ratio of 3). The assay is selective, stable and reproducible. It was applied to the determination of ampicillin in spiked milk samples where it gave recoveries ranging from 95.5 to 105.5%. Graphical abstract Schematic of a simple and sensitive electrochemical apta-biosensor for ampicillin detection. It is based on the use of gold nanoparticles (AuNPs), DNA aptamer, DNA functionalized AuNPs (DNA-AuNPs), and single-strand DNA binding protein (SSBP).

  6. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.

    1994-01-01

    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  7. Genetic evidence for single-strand lesions initiating Nbs1-dependent homologous recombination in diversification of Ig v in chicken B lymphocytes.

    Directory of Open Access Journals (Sweden)

    Makoto Nakahara

    2009-01-01

    Full Text Available Homologous recombination (HR is initiated by DNA double-strand breaks (DSB. However, it remains unclear whether single-strand lesions also initiate HR in genomic DNA. Chicken B lymphocytes diversify their Immunoglobulin (Ig V genes through HR (Ig gene conversion and non-templated hypermutation. Both types of Ig V diversification are initiated by AID-dependent abasic-site formation. Abasic sites stall replication, resulting in the formation of single-stranded gaps. These gaps can be filled by error-prone DNA polymerases, resulting in hypermutation. However, it is unclear whether these single-strand gaps can also initiate Ig gene conversion without being first converted to DSBs. The Mre11-Rad50-Nbs1 (MRN complex, which produces 3' single-strand overhangs, promotes the initiation of DSB-induced HR in yeast. We show that a DT40 line expressing only a truncated form of Nbs1 (Nbs1(p70 exhibits defective HR-dependent DSB repair, and a significant reduction in the rate--though not the fidelity--of Ig gene conversion. Interestingly, this defective gene conversion was restored to wild type levels by overproduction of Escherichia coli SbcB, a 3' to 5' single-strand-specific exonuclease, without affecting DSB repair. Conversely, overexpression of chicken Exo1 increased the efficiency of DSB-induced gene-targeting more than 10-fold, with no effect on Ig gene conversion. These results suggest that Ig gene conversion may be initiated by single-strand gaps rather than by DSBs, and, like SbcB, the MRN complex in DT40 may convert AID-induced lesions into single-strand gaps suitable for triggering HR. In summary, Ig gene conversion and hypermutation may share a common substrate-single-stranded gaps. Genetic analysis of the two types of Ig V diversification in DT40 provides a unique opportunity to gain insight into the molecular mechanisms underlying the filling of gaps that arise as a consequence of replication blocks at abasic sites, by HR and error

  8. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian

    2012-07-06

    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  9. Identification and characterization of single-stranded DNA-binding protein from the facultative psychrophilic bacteria Pseudoalteromonas haloplanktis.

    Science.gov (United States)

    Olszewski, Marcin; Nowak, Marta; Cyranka-Czaja, Anna; Kur, Józef

    2014-01-01

    Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism such as DNA replication, repair, and recombination, and is essential for cell survival. This study reports on the ssb-like gene cloning, gene expression and characterization of a single-stranded DNA-binding protein of Pseudoalteromonas haloplanktis (PhaSSB) and is the first report of such a protein from psychrophilic microorganism. PhaSSB possesses a high sequence similarity to Escherichia coli SSB (48% identity and 57% similarity) and has the longest amino acid sequence (244 amino acid residues) of all the known bacterial SSBs with one OB-fold per monomer. An analysis of purified PhaSSB by means of chemical cross-linking experiments, sedimentation analysis and size exclusion chromatography revealed a stable tetramer in solution. Using EMSA, we characterized the stoichiometry of PhaSSB complexed with a series of ssDNA homopolymers, and the size of the binding site was determined as being approximately 35 nucleotides long. In fluorescence titrations, the occluded site size of PhaSSB on poly(dT) is 34 nucleotides per tetramer under low-salt conditions (2mM NaCl), but increases to 54-64 nucleotides at higher-salt conditions (100-300mM NaCl). This suggests that PhaSSB undergoes a transition between ssDNA binding modes, which is observed for EcoSSB. The binding properties of PhaSSB investigated using SPR technology revealed that the affinity of PhaSSB to ssDNA is typical of SSB proteins. The only difference in the binding mode of PhaSSB to ssDNA is a faster association phase, when compared to EcoSSB, though compensated by faster dissociation rate. When analyzed by differential scanning calorimetry (DSC), the melting temperature (Tm) was determined as 63 °C, which is only a few degrees lower than for EcoSSB. Copyright © 2013 Elsevier GmbH. All rights reserved.

  10. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  11. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii.

    Science.gov (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten

    2012-01-01

    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  12. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der

    1978-01-01

    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  13. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.

    1982-01-01

    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  14. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

    1982-01-01

    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  15. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.

    2006-01-01

    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  16. Functional analysis of multiple single-stranded DNA-binding proteins from Methanosarcina acetivorans and their effects on DNA synthesis by DNA polymerase BI.

    Science.gov (United States)

    Robbins, Justin B; Murphy, Mary C; White, Bryan A; Mackie, Roderick I; Ha, Taekjip; Cann, Isaac K O

    2004-02-20

    Single-stranded DNA-binding proteins and their functional homologs, replication protein A, are essential components of cellular DNA replication, repair and recombination. We describe here the isolation and characterization of multiple replication protein A homologs, RPA1, RPA2, and RPA3, from the archaeon Methanosarcina acetivorans. RPA1 comprises four single-stranded DNA-binding domains, while RPA2 and RPA3 are each composed of two such domains and a zinc finger domain. Gel filtration analysis suggested that RPA1 exists as homotetramers and homodimers in solution, while RPA2 and RPA3 form only homodimers. Unlike the multiple RPA proteins found in other Archaea and eukaryotes, each of the M. acetivorans RPAs can act as a distinct single-stranded DNA-binding protein. Fluorescence resonance energy transfer and fluorescence polarization anisotropy studies revealed that the M. acetivorans RPAs bind to as few as 10 single-stranded DNA bases. However, more stable binding is achieved with single-stranded DNA of 18-23 bases, and for such substrates the estimated Kd was 3.82 +/- 0.28 nM, 173.6 +/- 105.17 nM, and 5.92 +/- 0.23 nM, for RPA1, RPA2, and RPA3, respectively. The architectures of the M. acetivorans RPAs are different from those of hitherto reported homologs. Thus, these proteins may represent novel forms of replication protein A. Most importantly, our results show that the three RPAs and their combinations highly stimulate the primer extension capacity of M. acetivorans DNA polymerase BI. Although bacterial SSB and eukaryotic RPA have been shown to stimulate DNA synthesis by their cognate DNA polymerases, our findings provide the first in vitro biochemical evidence for the conservation of this property in an archaeon.

  17. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  18. EFFECTOR OF TRANSCRIPTION2 is involved in xylem differentiation and includes a functional DNA single strand cutting domain.

    Science.gov (United States)

    Ivanov, Rumen; Tiedemann, Jens; Czihal, Andreas; Schallau, Anna; Diep, Le Hong; Mock, Hans-Peter; Claus, Bernhard; Tewes, Annegret; Bäumlein, Helmut

    2008-01-01

    EFFECTORS OF TRANSCRIPTION2 (ET) are plant-specific regulatory proteins characterized by the presence of two to five C-terminal DNA- and Zn-binding repeats, and a highly conserved cysteine pattern. We describe the structural characterization of the three member Arabidopsis thaliana ET gene family and reveal some allelic sequence polymorphisms. A mutation analysis showed that AtET2 affects the expression of various KNAT genes involved in the maintenance of the undifferentiated state of cambial meristem cells. It also plays a role in the regulation of GA5 (gibberellin 3-beta-dioxygenase) and the cell-cycle-related GASA4. A correlation was established between AtET2 expression and the cellular differentiation state. AtET-GFP fusion proteins shuttle between the cytoplasm and nucleus, with the AtET2 product prevented from entering the nucleus in non-differentiating cells. Within the nucleus, AtET2 probably acts via a single strand cutting domain. A more general regulatory role for ET factors is proposed, governing cell differentiation in cambial meristems, a crucial process for the development of plant vascular tissues.

  19. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)

    2015-04-22

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  20. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.

    1985-01-01

    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  1. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA

    Science.gov (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana

    2009-04-01

    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  2. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia

    2009-01-01

    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  3. Capillary electrophoresis ribosomal RNA single-stranded conformation polymorphism: a new approach for characterization of low-diversity microbial communities.

    Science.gov (United States)

    Nai, Yi H; Zemb, Oliver; Gutierrez-Zamora, Maria-Luisa; Manefield, Mike; Powell, Shane M; Breadmore, Michael C

    2012-10-01

    Capillary electrophoresis (CE) has been the principle system for nucleic acid analysis since the early 1990s due to its inherent advantages such as fast analysis time, high resolution and efficiency, minimal sample requirement, high detection sensitivity, and automation. In the past few decades, microbial community fingerprinting methods such as terminal restriction fragment length polymorphism and single-stranded conformation polymorphism (SSCP) have migrated to CE to utilize its advantages over conventional slab gel electrophoresis. Recently, a gel-based direct rRNA fingerprint method was demonstrated. Different from other existing microbial community characterization approaches, this novel approach is polymerase chain reaction free and capable of providing information on the relative abundance of rRNA from individual phylotypes in low-diversity samples. As a gel-based method, it has a long analysis time and relatively large reagent and sample requirements. Here, we addressed these limitations by transferring the RNA fingerprint approach to the CE platform. Analysis time significantly improved from 24 h to 60 min, and the use of a fluorescently labeled hybridization probe as the detection strategy decreased the sample requirement by ten-fold. The combination of fast analysis time, low sample requirement, and sensitive fluorescence detection makes CE-RNA-SSCP an appealing new approach for characterizing low-diversity microbial communities.

  4. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))

    1993-03-01

    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  5. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  6. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  7. JRC GMO-Amplicons: a collection of nucleic acid sequences related to genetically modified organisms.

    Science.gov (United States)

    Petrillo, Mauro; Angers-Loustau, Alexandre; Henriksson, Peter; Bonfini, Laura; Patak, Alex; Kreysa, Joachim

    2015-01-01

    The DNA target sequence is the key element in designing detection methods for genetically modified organisms (GMOs). Unfortunately this information is frequently lacking, especially for unauthorized GMOs. In addition, patent sequences are generally poorly annotated, buried in complex and extensive documentation and hard to link to the corresponding GM event. Here, we present the JRC GMO-Amplicons, a database of amplicons collected by screening public nucleotide sequence databanks by in silico determination of PCR amplification with reference methods for GMO analysis. The European Union Reference Laboratory for Genetically Modified Food and Feed (EU-RL GMFF) provides these methods in the GMOMETHODS database to support enforcement of EU legislation and GM food/feed control. The JRC GMO-Amplicons database is composed of more than 240 000 amplicons, which can be easily accessed and screened through a web interface. To our knowledge, this is the first attempt at pooling and collecting publicly available sequences related to GMOs in food and feed. The JRC GMO-Amplicons supports control laboratories in the design and assessment of GMO methods, providing inter-alia in silico prediction of primers specificity and GM targets coverage. The new tool can assist the laboratories in the analysis of complex issues, such as the detection and identification of unauthorized GMOs. Notably, the JRC GMO-Amplicons database allows the retrieval and characterization of GMO-related sequences included in patents documentation. Finally, it can help annotating poorly described GM sequences and identifying new relevant GMO-related sequences in public databases. The JRC GMO-Amplicons is freely accessible through a web-based portal that is hosted on the EU-RL GMFF website. Database URL: http://gmo-crl.jrc.ec.europa.eu/jrcgmoamplicons/. © The Author(s) 2015. Published by Oxford University Press.

  8. Similar diversity of Alphaproteobacteria and nitrogenase gene amplicons on two related Sphagnum mosses

    Directory of Open Access Journals (Sweden)

    Anastasia eBragina

    2012-01-01

    Full Text Available Sphagnum mosses represent a main component in ombrotrophic wetlands. They harbor a specific and diverse microbial community with essential functions for the host. To understand extend and degree of host specificity, Sphagnum fallax and S. angustifolium, two phylogenetically closely related species, which show distinct habitat preference with respect to the nutrient level, were analyzed by a multifaceted approach. Microbial fingerprints obtained by PCR-SSCP (single-strand conformation polymorphism using universal, group-specific and functional primers were highly similar. Similarity was confirmed for colonization patterns obtained by fluorescence in situ hybridization (FISH coupled with confocal laser scanning microscopy (CLSM: Alphaproteobacteria were the main colonizers inside the hyaline cells of Sphagnum leaves. A deeper survey of Alphaproteobacteria by 16S rRNA gene amplicon sequencing reveals a high diversity with Acidocella, Acidisphaera, Rhodopila and Phenylobacterium as major genera for both mosses. Pathogen defense and nitrogen fixation are important functions of Sphagnum-associated bacteria, which are fulfilled by microbial communities of both Sphagna in a similar way. NifH libraries of Sphagnum-associated microbial communities were characterized by high diversity and abundance of Alphaproteobacteria but contained also diverse amplicons of other taxa, e.g. Cyanobacteria, Geobacter and Spirochaeta. Statistically significant differences between the microbial communities of both Sphagnum species could not be discovered in any of the experimental approach. Our results show that the same close relationship, which exists between the physical, morphological and chemical characteristics of Sphagnum mosses and the ecology and function of bog ecosystems, also connects moss plantlets with their associated bacterial communities.

  9. Cooperative Epigenetic Modulation by Cancer Amplicon Genes

    Science.gov (United States)

    Rui, Lixin; Tolga Emre, N. C.; Kruhlak, Michael J.; Chung, Hye-Jung; Steidl, Christian; Slack, Graham; Wright, George W.; Lenz, Georg; Ngo, Vu N.; Shaffer, Arthur L.; Xu, Weihong; Zhao, Hong; Yang, Yandan; Lamy, Laurence; Davis, R. Eric; Xiao, Wenming; Powell, John; Maloney, David; Thomas, Craig J.; Möller, Peter; Rosenwald, Andreas; Ott, German; Muller-Hermelink, Hans Konrad; Savage, Kerry; Connors, Joseph M.; Rimsza, Lisa M.; Campo, Elias; Jaffe, Elaine S.; Delabie, Jan; Smeland, Erlend B.; Weisenburger, Dennis D.; Chan, Wing C.; Gascoyne, Randy D.; Levens, David; Staudt, Louis M.

    2010-01-01

    Chromosome band 9p24 is frequently amplified in primary mediastinal B-cell lymphoma (PMBL) and Hodgkin lymphoma (HL). To identify oncogenes in this amplicon, we screened an RNA interference library targeting amplicon genes and thereby identified JAK2 and the histone demethylase JMJD2C as essential genes in these lymphomas. Inhibition of JAK2 and JMJD2C cooperated in killing these lymphomas by decreasing tyrosine 41 phosphorylation and increasing lysine 9 trimethylation of histone H3, promoting heterochromatin formation. MYC, a major target of JAK2-mediated histone phosphorylation, was silenced following JAK2 and JMJD2C inhibition, with a corresponding increase in repressive chromatin. Hence, JAK2 and JMJD2C cooperatively remodel the PMBL and HL epigenome, offering a mechanistic rationale for the development of JAK2 and JMJD2C inhibitors in these diseases. PMID:21156283

  10. Assessing single-stranded oligonucleotide drug-induced effects in vitro reveals key risk factors for thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Sabine Sewing

    Full Text Available Single-stranded oligonucleotides (ON comprise a promising therapeutic platform that enables selective modulation of currently undruggable targets. The development of novel ON drug candidates has demonstrated excellent efficacy, but in certain cases also some safety liabilities were reported. Among them are events of thrombocytopenia, which have recently been evident in late stage trials with ON drugs. The underlying mechanisms are poorly understood and the risk for ON candidates causing such events cannot be sufficiently assessed pre-clinically. We investigated potential thrombocytopenia risk factors of ONs and implemented a set of in vitro assays to assess these risks. Our findings support previous observations that phosphorothioate (PS-ONs can bind to platelet proteins such as platelet collagen receptor glycoprotein VI (GPVI and activate human platelets in vitro to various extents. We also show that these PS-ONs can bind to platelet factor 4 (PF4. Binding to platelet proteins and subsequent activation correlates with ON length and connected to this, the number of PS in the backbone of the molecule. Moreover, we demonstrate that locked nucleic acid (LNA ribosyl modifications in the wings of the PS-ONs strongly suppress binding to GPVI and PF4, paralleled by markedly reduced platelet activation. In addition, we provide evidence that PS-ONs do not directly affect hematopoietic cell differentiation in culture but at higher concentrations show a pro-inflammatory potential, which might contribute to platelet activation. Overall, our data confirm that certain molecular attributes of ONs are associated with a higher risk for thrombocytopenia. We propose that applying the in vitro assays discussed here during the lead optimization phase may aid in deprioritizing ONs with a potential to induce thrombocytopenia.

  11. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA.

    Science.gov (United States)

    Rogers, Cody M; Bochman, Matthew L

    2017-05-13

    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold.

    Science.gov (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G

    2005-05-24

    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  13. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage

    Science.gov (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio

    1998-01-01

    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  14. Slowing single-stranded DNA translocation through a solid-state nanopore by decreasing the nanopore diameter.

    Science.gov (United States)

    Akahori, Rena; Haga, Takanobu; Hatano, Toshiyuki; Yanagi, Itaru; Ohura, Takeshi; Hamamura, Hirotaka; Iwasaki, Tomio; Yokoi, Takahide; Anazawa, Takashi

    2014-07-11

    To slow the translocation of single-stranded DNA (ssDNA) through a solid-state nanopore, a nanopore was narrowed, and the effect of the narrowing on the DNA translocation speed was investigated. In order to accurately measure the speed, long (5.3 kb) ssDNA (namely, ss-poly(dA)) with uniform length (±0.4 kb) was synthesized. The diameters of nanopores fabricated by a transmission electron microscope were controlled by atomic-layer deposition. Reducing the nanopore diameter from 4.5 to 2.3 nm slowed down the translocation of ssDNA by more than 16 times (to 0.18 μs base(-1)) when 300 mV was applied across the nanopore. It is speculated that the interaction between the nanopore and the ssDNA dominates the translocation speed. Unexpectedly, the translocation speed of ssDNA through the 4.5 nm nanopore is more than two orders of magnitude higher than that of double-stranded DNA (dsDNA) through a nanopore of almost the same size. The cause of such a faster translocation of ssDNA can be explained by the weaker drag force inside the nanopore. Moreover, the measured translocation speeds of ssDNA and dsDNA agree well with those calculated by molecular-dynamics (MD) simulation. The MD simulation predicted that reducing the nanopore diameter to almost the same as that of ssDNA (i.e. 1.4 nm) decreases the translocation speed (to 1.4 μs base(-1)). Narrowing the nanopore is thus an effective approach for accomplishing nanopore DNA sequencing.

  15. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  16. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler

    2007-12-01

    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  17. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines.

    Science.gov (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao

    2017-07-01

    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  18. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA.

    Science.gov (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee

    2011-03-24

    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  19. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis.

    Science.gov (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J

    2012-01-01

    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  1. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.

    1992-01-01

    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  2. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  3. Synthesis of a gene for the HIV transactivator protein TAT by a novel single stranded approach involving in vivo gap repair.

    OpenAIRE

    Adams, S E; Johnson, I D; Braddock, M; Kingsman, A J; Kingsman, S M; Edwards, R M

    1988-01-01

    The synthesis of a gene for the HIV TAT protein is described using a novel approach that capitalises on the ability to synthesise oligonucleotides of greater than 100 bp in length. It involves the synthesis of large oligomers covering one strand of the desired gene in its entirety and the use of small complementary bridging and adapter oligonucleotides to direct the assembly and cloning of the large oligomers. After ligation to the cloning vector the partially single stranded intermediate is ...

  4. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers

    OpenAIRE

    Antolin, M. F.; Bosio, C. F.; Cotton, J.; Sweeney, W.; Strand, M. R.; Black-IV, W. C.

    1996-01-01

    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  5. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr

    2015-01-01

    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single- strand ed DNA -binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  6. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.

    1979-10-01

    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  7. Escherichia coli Single-Stranded DNA-Binding Protein: NanoESI-MS Studies of Salt-Modulated Subunit Exchange and DNA Binding Transactions

    Science.gov (United States)

    Mason, Claire E.; Jergic, Slobodan; Lo, Allen T. Y.; Wang, Yao; Dixon, Nicholas E.; Beck, Jennifer L.

    2013-02-01

    Single-stranded DNA-binding proteins (SSBs) are ubiquitous oligomeric proteins that bind with very high affinity to single-stranded DNA and have a variety of essential roles in DNA metabolism. Nanoelectrospray ionization mass spectrometry (nanoESI-MS) was used to monitor subunit exchange in full-length and truncated forms of the homotetrameric SSB from Escherichia coli. Subunit exchange in the native protein was found to occur slowly over a period of hours, but was significantly more rapid in a truncated variant of SSB from which the eight C-terminal residues were deleted. This effect is proposed to result from C-terminus mediated stabilization of the SSB tetramer, in which the C-termini interact with the DNA-binding cores of adjacent subunits. NanoESI-MS was also used to examine DNA binding to the SSB tetramer. Binding of single-stranded oligonucleotides [one molecule of (dT)70, one molecule of (dT)35, or two molecules of (dT)35] was found to prevent SSB subunit exchange. Transfer of SSB tetramers between discrete oligonucleotides was also observed and is consistent with predictions from solution-phase studies, suggesting that SSB-DNA complexes can be reliably analyzed by ESI mass spectrometry.

  8. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  9. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.

    1992-01-01

    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  10. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  11. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: simonaclichici@yahoo.com [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)

    2012-03-15

    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  12. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus

    Science.gov (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.

    2016-01-01

    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  13. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy

    OpenAIRE

    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried

    2013-01-01

    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  14. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  15. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.

    1989-01-01

    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  16. A single-stranded RNA copy of the Giardia lamblia virus double-stranded RNA genome is present in the infected Giardia lamblia.

    OpenAIRE

    Furfine, E S; White, T C; Wang, A L; Wang, C C

    1989-01-01

    An isolate of Giardia lamblia infected with the double-stranded RNA virus (GLV) has two major species of RNA that are not present in an uninfected isolate. One of these species is the previously characterized double-stranded RNA genome of GLV (1). The second species of RNA appears to be a full length copy of one strand of the double-stranded RNA genome. This full length single-stranded RNA is not present in viral particles isolated from the growth medium. The cellular concentration of the sin...

  17. Using surface-enhanced Raman spectroscopy and electrochemically driven melting to discriminate Yersinia pestis from Y. pseudotuberculosis based on single nucleotide polymorphisms within unpurified polymerase chain reaction amplicons.

    Science.gov (United States)

    Papadopoulou, Evanthia; Goodchild, Sarah A; Cleary, David W; Weller, Simon A; Gale, Nittaya; Stubberfield, Michael R; Brown, Tom; Bartlett, Philip N

    2015-02-03

    The development of sensors for the detection of pathogen-specific DNA, including relevant species/strain level discrimination, is critical in molecular diagnostics with major impacts in areas such as bioterrorism and food safety. Herein, we use electrochemically driven denaturation assays monitored by surface-enhanced Raman spectroscopy (SERS) to target single nucleotide polymorphisms (SNPs) that distinguish DNA amplicons generated from Yersinia pestis, the causative agent of plague, from the closely related species Y. pseudotuberculosis. Two assays targeting SNPs within the groEL and metH genes of these two species have been successfully designed. Polymerase chain reaction (PCR) was used to produce Texas Red labeled single-stranded DNA (ssDNA) amplicons of 262 and 251 bases for the groEL and metH targets, respectively. These amplicons were used in an unpurified form to hybridize to immobilized probes then subjected to electrochemically driven melting. In all cases electrochemically driven melting was able to discriminate between fully homologous DNA and that containing SNPs. The metH assay was particularly challenging due to the presence of only a single base mismatch in the middle of the 251 base long PCR amplicon. However, manipulation of assay conditions (conducting the electrochemical experiments at 10 °C) resulted in greater discrimination between the complementary and mismatched DNA. Replicate data were collected and analyzed for each duplex on different days, using different batches of PCR product and different sphere segment void (SSV) substrates. Despite the variability introduced by these differences, the assays are shown to be reliable and robust providing a new platform for strain discrimination using unpurified PCR samples.

  18. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  19. Oxidized base damage and single-strand break repair in mammalian genomes: role of disordered regions and posttranslational modifications in early enzymes.

    Science.gov (United States)

    Hegde, Muralidhar L; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic endonuclease 1 (APE1), form complexes with downstream repair (and other noncanonical) proteins via pairwise interactions. Furthermore, a unique feature of mammalian early BER/SSBR enzymes is the presence of a disordered terminal extension that is absent in their Escherichia coli prototypes. These nonconserved segments usually contain organelle-targeting signals, common interaction interfaces, and sites of posttranslational modifications that may be involved in regulating their repair function including lesion scanning. Finally, the linkage of BER/SSBR deficiency to cancer, aging, and human neurodegenerative diseases, and therapeutic targeting of BER/SSBR are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples.

    Science.gov (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J

    2006-03-01

    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  1. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast.

    Science.gov (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A

    2010-08-05

    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  2. Isolation and characterization of a single-stranded DNA virus infecting the marine diatom Chaetoceros sp. strain SS628-11 isolated from western Japan.

    Directory of Open Access Journals (Sweden)

    Kei Kimura

    Full Text Available Diatoms are significant organisms for primary production in the earth's aquatic environment. Hence, their dynamics are an important focus area in current studies. Viruses are a great concern as potential factors of diatom mortality, along with other physical, chemical, and biological factors. We isolated and characterized a new diatom virus (Csp07DNAV that lyses the marine planktonic diatom Chaetoceros sp. strain SS628-11. This paper examines the physiological, morphological, and genomic characteristics of Csp07DNAV. The virus was isolated from a surface water sample that was collected at Hiroshima Bay, Japan. It was icosahedral, had a diameter of 34 nm, and accumulated in the nuclei of host cells. Rod-shaped virus particles also coexisted in the host nuclei. The latent period and burst size were estimated to be <12 h and 29 infectious units per host cell, respectively. Csp07DNAV had a closed circular single-stranded DNA genome (5,552 nucleotides, which included a double-stranded region and 3 open reading frames. The monophyly of Csp07DNAV and other Bacilladnavirus group single-stranded DNA viruses was supported by phylogenetic analysis that was based on the amino acid sequence of each virus protein. On the basis of these results, we considered Csp07DNAV to be a new member of the genus Bacilladnavirus.

  3. Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library.

    Directory of Open Access Journals (Sweden)

    Sumate Pengpumkiat

    Full Text Available Chemical synthesis of oligonucleotides is a widely used tool in the field of biochemistry. Several methods for gene synthesis have been introduced in the growing area of genomics. In this paper, a novel method of constructing dsDNA is proposed. Short (28-mer oligo fragments from a library were assembled through successive annealing and ligation processes, followed by PCR. First, two oligo fragments annealed to form a dsDNA molecule. The double-stranded oligo was immobilized onto magnetic beads (solid support via streptavidin-biotin binding. Next, single-stranded oligo fragments were added successively through ligation to form the complete DNA molecule. The synthesized DNA was amplified through PCR and gel electrophoresis was used to characterize the product. Sanger sequencing showed that more than 97% of the nucleotides matched the expected sequence. Extending the length of the DNA molecule by adding single-stranded oligonucleotides from a basis set (library via ligation enables a more convenient and rapid mechanism for the design and synthesis of oligonucleotides on the go. Coupled with an automated dispensing system and libraries of short oligo fragments, this novel DNA synthesis method would offer an efficient and cost-effective method for producing dsDNA.

  4. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  5. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H

    2012-02-22

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  6. On-site detection of Phytophthora spp.—single-stranded target DNA as the limiting factor to improve on-chip hybridization

    International Nuclear Information System (INIS)

    Schwenkbier, Lydia; Pollok, Sibyll; Popp, Jürgen; Weber, Karina; König, Stephan; Wagner, Stefan; Werres, Sabine; Weber, Jörg; Hentschel, Martin

    2014-01-01

    We report on a lab-on-a-chip approach for on-site detection of Phytophthora species that allows visual signal readout. The results demonstrate the significance of single-stranded DNA (ssDNA) generation in terms of improving the intensity of the hybridization signal and to improve the reliability of the method. Conventional PCR with subsequent heat denaturation, sodium hydroxide-based denaturation, lambda exonuclease digestion and two asymmetric PCR methods were investigated for the species P. fragariae, P. kernoviae, and P. ramorum. The positioning of the capture probe within the amplified yeast GTP-binding protein (YPT1) target DNA was also of interest because it significantly influences the intensity of the signal. Statistical tests were used to validate the impact of the ssDNA generation methods and the capture-target probe position. The single-stranded target DNA generated by Linear-After-The-Exponential PCR (LATE-PCR) was found to produce signal intensities comparable to post-PCR exonuclease treatment. The LATE-PCR is the best method for the on-site detection of Phytophthora because the enzymatic digestion after PCR is more laborious and time-consuming. (author)

  7. Synthesis of a wild-type and three mutant Cucurbita maxima trypsin inhibitor-encoding genes by a single-strand approach.

    Science.gov (United States)

    Botes, D P; Qobose, M D; Corfield, V A

    1991-09-15

    A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.

  8. The casein genes in goat breeds from different Continents: analysis by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP

    Directory of Open Access Journals (Sweden)

    A. Caroli

    2010-04-01

    Full Text Available A screening of casein gene variability was carried out by Polymerase Chain Reaction – Single Strand Conformation Polymorphism in 8 goat breeds from Sudan (Nubian goat, Turkey (Angora Goat Lalahan Tiftic, Angora Goat Yerkoy, Hair goat and India (Jammu, Maharashtra, Rajasthan, South Goat. A total of 16 different alleles or groups of alleles were found, showing conspicuous differences among breeds. The allele frequencies were submitted to cluster analysis in order to highlight differences between breeds, also including data from Red Sokoto, West African Dwarf Nigeria, West African Dwarf Cameroon, and Borno Goat. The tree obtained from the cluster analysis showed two main lineages. The West African goat clustered together, the Indian and Turkish breeds were in the other group. Nubian goat was found in an intermediate position.

  9. Investigation of single-strand conformational polymorphism of the TP53 gene in women with a family history of breast cancer

    Directory of Open Access Journals (Sweden)

    R.R. Burbano

    2000-11-01

    Full Text Available Breast cancer in families with germ line mutations in the TP53 gene has been described in the medical literature. Mutation screening for susceptibility genes should allow effective prophylactic and preventive measures. Using single-strand conformational polymorphism, we screened for mutations in exons 5, 6, 7 and 8 of gene TP53 in the peripheral blood of 8 young non-affected members (17 to 36 years old of families with a history of breast cancer. Studies of this type on young patients (mean age, 25 years are very rare in the literature. The identification of these mutations would contribute to genetic counseling of members of families with predisposition to breast cancer. The results obtained did not show any polymorphism indicating mutation. In our sample, the familial tumorigenesis is probably related to other gene etiologies.

  10. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.

    1994-01-01

    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  11. Influence of the single-strand linker composition on the structural/dynamical properties of a truncated octahedral DNA nano-cage family.

    Science.gov (United States)

    Iacovelli, Federico; Alves, Cassio; Falconi, Mattia; Oteri, Francesco; de Oliveira, Cristiano L P; Desideri, Alessandro

    2014-10-01

    The structural/dynamical properties of three truncated octahedral DNA nano-cages composed by identical double helices but single strand linkers with different composition, namely 7 thymidines, 7 adenines, and 7 alternated thymidines and adenines, have been investigated through classical molecular dynamics simulations. Trajectories have been analyzed to investigate the role of the linkers in defining nano-cages stability and flexibility, including possible influence on the internal cages motions. The data indicate that the cages behavior is almost identical and that the structural/dynamical parameters measured along the trajectories are not particularly affected by the presence of different bases. These results demonstrate that the constraints imposed by the nano-structure geometry are the main factor in modulating these properties

  12. Localization of specific sequences and DNA single-strand breaks in individual UV-A-irradiated human lymphocytes by COMET FISH

    Science.gov (United States)

    Bock, Claudia; Rapp, Alexander; Dittmar, Heike; Monajembashi, Shamci; Greulich, Karl-Otto

    1999-01-01

    The COMET assay, a single cell electrophoresis technique which allows to separate electrophoretically fractionated DNA according to size has been combined with fluorescence in situ hybridization (FISH) which allows to localize specific genes or gene regions. This combination (COMET FISH) allows the detection of DNA single strand breaks in specific regions of the genome of human lymphocytes at the single cell level. Various types of DNA probes, e.g. centromere-, (alpha) - satellite-, telomere-, whole chromosome-, single copy- and region specific DNA probes have been used to investigate whether the UV-A induced DNA single strand breaks are distributed randomly all over the human genome or induced at specific sites ('hot spots'). In the investigated human peripheral blood lymphocytes all but one centromere reveal low sensitivity for UV-A irradiation (500 kJ/m2), while telomeres are randomly distributed over COMET heads and tails. The human chromosome 1 is fractionated by irradiation, but remains in the COMET head, indicating an only moderate degree of fractionation. Among three tested single copy probes, c- myc, p53 and p58, the p53 gene located on chromosome 17p13.1 and the p58 gene (1p36) appear to be located in UV-A stable regions of the human genome in 95% of 65 investigated lymphocytes. In contrast, the c-myc proto-oncogene (8q24) is found in the COMET tail in 90% of the 27 investigated lymphocytes and thus appears to be more sensitive to UV-A irradiation.

  13. Evidence that single-stranded DNA breaks are a normal feature of koala sperm chromatin, while double-stranded DNA breaks are indicative of DNA damage.

    Science.gov (United States)

    Zee, Yeng Peng; López-Fernández, Carmen; Arroyo, F; Johnston, Stephen D; Holt, William V; Gosalvez, Jaime

    2009-08-01

    In this study, we have used single and double comet assays to differentiate between single- and double-stranded DNA damage in an effort to refine the interpretation of DNA damage in mature koala spermatozoa. We have also investigated the likelihood that single-stranded DNA breakage is part of the natural spermiogenic process in koalas, where its function would be the generation of structural bends in the DNA molecule so that appropriate packaging and compaction can occur. Koala spermatozoa were examined using the sperm chromatin dispersion test (SCDt) and comet assays to investigate non-orthodox double-stranded DNA. Comet assays were conducted under 1) neutral conditions; and 2) neutral followed by alkaline conditions (double comet assay); the latter technique enabled simultaneous visualisation of both single-stranded and double-stranded DNA breaks. Following the SCDt, there was a continuum of nuclear morphotypes, ranging from no apparent DNA fragmentation to those with highly dispersed and degraded chromatin. Dispersion morphotypes were mirrored by a similar diversity of comet morphologies that could be further differentiated using the double comet assay. The majority of koala spermatozoa had nuclei with DNA abasic-like residues that produced single-tailed comets following the double comet assay. The ubiquity of these residues suggests that constitutive alkali-labile sites are part of the structural configuration of the koala sperm nucleus. Spermatozoa with 'true' DNA fragmentation exhibited a continuum of comet morphologies, ranging from a more severe form of alkaline-susceptible DNA with a diffuse single tail to nuclei that exhibited both single- and double-stranded breaks with two comet tails.

  14. Functional roles of the N- and C-terminal regions of the human mitochondrial single-stranded DNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Marcos T Oliveira

    2010-10-01

    Full Text Available Biochemical studies of the mitochondrial DNA (mtDNA replisome demonstrate that the mtDNA polymerase and the mtDNA helicase are stimulated by the mitochondrial single-stranded DNA-binding protein (mtSSB. Unlike Escherichia coli SSB, bacteriophage T7 gp2.5 and bacteriophage T4 gp32, mtSSBs lack a long, negatively charged C-terminal tail. Furthermore, additional residues at the N-terminus (notwithstanding the mitochondrial presequence are present in the sequence of species across the animal kingdom. We sought to analyze the functional importance of the N- and C-terminal regions of the human mtSSB in the context of mtDNA replication. We produced the mature wild-type human mtSSB and three terminal deletion variants, and examined their physical and biochemical properties. We demonstrate that the recombinant proteins adopt a tetrameric form, and bind single-stranded DNA with similar affinities. They also stimulate similarly the DNA unwinding activity of the human mtDNA helicase (up to 8-fold. Notably, we find that unlike the high level of stimulation that we observed previously in the Drosophila system, stimulation of DNA synthesis catalyzed by human mtDNA polymerase is only moderate, and occurs over a narrow range of salt concentrations. Interestingly, each of the deletion variants of human mtSSB stimulates DNA synthesis at a higher level than the wild-type protein, indicating that the termini modulate negatively functional interactions with the mitochondrial replicase. We discuss our findings in the context of species-specific components of the mtDNA replisome, and in comparison with various prokaryotic DNA replication machineries.

  15. Optimal Activation of Isopsoralen To Prevent Amplicon Carryover

    OpenAIRE

    Fahle, Gary A.; Gill, Vee J.; Fischer, Steven H.

    1999-01-01

    We compared the efficiencies of activation of the photochemical isopsoralen compound 10 and its resulting amplicon neutralizations under conditions with a UV transilluminator box at room temperature (RT) and a HRI-300 UV photothermal reaction chamber at RT and at 5°C. Our data suggest that use of the HRI-300 reaction chamber at 5°C results in a statistically significantly higher degree of amplicon neutralization.

  16. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide

    2015-10-01

    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  17. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...

  18. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2016-05-28

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  19. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy

    2008-01-01

    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  20. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray.

    Science.gov (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino

    2008-08-25

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  1. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Science.gov (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino

    2008-01-01

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  2. A biomarker model of sublethal genotoxicity (DNA single-strand breaks and adducts) using the sentinel organism Aporrectodea longa in spiked soil

    International Nuclear Information System (INIS)

    Martin, Francis L.; Piearce, Trevor G.; Hewer, Alan; Phillips, David H.; Semple, Kirk T.

    2005-01-01

    There is a need to develop risk biomarkers during the remediation of contaminated land. We employed the earthworm, Aporrectodea longa (Ude), to determine whether genotoxicity measures could be applied to this organism's intestinal tissues. Earthworms were added, for 24 h or 7 days, to soil samples spiked with benzo[a]pyrene (B[a]P) and/or lindane. After exposure, intestinal tissues (crop/gizzard or intestine) were removed prior to the measurement in disaggregated cells of DNA single-strand breaks (SSBs) by the alkaline comet assay. Damage was quantified by comet tail length (CTL, μm). B[a]P 24-h exposure induced dose-related increases (P 32 P-postlabelling, showed a two-adduct-spot pattern. This preliminary investigation suggests that earthworm tissues may be incorporated into genotoxicity assays to facilitate hazard identification within terrestrial ecosystems. - Sublethal genotoxicity in the sentinel organism A. longa can be used to monitor the effects of contaminants in soil

  3. Conformation effects of CpG methylation on single-stranded DNA oligonucleotides: analysis of the opioid peptide dynorphin-coding sequences.

    Directory of Open Access Journals (Sweden)

    Malik Mumtaz Taqi

    Full Text Available Single-stranded DNA (ssDNA is characterized by high conformational flexibility that allows these molecules to adopt a variety of conformations. Here we used native polyacrylamide gel electrophoresis (PAGE, circular dichroism (CD spectroscopy and nuclear magnetic resonance (NMR spectroscopy to show that cytosine methylation at CpG sites affects the conformational flexibility of short ssDNA molecules. The CpG containing 37-nucleotide PDYN (prodynorphin fragments were used as model molecules. The presence of secondary DNA structures was evident from differences in oligonucleotide mobilities on PAGE, from CD spectra, and from formation of A-T, G-C, and non-canonical G-T base pairs observed by NMR spectroscopy. The oligonucleotides displayed secondary structures at 4°C, and some also at 37°C. Methylation at CpG sites prompted sequence-dependent formation of novel conformations, or shifted the equilibrium between different existing ssDNA conformations. The effects of methylation on gel mobility and base pairing were comparable in strength to the effects induced by point mutations in the DNA sequences. The conformational effects of methylation may be relevant for epigenetic regulatory events in a chromatin context, including DNA-protein or DNA-DNA recognition in the course of gene transcription, and DNA replication and recombination when double-stranded DNA is unwinded to ssDNA.

  4. Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Krzysztof Lepek

    2015-01-01

    Full Text Available Monitoring and control of infections are key parts of surveillance systems and epidemiological risk prevention. In the case of influenza A viruses (IAVs, which show high variability, a wide range of hosts, and a potential of reassortment between different strains, it is essential to study not only people, but also animals living in the immediate surroundings. If understated, the animals might become a source of newly formed infectious strains with a pandemic potential. Special attention should be focused on pigs, because of the receptors specific for virus strains originating from different species, localized in their respiratory tract. Pigs are prone to mixed infections and may constitute a reservoir of potentially dangerous IAV strains resulting from genetic reassortment. It has been reported that a quadruple reassortant, A(H1N1pdm09, can be easily transmitted from humans to pigs and serve as a donor of genetic segments for new strains capable of infecting humans. Therefore, it is highly desirable to develop a simple, cost-effective, and rapid method for evaluation of IAV genetic variability. We describe a method based on multitemperature single-strand conformational polymorphism (MSSCP, using a fragment of the hemagglutinin (HA gene, for detection of coinfections and differentiation of genetic variants of the virus, difficult to identify by conventional diagnostic.

  5. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS.

    Science.gov (United States)

    Pachkowski, Brian F; Tano, Keizo; Afonin, Valeriy; Elder, Rhoderick H; Takeda, Shunichi; Watanabe, Masami; Swenberg, James A; Nakamura, Jun

    2009-12-01

    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase beta.

  6. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against the Pesticide Fipronil and Sensitive Detection in River Water

    Directory of Open Access Journals (Sweden)

    Ka L. Hong

    2017-12-01

    Full Text Available Fipronil is a commonly used insecticide that has been shown to have environmental and human health risks. The current standard methods of detection for fipronil and its metabolites, such as GC-MS, are time consuming and labor intensive. In this study, a variant of systematic evolution of ligands by exponential enrichment (SELEX, was utilized to identify the first single-stranded DNA (ssDNA molecular recognition element (MRE that binds to fipronil with high affinity (Kd = 48 ± 8 nM. The selected MRE displayed low cross binding activity on various environmentally relevant, structurally unrelated herbicides and pesticides, in addition to broad-spectrum binding activity on major metabolites of fipronil and a structurally similar pesticide in prepared river samples. Additionally, a proof-of-principle fluorescent detection assay was developed by using the selected ssDNA MRE as a signal-reporting element, with a limit of detection of 105 nM in a prepared river water sample.

  7. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Boye, E.; Johansen, I.; Brustad, T.

    1976-01-01

    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 2 0 C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 2 0 C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  8. Clonal origin of multiple lung cancers: K-ras and p53 mutations determined by nonradioisotopic single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Lau, D H; Yang, B; Hu, R; Benfield, J R

    1997-08-01

    Disease stage is the most important factor in determining prognosis and treatment of lung cancer. Staging of lung cancer is complicated by presentation of multiple pulmonary malignant lesions with a similar histology. It is a dilemma to decide if these lesions are synchronous primaries arising from different malignant clones or metastases from a single clone. Lung cancer is associated with multiple genetic abnormalities including mutations of K-ras and p53, which are believed to occur prior to onset of metastasis. To determine the clonal origin of multiple pulmonary malginant nodules, we analyzed point-mutations of K-ras and p53 by microdissection, polymerase chain reactions (PCR), nonradioisotopic single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. Each pulmonary lesion was microdissected from paraffin slides. Genomic DNA was amplified by two sequential PCRs followed by electrophoresis in a minigel and silver staining. Deoxyribonucleic acid sequencing was performed if necessary to confirm a mutation found upon SSCP analysis. Applying this molecular approach, we were able to differentiate the clonal origins of multiple malignant nodules of the lung as exemplified by the two cases presented.

  9. Simultaneous identification of seven foodborne pathogens and Escherichia coli (pathogenic and nonpathogenic) using capillary electrophoresis-based single-strand conformation polymorphism coupled with multiplex PCR.

    Science.gov (United States)

    Oh, Mi-Hwa; Paek, Se-Hee; Shin, Gi Won; Kim, Hae-Yeong; Jung, Gyoo Yeol; Oh, Sangsuk

    2009-06-01

    The objective of this study was to develop a novel technique for parallel analysis of eight important foodborne microbes using capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) coupled with multiplex PCR. Specific primers for multiplex PCR amplification of the 16S rRNA gene were designed, corresponding to eight species of bacteria, including Escherichia coli, Clostridium perfringens, Campylobacter jejuni, Salmonella enterica, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Bacillus cereus, for the species-specific identification and optimal separation of their PCR products in subsequent analysis by CE-SSCP. Multiplex PCR conditions including annealing temperature, extension time, the number of PCR cycles, and primer concentrations were then optimized for simultaneous detection of all target foodborne bacteria. The diagnostic system using CE-SSCP combined with multiplex PCR developed here can be used for rapid investigation of causative agents of foodborne illness. The simplicity and high sensitivity of the method may lead to improved management of safety and illness related to food.

  10. Selection and Characterization of Single-Stranded DNA Aptamers Binding Human B-Cell Surface Protein CD20 by Cell-SELEX

    Directory of Open Access Journals (Sweden)

    Mansoureh Haghighi

    2018-03-01

    Full Text Available The B-lymphocyte antigen (CD20 is a suitable target for single-stranded (ss nucleic acid oligomer (aptamers. The aim of study was selection and characterization of a ssDNA aptamer against CD20 using Cell-Systematic Evolution of Ligands by Exponential Enrichment (Cell-SELEX. The cDNA clone of CD20 (pcDNA-CD20 was transfected to human embryonic kidney (HEK293T cells. Ten rounds of Cell-SELEX was performed on recombinant HEK-CD20 cells. The final eluted ssDNA pool was amplified and ligated in T/A vector for cloning. The plasmids of positive clones were extracted, sequenced and the secondary structures of the aptamers predicted using DNAMAN® software. The sequencing results revealed 10 different types; three of them had the highest thermodynamic stability, named AP-1, AP-2 and AP-3. The AP-1 aptamer was the most thermodynamically stable one (ΔGAP-1 = −10.87 kcal/mol with the highest binding affinity to CD20 (96.91 ± 4.5 nM. Since, the CD20 is a suitable target for recognition of B-Cell. The selected aptamers could be comparable to antibodies with many advantages. The AP-1, AP-2 and AP-3 could be candidate instead of antibodies for diagnostic and therapeutic applications in immune deficiency, autoimmune diseases, leukemia and lymphoma.

  11. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    Science.gov (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Integrative modelling coupled with ion mobility mass spectrometry reveals structural features of the clamp loader in complex with single-stranded DNA binding protein.

    Science.gov (United States)

    Politis, Argyris; Park, Ah Young; Hall, Zoe; Ruotolo, Brandon T; Robinson, Carol V

    2013-11-29

    DNA polymerase III, a decameric 420-kDa assembly, simultaneously replicates both strands of the chromosome in Escherichia coli. A subassembly of this holoenzyme, the seven-subunit clamp loader complex, is responsible for loading the sliding clamp (β2) onto DNA. Here, we use structural information derived from ion mobility mass spectrometry (IM-MS) to build three-dimensional models of one form of the full clamp loader complex, γ3δδ'ψχ (254 kDa). By probing the interaction between the clamp loader and a single-stranded DNA (ssDNA) binding protein (SSB4) and by identifying two distinct conformational states, with and without ssDNA, we assemble models of ψχ-SSB4 (108 kDa) and the clamp loader-SSB4 (340 kDa) consistent with IM data. A significant increase in measured collision cross-section (~10%) of the clamp loader-SSB4 complex upon DNA binding suggests large conformational rearrangements. This DNA bound conformation represents the active state and, along with the presence of ψχ, stabilises the clamp loader-SSB4 complex. Overall, this study of a large heteromeric complex analysed by IM-MS, coupled with integrative modelling, highlights the potential of such an approach to reveal structural features of previously unknown complexes of high biological importance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system.

    Science.gov (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus

    2011-04-06

    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  14. porphyrin with single strand DNAs

    Indian Academy of Sciences (India)

    for organization of porphyrin molecules into extended assemblies, providing opportunities for construction of supramolecular structures.6–8 Among the porphyrin .... and consequently the mono- and bi-exponential nature of the decays were judged by the reduced chi-square. (χ2) values and distribution of the weighted ...

  15. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA.

    Science.gov (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S

    2000-09-20

    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  16. Flow cytometry analysis of single-strand DNA damage in neuroblastoma cell lines using the F7-26 monoclonal antibody.

    Science.gov (United States)

    Grigoryan, Rita S; Yang, Bo; Keshelava, Nino; Barnhart, Jerry R; Reynolds, C Patrick

    2007-11-01

    The F7-26 monoclonal antibody (Mab) has been reported to be specific for single-strand DNA damage (ssDNA) and to also identify cells in apoptosis. We carriedout studies to determine if F7-26 binding measured by flow cytometry was able to specifically identify exogenous ssDNA as opposed to DNA damage from apoptosis. Neuroblastoma cells were treated with melphalan (L-PAM), fenretinide, 4-hydroperoxycyclophosphamide (4-HC)+/-pan-caspase inhibitor BOC-d-fmk, topotecan or with 10Gy gamma radiation+/-hydrogen peroxide (H2O2) and fixed immediately postradiation. Cytotoxicity was measured by DIMSCAN digital imaging fluorescence assay. The degree of ssDNA damage was analyzed by flow cytometry using Mab F7-26, with DNA visualized by propidium iodide counterstaining. Flow cytometry was used to measure apoptosis detected by terminal deoxynucleotidyltransferase (TUNEL) assay and reactive oxygen species (ROS) by carboxy-dichlorofluorescein diacetate. Irradiated and immediately fixed neuroblastoma cells showed increased ssDNA, but not apoptosis by TUNEL (TUNEL-negative). 4-HC or L-PAM+/-BOC-d-fmk increased ssDNA (F7-26-positive), but BOC-d-fmk prevented TUNEL staining. Fenretinide increased apoptosis by TUNEL but not ssDNA damage detected with F7-26. Enhanced ssDNA in neuroblastoma cells treated with radiation+H2O2 was associated with increased ROS. Topotecan increased both ssDNA and cytotoxicity in 4-HC-treated cells. These data demonstrate that Mab F7-26 recognized ssDNA due to exogenous DNA damage, rather than apoptosis. This assay should be useful to characterize the mechanism of action of antineoplastic drugs. Copyright (c) 2007 International Society for Analytical Cytology.

  17. Detection of p53 mutations by single-strand conformation polymorphisms (SSCP) gel electrophoresis. A comparative study of radioactive and nonradioactive silver-stained SSCP analysis.

    Science.gov (United States)

    Bosari, S; Marchetti, A; Buttitta, F; Graziani, D; Borsani, G; Loda, M; Bevilacqua, G; Coggi, G

    1995-12-01

    p53 mutations are the most common genetic abnormality in humans tumors, but their clinical significance remains to be precisely elucidated. Conventional single-strand conformation polymorphism (SSCP) analysis, a well-established technique for detecting p53 mutations, uses radioactively labeled polymerase chain reaction (PCR) products, which migrate abnormally in the presence of mutations. We performed radioactive PCR-SSCP analysis in a series of 30 formalin-fixed, paraffin-embedded ovarian carcinomas and two cell lines (SW480 and Caov4) harboring known homozygous p53 mutations and compared the results with nonradioactive silver-stained SSCP. The purpose was to assess whether nonradioactive SSCP is suitable for detecting p53 mutations in a rapid, sensitive, cost-effective fashion, without the need of radioactive isotopes. We accomplished PCR amplification of p53 exons 5 through 8 in 26 carcinomas, and radioactive SSCP detected p53 mutations in 13 tumors; three mutations were localized in exon 5, six in exon 6, two in exon 7, and two in exon 8. All mutations were correctly identified with nonradioactive SSCP, except for one exon 8 mutation. To establish the sensitivity of nonradioactive SSCP, DNA samples of SW480 and Caov4 were mixed with increasing amounts (0-90%) of normal DNA and subjected to PCR-SSCP analysis. Mutations were detected until the concentration of SW480 and Caov4 was 15% and 10%, respectively, of the total sample. The results of our investigation demonstrate that nonradioactive silver-stained SSCP is a sensitive, rapid, and simple technique to detect p53 mutations, even in formalin-fixed tissues, and could be easily used to investigate large series of patients to assess the clinical significance of p53 mutations in human tumors.

  18. Ampelomyces mycoparasites from apple powdery mildew identified as a distinct group based on single-stranded conformation polymorphism analysis of the rDNA ITS region.

    Science.gov (United States)

    Szentiványi, Orsolya; Kiss, Levente; Russell, John C; Kovács, Gábor M; Varga, Krisztina; Jankovics, Tünde; Lesemann, Silke; Xu, Xiang-Ming; Jeffries, Peter

    2005-04-01

    Pycnidial fungi belonging to the genus Ampelomyces are the most common natural antagonists of powdery mildews worldwide. During a study of the interactions between apple powdery mildew (Podosphaera leucotricha) and Ampelomyces mycoparasites, 52 new Ampelomyces isolates were obtained from P. leucotricha and, in addition, 13 new isolates from other species of the Erysiphaceae in four European countries. Their genetic diversity was screened using single-stranded conformation polymorphism (SSCP) analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). For comparison, 24 isolates obtained from genetic resource collections or other sources were included in this study. Based on the ITS-SSCP patterns, the isolates were placed in eight groups. The isolates belonged to two types based on their growth in culture. The faster-growing and the slower-growing isolates were included in different SSCP groups. A phylogenetic analysis of the ITS sequences of representatives of these groups confirmed the results obtained with the SSCP method, and showed that the faster-growing isolates do not belong to Ampelomyces as suggested by earlier studies. All the isolates from P. leucotricha fell into a distinct SSCP group of genetically homogeneous isolates. This suggests that Ampelomyces mycoparasites which occur in apple powdery mildew are slightly different from the other Ampelomyces groups which contain mycoparasites from various powdery mildew species. This may be because the main growth period of Ampelomyces mycoparasites in apple powdery mildew is isolated in time from that of Ampelomyces isolates that occur in other species of the Erysiphaceae. P. leucotricha starts its life-cycle early in the season, usually in March-April, while most powdery mildews are active in the same environments only late in the year.

  19. Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody: a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody.

    Science.gov (United States)

    Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua

    2018-02-01

    Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.

  20. Variabilidad genética de Aedes aegypti en algunas áreas del Perú usando Single Stranded Conformational Polymorphism (SSCP

    Directory of Open Access Journals (Sweden)

    Nélida Leiva G

    2004-07-01

    Full Text Available Aedes aegypti es el vector responsable de la transmisión del virus del dengue, su distribución geográfica se ha ampliado rápidamente debido principalmente a la intervención de los seres humanos. Objetivo: Analizar la variabilidad genética de este mosquito mediante la comparación del Segundo Espaciador Transcrito Interno (ITS 2 perteneciente al ADN ribosomal (rADN. Materiales y Métodos: Se analizaron muestras de ocho localidades (Jaén, Tingo María, Iquitos, Lambayeque, el distrito de El Rimac, Sullana y Zarumilla y uno de la provincia de Huaquillas (Ecuador. El análisis de la variabilidad se determinó usando la técnica conocida como SSCP (Single Stranded Conformation Polymorphism. Resultados: El estudio muestra que existe variabilidad genética entre las poblaciones analizadas, principalmente entre las muestras localizadas en la costa del Perú (Zarumilla, El Rímac, Sullana y Huaquillas y las muestras del nororiente (Tingo María, Iquitos, Jaén y Lambayeque Conclusión: Se determinaron dos variantes genéticas entre las poblaciones de Aedes aegypti: Costeña y Nororiental, que probablemente provienen de dos ancestros diferentes y cuyo ancestro común sufrió de aislamiento por distancia. Se observó que no existe relación entre las distancias genéticas y las distancias geográficas indicando que la migración de estas poblaciones es el resultado de la intervención de los seres humanos que diseminan al vector y no por la migración activa del mosquito. Se plantea el papel de la Cordillera de los Andes en la migración y separación de las poblaciones de Aedes.

  1. Detection of hybridization of single-strand DNA PCR products in temperature change process by a novel metal-clamping piezoelectric sensor.

    Science.gov (United States)

    Chen, Qinghai; Bian, Zhiheng; Hua, Xing; Yao, Chunyan; Wu, Wei; Zhang, Xue; Zhang, Bo; Huang, Junfu; Tang, Wanli; Fu, Weiling

    2010-05-15

    Oligonucleotide probes on the sensor surface can be hybridized with single-strand DNA (ssDNA) that is formed from PCR products in ice bath after degeneration. Thus, detection of PCR products by piezoelectric sensors requires the participation of ssDNA PCR products in ice bath. When PCR products in ice bath are added into the buffer of the sensor well at room temperature, there will be a temperature change process during mixing. However, it still remains unclear whether the temperature change affects the frequency baseline stability of the sensor and the result judgment, which is the basic condition for detecting hybridization of nucleic acid. In this study, we detected the hybridization of HPV PCR products during temperature change process by a self-designed adjustable metal-clamping piezoelectric sensor. The study mainly involves sensor adjustment, probe immobilization and ice bath sample addition (at different concentrations and different volumes). The response curve of basic frequency in temperature change process showed three stages, i.e., increase, decrease to baseline, and continuous decrease to stability. The early increase of frequency and duration of the time can reach 55+/-7.4 Hz and 39 min when 40 microL sample (0-1 degrees C) was added into 110 microL buffer (25 degrees C). The frequency increase effect caused by temperature difference at early stage depends on the volume ratio of two liquids and on the temperature difference. The results indicate that we should pay more attention to possibly small volume of PCR products in ice bath and minor temperature difference of two liquids in operation. 2010 Elsevier B.V. All rights reserved.

  2. Gauging the Nanotoxicity of h2D-C2N toward Single-Stranded DNA: An in Silico Molecular Simulation Approach.

    Science.gov (United States)

    Mukhopadhyay, Titas Kumar; Bhattacharyya, Kalishankar; Datta, Ayan

    2018-04-12

    Recent toxicological assessments of graphene, graphene oxides, and some other two-dimensional (2D) materials have shown them to be substantially toxic at the nanoscale, where they inhibit and eventually disrupt biological processes. These shortfalls of graphene and analogs have resulted in a quest for novel biocompatible 2D materials with minimum cytotoxicity. In this article, we demonstrate C 2 N (h2D-C 2 N), a newly synthesized 2D porous graphene analog, to be non-nanotoxic toward genetic materials from an "in-silico" point of view through sequence-dependent binding of different polynucleotide single-stranded DNA (ssDNA) onto it. The calculated binding energy of nucleobases and the free energy of binding of polynucleotides follow the common trait, cytosine > guanine > adenine > thymine, and are well within the limits of physisorption. Ab-initio simulations completely exclude the possibility of any chemical reaction, demonstrating purely noncovalent binding of nucleobases with C 2 N through a crucial interplay between hydrogen bonding and π-stacking interactions with the surface. Further, we show that the extent of distortion inflicted upon ssDNA by C 2 N is negligible. Analysis of the density of states of the nucleobase-C 2 N hybrids confirms minimum electronic perturbation of the bases after adsorption. Most importantly, we demonstrate the potency of C 2 N in nucleic acid transportation via reversible binding of ssDNA. The plausible use of C 2 N as a template for DNA repair is illustrated through an example of C 2 N-assisted complementary ssDNA winding.

  3. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms.

    Science.gov (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A

    2012-05-01

    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    Science.gov (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  7. Analysis and Visualization Tool for Targeted Amplicon Bisulfite Sequencing on Ion Torrent Sequencers.

    Directory of Open Access Journals (Sweden)

    Stephan Pabinger

    Full Text Available Targeted sequencing of PCR amplicons generated from bisulfite deaminated DNA is a flexible, cost-effective way to study methylation of a sample at single CpG resolution and perform subsequent multi-target, multi-sample comparisons. Currently, no platform specific protocol, support, or analysis solution is provided to perform targeted bisulfite sequencing on a Personal Genome Machine (PGM. Here, we present a novel tool, called TABSAT, for analyzing targeted bisulfite sequencing data generated on Ion Torrent sequencers. The workflow starts with raw sequencing data, performs quality assessment, and uses a tailored version of Bismark to map the reads to a reference genome. The pipeline visualizes results as lollipop plots and is able to deduce specific methylation-patterns present in a sample. The obtained profiles are then summarized and compared between samples. In order to assess the performance of the targeted bisulfite sequencing workflow, 48 samples were used to generate 53 different Bisulfite-Sequencing PCR amplicons from each sample, resulting in 2,544 amplicon targets. We obtained a mean coverage of 282X using 1,196,822 aligned reads. Next, we compared the sequencing results of these targets to the methylation level of the corresponding sites on an Illumina 450k methylation chip. The calculated average Pearson correlation coefficient of 0.91 confirms the sequencing results with one of the industry-leading CpG methylation platforms and shows that targeted amplicon bisulfite sequencing provides an accurate and cost-efficient method for DNA methylation studies, e.g., to provide platform-independent confirmation of Illumina Infinium 450k methylation data. TABSAT offers a novel way to analyze data generated by Ion Torrent instruments and can also be used with data from the Illumina MiSeq platform. It can be easily accessed via the Platomics platform, which offers a web-based graphical user interface along with sample and parameter storage

  8. Multiplex amplicon sequencing for microbe identification in community-based culture collections.

    Science.gov (United States)

    Armanhi, Jaderson Silveira Leite; de Souza, Rafael Soares Correa; de Araújo, Laura Migliorini; Okura, Vagner Katsumi; Mieczkowski, Piotr; Imperial, Juan; Arruda, Paulo

    2016-07-12

    Microbiome analysis using metagenomic sequencing has revealed a vast microbial diversity associated with plants. Identifying the molecular functions associated with microbiome-plant interaction is a significant challenge concerning the development of microbiome-derived technologies applied to agriculture. An alternative to accelerate the discovery of the microbiome benefits to plants is to construct microbial culture collections concomitant with accessing microbial community structure and abundance. However, traditional methods of isolation, cultivation, and identification of microbes are time-consuming and expensive. Here we describe a method for identification of microbes in culture collections constructed by picking colonies from primary platings that may contain single or multiple microorganisms, which we named community-based culture collections (CBC). A multiplexing 16S rRNA gene amplicon sequencing based on two-step PCR amplifications with tagged primers for plates, rows, and columns allowed the identification of the microbial composition regardless if the well contains single or multiple microorganisms. The multiplexing system enables pooling amplicons into a single tube. The sequencing performed on the PacBio platform led to recovery near-full-length 16S rRNA gene sequences allowing accurate identification of microorganism composition in each plate well. Cross-referencing with plant microbiome structure and abundance allowed the estimation of diversity and abundance representation of microorganism in the CBC.

  9. Contribution of single-strand breaks and alkali-labile bonds to the loss of infectivity of γ-irradiated phiX174 RF-DNA in E. coli cells mutant in various repair functions

    International Nuclear Information System (INIS)

    McKee, R.H.

    1975-01-01

    Twenty-one radiation sensitive mutants have been examined for their capacity to support gamma-irradiated phiX174 RF-DNA. The survival of phiX174 RF-DNA was reduced in essentially all of the sensitive mutants. The irradiated phiX174 RF-DNA was then separated into populations containing either single-strand breaks or alkali-labile bonds to examine the capacity of the mutants to repair each of the classes of lesions. It was found that all E. coli strains are unable to repair 22 percent of the single-strand breaks and all sensitive mutants are unable to repair an additional 10 percent of the breaks. All the repair functions examined are involved in single-strand break repair and none are more or less necessary than any of the others. PhiX174 RF-DNA is also inactivated by alkali-labile bonds. In the normal strains the inactivation efficiency is 0.16 lethal events per lesion with a threshold dose of 15 to 20 krads. The mutants are divided into two classes by their sensitivity to alkali-labile bonds. Both classes of mutants are also inactivated by alkali-labile bonds with efficiencies of about 0.17 and 0.29 lethal events per lesion, respectively. It is proposed that the differences seen in survival curves of phiX174 measured in the sensitive mutants is due to this difference. Although in normal cells the efficiency of inactivation of phiX174 by single-strand breaks is 50 percent greater than by alkali-labile bonds, alkali-labile bonds are produced at approximately twice the rate of single-strand breaks so alkali-labile bonds account for about 61 percent of the overall inactivation. In the mutants of least sensitivity alkali-labile bonds account for about 54 percent of the inactivating events and in the most sensitive about 67 percent

  10. Characterization of a Novel Megabirnavirus from Sclerotinia sclerotiorum Reveals Horizontal Gene Transfer from Single-Stranded RNA Virus to Double-Stranded RNA Virus.

    Science.gov (United States)

    Wang, Minghong; Wang, Yong; Sun, Xiangzhong; Cheng, Jiasen; Fu, Yanping; Liu, Huiquan; Jiang, Daohong; Ghabrial, Said A; Xie, Jiatao

    2015-08-01

    Mycoviruses have been detected in all major groups of filamentous fungi, and their study represents an important branch of virology. Here, we characterized a novel double-stranded RNA (dsRNA) mycovirus, Sclerotinia sclerotiorum megabirnavirus 1 (SsMBV1), in an apparently hypovirulent strain (SX466) of Sclerotinia sclerotiorum. Two similarly sized dsRNA segments (L1- and L2-dsRNA), the genome of SsMBV1, are packaged in rigid spherical particles purified from strain SX466. The full-length cDNA sequence of L1-dsRNA/SsMBV1 comprises two large open reading frames (ORF1 and ORF2), which encode a putative coat protein and an RNA-dependent RNA polymerase (RdRp), respectively. Phylogenetic analysis of the RdRp domain clearly indicates that SsMBV1 is related to Rosellinia necatrix megabirnavirus 1 (RnMBV1). L2-dsRNA/SsMBV1 comprises two nonoverlapping ORFs (ORFA and ORFB) encoding two hypothetical proteins with unknown functions. The 5'-terminal regions of L1- and L2-dsRNA/SsMBV1 share strictly conserved sequences and form stable stem-loop structures. Although L2-dsRNA/SsMBV1 is dispensable for replication, genome packaging, and pathogenicity of SsMBV1, it enhances transcript accumulation of L1-dsRNA/SsMBV1 and stability of virus-like particles (VLPs). Interestingly, a conserved papain-like protease domain similar to a multifunctional protein (p29) of Cryphonectria hypovirus 1 was detected in the ORFA-encoded protein of L2-dsRNA/SsMBV1. Phylogenetic analysis based on the protease domain suggests that horizontal gene transfer may have occurred from a single-stranded RNA (ssRNA) virus (hypovirus) to a dsRNA virus, SsMBV1. Our results reveal that SsMBV1 has a slight impact on the fundamental biological characteristics of its host regardless of the presence or absence of L2-dsRNA/SsMBV1. Mycoviruses are widespread in all major fungal groups, and they possess diverse genomes of mostly ssRNA and dsRNA and, recently, circular ssDNA. Here, we have characterized a novel dsRNA virus

  11. Accessibility

    DEFF Research Database (Denmark)

    Brooks, Anthony Lewis

    2017-01-01

    This contribution is timely as it addresses accessibility in regards system hardware and software aligned with introduction of the Twenty-First Century Communications and Video Accessibility Act (CVAA) and adjoined game industry waiver that comes into force January 2017. This is an act created...... by the USA Federal Communications Commission (FCC) to increase the access of persons with disabilities to modern communications, and for other purposes. The act impacts advanced communications services and products including text messaging; e-mail; instant messaging; video communications; browsers; game...... platforms; and games software. However, the CVAA has no legal status in the EU. This text succinctly introduces and questions implications, impact, and wider adoption. By presenting the full CVAA and game industry waiver the text targets to motivate discussions and further publications on the subject...

  12. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family.

    Science.gov (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław

    2017-05-01

    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  13. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D

    2010-01-01

    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  14. Increased type I collagen content and DNA binding activity of a single-stranded, cytosine-rich sequence in the high-salt buffer protein extract of the copper-deficient rat heart.

    Science.gov (United States)

    Zeng, Huawei; Saari, Jack T

    2004-11-01

    Dietary copper (Cu) deficiency not only causes a hypertrophic cardiomyopathy but also increases cancer risk in rodent models. However, a possible alteration in gene expression has not been fully examined. The present study was undertaken to determine the effect of Cu deficiency on protein profiles in rat heart tissue. Male Sprague-Dawley rats were fed diets that were either a Cu-adequate diet (6.0 microg Cu/g diet, n = 6) or a Cu-deficient diet (0.3 microg Cu/g diet, n = 6) for 5 weeks. The high-salt buffer (HSB) protein extract from heart tissue of Cu-deficient, but not Cu-adequate rats showed a 132 kDa protein band by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. This protein band stained pink with Coomassie Blue, suggesting the presence of collagens or other proline-rich proteins. Dot immunoblotting demonstrated that total type I collagen was increased by 110% in HSB protein extract from Cu-deficient, relative to Cu-adequate, rats. Liquid chromatography with mass spectrometry analysis indicated that the 132 kDa protein band contained a collagen alpha (I) chain precursor as well as a leucine-rich protein 130 (LRP130) in HSB protein extract from Cu-deficient but not Cu-adequate rats. A gel shift assay showed that HSB protein extract from Cu-deficient rats bound to a single-stranded cytosine-rich DNA with higher affinity than the extract of Cu-adequate rats, similar to reports of an increase in LRP130 single-stranded DNA binding activity in several types of tumor cells. Collectively, these results not only suggest an additional feature of altered collagen metabolism with Cu deficiency but also demonstrate for the first time an increase in single-stranded cytosine-rich DNA binding in Cu-deficient rat heart.

  15. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: tcheng@ntu.edu.tw [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)

    2013-02-01

    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ► To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ► ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ► PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ► The findings

  16. Swarm: robust and fast clustering method for amplicon-based studies

    Science.gov (United States)

    Rognes, Torbjørn; Quince, Christopher; de Vargas, Colomban; Dunthorn, Micah

    2014-01-01

    Popular de novo amplicon clustering methods suffer from two fundamental flaws: arbitrary global clustering thresholds, and input-order dependency induced by centroid selection. Swarm was developed to address these issues by first clustering nearly identical amplicons iteratively using a local threshold, and then by using clusters’ internal structure and amplicon abundances to refine its results. This fast, scalable, and input-order independent approach reduces the influence of clustering parameters and produces robust operational taxonomic units. PMID:25276506

  17. FlowClus: efficiently filtering and denoising pyrosequenced amplicons.

    Science.gov (United States)

    Gaspar, John M; Thomas, W Kelley

    2015-03-27

    Reducing the effects of sequencing errors and PCR artifacts has emerged as an essential component in amplicon-based metagenomic studies. Denoising algorithms have been designed that can reduce error rates in mock community data, but they change the sequence data in a manner that can be inconsistent with the process of removing errors in studies of real communities. In addition, they are limited by the size of the dataset and the sequencing technology used. FlowClus uses a systematic approach to filter and denoise reads efficiently. When denoising real datasets, FlowClus provides feedback about the process that can be used as the basis to adjust the parameters of the algorithm to suit the particular dataset. When used to analyze a mock community dataset, FlowClus produced a lower error rate compared to other denoising algorithms, while retaining significantly more sequence information. Among its other attributes, FlowClus can analyze longer reads being generated from all stages of 454 sequencing technology, as well as from Ion Torrent. It has processed a large dataset of 2.2 million GS-FLX Titanium reads in twelve hours; using its more efficient (but less precise) trie analysis option, this time was further reduced, to seven minutes. Many of the amplicon-based metagenomics datasets generated over the last several years have been processed through a denoising pipeline that likely caused deleterious effects on the raw data. By using FlowClus, one can avoid such negative outcomes while maintaining control over the filtering and denoising processes. Because of its efficiency, FlowClus can be used to re-analyze multiple large datasets together, thereby leading to more standardized conclusions. FlowClus is freely available on GitHub (jsh58/FlowClus); it is written in C and supported on Linux.

  18. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: skim1@lsuhsc.edu [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  19. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  20. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee

    2012-01-01

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  1. Deep amplicon sequencing reveals mixed phytoplasma infection within single grapevine plants

    DEFF Research Database (Denmark)

    Nicolaisen, Mogens; Contaldo, Nicoletta; Makarova, Olga

    2011-01-01

    The diversity of phytoplasmas within single plants has not yet been fully investigated. In this project, deep amplicon sequencing was used to generate 50,926 phytoplasma sequences from 11 phytoplasma-infected grapevine samples from a PCR amplicon in the 5' end of the 16S region. After clustering ...

  2. Metatranscriptomics and Amplicon Sequencing Reveal Mutualisms in Seagrass Microbiomes

    Directory of Open Access Journals (Sweden)

    Byron C. Crump

    2018-03-01

    Full Text Available Terrestrial plants benefit from many well-understood mutualistic relationships with root- and leaf-associated microbiomes, but relatively little is known about these relationships for seagrass and other aquatic plants. We used 16S rRNA gene amplicon sequencing and metatranscriptomics to assess potential mutualisms between microorganisms and the seagrasses Zostera marina and Zostera japonica collected from mixed beds in Netarts Bay, OR, United States. The phylogenetic composition of leaf-, root-, and water column-associated bacterial communities were strikingly different, but these communities were not significantly different between plant species. Many taxa present on leaves were related to organisms capable of consuming the common plant metabolic waste product methanol, and of producing agarases, which can limit the growth of epiphytic algae. Taxa present on roots were related to organisms capable of oxidizing toxic sulfur compounds and of fixing nitrogen. Metatranscriptomic sequencing identified expression of genes involved in all of these microbial metabolic processes at levels greater than typical water column bacterioplankton, and also identified expression of genes involved in denitrification and in bacterial synthesis of the plant growth hormone indole-3-acetate. These results provide the first evidence using metatranscriptomics that seagrass microbiomes carry out a broad range of functions that may benefit their hosts, and imply that microbe–plant mutualisms support the health and growth of aquatic plants.

  3. Use of AmpliWax to optimize amplicon sterilization by isopsoralen.

    OpenAIRE

    De la Viuda, M; Fille, M; Ruiz, J; Aslanzadeh, J

    1996-01-01

    The photochemical inactivation of amplicons by isopsoralen (IP-10) has been suggested as a possible means to prevent PCR carryover contamination. To evaluate the technique, serial dilutions of amplicons (10(11) to 10(3)) from the Borrelia burgdorferi OSP A gene were amplified in the presence of 0, 25, 50, and 100 micrograms of IP-10 per ml for 45 cycles. The PCR products were exposed to UV light for 15 min to activate IP-10 and sterilize the amplicons. One microliter of each sterilized sample...

  4. Improved Efficiency and Reliability of NGS Amplicon Sequencing Data Analysis for Genetic Diagnostic Procedures Using AGSA Software

    Directory of Open Access Journals (Sweden)

    Axel Poulet

    2016-01-01

    Full Text Available Screening for BRCA mutations in women with familial risk of breast or ovarian cancer is an ideal situation for high-throughput sequencing, providing large amounts of low cost data. However, 454, Roche, and Ion Torrent, Thermo Fisher, technologies produce homopolymer-associated indel errors, complicating their use in routine diagnostics. We developed software, named AGSA, which helps to detect false positive mutations in homopolymeric sequences. Seventy-two familial breast cancer cases were analysed in parallel by amplicon 454 pyrosequencing and Sanger dideoxy sequencing for genetic variations of the BRCA genes. All 565 variants detected by dideoxy sequencing were also detected by pyrosequencing. Furthermore, pyrosequencing detected 42 variants that were missed with Sanger technique. Six amplicons contained homopolymer tracts in the coding sequence that were systematically misread by the software supplied by Roche. Read data plotted as histograms by AGSA software aided the analysis considerably and allowed validation of the majority of homopolymers. As an optimisation, additional 250 patients were analysed using microfluidic amplification of regions of interest (Access Array Fluidigm of the BRCA genes, followed by 454 sequencing and AGSA analysis. AGSA complements a complete line of high-throughput diagnostic sequence analysis, reducing time and costs while increasing reliability, notably for homopolymer tracts.

  5. Isolation and characterization of Nylanderia fulva virus 1, a positive-sense, single-stranded RNA virus infecting the tawny crazy ant, Nylanderia fulva

    Energy Technology Data Exchange (ETDEWEB)

    Valles, Steven M., E-mail: steven.valles@ars.usda.gov [Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, 1600 SW 23rd Drive, Gainesville, FL 32608 (United States); Oi, David H.; Becnel, James J. [Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, 1600 SW 23rd Drive, Gainesville, FL 32608 (United States); Wetterer, James K. [Wilkes Honors College, Florida Atlantic University, 5353 Parkside Drive, Jupiter, FL 33458 (United States); LaPolla, John S. [Department of Biological Sciences, Towson University, 8000 York Road, Towson, MD 21252 (United States); Firth, Andrew E. [Department of Pathology, University of Cambridge, Cambridge CB2 1QP (United Kingdom)

    2016-09-15

    We report the discovery of Nylanderia fulva virus 1 (NfV-1), the first virus identified and characterized from the ant, Nylanderia fulva. The NfV-1 genome (GenBank accession KX024775) is 10,881 nucleotides in length, encoding one large open reading frame (ORF). Helicase, protease, RNA-dependent RNA polymerase, and jelly-roll capsid protein domains were recognized within the polyprotein. Phylogenetic analysis placed NfV-1 in an unclassified clade of viruses. Electron microscopic examination of negatively stained samples revealed particles with icosahedral symmetry with a diameter of 28.7±1.1 nm. The virus was detected by RT-PCR in larval, pupal, worker and queen developmental stages. However, the replicative strand of NfV-1 was only detected in larvae. Vertical transmission did not appear to occur, but horizontal transmission was facile. The inter-colonial field prevalence of NfV-1 was 52±35% with some local infections reaching 100%. NfV-1 was not detected in limited samples of other Nylanderia species or closely related ant species. - Highlights: • A new positive-strand RNA virus was discovered in the ant, Nylanderia fulva. • The Nylanderia fulva virus 1 genome was comprised of 10,881 nucleotides. • NfV-1 was detected in larval, pupal, queen and worker ants, but not eggs. • Replication of NfV-1 appeared to be limited to the larval stage.

  6. Characterization of Novel Genes With 8p11-12 Amplicon in Breast Cancer

    National Research Council Canada - National Science Library

    Yang, Zeng-Quan

    2004-01-01

    ...% of human breast cancer (HBC). Using chromosome comparative genomic hybridization (CGH) and array CGH, overlapping amplicons were found to be centered around chromosome 8p11-p12 in 3 breast cancer cell lines developed in Dr...

  7. Ro60-associated single-stranded RNA links inflammation with fetal cardiac fibrosis via ligation of TLRs: a novel pathway to autoimmune-associated heart block.

    Science.gov (United States)

    Clancy, Robert M; Alvarez, David; Komissarova, Elena; Barrat, Franck J; Swartz, Jordan; Buyon, Jill P

    2010-02-15

    Activation of TLR by ssRNA after FcgammaR-mediated phagocytosis of immune complexes (IC) may be relevant in autoimmune-associated congenital heart block (CHB) where the obligate factor is a maternal anti-SSA/Ro Ab and the fetal factors, protein/RNA on an apoptotic cardiocyte and infiltrating macrophages. This study addressed the hypothesis that Ro60-associated ssRNAs link macrophage activation to fibrosis via TLR engagement. Both macrophage transfection with noncoding ssRNA that bind Ro60 and an IC generated by incubation of Ro60-ssRNA with an IgG fraction from a CHB mother or affinity purified anti-Ro60 significantly increased TNF-alpha secretion, an effect not observed using control RNAs or normal IgG. Dependence on TLR was supported by the significant inhibition of TNF-alpha release by IRS661 and chloroquine. The requirement for FcgammaRIIIa-mediated delivery was provided by inhibition with an anti-CD16a Ab. Fibrosis markers were noticeably increased in fetal cardiac fibroblasts after incubation with supernatants generated from macrophages transfected with ssRNA or incubated with the IC. Supernatants generated from macrophages with ssRNA in the presence of IRS661 or chloroquine did not cause fibrosis. In a CHB heart, but not a healthy heart, TLR7 immunostaining was localized to a region near the atrioventricular groove at a site enriched in mononuclear cells and fibrosis. These data support a novel injury model in CHB, whereby endogenous ligand, Ro60-associated ssRNA, forges a nexus between TLR ligation and fibrosis instigated by binding of anti-Ro Abs to the target protein likely accessible via apoptosis.

  8. Efficient error correction for next-generation sequencing of viral amplicons

    Directory of Open Access Journals (Sweden)

    Skums Pavel

    2012-06-01

    Full Text Available Abstract Background Next-generation sequencing allows the analysis of an unprecedented number of viral sequence variants from infected patients, presenting a novel opportunity for understanding virus evolution, drug resistance and immune escape. However, sequencing in bulk is error prone. Thus, the generated data require error identification and correction. Most error-correction methods to date are not optimized for amplicon analysis and assume that the error rate is randomly distributed. Recent quality assessment of amplicon sequences obtained using 454-sequencing showed that the error rate is strongly linked to the presence and size of homopolymers, position in the sequence and length of the amplicon. All these parameters are strongly sequence specific and should be incorporated into the calibration of error-correction algorithms designed for amplicon sequencing. Results In this paper, we present two new efficient error correction algorithms optimized for viral amplicons: (i k-mer-based error correction (KEC and (ii empirical frequency threshold (ET. Both were compared to a previously published clustering algorithm (SHORAH, in order to evaluate their relative performance on 24 experimental datasets obtained by 454-sequencing of amplicons with known sequences. All three algorithms show similar accuracy in finding true haplotypes. However, KEC and ET were significantly more efficient than SHORAH in removing false haplotypes and estimating the frequency of true ones. Conclusions Both algorithms, KEC and ET, are highly suitable for rapid recovery of error-free haplotypes obtained by 454-sequencing of amplicons from heterogeneous viruses. The implementations of the algorithms and data sets used for their testing are available at: http://alan.cs.gsu.edu/NGS/?q=content/pyrosequencing-error-correction-algorithm

  9. The Rev1 interacting region (RIR) motif in the scaffold protein XRCC1 mediates a low-affinity interaction with polynucleotide kinase/phosphatase (PNKP) during DNA single-strand break repair.

    Science.gov (United States)

    Breslin, Claire; Mani, Rajam S; Fanta, Mesfin; Hoch, Nicolas; Weinfeld, Michael; Caldecott, Keith W

    2017-09-29

    The scaffold protein X-ray repair cross-complementing 1 (XRCC1) interacts with multiple enzymes involved in DNA base excision repair and single-strand break repair (SSBR) and is important for genetic integrity and normal neurological function. One of the most important interactions of XRCC1 is that with polynucleotide kinase/phosphatase (PNKP), a dual-function DNA kinase/phosphatase that processes damaged DNA termini and that, if mutated, results in ataxia with oculomotor apraxia 4 (AOA4) and microcephaly with early-onset seizures and developmental delay (MCSZ). XRCC1 and PNKP interact via a high-affinity phosphorylation-dependent interaction site in XRCC1 and a forkhead-associated domain in PNKP. Here, we identified using biochemical and biophysical approaches a second PNKP interaction site in XRCC1 that binds PNKP with lower affinity and independently of XRCC1 phosphorylation. However, this interaction nevertheless stimulated PNKP activity and promoted SSBR and cell survival. The low-affinity interaction site required the highly conserved Rev1-interacting region (RIR) motif in XRCC1 and included three critical and evolutionarily invariant phenylalanine residues. We propose a bipartite interaction model in which the previously identified high-affinity interaction acts as a molecular tether, holding XRCC1 and PNKP together and thereby promoting the low-affinity interaction identified here, which then stimulates PNKP directly. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  11. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  12. OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

    Directory of Open Access Journals (Sweden)

    Kevin M. Bradley

    2014-08-01

    Full Text Available Synthetic biologists wishing to self-assemble large DNA (L-DNA constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson–Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS, and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting" software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

  13. The interaction of hyperthermophilic TATA-box binding protein with single-stranded DNA is entropically favorable and exhibits a large negative heat capacity change at high salt concentration.

    Science.gov (United States)

    Nagatoishi, Satoru; Tanaka, Yoshikazu; Kudou, Motonori; Tsumoto, Kouhei

    2009-09-01

    We have investigated the thermodynamics of the interaction between the TATA-box-binding protein from Pyrococcus horikoshii (PhoTBP) and its target DNA (TATA-1). The interaction between PhoTBP and double-stranded DNA (dsDNA) is entropically favorable and enthalpically unfavorable. The thermodynamic parameters for TATA-1 duplex formation in the presence of PhoTBP, that is, ternary PhoTBP-dsDNA complexation, are similar to those for TATA-1 duplex formation, which is enthalpically favorable. Surface plasmon resonance analysis indicates that the interaction between PhoTBP and single-stranded DNA (ssDNA) of TATA-1 is entropy driven and has a large negative heat capacity change (-1.19 kcal mol(-1) K(-1)) at high salt concentration (800 mM NaCl). These results suggest that the favorable entropic effect corresponding to the interaction between PhoTBP and dsDNA is due not to ternary complexation but to the interaction between PhoTBP and ssDNA. This report is the first to describe the thermodynamics of the interaction between TBP and ssDNA.

  14. Genome editing using FACS enrichment of nuclease-expressing cells and indel detection by amplicon analysis

    DEFF Research Database (Denmark)

    Lonowski, Lindsey A; Narimatsu, Yoshiki; Riaz, Anjum

    2017-01-01

    ). First, Indel Detection by Amplicon Analysis (IDAA) determines the size and frequency of insertions and deletions elicited by nucleases in cells, tissues or embryos through analysis of fluorophore-labeled PCR amplicons covering the nuclease target site by capillary electrophoresis in a sequenator. Second...... the testing of new nuclease reagents and the generation of edited cell pools or clonal cell lines, reducing the number of clones that need to be generated and increasing the ease with which they are screened. The pipeline shortens the time line, but it most prominently reduces the workload of cell...

  15. Use of AmpliWax to optimize amplicon sterilization by isopsoralen.

    Science.gov (United States)

    De la Viuda, M; Fille, M; Ruiz, J; Aslanzadeh, J

    1996-12-01

    The photochemical inactivation of amplicons by isopsoralen (IP-10) has been suggested as a possible means to prevent PCR carryover contamination. To evaluate the technique, serial dilutions of amplicons (10(11) to 10(3)) from the Borrelia burgdorferi OSP A gene were amplified in the presence of 0, 25, 50, and 100 micrograms of IP-10 per ml for 45 cycles. The PCR products were exposed to UV light for 15 min to activate IP-10 and sterilize the amplicons. One microliter of each sterilized sample was reamplified for an additional 45 cycles. The PCR products were then resolved in an agarose gel, blotted onto a nylon membrane, and probed with an alkaline phosphatase-conjugated chemiluminescent probe. Although IP-10 at concentrations of 50 and 100 micrograms/ml effectively sterilized up to 10(11) amplicons, the compound was inhibitory to PCR. IP-10 at a concentration of 25 micrograms/ml had slight inhibitory effect on PCR and did not completely sterilized all of the amplicons. Therefore, in subsequent experiments AmpliWax was substituted for mineral oil, and PCR was performed on 10(9) to 10(3) amplicons as described above. Following the amplification, the PCR tubes were cooled to solidify the AmpliWax and inoculated with various concentrations of IP-10. With this technique, PCR products produced from as many as 10(9) target amplicons were effectively sterilized with 200 micrograms of IP-10 per ml. Similarly, the addition of IP-10 (50 micrograms/ml) before and after PCR was evaluated for the detection of B. burgdorferi in 62 ticks from a region of Southern Connecticut where the organism is highly endemic. PCR performed in the presence of 50 micrograms of IP-10 per ml detected B. burgdorferi-specific DNA in 17 of 62 ticks (27%) following gel electrophoresis and in 34 of 62 ticks (55%) following Southern blot hybridization of the PCR products. In contrast, post-PCR addition of IP-10 detected borrelia-specific DNA in 31 of 62 ticks (50%) following gel electrophoresis and in

  16. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

    2003-01-01

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  17. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  18. A G-C-rich palindromic structural motif and a stretch of single-stranded purines are required for optimal packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA.

    Science.gov (United States)

    Jaballah, Soumeya Ali; Aktar, Suriya J; Ali, Jahabar; Phillip, Pretty Susan; Al Dhaheri, Noura Salem; Jabeen, Aayesha; Rizvi, Tahir A

    2010-09-03

    During retroviral RNA packaging, two copies of genomic RNA are preferentially packaged into the budding virus particles whereas the spliced viral RNAs and the cellular RNAs are excluded during this process. Specificity towards retroviral RNA packaging is dependent upon sequences at the 5' end of the viral genome, which at times extend into Gag sequences. It has earlier been suggested that the Mason-Pfizer monkey virus (MPMV) contains packaging sequences within the 5' untranslated region (UTR) and Gag. These studies have also suggested that the packaging determinants of MPMV that lie in the UTR are bipartite and are divided into two regions both upstream and downstream of the major splice donor. However, the precise boundaries of these discontinuous regions within the UTR and the role of the intervening sequences between these dipartite sequences towards MPMV packaging have not been investigated. Employing a combination of genetic and structural prediction analyses, we have shown that region "A", immediately downstream of the primer binding site, is composed of 50 nt, whereas region "B" is composed of the last 23 nt of UTR, and the intervening 55 nt between these two discontinuous regions do not contribute towards MPMV RNA packaging. In addition, we have identified a 14-nt G-C-rich palindromic sequence (with 100% autocomplementarity) within region A that has been predicted to fold into a structural motif and is essential for optimal MPMV RNA packaging. Furthermore, we have also identified a stretch of single-stranded purines (ssPurines) within the UTR and 8 nt of these ssPurines are duplicated in region B. The native ssPurines or its repeat in region B when predicted to refold as ssPurines has been shown to be essential for RNA packaging, possibly functioning as a potential nucleocapsid binding site. Findings from this study should enhance our understanding of the steps involved in MPMV replication including RNA encapsidation process. Copyright (c) 2010 Elsevier Ltd

  19. A single-stranded conformational polymorphism (SSCP)-derived quantitative variable to monitor the virulence of a Barley yellow dwarf virus-PAV (BYDV-PAV) isolate during adaptation to the TC14 resistant wheat line.

    Science.gov (United States)

    Delaunay, Agnes; Lacroix, Christelle; Morliere, Stephanie; Riault, Gerard; Chain, Florian; Trottet, Maxime; Jacquot, Emmanuel

    2010-09-01

    A standardized single-stranded conformational polymorphism (SSCP) procedure is proposed as an alternative to the time-consuming biological characterization of Barley yellow dwarf virus-PAV (BYDV-PAV) isolates. Using this procedure, six of 21 overlapping regions used to scan the viral genome gave patterns specific to '4E' (avirulent) or '4T' ('4E'-derived virulent) isolates. The calibration of samples and integration of SSCP patterns corresponding to the nucleotide region 1482-2023 allowed the estimation of P(T) values that reflect the proportions of a '4T'-specific band. Analysis of the biological (area under the pathogen progress curve) and molecular (P(T)) data suggested a positive linear relation between these variables. Moreover, sequence analysis of the nucleotide region 1482-2023 highlighted the presence of a nucleotide polymorphism (C/A(1835)) which can be considered as a candidate for virus-host interactions linked to the monitored virulence. According to these parameters, P(T) values associated with '4E'- and '4T'-derived populations show that: (i) long-term infection of a BYDV-PAV isolate on the 'TC14' resistant host leads to the fixation of virulent individuals in viral populations; and (ii) the introduction of susceptible hosts in successive 'TC14' infections results in the maintenance of low virulence of the populations. Thus, the presented study demonstrates that SSCP is a useful tool for monitoring viral populations during the host adaptation process. The described impact of host alternation provides new opportunities for the use of the 'TC14' resistance source in BYDV-resistant breeding programmes. This study is part of the global effort made by the scientific community to propose sustainable alternatives to the chemical control of this viral disease.

  20. Ex vivo gene editing of the dystrophin gene in muscle stem cells mediated by peptide nucleic acid single stranded oligodeoxynucleotides induces stable expression of dystrophin in a mouse model for Duchenne muscular dystrophy.

    Science.gov (United States)

    Nik-Ahd, Farnoosh; Bertoni, Carmen

    2014-07-01

    Duchenne muscular dystrophy (DMD) is a fatal disease caused by mutations in the dystrophin gene, which result in the complete absence of dystrophin protein throughout the body. Gene correction strategies hold promise to treating DMD. Our laboratory has previously demonstrated the ability of peptide nucleic acid single-stranded oligodeoxynucleotides (PNA-ssODNs) to permanently correct single-point mutations at the genomic level. In this study, we show that PNA-ssODNs can target and correct muscle satellite cells (SCs), a population of stem cells capable of self-renewing and differentiating into muscle fibers. When transplanted into skeletal muscles, SCs transfected with correcting PNA-ssODNs were able to engraft and to restore dystrophin expression. The number of dystrophin-positive fibers was shown to significantly increase over time. Expression was confirmed to be the result of the activation of a subpopulation of SCs that had undergone repair as demonstrated by immunofluorescence analyses of engrafted muscles using antibodies specific to full-length dystrophin transcripts and by genomic DNA analysis of dystrophin-positive fibers. Furthermore, the increase in dystrophin expression detected over time resulted in a significant improvement in muscle morphology. The ability of transplanted cells to return into quiescence and to activate upon demand was confirmed in all engrafted muscles following injury. These results demonstrate the feasibility of using gene editing strategies to target and correct SCs and further establish the therapeutic potential of this approach to permanently restore dystrophin expression into muscle of DMD patients. © 2014 AlphaMed Press.

  1. Amplicon sequencing for the quantification of spoilage microbiota in complex foods including bacterial spores

    NARCIS (Netherlands)

    Boer, de P.; Caspers, M.; Sanders, J.W.; Kemperman, R.; Wijman, J.; Lommerse, G.; Roeselers, G.; Montijn, R.; Abee, T.; Kort, R.

    2015-01-01

    Background
    Spoilage of food products is frequently caused by bacterial spores and lactic acid bacteria. Identification of these organisms by classic cultivation methods is limited by their ability to form colonies on nutrient agar plates. In this study, we adapted and optimized 16S rRNA amplicon

  2. Overexpressed Genes/ESTs and Characterization of Distinct Amplicons on 17823 in Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Ayse E. Erson

    2001-01-01

    Full Text Available 17823 is a frequent site of gene amplification in breast cancer. Several lines of evidence suggest the presence of multiple amplicons on 17823. To characterize distinct amplicons on 17823 and localize putative oncogenes, we screened genes and expressed sequence tags (ESTs in existing physical and radiation hybrid maps for amplification and overexpression in breast cancer cell lines by semiquantitative duplex PCR, semiquantitative duplex RT-PCR, Southern blot, Northern blot analyses. We identified two distinct amplicons on 17823, one including TBX2 and another proximal region including RPS6KB1 (PS6K and MUL. In addition to these previously reported overexpressed genes, we also identified amplification and overexpression of additional uncharacterized genes and ESTs, some of which suggest potential oncogenic activity. In conclusion, we have further defined two distinct regions of gene amplification and overexpression on 17823 with identification of new potential oncogene candidates. Based on the amplification and overexpression patterns of known and as of yet unrecognized genes on 17823, it is likely that some of these genes mapping to the discrete amplicons function as oncogenes and contribute to tumor progression in breast cancer cells.

  3. Global Perspectives on Activated Sludge Community Composition analyzed using 16S rRNA amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Saunders, Aaron Marc; Albertsen, Mads

    Activated sludge is the most commonly applied bioprocess throughout the world for wastewater treatment. Microorganisms are key to the process, yet our knowledge of their identity and function is still limited. High-througput16S rRNA amplicon sequencing can reliably characterize microbial...

  4. Improved sensitivity of circulating tumor DNA measurement using short PCR amplicons

    DEFF Research Database (Denmark)

    Andersen, Rikke Fredslund; Spindler, Karen-Lise Garm; Brandslund, Ivan

    2015-01-01

    , however, presents a number of challenges that require attention. The amount of DNA is low and highly fragmented and analyses need to be optimized accordingly. KRAS ARMS-qPCR assays with amplicon lengths of 120 and 85 base pairs, respectively, were compared using positive control material (PCR fragments...

  5. Characterization of the 17p amplicon in human sarcomas: microsatellite marker analysis

    NARCIS (Netherlands)

    Wolf, M.; Tarkkanen, M.; Hulsebos, T.; Larramendy, M. L.; Forus, A.; Myklebost, O.; Aaltonen, L. A.; Elomaa, I.; Knuutila, S.

    1999-01-01

    The structure of the 17p amplicon from 9 human sarcoma specimens evaluated by comparative genomic hybridization (CGH) has been studied by analyzing 28 microsatellite markers by PCR. Eleven sarcoma specimens showing no DNA copy number increases at 17p by CGH were analyzed as control samples. Five

  6. The influence of amplicon length on real-time PCR results

    Directory of Open Access Journals (Sweden)

    Debode, F.

    2017-01-01

    Full Text Available Description of the subject. This paper discusses the influence of amplicon length on real-time PCR results. Objectives. The aim of the experiments was to show that amplicon size has an influence on detection. Method. Tests were performed on genomic and plasmid DNA. Double-dye probes and SYBR® Green were used for detection by real-time PCR. Primers were selected in order to produce fragments with increasing sizes. Experiments dealt with two targets: an endogenous target for soybean (part of the lectin gene and a transgenic target (junction P35S-CTP of the MON40-3-2 soybean. Results. The results show that the kinetics of amplification curves evolve as a function of amplicon length, and smaller amplicons yield a higher level of fluorescence for the plateau phase. DNA degradation within the sample as well as the principles of fluorescence acquisition as a function of the chemistry used can also be factors. Conclusions. It was experimentally shown that the observed effect is linked to the suboptimal elongation temperature used in real-time PCR. Detection using SYBR® Green is less impacted as the loss of efficiency is partially compensated by the greater integration of SYBR® Green molecules in the larger fragments.

  7. Mutagenesis of the Agrobacterium VirE2 single-stranded DNA-binding protein identifies regions required for self-association and interaction with VirE1 and a permissive site for hybrid protein construction.

    Science.gov (United States)

    Zhou, X R; Christie, P J

    1999-07-01

    The VirE2 single-stranded DNA-binding protein (SSB) of Agrobacterium tumefaciens is required for delivery of T-DNA to the nuclei of susceptible plant cells. By yeast two-hybrid and immunoprecipitation analyses, VirE2 was shown to self-associate and to interact with VirE1. VirE2 mutants with small deletions or insertions of a 31-residue oligopeptide (i31) at the N or C terminus or with an i31 peptide insertion at Leu236 retained the capacity to form homomultimers. By contrast, VirE2 mutants with modifications outside a central region located between residues 320 and 390 retained the capacity to interact with VirE1. These findings suggest the tertiary structure of VirE2 is important for homomultimer formation whereas a central domain mediates formation of a complex with VirE1. The capacity of VirE2 mutants to interact with full-length VirE2 in the yeast Saccharomyces cerevisiae correlated with the abundance of the mutant proteins in A. tumefaciens, suggesting that VirE2 is stabilized by homomultimerization in the bacterium. We further characterized the promoter and N- and C-terminal sequence requirements for synthesis of functional VirE2. A PvirB::virE2 construct yielded functional VirE2 protein as defined by complementation of a virE2 null mutation. By contrast, PvirE or Plac promoter constructs yielded functional VirE2 only if virE1 was coexpressed with virE2. Deletion of 10 or 9 residues from the N or C terminus of VirE2, respectively, or addition of heterologous peptides or proteins to either terminus resulted in a loss of protein function. However, an i31 peptide insertion at Tyr39 had no effect on protein function as defined by the capacity of the mutant protein to (i) interact with native VirE2, (ii) interact with VirE1, (iii) accumulate at abundant levels in A. tumefaciens, and (iv) restore wild-type virulence to a virE2 null mutant. We propose that Tyr39 of VirE2 corresponds to a permissive site for insertion of heterologous peptides or proteins of interest

  8. Bacterial and viral identification and differentiation by amplicon sequencing on the MinION nanopore sequencer.

    Science.gov (United States)

    Kilianski, Andy; Haas, Jamie L; Corriveau, Elizabeth J; Liem, Alvin T; Willis, Kristen L; Kadavy, Dana R; Rosenzweig, C Nicole; Minot, Samuel S

    2015-01-01

    The MinION™ nanopore sequencer was recently released to a community of alpha-testers for evaluation using a variety of sequencing applications. Recent reports have tested the ability of the MinION™ to act as a whole genome sequencer and have demonstrated that nanopore sequencing has tremendous potential utility. However, the current nanopore technology still has limitations with respect to error-rate, and this is problematic when attempting to assemble whole genomes without secondary rounds of sequencing to correct errors. In this study, we tested the ability of the MinION™ nanopore sequencer to accurately identify and differentiate bacterial and viral samples via directed sequencing of characteristic genes shared broadly across a target clade. Using a 6 hour sequencing run time, sufficient data were generated to identify an E. coli sample down to the species level from 16S rDNA amplicons. Three poxviruses (cowpox, vaccinia-MVA, and vaccinia-Lister) were identified and differentiated down to the strain level, despite over 98% identity between the vaccinia strains. The ability to differentiate strains by amplicon sequencing on the MinION™ was accomplished despite an observed per-base error rate of approximately 30%. While nanopore sequencing, using the MinION™ platform from Oxford Nanopore in particular, continues to mature into a commercially available technology, practical uses are sought for the current versions of the technology. This study offers evidence of the utility of amplicon sequencing by demonstrating that the current versions of MinION™ technology can accurately identify and differentiate both viral and bacterial species present within biological samples via amplicon sequencing.

  9. Analysing 454 amplicon resequencing experiments using the modular and database oriented Variant Identification Pipeline

    Directory of Open Access Journals (Sweden)

    Deforce Dieter

    2010-05-01

    Full Text Available Abstract Background Next-generation amplicon sequencing enables high-throughput genetic diagnostics, sequencing multiple genes in several patients together in one sequencing run. Currently, no open-source out-of-the-box software solution exists that reliably reports detected genetic variations and that can be used to improve future sequencing effectiveness by analyzing the PCR reactions. Results We developed an integrated database oriented software pipeline for analysis of 454/Roche GS-FLX amplicon resequencing experiments using Perl and a relational database. The pipeline enables variation detection, variation detection validation, and advanced data analysis, which provides information that can be used to optimize PCR efficiency using traditional means. The modular approach enables customization of the pipeline where needed and allows researchers to adopt their analysis pipeline to their experiments. Clear documentation and training data is available to test and validate the pipeline prior to using it on real sequencing data. Conclusions We designed an open-source database oriented pipeline that enables advanced analysis of 454/Roche GS-FLX amplicon resequencing experiments using SQL-statements. This modular database approach allows easy coupling with other pipeline modules such as variant interpretation or a LIMS system. There is also a set of standard reporting scripts available.

  10. Comparison of somatic mutation calling methods in amplicon and whole exome sequence data.

    Science.gov (United States)

    Xu, Huilei; DiCarlo, John; Satya, Ravi Vijaya; Peng, Quan; Wang, Yexun

    2014-03-28

    High-throughput sequencing is rapidly becoming common practice in clinical diagnosis and cancer research. Many algorithms have been developed for somatic single nucleotide variant (SNV) detection in matched tumor-normal DNA sequencing. Although numerous studies have compared the performance of various algorithms on exome data, there has not yet been a systematic evaluation using PCR-enriched amplicon data with a range of variant allele fractions. The recently developed gold standard variant set for the reference individual NA12878 by the NIST-led "Genome in a Bottle" Consortium (NIST-GIAB) provides a good resource to evaluate admixtures with various SNV fractions. Using the NIST-GIAB gold standard, we compared the performance of five popular somatic SNV calling algorithms (GATK UnifiedGenotyper followed by simple subtraction, MuTect, Strelka, SomaticSniper and VarScan2) for matched tumor-normal amplicon and exome sequencing data. We demonstrated that the five commonly used somatic SNV calling methods are applicable to both targeted amplicon and exome sequencing data. However, the sensitivities of these methods vary based on the allelic fraction of the mutation in the tumor sample. Our analysis can assist researchers in choosing a somatic SNV calling method suitable for their specific needs.

  11. Amplicon sequencing for the quantification of spoilage microbiota in complex foods including bacterial spores.

    Science.gov (United States)

    de Boer, Paulo; Caspers, Martien; Sanders, Jan-Willem; Kemperman, Robèr; Wijman, Janneke; Lommerse, Gijs; Roeselers, Guus; Montijn, Roy; Abee, Tjakko; Kort, Remco

    2015-01-01

    Spoilage of food products is frequently caused by bacterial spores and lactic acid bacteria. Identification of these organisms by classic cultivation methods is limited by their ability to form colonies on nutrient agar plates. In this study, we adapted and optimized 16S rRNA amplicon sequencing for quantification of bacterial spores in a canned food matrix and for monitoring the outgrowth of spoilage microbiota in a ready-to-eat food matrix. The detection limit of bar-coded 16S rRNA amplicon sequencing was determined for the number of bacterial spores in a canned food matrix. Analysis of samples from a canned food matrix spiked with a mixture of equinumerous spores from the thermophiles, Geobacillus stearothermophilus and Geobacillus thermoglucosidans, and the mesophiles, Bacillus sporothermodurans, Bacillus cereus, and Bacillus subtilis, led to the detection of these spores with an average limit of 2 × 10(2) spores ml(-1). The data were normalized by setting the number of sequences resulting from DNA of an inactivated bacterial species, present in the matrix at the same concentration in all samples, to a fixed value for quantitative sample-to-sample comparisons. The 16S rRNA amplicon sequencing method was also employed to monitor population dynamics in a ready-to-eat rice meal, incubated over a period of 12 days at 7 °C. The most predominant outgrowth was observed by the genera Leuconostoc, Bacillus, and Paenibacillus. Analysis of meals pre-treated with weak acids showed inhibition of outgrowth of these three genera. The specificity of the amplicon synthesis was improved by the design of oligonucleotides that minimize the amplification of 16S rRNA genes from chloroplasts originating from plant-based material present in the food. This study shows that the composition of complex spoilage populations, including bacterial spores, can be monitored in complex food matrices by bar-coded amplicon sequencing in a quantitative manner. In order to allow sample

  12. Genetic relationships and diversity of Jatropha curcas accessions in ...

    African Journals Online (AJOL)

    This study has been undertaken to assess the extent of genetic diversity in a representative set of 16 accessions of Jatropha curcas. Inter-simple sequence repeat (ISSR) analysis was used to establish the genetic relationship among the accessions. From the eight ISSR primers used, the number of amplicons per primers ...

  13. Sequence-specific validation of LAMP amplicons in real-time optomagnetic detection of Dengue serotype 2 synthetic DNA

    DEFF Research Database (Denmark)

    Minero, Gabriel Khose Antonio; Nogueira, Catarina; Rizzi, Giovanni

    2017-01-01

    magnetic nanoparticles attached to biotinylated LAMP amplicons. We demonstrate detection of sub-femtomolar Dengue DNA target concentrations in the ideal contamination-free lab environment within 20 min. The second detection approach is based on sequence-specific binding of functionalised magnetic...... nanoparticles to loops of LAMP amplicons. Melting studies reveal that true positive and spurious amplicons have different melting points and this allows us to discriminate between them. This is found to be in a good agreement with subsequent studies on real-time sequence-specific discrimination of LAMP...... amplicons. The specific binding causes clustering of magnetic nanoparticles via binding to multiple sites (loops) emerging in the elongation phase of LAMP. Formation of nanoclusters is monitored via the depletion of the optomagnetic signal due to free nanoparticles. After sequence-specific validation, we...

  14. Ultra-high resolution HLA genotyping and allele discovery by highly multiplexed cDNA amplicon pyrosequencing

    Directory of Open Access Journals (Sweden)

    Lank Simon M

    2012-08-01

    Full Text Available Abstract Background High-resolution HLA genotyping is a critical diagnostic and research assay. Current methods rarely achieve unambiguous high-resolution typing without making population-specific frequency inferences due to a lack of locus coverage and difficulty in exon-phase matching. Achieving high-resolution typing is also becoming more challenging with traditional methods as the database of known HLA alleles increases. Results We designed a cDNA amplicon-based pyrosequencing method to capture 94% of the HLA class I open-reading-frame with only two amplicons per sample, and an analogous method for class II HLA genes, with a primary focus on sequencing the DRB loci. We present a novel Galaxy server-based analysis workflow for determining genotype. During assay validation, we performed two GS Junior sequencing runs to determine the accuracy of the HLA class I amplicons and DRB amplicon at different levels of multiplexing. When 116 amplicons were multiplexed, we unambiguously resolved 99%of class I alleles to four- or six-digit resolution, as well as 100% unambiguous DRB calls. The second experiment, with 271 multiplexed amplicons, missed some alleles, but generated high-resolution, concordant typing for 93% of class I alleles, and 96% for DRB1 alleles. In a third, preliminary experiment we attempted to sequence novel amplicons for other class II loci with mixed success. Conclusions The presented assay is higher-throughput and higher-resolution than existing HLA genotyping methods, and suitable for allele discovery or large cohort sampling. The validated class I and DRB primers successfully generated unambiguously high-resolution genotypes, while further work is needed to validate additional class II genotyping amplicons.

  15. Mining environmental high-throughput sequence data sets to identify divergent amplicon clusters for phylogenetic reconstruction and morphotype visualization.

    Science.gov (United States)

    Gimmler, Anna; Stoeck, Thorsten

    2015-08-01

    Environmental high-throughput sequencing (envHTS) is a very powerful tool, which in protistan ecology is predominantly used for the exploration of diversity and its geographic and local patterns. We here used a pyrosequenced V4-SSU rDNA data set from a solar saltern pond as test case to exploit such massive protistan amplicon data sets beyond this descriptive purpose. Therefore, we combined a Swarm-based blastn network including 11 579 ciliate V4 amplicons to identify divergent amplicon clusters with targeted polymerase chain reaction (PCR) primer design for full-length small subunit of the ribosomal DNA retrieval and probe design for fluorescence in situ hybridization (FISH). This powerful strategy allows to benefit from envHTS data sets to (i) reveal the phylogenetic position of the taxon behind divergent amplicons; (ii) improve phylogenetic resolution and evolutionary history of specific taxon groups; (iii) solidly assess an amplicons (species') degree of similarity to its closest described relative; (iv) visualize the morphotype behind a divergent amplicons cluster; (v) rapidly FISH screen many environmental samples for geographic/habitat distribution and abundances of the respective organism and (vi) to monitor the success of enrichment strategies in live samples for cultivation and isolation of the respective organisms. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  16. Amplicon-based metagenomics identified candidate organisms in soils that caused yield decline in strawberry

    OpenAIRE

    Xiangming Xu; Thomas Passey; Feng Wei; Robert Saville; Richard J. Harrison

    2015-01-01

    A phenomenon of yield decline due to weak plant growth in strawberry was recently observed in non-chemo-fumigated soils, which was not associated with the soil fungal pathogen Verticillium dahliae, the main target of fumigation. Amplicon-based metagenomics was used to profile soil microbiota in order to identify microbial organisms that may have caused the yield decline. A total of 36 soil samples were obtained in 2013 and 2014 from four sites for metagenomic studies; two of the four sites ha...

  17. Bacterial tag encoded FLX titanium amplicon pyrosequencing (bTEFAP based assessment of prokaryotic diversity in metagenome of Lonar soda lake, India

    Directory of Open Access Journals (Sweden)

    Pravin Dudhagara

    2015-06-01

    Full Text Available Bacterial diversity and archaeal diversity in metagenome of the Lonar soda lake sediment were assessed by bacterial tag-encoded FLX amplicon pyrosequencing (bTEFAP. Metagenome comprised 5093 sequences with 2,531,282 bp and 53 ± 2% G + C content. Metagenome sequence data are available at NCBI under the Bioproject database with accession no. PRJNA218849. Metagenome sequence represented the presence of 83.1% bacterial and 10.5% archaeal origin. A total of 14 different bacteria demonstrating 57 species were recorded with dominating species like Coxiella burnetii (17%, Fibrobacter intestinalis (12% and Candidatus Cloacamonas acidaminovorans (11%. Occurrence of two archaeal phyla representing 24 species, among them Methanosaeta harundinacea (35%, Methanoculleus chikugoensis (12% and Methanolinea tarda (11% were dominating species. Significant presence of 11% sequences as an unclassified indicated the possibilities for unknown novel prokaryotes from the metagenome.

  18. Amplicon-based metagenomics identified candidate organisms in soils that caused yield decline in strawberry.

    Science.gov (United States)

    Xu, Xiangming; Passey, Thomas; Wei, Feng; Saville, Robert; Harrison, Richard J

    2015-01-01

    A phenomenon of yield decline due to weak plant growth in strawberry was recently observed in non-chemo-fumigated soils, which was not associated with the soil fungal pathogen Verticillium dahliae, the main target of fumigation. Amplicon-based metagenomics was used to profile soil microbiota in order to identify microbial organisms that may have caused the yield decline. A total of 36 soil samples were obtained in 2013 and 2014 from four sites for metagenomic studies; two of the four sites had a yield-decline problem, the other two did not. More than 2000 fungal or bacterial operational taxonomy units (OTUs) were found in these samples. Relative abundance of individual OTUs was statistically compared for differences between samples from sites with or without yield decline. A total of 721 individual comparisons were statistically significant - involving 366 unique bacterial and 44 unique fungal OTUs. Based on further selection criteria, we focused on 34 bacterial and 17 fungal OTUs and found that yield decline resulted probably from one or more of the following four factors: (1) low abundance of Bacillus and Pseudomonas populations, which are well known for their ability of supressing pathogen development and/or promoting plant growth; (2) lack of the nematophagous fungus (Paecilomyces species); (3) a high level of two non-specific fungal root rot pathogens; and (4) wet soil conditions. This study demonstrated the usefulness of an amplicon-based metagenomics approach to profile soil microbiota and to detect differential abundance in microbes.

  19. A priori Considerations When Conducting High-Throughput Amplicon-Based Sequence Analysis

    Directory of Open Access Journals (Sweden)

    Aditi Sengupta

    2016-03-01

    Full Text Available Amplicon-based sequencing strategies that include 16S rRNA and functional genes, alongside “meta-omics” analyses of communities of microorganisms, have allowed researchers to pose questions and find answers to “who” is present in the environment and “what” they are doing. Next-generation sequencing approaches that aid microbial ecology studies of agricultural systems are fast gaining popularity among agronomy, crop, soil, and environmental science researchers. Given the rapid development of these high-throughput sequencing techniques, researchers with no prior experience will desire information about the best practices that can be used before actually starting high-throughput amplicon-based sequence analyses. We have outlined items that need to be carefully considered in experimental design, sampling, basic bioinformatics, sequencing of mock communities and negative controls, acquisition of metadata, and in standardization of reaction conditions as per experimental requirements. Not all considerations mentioned here may pertain to a particular study. The overall goal is to inform researchers about considerations that must be taken into account when conducting high-throughput microbial DNA sequencing and sequences analysis.

  20. Insight into biases and sequencing errors for amplicon sequencing with the Illumina MiSeq platform.

    Science.gov (United States)

    Schirmer, Melanie; Ijaz, Umer Z; D'Amore, Rosalinda; Hall, Neil; Sloan, William T; Quince, Christopher

    2015-03-31

    With read lengths of currently up to 2 × 300 bp, high throughput and low sequencing costs Illumina's MiSeq is becoming one of the most utilized sequencing platforms worldwide. The platform is manageable and affordable even for smaller labs. This enables quick turnaround on a broad range of applications such as targeted gene sequencing, metagenomics, small genome sequencing and clinical molecular diagnostics. However, Illumina error profiles are still poorly understood and programs are therefore not designed for the idiosyncrasies of Illumina data. A better knowledge of the error patterns is essential for sequence analysis and vital if we are to draw valid conclusions. Studying true genetic variation in a population sample is fundamental for understanding diseases, evolution and origin. We conducted a large study on the error patterns for the MiSeq based on 16S rRNA amplicon sequencing data. We tested state-of-the-art library preparation methods for amplicon sequencing and showed that the library preparation method and the choice of primers are the most significant sources of bias and cause distinct error patterns. Furthermore we tested the efficiency of various error correction strategies and identified quality trimming (Sickle) combined with error correction (BayesHammer) followed by read overlapping (PANDAseq) as the most successful approach, reducing substitution error rates on average by 93%. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. CASPER: context-aware scheme for paired-end reads from high-throughput amplicon sequencing.

    Science.gov (United States)

    Kwon, Sunyoung; Lee, Byunghan; Yoon, Sungroh

    2014-01-01

    Merging the forward and reverse reads from paired-end sequencing is a critical task that can significantly improve the performance of downstream tasks, such as genome assembly and mapping, by providing them with virtually elongated reads. However, due to the inherent limitations of most paired-end sequencers, the chance of observing erroneous bases grows rapidly as the end of a read is approached, which becomes a critical hurdle for accurately merging paired-end reads. Although there exist several sophisticated approaches to this problem, their performance in terms of quality of merging often remains unsatisfactory. To address this issue, here we present a context-aware scheme for paired-end reads (CASPER): a computational method to rapidly and robustly merge overlapping paired-end reads. Being particularly well suited to amplicon sequencing applications, CASPER is thoroughly tested with both simulated and real high-throughput amplicon sequencing data. According to our experimental results, CASPER significantly outperforms existing state-of-the art paired-end merging tools in terms of accuracy and robustness. CASPER also exploits the parallelism in the task of paired-end merging and effectively speeds up by multithreading. CASPER is freely available for academic use at http://best.snu.ac.kr/casper.

  2. Direct recovery of infectious Pestivirus from a full-length RT-PCR amplicon

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Reimann, Ilona; Hoffmann, Bernd

    2008-01-01

    This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro, and the result......This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro......, and the resulting RNA transcripts were electroporated into ovine cells. Infectious virus was obtained after one cell culture passage. The rescued viruses had a phenotype similar to the parental Border Disease virus strain. Therefore, direct generation of infectious pestiviruses from full-length RT-PCR cDNA products...

  3. Photochemical immobilization of anthraquinone conjugated oligonucleotides and PCR amplicons on solid surfaces

    DEFF Research Database (Denmark)

    Koch, T.; Jacobsen, N.; Fensholdt, J.

    2000-01-01

    Ligand immobilization on solid surfaces is an essential step in fields such as diagnostics, bio sensor manufacturing, and new material sciences in general. In this paper a photochemical approach based on anthraquinone as the chromophore is presented. Photochemical procedures offer special...... advantages as they are able to generate highly reactive species in an orientation specific manner. As presented here, anthraquinone (AQ) mediated covalent DNA immobilization appears to be superior to currently known procedures. A synthetic procedure providing AQ-phosphoramidites is presented. These reagents...... facilitate AQ conjugation during routine DNA synthesis, thus enabling the AQ-oligonucleotides to be immobilized in a very convenient and efficient manner. AQ-conjugated PCR primers can be used directly in PCR. When the PCR is performed in solution, the amplicons can be immobilized after the PCR. Moreover...

  4. Swarm v2: highly-scalable and high-resolution amplicon clustering.

    Science.gov (United States)

    Mahé, Frédéric; Rognes, Torbjørn; Quince, Christopher; de Vargas, Colomban; Dunthorn, Micah

    2015-01-01

    Previously we presented Swarm v1, a novel and open source amplicon clustering program that produced fine-scale molecular operational taxonomic units (OTUs), free of arbitrary global clustering thresholds and input-order dependency. Swarm v1 worked with an initial phase that used iterative single-linkage with a local clustering threshold (d), followed by a phase that used the internal abundance structures of clusters to break chained OTUs. Here we present Swarm v2, which has two important novel features: (1) a new algorithm for d = 1 that allows the computation time of the program to scale linearly with increasing amounts of data; and (2) the new fastidious option that reduces under-grouping by grafting low abundant OTUs (e.g., singletons and doubletons) onto larger ones. Swarm v2 also directly integrates the clustering and breaking phases, dereplicates sequencing reads with d = 0, outputs OTU representatives in fasta format, and plots individual OTUs as two-dimensional networks.

  5. Nitrogenase gene amplicons from global marine surface waters are dominated by genes of non-cyanobacteria

    DEFF Research Database (Denmark)

    Farnelid, Hanna; Andersson, Anders F.; Bertilsson, Stefan

    2011-01-01

    by unicellular cyanobacteria, 42% of the identified non-cyanobacterial nifH clusters from the corresponding DNA samples were also detected in cDNA. The study indicates that non-cyanobacteria account for a substantial part of the nifH gene pool in marine surface waters and that these genes are at least......Cyanobacteria are thought to be the main N2-fixing organisms (diazotrophs) in marine pelagic waters, but recent molecular analyses indicate that non-cyanobacterial diazotrophs are also present and active. Existing data are, however, restricted geographically and by limited sequencing depths. Our...... of the nifH gene pool in marine waters. Great divergence in nifH composition was observed between sites. Cyanobacteria-like genes were most frequent among amplicons from the warmest waters, but overall the data set was dominated by nifH sequences most closely related to non-cyanobacteria. Clusters related...

  6. Performance of amplicon-based next generation DNA sequencing for diagnostic gene mutation profiling in oncopathology.

    Science.gov (United States)

    Sie, Daoud; Snijders, Peter J F; Meijer, Gerrit A; Doeleman, Marije W; van Moorsel, Marinda I H; van Essen, Hendrik F; Eijk, Paul P; Grünberg, Katrien; van Grieken, Nicole C T; Thunnissen, Erik; Verheul, Henk M; Smit, Egbert F; Ylstra, Bauke; Heideman, Daniëlle A M

    2014-10-01

    Next generation DNA sequencing (NGS) holds promise for diagnostic applications, yet implementation in routine molecular pathology practice requires performance evaluation on DNA derived from routine formalin-fixed paraffin-embedded (FFPE) tissue specimens. The current study presents a comprehensive analysis of TruSeq Amplicon Cancer Panel-based NGS using a MiSeq Personal sequencer (TSACP-MiSeq-NGS) for somatic mutation profiling. TSACP-MiSeq-NGS (testing 212 hotspot mutation amplicons of 48 genes) and a data analysis pipeline were evaluated in a retrospective learning/test set approach (n = 58/n = 45 FFPE-tumor DNA samples) against 'gold standard' high-resolution-melting (HRM)-sequencing for the genes KRAS, EGFR, BRAF and PIK3CA. Next, the performance of the validated test algorithm was assessed in an independent, prospective cohort of FFPE-tumor DNA samples (n = 75). In the learning set, a number of minimum parameter settings was defined to decide whether a FFPE-DNA sample is qualified for TSACP-MiSeq-NGS and for calling mutations. The resulting test algorithm revealed 82% (37/45) compliance to the quality criteria and 95% (35/37) concordant assay findings for KRAS, EGFR, BRAF and PIK3CA with HRM-sequencing (kappa = 0.92; 95% CI = 0.81-1.03) in the test set. Subsequent application of the validated test algorithm to the prospective cohort yielded a success rate of 84% (63/75), and a high concordance with HRM-sequencing (95% (60/63); kappa = 0.92; 95% CI = 0.84-1.01). TSACP-MiSeq-NGS detected 77 mutations in 29 additional genes. TSACP-MiSeq-NGS is suitable for diagnostic gene mutation profiling in oncopathology.

  7. Amplicon Sequencing Reveals Microbiological Signatures in Spent Nuclear Fuel Storage Basins

    Directory of Open Access Journals (Sweden)

    Christopher E. Bagwell

    2018-03-01

    Full Text Available Water quality is an important determinant for the structural integrity of alloy cladded fuels and assemblies during long-term wet storage. Detailed characterization of a water filled storage basin for spent nuclear reactor fuel was performed following the formation and proliferation of an amorphous white flocculent. White precipitant was sampled throughout the storage basin for chemical and spectroscopic characterization, and environmental DNA was extracted for 454 pyrosequencing of bacterial 16S rRNA gene diversity. Accordingly, spectroscopic analyses indicated the precipitant to be primarily amorphous to crystalline aluminum (oxy hydroxides with minor associated elemental components including Fe, Si, Ti, and U. High levels of organic carbon were co-localized with the precipitant relative to bulk dissolved organic concentrations. Bacterial densities were highly variable between sampling locations and with depth within the water filled storage basin; cell numbers ranged from 4 × 103to 4 × 104 cells/mL. Bacterial diversity that was physically associated with the aluminum (oxy hydroxide complexes exceeded an estimated 4,000 OTUs/amplicon library (3% cutoff and the majority of sequences were aligned to the families Burkholderiaceae (23%, Nitrospiraceae (23%, Hyphomicrobiaceae (17%, and Comamonadaceae (6%. We surmise that episodic changes in the physical and chemical properties of the basin contribute to the polymerization of aluminum (oxy hydroxides, which in turn can chemisorb nutrients, carbon ligands and bacterial cells from the surrounding bulk aqueous phase. As such, these precipitants should establish favorable microhabitats for bacterial colonization and growth. Comparative analyses of 16S rRNA gene amplicon libraries across a selection of natural and engineered aquatic ecosystems were performed and microbial community and taxonomic signatures unique to the spent nuclear fuel (SNF storage basin environment were revealed. These insights

  8. Sequence-specific validation of LAMP amplicons in real-time optomagnetic detection of Dengue serotype 2 synthetic DNA.

    Science.gov (United States)

    Minero, Gabriel Antonio S; Nogueira, Catarina; Rizzi, Giovanni; Tian, Bo; Fock, Jeppe; Donolato, Marco; Strömberg, Mattias; Hansen, Mikkel F

    2017-09-08

    We report on an optomagnetic technique optimised for real-time molecular detection of Dengue fever virus under ideal as well as non-ideal laboratory conditions using two different detection approaches. The first approach is based on the detection of the hydrodynamic volume of streptavidin coated magnetic nanoparticles attached to biotinylated LAMP amplicons. We demonstrate detection of sub-femtomolar Dengue DNA target concentrations in the ideal contamination-free lab environment within 20 min. The second detection approach is based on sequence-specific binding of functionalised magnetic nanoparticles to loops of LAMP amplicons. Melting studies reveal that true positive and spurious amplicons have different melting points and this allows us to discriminate between them. This is found to be in a good agreement with subsequent studies on real-time sequence-specific discrimination of LAMP amplicons. The specific binding causes clustering of magnetic nanoparticles via binding to multiple sites (loops) emerging in the elongation phase of LAMP. Formation of nanoclusters is monitored via the depletion of the optomagnetic signal due to free nanoparticles. After sequence-specific validation, we claim detection of down to 100 fM of Dengue target after 20 min of LAMP with a contamination background.

  9. Function of the EGR-1/TIS8 radiation inducible promoter in a minimal HSV-1 amplicon system

    International Nuclear Information System (INIS)

    Spear, M.A.; Sakamoto, K.M.; Herrlinger, U.; Pechan, P.; Breakefield, X.O.

    1997-01-01

    Purpose: To evaluate function of the EGR-1/TIS8 promoter region in minimal HSV-1 amplicon system in order to determine the feasibility of using the system to regulate vector replication with radiation. Materials and Methods: A 600-base pair 5' upstream region of the EGR-1 promoter linked to chloramphenicol acetyltransferase (CAT) was recombined into a minimal HSV-1 amplicon vector system (pONEC). pONEC or a control plasmid was transfected into U87 glioma cells using the Lipofectamine method. Thirty-six hours later one aliquot of cells from each transfection was irradiated to a dose of 20 Gy and another identical aliquot served as a control. CAT activity was assayed 8 hours after irradiation. Results: pONEC transfected cells irradiated with 20 Gy demonstrated 2.0 fold increase in CAT activity compared to non-irradiated cells. Cells transfected with control plasmid showed no change in CAT activity. Unirradiated pONEC cells had CAT activity 1.3 times those transfected with control plasmid. Conclusion: We have previously created HSV-1 gene therapy amplicon vector systems which allow virus-amplicon interdependent replication, with the intent of regulating replication. The above data demonstrates that a minimal amplicon system will allow radiation dependent regulation by the EGR-1 promoter, thus indicating the possibility of using this system to regulate onsite, spatially and temporally regulated vector production. Baseline CAT activity was higher and relative induction lower than other reported expression constructs, which raises concern for the ability of the system to produce a differential in transcription levels sufficient for this purpose. This is possibly the result of residual promoter/enhancer elements remaining in the HSV-1 sequences. We are attempting to create constructs lacking these elements. Addition of secondary promoter sequences may also be of use. We are also currently evaluating the efficacy of the putative IEX-1 radiation inducible promoter region in

  10. Herpes simplex virus type 1-based amplicon vectors for fundamental research in neurosciences and gene therapy of neurological diseases.

    Science.gov (United States)

    Jerusalinsky, Diana; Baez, María Verónica; Epstein, Alberto Luis

    2012-01-01

    Somatic manipulation of the nervous system without the involvement of the germinal line appears as a powerful counterpart of the transgenic strategy. The use of viral vectors to produce specific, transient and localized knockout, knockdown, ectopic expression or overexpression of a gene, leads to the possibility of analyzing both in vitro and in vivo molecular basis of neural function. In this approach, viral particles engineered to carry transgenic sequences are delivered into discrete brain regions, to transduce cells that will express the transgenic products. Amplicons are replication-incompetent helper-dependent vectors derived from herpes simplex virus type 1 (HSV-1), with several advantages that potentiate their use in neurosciences: (1) minimal toxicity: amplicons do not encode any virus proteins, are neither toxic for the infected cells nor pathogenic for the inoculated animals and elicit low levels of adaptive immune responses; (2) extensive transgene capacity to carry up to 150-kb of foreign DNA; i.e., entire genes with regulatory sequences could be delivered; (3) widespread cellular tropism: amplicons can experimentally infect several cell types including glial cells, though naturally the virus infects mainly neurons and epithelial cells; (4) since the viral genome does not integrate into cellular chromosomes there is low probability to induce insertional mutagenesis. Recent investigations on gene transfer into the brain using these vectors, have focused on gene therapy of inherited genetic diseases affecting the nervous system, such as ataxias, or on neurodegenerative disorders using experimental models of Parkinson's or Alzheimer's disease. Another group of studies used amplicons to investigate complex neural functions such as neuroplasticity, anxiety, learning and memory. In this short review, we summarize recent data supporting the potential of HSV-1 based amplicon vector model for gene delivery and modulation of gene expression in primary cultures

  11. 16S rRNA Amplicon Sequencing for Epidemiological Surveys of Bacteria in Wildlife.

    Science.gov (United States)

    Galan, Maxime; Razzauti, Maria; Bard, Emilie; Bernard, Maria; Brouat, Carine; Charbonnel, Nathalie; Dehne-Garcia, Alexandre; Loiseau, Anne; Tatard, Caroline; Tamisier, Lucie; Vayssier-Taussat, Muriel; Vignes, Helene; Cosson, Jean-François

    2016-01-01

    The human impact on natural habitats is increasing the complexity of human-wildlife interactions and leading to the emergence of infectious diseases worldwide. Highly successful synanthropic wildlife species, such as rodents, will undoubtedly play an increasingly important role in transmitting zoonotic diseases. We investigated the potential for recent developments in 16S rRNA amplicon sequencing to facilitate the multiplexing of the large numbers of samples needed to improve our understanding of the risk of zoonotic disease transmission posed by urban rodents in West Africa. In addition to listing pathogenic bacteria in wild populations, as in other high-throughput sequencing (HTS) studies, our approach can estimate essential parameters for studies of zoonotic risk, such as prevalence and patterns of coinfection within individual hosts. However, the estimation of these parameters requires cleaning of the raw data to mitigate the biases generated by HTS methods. We present here an extensive review of these biases and of their consequences, and we propose a comprehensive trimming strategy for managing these biases. We demonstrated the application of this strategy using 711 commensal rodents, including 208 Mus musculus domesticus , 189 Rattus rattus , 93 Mastomys natalensis , and 221 Mastomys erythroleucus , collected from 24 villages in Senegal. Seven major genera of pathogenic bacteria were detected in their spleens: Borrelia , Bartonella , Mycoplasma , Ehrlichia , Rickettsia , Streptobacillus , and Orientia . Mycoplasma , Ehrlichia , Rickettsia , Streptobacillus , and Orientia have never before been detected in West African rodents. Bacterial prevalence ranged from 0% to 90% of individuals per site, depending on the bacterial taxon, rodent species, and site considered, and 26% of rodents displayed coinfection. The 16S rRNA amplicon sequencing strategy presented here has the advantage over other molecular surveillance tools of dealing with a large spectrum of

  12. Differential amplicons (ΔAmp)-a new molecular method to assess RNA integrity.

    Science.gov (United States)

    Björkman, J; Švec, D; Lott, E; Kubista, M; Sjöback, R

    2016-01-01

    Integrity of the mRNA in clinical samples has major impact on the quality of measured expression levels. This is independent of the measurement technique being next generation sequencing (NGS), Quantitative real-time PCR (qPCR) or microarray profiling. If mRNA is highly degraded or damaged, measured data will be very unreliable and the whole study is likely a waste of time and money. It is therefore common strategy to test the quality of RNA in samples before conducting large and costly studies. Most methods today to assess the quality of RNA are ignorant to the nature of the RNA and, therefore, reflect the integrity of ribosomal RNA, which is the dominant species, rather than of mRNAs, microRNAs and long non-coding RNAs, which usually are the species of interest. Here, we present a novel molecular approach to assess the quality of the targeted RNA species by measuring the differential amplification (ΔAmp) of an Endogenous RNase Resistant (ERR) marker relative to a reference gene, optionally combined with the measurement of two amplicons of different lengths. The combination reveals any mRNA degradation caused by ribonucleases as well as physical, chemical or UV damage. ΔAmp has superior sensitivity to common microfluidic electrophoretic methods, senses the integrity of the actual targeted RNA species, and allows for a smoother and more cost efficient workflow.

  13. Differential amplicons (ΔAmp—a new molecular method to assess RNA integrity

    Directory of Open Access Journals (Sweden)

    J. Björkman

    2016-01-01

    Full Text Available Integrity of the mRNA in clinical samples has major impact on the quality of measured expression levels. This is independent of the measurement technique being next generation sequencing (NGS, Quantitative real-time PCR (qPCR or microarray profiling. If mRNA is highly degraded or damaged, measured data will be very unreliable and the whole study is likely a waste of time and money. It is therefore common strategy to test the quality of RNA in samples before conducting large and costly studies. Most methods today to assess the quality of RNA are ignorant to the nature of the RNA and, therefore, reflect the integrity of ribosomal RNA, which is the dominant species, rather than of mRNAs, microRNAs and long non-coding RNAs, which usually are the species of interest. Here, we present a novel molecular approach to assess the quality of the targeted RNA species by measuring the differential amplification (ΔAmp of an Endogenous RNase Resistant (ERR marker relative to a reference gene, optionally combined with the measurement of two amplicons of different lengths. The combination reveals any mRNA degradation caused by ribonucleases as well as physical, chemical or UV damage. ΔAmp has superior sensitivity to common microfluidic electrophoretic methods, senses the integrity of the actual targeted RNA species, and allows for a smoother and more cost efficient workflow.

  14. Hi-Plex for Simple, Accurate, and Cost-Effective Amplicon-based Targeted DNA Sequencing.

    Science.gov (United States)

    Pope, Bernard J; Hammet, Fleur; Nguyen-Dumont, Tu; Park, Daniel J

    2018-01-01

    Hi-Plex is a suite of methods to enable simple, accurate, and cost-effective highly multiplex PCR-based targeted sequencing (Nguyen-Dumont et al., Biotechniques 58:33-36, 2015). At its core is the principle of using gene-specific primers (GSPs) to "seed" (or target) the reaction and universal primers to "drive" the majority of the reaction. In this manner, effects on amplification efficiencies across the target amplicons can, to a large extent, be restricted to early seeding cycles. Product sizes are defined within a relatively narrow range to enable high-specificity size selection, replication uniformity across target sites (including in the context of fragmented input DNA such as that derived from fixed tumor specimens (Nguyen-Dumont et al., Biotechniques 55:69-74, 2013; Nguyen-Dumont et al., Anal Biochem 470:48-51, 2015), and application of high-specificity genetic variant calling algorithms (Pope et al., Source Code Biol Med 9:3, 2014; Park et al., BMC Bioinformatics 17:165, 2016). Hi-Plex offers a streamlined workflow that is suitable for testing large numbers of specimens without the need for automation.

  15. Extracellular DNA amplicon sequencing reveals high levels of benthic eukaryotic diversity in the central Red Sea

    KAUST Repository

    Pearman, John K.

    2015-11-01

    The present study aims to characterize the benthic eukaryotic biodiversity patterns at a coarse taxonomic level in three areas of the central Red Sea (a lagoon, an offshore area in Thuwal and a shallow coastal area near Jeddah) based on extracellular DNA. High-throughput amplicon sequencing targeting the V9 region of the 18S rRNA gene was undertaken for 32 sediment samples. High levels of alpha-diversity were detected with 16,089 operational taxonomic units (OTUs) being identified. The majority of the OTUs were assigned to Metazoa (29.2%), Alveolata (22.4%) and Stramenopiles (17.8%). Stramenopiles (Diatomea) and Alveolata (Ciliophora) were frequent in a lagoon and in shallower coastal stations, whereas metazoans (Arthropoda: Maxillopoda) were dominant in deeper offshore stations. Only 24.6% of total OTUs were shared among all areas. Beta-diversity was generally lower between the lagoon and Jeddah (nearshore) than between either of those and the offshore area, suggesting a nearshore–offshore biodiversity gradient. The current approach allowed for a broad-range of benthic eukaryotic biodiversity to be analysed with significantly less labour than would be required by other traditional taxonomic approaches. Our findings suggest that next generation sequencing techniques have the potential to provide a fast and standardised screening of benthic biodiversity at large spatial and temporal scales.

  16. Functional Overexpression of Vomeronasal Receptors Using a Herpes Simplex Virus Type 1 (HSV-1-Derived Amplicon.

    Directory of Open Access Journals (Sweden)

    Benjamin Stein

    Full Text Available In mice, social behaviors such as mating and aggression are mediated by pheromones and related chemosignals. The vomeronasal organ (VNO detects olfactory information from other individuals by sensory neurons tuned to respond to specific chemical cues. Receptors expressed by vomeronasal neurons are implicated in selective detection of these cues. Nearly 400 receptor genes have been identified in the mouse VNO, but the tuning properties of individual receptors remain poorly understood, in part due to the lack of a robust heterologous expression system. Here we develop a herpes virus-based amplicon delivery system to overexpress three types of vomeronasal receptor genes and to characterize cell responses to their proposed ligands. Through Ca2+ imaging in native VNO cells we show that virus-induced overexpression of V1rj2, V2r1b or Fpr3 caused a pronounced increase of responsivity to sulfated steroids, MHC-binding peptide or the synthetic hexapeptide W-peptide, respectively. Other related ligands were not recognized by infected individual neurons, indicating a high degree of selectivity by the overexpressed receptor. Removal of G-protein signaling eliminates Ca2+ responses, indicating that the endogenous second messenger system is essential for observing receptor activation. Our results provide a novel expression system for vomeronasal receptors that should be useful for understanding the molecular logic of VNO ligand detection. Functional expression of vomeronasal receptors and their deorphanization provides an essential requirement for deciphering the neural mechanisms controlling behavior.

  17. Swarm v2: highly-scalable and high-resolution amplicon clustering

    Directory of Open Access Journals (Sweden)

    Frédéric Mahé

    2015-12-01

    Full Text Available Previously we presented Swarm v1, a novel and open source amplicon clustering program that produced fine-scale molecular operational taxonomic units (OTUs, free of arbitrary global clustering thresholds and input-order dependency. Swarm v1 worked with an initial phase that used iterative single-linkage with a local clustering threshold (d, followed by a phase that used the internal abundance structures of clusters to break chained OTUs. Here we present Swarm v2, which has two important novel features: (1 a new algorithm for d = 1 that allows the computation time of the program to scale linearly with increasing amounts of data; and (2 the new fastidious option that reduces under-grouping by grafting low abundant OTUs (e.g., singletons and doubletons onto larger ones. Swarm v2 also directly integrates the clustering and breaking phases, dereplicates sequencing reads with d = 0, outputs OTU representatives in fasta format, and plots individual OTUs as two-dimensional networks.

  18. Shedding light on the microbial community of the macropod foregut using 454-amplicon pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Lisa-Maree Gulino

    Full Text Available Twenty macropods from five locations in Queensland, Australia, grazing on a variety of native pastures were surveyed and the bacterial community of the foregut was examined using 454-amplicon pyrosequencing. Specifically, the V3/V4 region of 16S rRNA gene was examined. A total of 5040 OTUs were identified in the data set (post filtering. Thirty-two OTUs were identified as 'shared' OTUS (i.e. present in all samples belonging to either Firmicutes or Bacteroidetes (Clostridiales/Bacteroidales. These phyla predominated the general microbial community in all macropods. Genera represented within the shared OTUs included: unclassified Ruminococcaceae, unclassified Lachnospiraceae, unclassified Clostridiales, Peptococcus sp. Coprococcus spp., Streptococcus spp., Blautia sp., Ruminoccocus sp., Eubacterium sp., Dorea sp., Oscillospira sp. and Butyrivibrio sp. The composition of the bacterial community of the foregut samples of each the host species (Macropus rufus, Macropus giganteus and Macropus robustus was significantly different allowing differentiation between the host species based on alpha and beta diversity measures. Specifically, eleven dominant OTUs that separated the three host species were identified and classified as: unclassified Ruminococcaceae, unclassified Bacteroidales, Prevotella spp. and a Syntrophococcus sucromutans. Putative reductive acetogens and fibrolytic bacteria were also identified in samples. Future work will investigate the presence and role of fibrolytics and acetogens in these ecosystems. Ideally, the isolation and characterization of these organisms will be used for enhanced feed efficiency in cattle, methane mitigation and potentially for other industries such as the biofuel industry.

  19. High-Throughput Analysis of DNA Break-Induced Chromosome Rearrangements by Amplicon Sequencing.

    Science.gov (United States)

    Brown, Alexander J; Al-Soodani, Aneesa T; Saul, Miles; Her, Stephanie; Garcia, Juan C; Ramsden, Dale A; Her, Chengtao; Roberts, Steven A

    2018-01-01

    The mechanistic understanding of how DNA double-strand breaks (DSB) are repaired is rapidly advancing in part due to the advent of inducible site-specific break model systems as well as the employment of next-generation sequencing (NGS) technologies to sequence repair junctions at high depth. Unfortunately, the sheer volume of data produced by these methods makes it difficult to analyze the structure of repair junctions manually or with other general-purpose software. Here, we describe methods to produce amplicon libraries of DSB repair junctions for sequencing, to map the sequencing reads, and then to use a robust, custom python script, Hi-FiBR, to analyze the sequence structure of mapped reads. The Hi-FiBR analysis processes large data sets quickly and provides information such as number and type of repair events, size of deletion, size of insertion and inserted sequence, microhomology usage, and whether mismatches are due to sequencing error or biological effect. The analysis also corrects for common alignment errors generated by sequencing read mapping tools, allowing high-throughput analysis of DSB break repair fidelity to be accurately conducted regardless of which suite of NGS analysis software is available. © 2018 Elsevier Inc. All rights reserved.

  20. Species tree estimation of North American chorus frogs (Hylidae: Pseudacris) with parallel tagged amplicon sequencing.

    Science.gov (United States)

    Barrow, Lisa N; Ralicki, Hannah F; Emme, Sandra A; Lemmon, Emily Moriarty

    2014-06-01

    The field of phylogenetics is changing rapidly with the application of high-throughput sequencing to non-model organisms. Cost-effective use of this technology for phylogenetic studies, which often include a relatively small portion of the genome but several taxa, requires strategies for genome partitioning and sequencing multiple individuals in parallel. In this study we estimated a multilocus phylogeny for the North American chorus frog genus Pseudacris using anonymous nuclear loci that were recently developed using a reduced representation library approach. We sequenced 27 nuclear loci and three mitochondrial loci for 44 individuals on 1/3 of an Illumina MiSeq run, obtaining 96.5% of the targeted amplicons at less than 20% of the cost of traditional Sanger sequencing. We found heterogeneity among gene trees, although four major clades (Trilling Frog, Fat Frog, crucifer, and West Coast) were consistently supported, and we resolved the relationships among these clades for the first time with strong support. We also found discordance between the mitochondrial and nuclear datasets that we attribute to mitochondrial introgression and a possible selective sweep. Bayesian concordance analysis in BUCKy and species tree analysis in (*)BEAST produced largely similar topologies, although we identify taxa that require additional investigation in order to clarify taxonomic and geographic range boundaries. Overall, we demonstrate the utility of a reduced representation library approach for marker development and parallel tagged sequencing on an Illumina MiSeq for phylogenetic studies of non-model organisms. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Comparative analyses of amplicon migration behavior in differing denaturing gradient gel electrophoresis (DGGE) systems

    Science.gov (United States)

    Thornhill, D. J.; Kemp, D. W.; Sampayo, E. M.; Schmidt, G. W.

    2010-03-01

    Denaturing gradient gel electrophoresis (DGGE) is commonly utilized to identify and quantify microbial diversity, but the conditions required for different electrophoretic systems to yield equivalent results and optimal resolution have not been assessed. Herein, the influence of different DGGE system configuration parameters on microbial diversity estimates was tested using Symbiodinium, a group of marine eukaryotic microbes that are important constituents of coral reef ecosystems. To accomplish this, bacterial clone libraries were constructed and sequenced from cultured isolates of Symbiodinium for the ribosomal DNA internal transcribed spacer 2 (ITS2) region. From these, 15 clones were subjected to PCR with a GC clamped primer set for DGGE analyses. Migration behaviors of the resulting amplicons were analyzed using a range of conditions, including variation in the composition of the denaturing gradient, electrophoresis time, and applied voltage. All tests were conducted in parallel on two commercial DGGE systems, a C.B.S. Scientific DGGE-2001, and the Bio-Rad DCode system. In this context, identical nucleotide fragments exhibited differing migration behaviors depending on the model of apparatus utilized, with fragments denaturing at a lower gradient concentration and applied voltage on the Bio-Rad DCode system than on the C.B.S. Scientific DGGE-2001 system. Although equivalent PCR-DGGE profiles could be achieved with both brands of DGGE system, the composition of the denaturing gradient and application of electrophoresis time × voltage must be appropriately optimized to achieve congruent results across platforms.

  2. DNA Methylation Analysis by Bisulfite Conversion Coupled to Double Multiplexed Amplicon-Based Next-Generation Sequencing (NGS).

    Science.gov (United States)

    Bashtrykov, Pavel; Jeltsch, Albert

    2018-01-01

    Methylation of cytosine bases in DNA is one of the main epigenetic signals regulating gene expression and chromatin structure. The distribution of DNA methylation in the genome has a cell-type-specific pattern and can be modulated by internal or external stimuli. One of the most powerful approaches to investigate DNA methylation patterns is bisulfite conversion of the DNA followed by DNA sequencing, which allows to determine methylation patterns at a single-cytosine resolution. Here, we present a protocol for bisulfite DNA methylation analysis of targeted genomic regions using amplicon-based next-generation sequencing (NGS) on an Illumina sequencing system. We use a PCR-free library generation approach and implement a nested strategy for double molecular barcoding of samples (combining indexing of adapters and in-line barcoding of individual amplicons) which allows highly multiplexed sequencing. Also, we discuss the main limitations of this technology in particular in relation to clonal DNA amplification and other PCR artifacts.

  3. Network analysis of the microorganism in 25 Danish wastewater treatment plants over 7 years using high-throughput amplicon sequencing

    DEFF Research Database (Denmark)

    Albertsen, Mads; Larsen, Poul; Saunders, Aaron Marc

    Wastewater treatment is the world’s largest biotechnological processes and a perfect model system for microbial ecology as the habitat is well defined and replicated all over the world. Extensive investigations on Danish wastewater treatment plants using fluorescent in situ hybridization have...... the existing knowledge on core genera with high-throughput amplicon sequencing, plant design and process data in order to identify interactions and community shaping factors. We investigated 25 Danish full-scale wastewater treatment plants with nutrient removal over a period of 7 years with two to four samples...... a year, totaling over 400 samples. All samples were subjected to 16S rDNA amplicon sequencing using V13 primers on the Illumina MiSeq platform (2x300bp) to a depth of at least 20.000 quality filtered reads per sample. The OTUs were assigned taxonomy based on a manually curated version of the greengenes...

  4. Competitive amplification of differentially melting amplicons (CADMA improves KRAS hotspot mutation testing in colorectal cancer

    Directory of Open Access Journals (Sweden)

    Kristensen Lasse

    2012-11-01

    Full Text Available Abstract Background Cancer is an extremely heterogeneous group of diseases traditionally categorized according to tissue of origin. However, even among patients with the same cancer subtype the cellular alterations at the molecular level are often very different. Several new therapies targeting specific molecular changes found in individual patients have initiated the era of personalized therapy and significantly improved patient care. In metastatic colorectal cancer (mCRC a selected group of patients with wild-type KRAS respond to antibodies against the epidermal growth factor receptor (EGFR. Testing for KRAS mutations is now required prior to anti-EGFR treatment, however, less sensitive methods based on conventional PCR regularly fail to detect KRAS mutations in clinical samples. Methods We have developed sensitive and specific assays for detection of the seven most common KRAS mutations based on a novel methodology named Competitive Amplification of Differentially Melting Amplicons (CADMA. The clinical applicability of these assays was assessed by analyzing 100 colorectal cancer samples, for which KRAS mutation status has been evaluated by the commercially available TheraScreen® KRAS mutation kit. Results The CADMA assays were sensitive to at least 0.5% mutant alleles in a wild-type background when using 50 nanograms of DNA in the reactions. Consensus between CADMA and the TheraScreen kit was observed in 96% of the colorectal cancer samples. In cases where disagreement was observed the CADMA result could be confirmed by a previously published assay based on TaqMan probes and by fast COLD-PCR followed by Sanger sequencing. Conclusions The high analytical sensitivity and specificity of CADMA may increase diagnostic sensitivity and specificity of KRAS mutation testing in mCRC patients.

  5. Evaluating the accuracy of amplicon-based microbiome computational pipelines on simulated human gut microbial communities.

    Science.gov (United States)

    Golob, Jonathan L; Margolis, Elisa; Hoffman, Noah G; Fredricks, David N

    2017-05-30

    Microbiome studies commonly use 16S rRNA gene amplicon sequencing to characterize microbial communities. Errors introduced at multiple steps in this process can affect the interpretation of the data. Here we evaluate the accuracy of operational taxonomic unit (OTU) generation, taxonomic classification, alpha- and beta-diversity measures for different settings in QIIME, MOTHUR and a pplacer-based classification pipeline, using a novel software package: DECARD. In-silico we generated 100 synthetic bacterial communities approximating human stool microbiomes to be used as a gold-standard for evaluating the colligative performance of microbiome analysis software. Our synthetic data closely matched the composition and complexity of actual healthy human stool microbiomes. Genus-level taxonomic classification was correctly done for only 50.4-74.8% of the source organisms. Miscall rates varied from 11.9 to 23.5%. Species-level classification was less successful, (6.9-18.9% correct); miscall rates were comparable to those of genus-level targets (12.5-26.2%). The degree of miscall varied by clade of organism, pipeline and specific settings used. OTU generation accuracy varied by strategy (closed, de novo or subsampling), reference database, algorithm and software implementation. Shannon diversity estimation accuracy correlated generally with OTU-generation accuracy. Beta-diversity estimates with Double Principle Coordinate Analysis (DPCoA) were more robust against errors introduced in processing than Weighted UniFrac. The settings suggested in the tutorials were among the worst performing in all outcomes tested. Even when using the same classification pipeline, the specific OTU-generation strategy, reference database and downstream analysis methods selection can have a dramatic effect on the accuracy of taxonomic classification, and alpha- and beta-diversity estimation. Even minor changes in settings adversely affected the accuracy of the results, bringing them far from the

  6. De novo origin of VCY2 from autosome to Y-transposed amplicon.

    Directory of Open Access Journals (Sweden)

    Peng-Rong Cao

    Full Text Available The formation of new genes is a primary driving force of evolution in all organisms. The de novo evolution of new genes from non-protein-coding genomic regions is emerging as an important additional mechanism for novel gene creation. Y chromosomes underlie sex determination in mammals and contain genes that are required for male-specific functions. In this study, a search was undertaken for Y chromosome de novo genes derived from non-protein-coding sequences. The Y chromosome orphan gene variable charge, Y-linked (VCY2, is an autosome-derived gene that has sequence similarity to large autosomal fragments but lacks an autosomal protein-coding homolog. VCY2 locates in the amplicon containing long DNA fragments that were transposed from autosomes to the Y chromosome before the ape-monkey split. We confirmed that VCY2 cannot be encoded by autosomes due to the presence of multiple disablers that disrupt the open reading frame, such as the absence of start or stop codons and the presence of premature stop codons. Similar observations have been made for homologs in the autosomes of the chimpanzee, gorilla, rhesus macaque, baboon and out-group marmoset, which suggests that there was a non-protein-coding ancestral VCY2 that was common to apes and monkeys that predated the transposition event. Furthermore, while protein-coding orthologs are absent, a putative non-protein-coding VCY2 with conserved disablers was identified in the rhesus macaque Y chromosome male-specific region. This finding implies that VCY2 might have not acquired its protein-coding ability before the ape-monkey split. VCY2 encodes a testis-specific expressed protein and is involved in the pathologic process of male infertility, and the acquisition of this gene might improve male fertility. This is the first evidence that de novo genes can be generated from transposed autosomal non-protein-coding segments, and this evidence provides novel insights into the evolutionary history of the Y

  7. Leptin gene polymorphism in Indian Sahiwal cattle by single strand ...

    African Journals Online (AJOL)

    These leptin gene variants can be sequenced and screened in the entire population to develop single nucleotide polymorphisms (SNPs) for association studies with different productive and reproductive performances and marker assisted selection. Keywords: Leptin gene, PCR-SSCP, genetic variability, dairy cattle

  8. Unraveling Core Functional Microbiota in Traditional Solid-State Fermentation by High-Throughput Amplicons and Metatranscriptomics Sequencing

    Directory of Open Access Journals (Sweden)

    Zhewei Song

    2017-07-01

    Full Text Available Fermentation microbiota is specific microorganisms that generate different types of metabolites in many productions. In traditional solid-state fermentation, the structural composition and functional capacity of the core microbiota determine the quality and quantity of products. As a typical example of food fermentation, Chinese Maotai-flavor liquor production involves a complex of various microorganisms and a wide variety of metabolites. However, the microbial succession and functional shift of the core microbiota in this traditional food fermentation remain unclear. Here, high-throughput amplicons (16S rRNA gene amplicon sequencing and internal transcribed space amplicon sequencing and metatranscriptomics sequencing technologies were combined to reveal the structure and function of the core microbiota in Chinese soy sauce aroma type liquor production. In addition, ultra-performance liquid chromatography and headspace-solid phase microextraction-gas chromatography-mass spectrometry were employed to provide qualitative and quantitative analysis of the major flavor metabolites. A total of 10 fungal and 11 bacterial genera were identified as the core microbiota. In addition, metatranscriptomic analysis revealed pyruvate metabolism in yeasts (genera Pichia, Schizosaccharomyces, Saccharomyces, and Zygosaccharomyces and lactic acid bacteria (genus Lactobacillus classified into two stages in the production of flavor components. Stage I involved high-level alcohol (ethanol production, with the genus Schizosaccharomyces serving as the core functional microorganism. Stage II involved high-level acid (lactic acid and acetic acid production, with the genus Lactobacillus serving as the core functional microorganism. The functional shift from the genus Schizosaccharomyces to the genus Lactobacillus drives flavor component conversion from alcohol (ethanol to acid (lactic acid and acetic acid in Chinese Maotai-flavor liquor production. Our findings provide

  9. Obtaining representative community profiles of anaerobic digesters through optimisation of 16S rRNA amplicon sequencing protocols

    DEFF Research Database (Denmark)

    Kirkegaard, Rasmus Hansen; McIlroy, Simon Jon; Karst, Søren Michael

    RNA gene amplicon sequencing is rapid, cheap, high throughput, and has high taxonomic resolution. However, biases are introduced in multiple steps of this approach, including non-representative DNA extraction and uneven taxonomic coverage of selected PCR primers, potentially giving a skewed view...... parameters involving harsher lysis conditions than recommended for the commercial kit, and appeared to be similar for both the mesophilic and thermophilic reactor biomass samples. The community profiling was found to be greatly influenced by the selected PCR primers, and showed that in silico designed...

  10. Next-generation sequencing of multiple individuals per barcoded library by deconvolution of sequenced amplicons using endonuclease fragment analysis.

    Science.gov (United States)

    Andersen, Jeppe D; Pereira, Vania; Pietroni, Carlotta; Mikkelsen, Martin; Johansen, Peter; Børsting, Claus; Morling, Niels

    2014-08-01

    The simultaneous sequencing of samples from multiple individuals increases the efficiency of next-generation sequencing (NGS) while also reducing costs. Here we describe a novel and simple approach for sequencing DNA from multiple individuals per barcode. Our strategy relies on the endonuclease digestion of PCR amplicons prior to library preparation, creating a specific fragment pattern for each individual that can be resolved after sequencing. By using both barcodes and restriction fragment patterns, we demonstrate the ability to sequence the human melanocortin 1 receptor (MC1R) genes from 72 individuals using only 24 barcoded libraries.

  11. Analysis of intra-host genetic diversity of Prunus necrotic ringspot virus (PNRSV using amplicon next generation sequencing.

    Directory of Open Access Journals (Sweden)

    Wycliff M Kinoti

    Full Text Available PCR amplicon next generation sequencing (NGS analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored.

  12. |SE|S|AM|E| Barcode: NGS-oriented software for amplicon characterization--application to species and environmental barcoding.

    Science.gov (United States)

    Piry, S; Guivier, E; Realini, A; Martin, J-F

    2012-11-01

    Progress in NGS technologies has opened up new opportunities for characterizing biodiversity, both for individual specimen identification and for environmental barcoding. Although the amount of data available to biologist is increasing, user-friendly tools to facilitate data analysis have yet to be developed. Our aim, with |SE|S|AM|E| Barcode, is to provide such support through a unified platform. The sequences are analysed through a pipeline that (i) processes NGS amplicon runs, filtering markers and samples, (ii) builds reference libraries and finally (iii) identifies (barcodes) the sequences in each amplicon from the reference library. We use a simulated data set for specimen identification and a recently published data set for environmental barcoding to validate the method. The results obtained are consistent with the expected characterizations (in silico and previously published, respectively). |SE|S|AM|E| Barcode and its documentation are freely available under the Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported Licence for Windows and Linux from http://www1.montpellier.inra.fr/CBGP/NGS/. © 2012 Blackwell Publishing Ltd.

  13. A Systematic Assessment of Accuracy in Detecting Somatic Mosaic Variants by Deep Amplicon Sequencing: Application to NF2 Gene.

    Directory of Open Access Journals (Sweden)

    Elisa Contini

    Full Text Available The accurate detection of low-allelic variants is still challenging, particularly for the identification of somatic mosaicism, where matched control sample is not available. High throughput sequencing, by the simultaneous and independent analysis of thousands of different DNA fragments, might overcome many of the limits of traditional methods, greatly increasing the sensitivity. However, it is necessary to take into account the high number of false positives that may arise due to the lack of matched control samples. Here, we applied deep amplicon sequencing to the analysis of samples with known genotype and variant allele fraction (VAF followed by a tailored statistical analysis. This method allowed to define a minimum value of VAF for detecting mosaic variants with high accuracy. Then, we exploited the estimated VAF to select candidate alterations in NF2 gene in 34 samples with unknown genotype (30 blood and 4 tumor DNAs, demonstrating the suitability of our method. The strategy we propose optimizes the use of deep amplicon sequencing for the identification of low abundance variants. Moreover, our method can be applied to different high throughput sequencing approaches to estimate the background noise and define the accuracy of the experimental design.

  14. A Portable Automatic Endpoint Detection System for Amplicons of Loop Mediated Isothermal Amplification on Microfluidic Compact Disk Platform

    Directory of Open Access Journals (Sweden)

    Shah Mukim Uddin

    2015-03-01

    Full Text Available In recent years, many improvements have been made in foodborne pathogen detection methods to reduce the impact of food contamination. Several rapid methods have been developed with biosensor devices to improve the way of performing pathogen detection. This paper presents an automated endpoint detection system for amplicons generated by loop mediated isothermal amplification (LAMP on a microfluidic compact disk platform. The developed detection system utilizes a monochromatic ultraviolet (UV emitter for excitation of fluorescent labeled LAMP amplicons and a color sensor to detect the emitted florescence from target. Then it processes the sensor output and displays the detection results on liquid crystal display (LCD. The sensitivity test has been performed with detection limit up to 2.5 × 10−3 ng/µL with different DNA concentrations of Salmonella bacteria. This system allows a rapid and automatic endpoint detection which could lead to the development of a point-of-care diagnosis device for foodborne pathogens detection in a resource-limited environment.

  15. Multitracer Positron Emission Tomographic Imaging of Exogenous Gene Expression Mediated by a Universal Herpes Simplex Virus 1 Amplicon Vector

    Directory of Open Access Journals (Sweden)

    Christiane Kummer

    2007-05-01

    Full Text Available To develop efficient and safe gene therapy approaches, the herpes simplex virus type 1 thymidine kinase gene (HSV-1-tk has been shown to function as a marker gene for the direct noninvasive in vivo localization of thymidine kinase (TK expression by positron emission tomography (PET using radiolabeled nucleoside analogues as specific TK substrates. Moreover, the gene encoding dopamine type 2 receptor (d2r could be used as a PET marker gene using specific radiolabeled receptor binding compounds. Here we describe the quantitative colocalization of d2r and HSV-1-tk gene expression mediated from a universal HSV-1 amplicon vector in a subcutaneous human Gli36dEGFR glioma model by PET. The HSV-1 amplicon vector was constructed using a bicistronic gene cassette to contain (1 the d2r80A mutant, which is able to bind its ligand racloprid but unable to activate downstream signal transduction pathways, and (2 the tk39 mutant with enhanced enzymatic activity toward guanosine analogues fused to the green fluorescent protein gene (tk39gfp serving as a marker gene in cell culture. After infection of human Gli36dEGFR glioma cells with the HSV-d2r80AIREStk39gfp (HSV-DITG amplicon vector in cell culture, D2 receptor expression and its targeting to the cell surface were determined by Western blotting and immunolabeling. Vector application in vivo served for quantitative colocalization of d2r80A- and tk39gfp-derived PET signals employing the specific D2 receptor binding compound [11C]racloprid and the specific TK39 substrate 9-(4-[18F]fluoro-3-hydroxymethylbutylguanine. Our results demonstrate that for the range of gene expression studied in vivo, both enzymatic and receptor binding assays give comparable quantitative information on the level of vector-mediated gene expression in vivo. The d2r80A in combination with a specific binding compound passing the intact blood-brain barrier might be an alternative marker gene for the noninvasive assessment of vector

  16. Identification of novel candidate target genes in amplicons of Glioblastoma multiforme tumors detected by expression and CGH microarray profiling

    Directory of Open Access Journals (Sweden)

    Hernández-Moneo Jose-Luis

    2006-09-01

    Full Text Available Abstract Background Conventional cytogenetic and comparative genomic hybridization (CGH studies in brain malignancies have shown that glioblastoma multiforme (GBM is characterized by complex structural and numerical alterations. However, the limited resolution of these techniques has precluded the precise identification of detailed specific gene copy number alterations. Results We performed a genome-wide survey of gene copy number changes in 20 primary GBMs by CGH on cDNA microarrays. A novel amplicon at 4p15, and previously uncharacterized amplicons at 13q32-34 and 1q32 were detected and are analyzed here. These amplicons contained amplified genes not previously reported. Other amplified regions containg well-known oncogenes in GBMs were also detected at 7p12 (EGFR, 7q21 (CDK6, 4q12 (PDGFRA, and 12q13-15 (MDM2 and CDK4. In order to identify the putative target genes of the amplifications, and to determine the changes in gene expression levels associated with copy number change events, we carried out parallel gene expression profiling analyses using the same cDNA microarrays. We detected overexpression of the novel amplified genes SLA/LP and STIM2 (4p15, and TNFSF13B and COL4A2 (13q32-34. Some of the candidate target genes of amplification (EGFR, CDK6, MDM2, CDK4, and TNFSF13B were tested in an independent set of 111 primary GBMs by using FISH and immunohistological assays. The novel candidate 13q-amplification target TNFSF13B was amplified in 8% of the tumors, and showed protein expression in 20% of the GBMs. Conclusion This high-resolution analysis allowed us to propose novel candidate target genes such as STIM2 at 4p15, and TNFSF13B or COL4A2 at 13q32-34 that could potentially contribute to the pathogenesis of these tumors and which would require futher investigations. We showed that overexpression of the amplified genes could be attributable to gene dosage and speculate that deregulation of those genes could be important in the development

  17. Community analysis of picocyanobacteria in an oligotrophic lake by cloning 16S rRNA gene and 16S rRNA gene amplicon sequencing.

    Science.gov (United States)

    Fujimoto, Naoshi; Mizuno, Keigo; Yokoyama, Tomoki; Ohnishi, Akihiro; Suzuki, Masaharu; Watanabe, Satoru; Komatsu, Kenji; Sakata, Yoichi; Kishida, Naohiro; Akiba, Michihiro; Matsukura, Satoko

    2015-01-01

    In this study, the picocyanobacterial species composition of Lake Miyagase was examined by analyzing the 16S rRNA gene in a clone library and by amplicon sequencing using a benchtop next-generation sequencer. Five separate samples were analyzed from different days over a ten-month period. In the picocyanobacterial lineage, 9 and 12 OTUs were identified from a clone library and by amplicon sequencing, respectively. Both analyses suggested that a picocyanobacterium related to Synechococcus sp. MW6B4 was dominant in Lake Miyagase. Our findings suggest that 16S rRNA gene amplicon sequencing enables detailed evaluation of picocyanobacteria composition. One OTU identified was found to be a novel cluster that does not group with any of the known freshwater picocyanobacteria.

  18. HPV Genotyping of Modified General Primer-Amplicons Is More Analytically Sensitive and Specific by Sequencing than by Hybridization.

    Science.gov (United States)

    Meisal, Roger; Rounge, Trine Ballestad; Christiansen, Irene Kraus; Eieland, Alexander Kirkeby; Worren, Merete Molton; Molden, Tor Faksvaag; Kommedal, Øyvind; Hovig, Eivind; Leegaard, Truls Michael; Ambur, Ole Herman

    2017-01-01

    Sensitive and specific genotyping of human papillomaviruses (HPVs) is important for population-based surveillance of carcinogenic HPV types and for monitoring vaccine effectiveness. Here we compare HPV genotyping by Next Generation Sequencing (NGS) to an established DNA hybridization method. In DNA isolated from urine, the overall analytical sensitivity of NGS was found to be 22% higher than that of hybridization. NGS was also found to be the most specific method and expanded the detection repertoire beyond the 37 types of the DNA hybridization assay. Furthermore, NGS provided an increased resolution by identifying genetic variants of individual HPV types. The same Modified General Primers (MGP)-amplicon was used in both methods. The NGS method is described in detail to facilitate implementation in the clinical microbiology laboratory and includes suggestions for new standards for detection and calling of types and variants with improved resolution.

  19. HPV Genotyping of Modified General Primer-Amplicons Is More Analytically Sensitive and Specific by Sequencing than by Hybridization.

    Directory of Open Access Journals (Sweden)

    Roger Meisal

    Full Text Available Sensitive and specific genotyping of human papillomaviruses (HPVs is important for population-based surveillance of carcinogenic HPV types and for monitoring vaccine effectiveness. Here we compare HPV genotyping by Next Generation Sequencing (NGS to an established DNA hybridization method. In DNA isolated from urine, the overall analytical sensitivity of NGS was found to be 22% higher than that of hybridization. NGS was also found to be the most specific method and expanded the detection repertoire beyond the 37 types of the DNA hybridization assay. Furthermore, NGS provided an increased resolution by identifying genetic variants of individual HPV types. The same Modified General Primers (MGP-amplicon was used in both methods. The NGS method is described in detail to facilitate implementation in the clinical microbiology laboratory and includes suggestions for new standards for detection and calling of types and variants with improved resolution.

  20. Shotgun metagenomes and multiple primer pair-barcode combinations of amplicons reveal biases in metabarcoding analyses of fungi

    Directory of Open Access Journals (Sweden)

    Leho Tedersoo

    2015-05-01

    Full Text Available Rapid development of high-throughput (HTS molecular identification methods has revolutionized our knowledge about taxonomic diversity and ecology of fungi. However, PCR-based methods exhibit multiple technical shortcomings that may bias our understanding of the fungal kingdom. This study was initiated to quantify potential biases in fungal community ecology by comparing the relative performance of amplicon-free shotgun metagenomics and amplicons of nine primer pairs over seven nuclear ribosomal DNA (rDNA regions often used in metabarcoding analyses. The internal transcribed spacer (ITS barcodes ITS1 and ITS2 provided greater taxonomic and functional resolution and richness of operational taxonomic units (OTUs at the 97% similarity threshold compared to barcodes located within the ribosomal small subunit (SSU and large subunit (LSU genes. All barcode-primer pair combinations provided consistent results in ranking taxonomic richness and recovering the importance of floristic variables in driving fungal community composition in soils of Papua New Guinea. The choice of forward primer explained up to 2.0% of the variation in OTU-level analysis of the ITS1 and ITS2 barcode data sets. Across the whole data set, barcode-primer pair combination explained 37.6–38.1% of the variation, which surpassed any environmental signal. Overall, the metagenomics data set recovered a similar taxonomic overview, but resulted in much lower fungal rDNA sequencing depth, inability to infer OTUs, and high uncertainty in identification. We recommend the use of ITS2 or the whole ITS region for metabarcoding and we advocate careful choice of primer pairs in consideration of the relative proportion of fungal DNA and expected dominant groups.

  1. Bacterial diversity in Solenopsis invicta and Solenopsis geminata ant colonies characterized by 16S amplicon 454 pyrosequencing.

    Science.gov (United States)

    Ishak, Heather D; Plowes, Rob; Sen, Ruchira; Kellner, Katrin; Meyer, Eli; Estrada, Dora A; Dowd, Scot E; Mueller, Ulrich G

    2011-05-01

    Social insects harbor diverse assemblages of bacterial microbes, which may play a crucial role in the success or failure of biological invasions. The invasive fire ant Solenopsis invicta (Formicidae, Hymenoptera) is a model system for understanding the dynamics of invasive social insects and their biological control. However, little is known about microbes as biotic factors influencing the success or failure of ant invasions. This pilot study is the first attempt to characterize and compare microbial communities associated with the introduced S. invicta and the native Solenopsis geminata in the USA. Using 16S amplicon 454 pyrosequencing, bacterial communities of workers, brood, and soil from nest walls were compared between neighboring S. invicta and S. geminata colonies at Brackenridge Field Laboratory, Austin, Texas, with the aim of identifying potential pathogenic, commensal, or mutualistic microbial associates. Two samples of S. geminata workers showed high counts of Spiroplasma bacteria, a known pathogen or mutualist of other insects. A subsequent analysis using PCR and sequencing confirmed the presence of Spiroplasma in additional colonies of both Solenopsis species. Wolbachia was found in one alate sample of S. geminata, while one brood sample of S. invicta had a high count of Lactococcus. As expected, ant samples from both species showed much lower microbial diversity than the surrounding soil. Both ant species had similar overall bacterial diversities, although little overlap in specific microbes. To properly characterize a single bacterial community associated with a Solenopsis ant sample, rarefaction analyses indicate that it is necessary to obtain 5,000-10,000 sequences. Overall, 16S amplicon 454 pyrosequencing appears to be a cost-effective approach to screen whole microbial diversity associated with invasive ant species.

  2. Analysis of 16S rRNA amplicon sequencing options on the Roche/454 next-generation titanium sequencing platform.

    Directory of Open Access Journals (Sweden)

    Hideyuki Tamaki

    Full Text Available BACKGROUND: 16S rRNA gene pyrosequencing approach has revolutionized studies in microbial ecology. While primer selection and short read length can affect the resulting microbial community profile, little is known about the influence of pyrosequencing methods on the sequencing throughput and the outcome of microbial community analyses. The aim of this study is to compare differences in output, ease, and cost among three different amplicon pyrosequencing methods for the Roche/454 Titanium platform METHODOLOGY/PRINCIPAL FINDINGS: The following three pyrosequencing methods for 16S rRNA genes were selected in this study: Method-1 (standard method is the recommended method for bi-directional sequencing using the LIB-A kit; Method-2 is a new option designed in this study for unidirectional sequencing with the LIB-A kit; and Method-3 uses the LIB-L kit for unidirectional sequencing. In our comparison among these three methods using 10 different environmental samples, Method-2 and Method-3 produced 1.5-1.6 times more useable reads than the standard method (Method-1, after quality-based trimming, and did not compromise the outcome of microbial community analyses. Specifically, Method-3 is the most cost-effective unidirectional amplicon sequencing method as it provided the most reads and required the least effort in consumables management. CONCLUSIONS: Our findings clearly demonstrated that alternative pyrosequencing methods for 16S rRNA genes could drastically affect sequencing output (e.g. number of reads before and after trimming but have little effect on the outcomes of microbial community analysis. This finding is important for both researchers and sequencing facilities utilizing 16S rRNA gene pyrosequencing for microbial ecological studies.

  3. Broadband Access

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Broadband Access. Worldwide market for broadband access $30 Billion! Over 200 million broadband subscribers worldwide! Various Competing Broadband access. Digital Subscriber line; Wireless; Optical Fiber.

  4. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing

    OpenAIRE

    Mehetre, Gajanan T.; Paranjpe, Aditi; Dastager, Syed G.; Dharne, Mahesh S.

    2016-01-01

    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche.

  5. KAT6A, a Chromatin Modifier from the 8p11-p12 Amplicon is a Candidate Oncogene in Luminal Breast Cancer

    Directory of Open Access Journals (Sweden)

    Brittany Turner-Ivey

    2014-08-01

    Full Text Available The chromosome 8p11-p12 amplicon is present in 12% to 15% of breast cancers, resulting in an increase in copy number and expression of several chromatin modifiers in these tumors, including KAT6A. Previous analyses in SUM-52 breast cancer cells showed amplification and overexpression of KAT6A, and subsequent RNAi screening identified KAT6A as a potential driving oncogene. KAT6A is a histone acetyltransferase previously identified as a fusion partner with CREB binding protein in acute myeloid leukemia. Knockdown of KAT6A in SUM-52 cells, a luminal breast cancer cell line harboring the amplicon, resulted in reduced growth rate compared to non-silencing controls and profound loss of clonogenic capacity both in mono-layer and in soft agar. The normal cell line MCF10A, however, did not exhibit slower growth with knockdown of KAT6A. SUM-52 cells with KAT6A knockdown formed fewer mammospheres in culture compared to controls, suggesting a possible role for KAT6A in self-renewal. Previous data from our laboratory identified FGFR2 as a driving oncogene in SUM-52 cells. The colony forming efficiency of SUM-52 KAT6A knockdown cells in the presence of FGFR inhibition was significantly reduced compared to cells with KAT6A knockdown only. These data suggest that KAT6A may be a novel oncogene in breast cancers bearing the 8p11-p12 amplicon. While there are other putative oncogenes in the amplicon, the identification of KAT6A as a driving oncogene suggests that chromatin-modifying enzymes are a key class of oncogenes in these cancers, and play an important role in the selection of this amplicon in luminal B breast cancers.

  6. A one-step real-time multiplex PCR for screening Y-chromosomal microdeletions without downstream amplicon size analysis.

    Directory of Open Access Journals (Sweden)

    Viviana Kozina

    Full Text Available BACKGROUND: Y-chromosomal microdeletions (YCMD are one of the major genetic causes for non-obstructive azoospermia. Genetic testing for YCMD by multiplex polymerase chain reaction (PCR is an established method for quick and robust screening of deletions in the AZF regions of the Y-chromosome. Multiplex PCRs have the advantage of including a control gene in every reaction and significantly reducing the number of reactions needed to screen the relevant genomic markers. PRINCIPAL FINDINGS: The widely established "EAA/EMQN best practice guidelines for molecular diagnosis of Y-chromosomal microdeletions (2004" were used as a basis for designing a real-time multiplex PCR system, in which the YCMD can simply be identified by their melting points. For this reason, some AZF primers were substituted by primers for regions in their genomic proximity, and the ZFX/ZFY control primer was exchanged by the AMELX/AMELY control primer. Furthermore, we substituted the classical SybrGreen I dye by the novel and high-performing DNA-binding dye EvaGreen™ and put substantial effort in titrating the primer combinations in respect to optimal melting peak separation and peak size. SIGNIFICANCE: With these changes, we were able to develop a platform-independent and robust real-time based multiplex PCR, which makes the need for amplicon identification by electrophoretic sizing expendable. By using an open-source system for real-time PCR analysis, we further demonstrate the applicability of automated melting point and YCMD detection.

  7. Simultaneous Whole Mitochondrial Genome Sequencing with Short Overlapping Amplicons Suitable for Degraded DNA Using the Ion Torrent Personal Genome Machine.

    Science.gov (United States)

    Chaitanya, Lakshmi; Ralf, Arwin; van Oven, Mannis; Kupiec, Tomasz; Chang, Joseph; Lagacé, Robert; Kayser, Manfred

    2015-12-01

    Whole mitochondrial (mt) genome analysis enables a considerable increase in analysis throughput, and improves the discriminatory power to the maximum possible phylogenetic resolution. Most established protocols on the different massively parallel sequencing (MPS) platforms, however, invariably involve the PCR amplification of large fragments, typically several kilobases in size, which may fail due to mtDNA fragmentation in the available degraded materials. We introduce a MPS tiling approach for simultaneous whole human mt genome sequencing using 161 short overlapping amplicons (average 200 bp) with the Ion Torrent Personal Genome Machine. We illustrate the performance of this new method by sequencing 20 DNA samples belonging to different worldwide mtDNA haplogroups. Additional quality control, particularly regarding the potential detection of nuclear insertions of mtDNA (NUMTs), was performed by comparative MPS analysis using the conventional long-range amplification method. Preliminary sensitivity testing revealed that detailed haplogroup inference was feasible with 100 pg genomic input DNA. Complete mt genome coverage was achieved from DNA samples experimentally degraded down to genomic fragment sizes of about 220 bp, and up to 90% coverage from naturally degraded samples. Overall, we introduce a new approach for whole mt genome MPS analysis from degraded and nondegraded materials relevant to resolve and infer maternal genetic ancestry at complete resolution in anthropological, evolutionary, medical, and forensic applications. © 2015 The Authors. **Human Mutation published by Wiley Periodicals, Inc.

  8. Factors that affect large subunit ribosomal DNA amplicon sequencing studies of fungal communities: classification method, primer choice, and error.

    Directory of Open Access Journals (Sweden)

    Teresita M Porter

    Full Text Available Nuclear large subunit ribosomal DNA is widely used in fungal phylogenetics and to an increasing extent also amplicon-based environmental sequencing. The relatively short reads produced by next-generation sequencing, however, makes primer choice and sequence error important variables for obtaining accurate taxonomic classifications. In this simulation study we tested the performance of three classification methods: 1 a similarity-based method (BLAST + Metagenomic Analyzer, MEGAN; 2 a composition-based method (Ribosomal Database Project naïve bayesian classifier, NBC; and, 3 a phylogeny-based method (Statistical Assignment Package, SAP. We also tested the effects of sequence length, primer choice, and sequence error on classification accuracy and perceived community composition. Using a leave-one-out cross validation approach, results for classifications to the genus rank were as follows: BLAST + MEGAN had the lowest error rate and was particularly robust to sequence error; SAP accuracy was highest when long LSU query sequences were classified; and, NBC runs significantly faster than the other tested methods. All methods performed poorly with the shortest 50-100 bp sequences. Increasing simulated sequence error reduced classification accuracy. Community shifts were detected due to sequence error and primer selection even though there was no change in the underlying community composition. Short read datasets from individual primers, as well as pooled datasets, appear to only approximate the true community composition. We hope this work informs investigators of some of the factors that affect the quality and interpretation of their environmental gene surveys.

  9. Multilocus amplicon sequencing of Pseudomonas aeruginosa cystic fibrosis airways isolates collected prior to and after early antipseudomonal chemotherapy.

    Science.gov (United States)

    Fischer, Sebastian; Greipel, Leonie; Klockgether, Jens; Dorda, Marie; Wiehlmann, Lutz; Cramer, Nina; Tümmler, Burkhard

    2017-05-01

    Early antimicrobial chemotherapy can prevent or at least delay chronic cystic fibrosis (CF) airways infections with Pseudomonas aeruginosa. During a 10-year study period P. aeruginosa was detected for the first time in 54 CF patients regularly seen at the CF centre Hannover. Amplicon sequencing of 34 loci of the P. aeruginosa core genome was performed in baseline and post-treatment isolates of the 15 CF patients who had remained P. aeruginosa - positive after the first round of antipseudomonal chemotherapy. Deep sequencing uncovered coexisting alternative nucleotides at in total 33 of 55,284 examined genome positions including six non-synonymous polymorphisms in the lasR gene, a key regulator of quorum sensing. After early treatment 42 of 50 novel nucleotide substitutions had emerged in exopolysaccharide biosynthesis, efflux pump and porin genes. Early treatment selects pathoadaptive mutations in P. aeruginosa that are typical for chronic infections of CF lungs. Copyright © 2016 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  10. Metagenomic Analysis of Slovak Bryndza Cheese Using Next-Generation 16S rDNA Amplicon Sequencing

    Directory of Open Access Journals (Sweden)

    Planý Matej

    2016-06-01

    Full Text Available Knowledge about diversity and taxonomic structure of the microbial population present in traditional fermented foods plays a key role in starter culture selection, safety improvement and quality enhancement of the end product. Aim of this study was to investigate microbial consortia composition in Slovak bryndza cheese. For this purpose, we used culture-independent approach based on 16S rDNA amplicon sequencing using next generation sequencing platform. Results obtained by the analysis of three commercial (produced on industrial scale in winter season and one traditional (artisanal, most valued, produced in May Slovak bryndza cheese sample were compared. A diverse prokaryotic microflora composed mostly of the genera Lactococcus, Streptococcus, Lactobacillus, and Enterococcus was identified. Lactococcus lactis subsp. lactis and Lactococcus lactis subsp. cremoris were the dominant taxons in all tested samples. Second most abundant species, detected in all bryndza cheeses, were Lactococcus fujiensis and Lactococcus taiwanensis, independently by two different approaches, using different reference 16S rRNA genes databases (Greengenes and NCBI respectively. They have been detected in bryndza cheese samples in substantial amount for the first time. The narrowest microbial diversity was observed in a sample made with a starter culture from pasteurised milk. Metagenomic analysis by high-throughput sequencing using 16S rRNA genes seems to be a powerful tool for studying the structure of the microbial population in cheeses.

  11. Fungi Sailing the Arctic Ocean: Speciose Communities in North Atlantic Driftwood as Revealed by High-Throughput Amplicon Sequencing.

    Science.gov (United States)

    Rämä, Teppo; Davey, Marie L; Nordén, Jenni; Halvorsen, Rune; Blaalid, Rakel; Mathiassen, Geir H; Alsos, Inger G; Kauserud, Håvard

    2016-08-01

    High amounts of driftwood sail across the oceans and provide habitat for organisms tolerating the rough and saline environment. Fungi have adapted to the extremely cold and saline conditions which driftwood faces in the high north. For the first time, we applied high-throughput sequencing to fungi residing in driftwood to reveal their taxonomic richness, community composition, and ecology in the North Atlantic. Using pyrosequencing of ITS2 amplicons obtained from 49 marine logs, we found 807 fungal operational taxonomic units (OTUs) based on clustering at 97 % sequence similarity cut-off level. The phylum Ascomycota comprised 74 % of the OTUs and 20 % belonged to Basidiomycota. The richness of basidiomycetes decreased with prolonged submersion in the sea, supporting the general view of ascomycetes being more extremotolerant. However, more than one fourth of the fungal OTUs remained unassigned to any fungal class, emphasising the need for better DNA reference data from the marine habitat. Different fungal communities were detected in coniferous and deciduous logs. Our results highlight that driftwood hosts a considerably higher fungal diversity than currently known. The driftwood fungal community is not a terrestrial relic but a speciose assemblage of fungi adapted to the stressful marine environment and different kinds of wooden substrates found in it.

  12. Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing.

    Science.gov (United States)

    Tourlousse, Dieter M; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro; Sekiguchi, Yuji

    2017-02-28

    High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Wireless Access

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Wireless Access. Wireless connect to the Base station. Easy and Convenient access. Costlier as compared to the wired technology. Reliability challenges. We see it as a complementary technology to the DSL.

  14. Combined amplicon pyrosequencing assays reveal presence of the apicomplexan "type-N" (cf. Gemmocystis cylindrus and Chromera velia on the Great Barrier Reef, Australia.

    Directory of Open Access Journals (Sweden)

    Jan Slapeta

    Full Text Available BACKGROUND: The coral is predominantly composed of the metabolically dependent coral host and the photosynthetic dinoflagellate Symbiodinium sp. The system as a whole interacts with symbiotic eukaryotes, bacteria and viruses. Gemmocystiscylindrus (cf. "type-N" symbiont belonging to the obligatory parasitic phylum Apicomplexa (Alveolata is ubiquitous in the Caribbean coral, but its presence in the Great Barrier Reef coral has yet to be documented. Approaches allowing identification of the healthy community from the pathogenic or saprobic organisms are needed for sustainable coral reef monitoring. METHODS & PRINCIPAL FINDINGS: We investigated the diversity of eukaryotes associated with a common reef-building corals from the southern Great Barrier Reef. We used three tag encoded 454 amplicon pyrosequencing assays targeting eukaryote small-subunit rRNA gene to demonstrate the presence of the apicomplexan type-N and a photosynthetic sister species to Apicomplexa-Chromeravelia. Amplicon pyrosequencing revealed presence of the small-subunit rRNA genes of known eukaryotic pathogens (Cryptosporidium and Cryptococcus. We therefore conducted bacterial tag encoded amplicon pyrosequencing assay for small-subunit rRNA gene to support effluent exposure of the coral. Bacteria of faecal origin (Enterobacteriales formed 41% of total sequences in contrast to 0-2% of the coral-associated bacterial communities with and without C. velia, respectively. SIGNIFICANCE: This is the first time apicomplexan type-N has been detected in the Great Barrier Reef. Eukaryote tag encoded amplicon pyrosequencing assays demonstrate presence of apicomplexan type-N and C. Velia in total coral DNA. The data highlight the need for combined approaches for eukaryotic diversity studies coupled with bacterial community assessment to achieve a more realistic goals of defining the holobiont community and assessing coral disease. With increasing evidence of Apicomplexa in coral reef

  15. Bacterial community in naturally fermented milk products of Arunachal Pradesh and Sikkim of India analysed by high-throughput amplicon sequencing

    OpenAIRE

    Shangpliang, H. Nakibapher Jones; Rai, Ranjita; Keisam, Santosh; Jeyaram, Kumaraswamy; Tamang, Jyoti Prakash

    2018-01-01

    Naturally fermented milk (NFM) products are popular ethnic fermented foods in Arunachal Pradesh and Sikkim states of India. The present study is the first to have documented the bacterial community in 54 samples of NFM products viz. chhurpi, churkam, dahi and gheu/mar by high-throughput Illumina amplicon sequencing. Metagenomic investigation showed that Firmicutes (Streptococcaceae, Lactobacillaceae) and Proteobacteria (Acetobacteraceae) were the two predominant members of the bacterial commu...

  16. FasL and FADD delivery by a glioma-specific and cell cycle-dependent HSV-1 amplicon virus enhanced apoptosis in primary human brain tumors

    Directory of Open Access Journals (Sweden)

    Lam Paula Y

    2010-10-01

    Full Text Available Abstract Background Glioblastoma multiforme is the most malignant cancer of the brain and is notoriously difficult to treat due to the highly proliferative and infiltrative nature of the cells. Herein, we explored the combination treatment of pre-established human glioma xenograft using multiple therapeutic genes whereby the gene expression is regulated by both cell-type and cell cycle-dependent transcriptional regulatory mechanism conferred by recombinant HSV-1 amplicon vectors. Results We demonstrated for the first time that Ki67-positive proliferating primary human glioma cells cultured from biopsy samples were effectively induced into cell death by the dual-specific function of the pG8-FasL amplicon vectors. These vectors were relatively stable and exhibited minimal cytotoxicity in vivo. Intracranial implantation of pre-transduced glioma cells resulted in better survival outcome when compared with viral vectors inoculated one week post-implantation of tumor cells, indicating that therapeutic efficacy is dependent on the viral spread and mode of viral vectors administration. We further showed that pG8-FasL amplicon vectors are functional in the presence of commonly used treatment regimens for human brain cancer. In fact, the combined therapies of pG8-FasL and pG8-FADD in the presence of temozolomide significantly improved the survival of mice bearing intracranial high-grade gliomas. Conclusion Taken together, our results showed that the glioma-specific and cell cycle-dependent HSV-1 amplicon vector is potentially useful as an adjuvant therapy to complement the current gene therapy strategy for gliomas.

  17. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing.

    Science.gov (United States)

    Mehetre, Gajanan T; Paranjpe, Aditi; Dastager, Syed G; Dharne, Mahesh S

    2016-02-25

    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. Copyright © 2016 Mehetre et al.

  18. Combined amplicon pyrosequencing assays reveal presence of the apicomplexan "type-N" (cf. Gemmocystis cylindrus) and Chromera velia on the Great Barrier Reef, Australia.

    Science.gov (United States)

    Slapeta, Jan; Linares, Marjorie C

    2013-01-01

    The coral is predominantly composed of the metabolically dependent coral host and the photosynthetic dinoflagellate Symbiodinium sp. The system as a whole interacts with symbiotic eukaryotes, bacteria and viruses. Gemmocystiscylindrus (cf. "type-N" symbiont) belonging to the obligatory parasitic phylum Apicomplexa (Alveolata) is ubiquitous in the Caribbean coral, but its presence in the Great Barrier Reef coral has yet to be documented. Approaches allowing identification of the healthy community from the pathogenic or saprobic organisms are needed for sustainable coral reef monitoring. We investigated the diversity of eukaryotes associated with a common reef-building corals from the southern Great Barrier Reef. We used three tag encoded 454 amplicon pyrosequencing assays targeting eukaryote small-subunit rRNA gene to demonstrate the presence of the apicomplexan type-N and a photosynthetic sister species to Apicomplexa-Chromeravelia. Amplicon pyrosequencing revealed presence of the small-subunit rRNA genes of known eukaryotic pathogens (Cryptosporidium and Cryptococcus). We therefore conducted bacterial tag encoded amplicon pyrosequencing assay for small-subunit rRNA gene to support effluent exposure of the coral. Bacteria of faecal origin (Enterobacteriales) formed 41% of total sequences in contrast to 0-2% of the coral-associated bacterial communities with and without C. velia, respectively. This is the first time apicomplexan type-N has been detected in the Great Barrier Reef. Eukaryote tag encoded amplicon pyrosequencing assays demonstrate presence of apicomplexan type-N and C. Velia in total coral DNA. The data highlight the need for combined approaches for eukaryotic diversity studies coupled with bacterial community assessment to achieve a more realistic goals of defining the holobiont community and assessing coral disease. With increasing evidence of Apicomplexa in coral reef environments, it is important not only to understand the evolution of these

  19. A One-Step Real-Time Multiplex PCR for Screening Y-Chromosomal Microdeletions without Downstream Amplicon Size Analysis

    Science.gov (United States)

    Kozina, Viviana; Cappallo-Obermann, Heike; Gromoll, Jörg; Spiess, Andrej-Nikolai

    2011-01-01

    Backgound Y-chromosomal microdeletions (YCMD) are one of the major genetic causes for non-obstructive azoospermia. Genetic testing for YCMD by multiplex polymerase chain reaction (PCR) is an established method for quick and robust screening of deletions in the AZF regions of the Y-chromosome. Multiplex PCRs have the advantage of including a control gene in every reaction and significantly reducing the number of reactions needed to screen the relevant genomic markers. Principal Findings The widely established “EAA/EMQN best practice guidelines for molecular diagnosis of Y-chromosomal microdeletions (2004)” were used as a basis for designing a real-time multiplex PCR system, in which the YCMD can simply be identified by their melting points. For this reason, some AZF primers were substituted by primers for regions in their genomic proximity, and the ZFX/ZFY control primer was exchanged by the AMELX/AMELY control primer. Furthermore, we substituted the classical SybrGreen I dye by the novel and high-performing DNA-binding dye EvaGreen™ and put substantial effort in titrating the primer combinations in respect to optimal melting peak separation and peak size. Significance With these changes, we were able to develop a platform-independent and robust real-time based multiplex PCR, which makes the need for amplicon identification by electrophoretic sizing expendable. By using an open-source system for real-time PCR analysis, we further demonstrate the applicability of automated melting point and YCMD detection. PMID:21887237

  20. Redefining the Human Oral Mycobiome with Improved Practices in Amplicon-based Taxonomy: Discovery of Malassezia as a Prominent Commensal

    Science.gov (United States)

    Dupuy, Amanda K.; David, Marika S.; Li, Lu; Heider, Thomas N.; Peterson, Jason D.; Montano, Elizabeth A.; Dongari-Bagtzoglou, Anna; Diaz, Patricia I.; Strausbaugh, Linda D.

    2014-01-01

    Fungi are a large, complex group, increasingly recognized as emerging threats. Their roles as modifiers of health mandate accurate portrayals of fungal communities in humans. As an entry point into the airways and gastrointestinal tract, fungi in the mouth are relevant to several biocompartments. We have revised current practices in sequence-based taxonomy assignments and employed the improvements to address the question of the fungal genera present in the healthy human mouth. The human oral mycobiome was surveyed using massively parallel, high throughput sequencing of internal transcribed spacer 1 (ITS1) amplicons from saliva following robust extraction methods. Taxonomy was assigned by comparison to a curated reference dataset, followed by filtering with an empirically determined BLAST E-value match statistic (10−42). Nomenclature corrections further refined results by conjoining redundant names for a single fungal genus. Following these curation steps, about two-thirds of the initially identified genera were eliminated. In comparison with the one similar metagenomic study and several earlier culture-based ones, our findings change the current conception of the oral mycobiome, especially with the discovery of the high prevalence and abundance of the genus Malassezia. Previously identified as an important pathogen of the skin, and recently reported as the predominant fungal genus at the nostril and backs of the head and ear, this is the first account of Malassezia in the human mouth. Findings from this study were in good agreement with others on the existence of many consensus members of the core mycobiome, and on unique patterns for individual subjects. This research offered a cautionary note about unconditional acceptance of lengthy lists of community members produced by automated assignments, provided a roadmap for enhancing the likely biological relevance of sequence-based fungal surveys, and built the foundation for understanding the role of fungi in health

  1. Nuclear species-diagnostic SNP markers mined from 454 amplicon sequencing reveal admixture genomic structure of modern citrus varieties.

    Directory of Open Access Journals (Sweden)

    Franck Curk

    Full Text Available Most cultivated Citrus species originated from interspecific hybridisation between four ancestral taxa (C. reticulata, C. maxima, C. medica, and C. micrantha with limited further interspecific recombination due to vegetative propagation. This evolution resulted in admixture genomes with frequent interspecific heterozygosity. Moreover, a major part of the phenotypic diversity of edible citrus results from the initial differentiation between these taxa. Deciphering the phylogenomic structure of citrus germplasm is therefore essential for an efficient utilization of citrus biodiversity in breeding schemes. The objective of this work was to develop a set of species-diagnostic single nucleotide polymorphism (SNP markers for the four Citrus ancestral taxa covering the nine chromosomes, and to use these markers to infer the phylogenomic structure of secondary species and modern cultivars. Species-diagnostic SNPs were mined from 454 amplicon sequencing of 57 gene fragments from 26 genotypes of the four basic taxa. Of the 1,053 SNPs mined from 28,507 kb sequence, 273 were found to be highly diagnostic for a single basic taxon. Species-diagnostic SNP markers (105 were used to analyse the admixture structure of varieties and rootstocks. This revealed C. maxima introgressions in most of the old and in all recent selections of mandarins, and suggested that C. reticulata × C. maxima reticulation and introgression processes were important in edible mandarin domestication. The large range of phylogenomic constitutions between C. reticulata and C. maxima revealed in mandarins, tangelos, tangors, sweet oranges, sour oranges, grapefruits, and orangelos is favourable for genetic association studies based on phylogenomic structures of the germplasm. Inferred admixture structures were in agreement with previous hypotheses regarding the origin of several secondary species and also revealed the probable origin of several acid citrus varieties. The developed species

  2. Microbial community composition and diversity via 16S rRNA gene amplicons: evaluating the illumina platform.

    Directory of Open Access Journals (Sweden)

    Lucas Sinclair

    Full Text Available As new sequencing technologies become cheaper and older ones disappear, laboratories switch vendors and platforms. Validating the new setups is a crucial part of conducting rigorous scientific research. Here we report on the reliability and biases of performing bacterial 16S rRNA gene amplicon paired-end sequencing on the MiSeq Illumina platform. We designed a protocol using 50 barcode pairs to run samples in parallel and coded a pipeline to process the data. Sequencing the same sediment sample in 248 replicates as well as 70 samples from alkaline soda lakes, we evaluated the performance of the method with regards to estimates of alpha and beta diversity. Using different purification and DNA quantification procedures we always found up to 5-fold differences in the yield of sequences between individually barcodes samples. Using either a one-step or a two-step PCR preparation resulted in significantly different estimates in both alpha and beta diversity. Comparing with a previous method based on 454 pyrosequencing, we found that our Illumina protocol performed in a similar manner - with the exception for evenness estimates where correspondence between the methods was low. We further quantified the data loss at every processing step eventually accumulating to 50% of the raw reads. When evaluating different OTU clustering methods, we observed a stark contrast between the results of QIIME with default settings and the more recent UPARSE algorithm when it comes to the number of OTUs generated. Still, overall trends in alpha and beta diversity corresponded highly using both clustering methods. Our procedure performed well considering the precisions of alpha and beta diversity estimates, with insignificant effects of individual barcodes. Comparative analyses suggest that 454 and Illumina sequence data can be combined if the same PCR protocol and bioinformatic workflows are used for describing patterns in richness, beta-diversity and taxonomic

  3. HeurAA: accurate and fast detection of genetic variations with a novel heuristic amplicon aligner program for next generation sequencing.

    Directory of Open Access Journals (Sweden)

    Lőrinc S Pongor

    Full Text Available Next generation sequencing (NGS of PCR amplicons is a standard approach to detect genetic variations in personalized medicine such as cancer diagnostics. Computer programs used in the NGS community often miss insertions and deletions (indels that constitute a large part of known human mutations. We have developed HeurAA, an open source, heuristic amplicon aligner program. We tested the program on simulated datasets as well as experimental data from multiplex sequencing of 40 amplicons in 12 oncogenes collected on a 454 Genome Sequencer from lung cancer cell lines. We found that HeurAA can accurately detect all indels, and is more than an order of magnitude faster than previous programs. HeurAA can compare reads and reference sequences up to several thousand base pairs in length, and it can evaluate data from complex mixtures containing reads of different gene-segments from different samples. HeurAA is written in C and Perl for Linux operating systems, the code and the documentation are available for research applications at http://sourceforge.net/projects/heuraa/

  4. Genetic divergence among Psidium accessions based on single nucleotide polymorphisms developed for Eucalyptus.

    Science.gov (United States)

    Costa, S R; Santos, C A F

    2017-05-04

    The goal of this study was to analyze the genetic divergence among Psidium species accessions based on SNPs developed for Eucalyptus. Fifty-three Psidium accessions, including 47 P. guajava, were genotyped with EUCHIP60K. The dendrogram similarity ranged from 0.58 to 1.00, with a cophenetic value of 0.97. Five groups were identified at dendrogram cut point of 0.7: the first with 44 guava accessions, the second with 1 guava accession, the third with 3 P. guineense accessions, the forth with 2 guava accessions, and the fifth with 3 P. cattleianum accessions. The Bayesian analyses suggested seven subpopulations, with formation of two additional groups with guava accessions. Primers designed with Eucalyptus SNP sequences resulted in reliable Psidium amplicons on 6% polyacrylamide gels. In general, the SNP dendrogram agreed with biological genus structure, since different species were not grouped, indicating that transferability among Myrtaceae genus was possible and reliable.

  5. Recombinant adeno-associated virus type 2 replication and packaging is entirely supported by a herpes simplex virus type 1 amplicon expressing Rep and Cap.

    Science.gov (United States)

    Conway, J E; Zolotukhin, S; Muzyczka, N; Hayward, G S; Byrne, B J

    1997-11-01

    Recombinant adeno-associated virus (AAV) type 2 (rAAV) vectors have recently been shown to have great utility as gene transfer agents both in vitro and in vivo. One of the problems associated with the use of rAAV vectors has been the difficulty of large-scale vector production. Low-efficiency plasmid transfection of the rAAV vector and complementing AAV type 2 (AAV-2) functions (rep and cap) followed by superinfection with adenovirus has been the standard approach to rAAV production. The objectives of this study were to demonstrate the ability of a recombinant herpes simplex virus type 1 (HSV-1) amplicon expressing AAV-2 Rep and Cap to support replication and packaging of rAAV vectors. HSV-1 amplicon vectors were constructed which contain the AAV-2 rep and cap genes under control of their native promoters (p5, p19, and p40). An HSV-1 amplicon vector, HSV-RC/KOS or HSV-RC/d27, was generated by supplying helper functions with either wild-type HSV-1 (KOS strain) or the ICP27-deleted mutant of HSV-1, d27-1, respectively. Replication of the amplicon stocks is not inhibited by the presence of AAV-2 Rep proteins, which highlights important differences between HSV-1 and adenovirus replication and the mechanism of providing helper function for productive AAV infection. Coinfection of rAAV and HSV-RC/KOS resulted in the replication and amplification of rAAV genomes. Similarly, rescue and replication of rAAV genomes occurred when rAAV vector plasmids were transfected into cells followed by HSV-RC/KOS infection and when two rAAV proviral cell lines were infected with HSV-RC/KOS or HSV-RC/d27. Production of infectious rAAV by rescue from two rAAV proviral cell lines has also been achieved with HSV-RC/KOS and HSV-RC/d27. The particle titer of rAAV produced with HSV-RC/d27 is equal to that achieved by supplying rep and cap by transfection followed by adenovirus superinfection. Importantly, no detectable wild-type AAV-2 is generated with this approach. These results demonstrate

  6. Polymicrobial nature of chronic diabetic foot ulcer biofilm infections determined using bacterial tag encoded FLX amplicon pyrosequencing (bTEFAP.

    Directory of Open Access Journals (Sweden)

    Scot E Dowd

    Full Text Available BACKGROUND: Diabetic extremity ulcers are associated with chronic infections. Such ulcer infections are too often followed by amputation because there is little or no understanding of the ecology of such infections or how to control or eliminate this type of chronic infection. A primary impediment to the healing of chronic wounds is biofilm phenotype infections. Diabetic foot ulcers are the most common, disabling, and costly complications of diabetes. Here we seek to derive a better understanding of the polymicrobial nature of chronic diabetic extremity ulcer infections. METHODS AND FINDINGS: Using a new bacterial tag encoded FLX amplicon pyrosequencing (bTEFAP approach we have evaluated the bacterial diversity of 40 chronic diabetic foot ulcers from different patients. The most prevalent bacterial genus associated with diabetic chronic wounds was Corynebacterium spp. Findings also show that obligate anaerobes including Bacteroides, Peptoniphilus, Fingoldia, Anaerococcus, and Peptostreptococcus spp. are ubiquitous in diabetic ulcers, comprising a significant portion of the wound biofilm communities. Other major components of the bacterial communities included commonly cultured genera such as Streptococcus, Serratia, Staphylococcus and Enterococcus spp. CONCLUSIONS: In this article, we highlight the patterns of population diversity observed in the samples and introduce preliminary evidence to support the concept of functional equivalent pathogroups (FEP. Here we introduce FEP as consortia of genotypically distinct bacteria that symbiotically produce a pathogenic community. According to this hypothesis, individual members of these communities when they occur alone may not cause disease but when they coaggregate or consort together into a FEP the synergistic effect provides the functional equivalence of well-known pathogens, such as Staphylococcus aureus, giving the biofilm community the factors necessary to maintain chronic biofilm infections

  7. RNA-Based Amplicon Sequencing Reveals Microbiota Development during Ripening of Artisanal versus Industrial Lard d'Arnad.

    Science.gov (United States)

    Ferrocino, Ilario; Bellio, Alberto; Romano, Angelo; Macori, Guerrino; Rantsiou, Kalliopi; Decastelli, Lucia; Cocolin, Luca

    2017-08-15

    Valle d'Aosta Lard d'Arnad is a protected designation of origin (PDO) product produced from fat of the shoulder and back of heavy pigs. Its manufacturing process can be very diverse, especially regarding the maturation temperature and the NaCl concentration used for the brine; thereby, the main goal of this study was to investigate the impact of those parameters on the microbiota developed during curing and ripening. Three farms producing Lard d'Arnad were selected. Two plants, reflecting the industrial process characterized either by low maturation temperature (plant A [10% NaCl, 2°C]) or by using a low NaCl concentration (plant B [2.5% NaCl, 4°C]), were selected, while the third was characterized by an artisanal process (plant C [30% NaCl, 8°C]). Lard samples were obtained at time 0 and after 7, 15, 30, 60, and 90 days of maturation. From each plant, 3 independent lots were analyzed. The diversity of live microbiota was evaluated by using classical plate counts and amplicon target sequencing of small subunit (SSU) rRNA. The main taxa identified by sequencing were Acinetobacter johnsonii , Psychrobacter , Staphylococcus equorum , Staphylococcus sciuri , Pseudomonas fragi , Brochothrix , Halomonas , and Vibrio , and differences in their relative abundances distinguished samples from the individual plants. The composition of the microbiota was more similar among plants A and B, and it was characterized by the higher presence of taxa recognized as undesired bacteria in food-processing environments. Oligotype analysis of Halomonas and Acinetobacter revealed the presence of several characteristic oligotypes associated with A and B samples. IMPORTANCE Changes in the food production process can drastically affect the microbial community structure, with a possible impact on the final characteristics of the products. The industrial processes of Lard d'Arnad production are characterized by a reduction in the salt concentration in the brines to address a consumer demand

  8. Open Access

    Science.gov (United States)

    Suber, Peter

    2012-01-01

    The Internet lets us share perfect copies of our work with a worldwide audience at virtually no cost. We take advantage of this revolutionary opportunity when we make our work "open access": digital, online, free of charge, and free of most copyright and licensing restrictions. Open access is made possible by the Internet and copyright-holder…

  9. Detection of double-stranded PCR amplicons at the attomole level electrosprayed from low nanomolar solutions using FT-ICR mass spectrometry.

    Science.gov (United States)

    Hannis, J C; Muddiman, D C

    2001-02-01

    An 82-base-pair polymerase chain reaction (PCR) product was amplified from the tetranucleotide short tandem repeat locus within the human tyrosine hydroxylase gene. PCR amplification was carried out using 100 ng of human nuclear DNA obtained from an individual who is homozygotic for the 9.3 allele resulting in a 50.5 kDa amplicon. To generate sufficient material for these investigations, several reactions were pooled and subsequently purified and quantified using UV-vis spectrophotometry. A serial dilution was carried out from a 2 microM stock solution providing solution concentrations down to 5 nM. Measurements were made using hexapole accumulation and gated trapping strategies in a 4.7 Telsa Fourier transform ion cyclotron resonance mass spectrometer (FTICR-MS) which facilitated detection of the amplicon at the attomole level when electrosprayed from a 5 nM solution with a single acquisition! The signal-to-noise ratio was determined to be 8.3 for the spectrum derived from the 5 nM solution using the magnitude-mode mass spectral peak height for the most abundant charge-state. This remarkable sensitivity for large PCR amplicons will dramatically improve the ability of electrospray ionization mass spectrometry to address important genetic questions for low copy number genes or when the amount of initial template is limited; the latter issue is commonly encountered in DNA forensics. Furthermore, these data represents over 2 orders of magnitude decrease in detection limits over other existing ESI-MS reports concerning PCR products, including those conducted using FTICR-MS.

  10. Microbial diversity of a full-scale UASB reactor applied to poultry slaughterhouse wastewater treatment: integration of 16S rRNA gene amplicon and shotgun metagenomic sequencing.

    Science.gov (United States)

    Delforno, Tiago Palladino; Lacerda Júnior, Gileno Vieira; Noronha, Melline F; Sakamoto, Isabel K; Varesche, Maria Bernadete A; Oliveira, Valéria M

    2017-06-01

    The 16S rRNA gene amplicon and whole-genome shotgun metagenomic (WGSM) sequencing approaches were used to investigate wide-spectrum profiles of microbial composition and metabolic diversity from a full-scale UASB reactor applied to poultry slaughterhouse wastewater treatment. The data were generated by using MiSeq 2 × 250 bp and HiSeq 2 × 150 bp Illumina sequencing platforms for 16S amplicon and WGSM sequencing, respectively. Each approach revealed a distinct microbial community profile, with Pseudomonas and Psychrobacter as predominant genus for the WGSM dataset and Clostridium and Methanosaeta for the 16S rRNA gene amplicon dataset. The virome characterization revealed the presence of two viral families with Bacteria and Archaea as host, Myoviridae, and Siphoviridae. A wide functional diversity was found with predominance of genes involved in the metabolism of acetone, butanol, and ethanol synthesis; and one-carbon metabolism (e.g., methanogenesis). Genes related to the acetotrophic methanogenesis pathways were more abundant than methylotrophic and hydrogenotrophic, corroborating the taxonomic results that showed the prevalence of the acetotrophic genus Methanosaeta. Moreover, the dataset indicated a variety of metabolic genes involved in sulfur, nitrogen, iron, and phosphorus cycles, with many genera able to act in all cycles. BLAST analysis against Antibiotic Resistance Genes Database (ARDB) revealed that microbial community contained 43 different types of antibiotic resistance genes, some of them were associated with growth chicken promotion (e.g., bacitracin, tetracycline, and polymyxin). © 2017 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  11. Assessment of Capture and Amplicon-Based Approaches for the Development of a Targeted Next-Generation Sequencing Pipeline to Personalize Lymphoma Management.

    Science.gov (United States)

    Hung, Stacy S; Meissner, Barbara; Chavez, Elizabeth A; Ben-Neriah, Susana; Ennishi, Daisuke; Jones, Martin R; Shulha, Hennady P; Chan, Fong Chun; Boyle, Merrill; Kridel, Robert; Gascoyne, Randy D; Mungall, Andrew J; Marra, Marco A; Scott, David W; Connors, Joseph M; Steidl, Christian

    2018-03-01

    Targeted next-generation sequencing panels are increasingly used to assess the value of gene mutations for clinical diagnostic purposes. For assay development, amplicon-based methods have been preferentially used on the basis of short preparation time and small DNA input amounts. However, capture sequencing has emerged as an alternative approach because of high testing accuracy. We compared capture hybridization and amplicon sequencing approaches using fresh-frozen and formalin-fixed, paraffin-embedded tumor samples from eight lymphoma patients. Next, we developed a targeted sequencing pipeline using a 32-gene panel for accurate detection of actionable mutations in formalin-fixed, paraffin-embedded tumor samples of the most common lymphocytic malignancies: chronic lymphocytic leukemia, diffuse large B-cell lymphoma, and follicular lymphoma. We show that hybrid capture is superior to amplicon sequencing by providing deep more uniform coverage and yielding higher sensitivity for variant calling. Sanger sequencing of 588 variants identified specificity limits of thresholds for mutation calling, and orthogonal validation on 66 cases indicated 93% concordance with whole-genome sequencing. The developed pipeline and assay identified at least one actionable mutation in 91% of tumors from 219 lymphoma patients and revealed subtype-specific mutation patterns and frequencies consistent with the literature. This pipeline is an accurate and sensitive method for identifying actionable gene mutations in routinely acquired biopsy materials, suggesting further assessment of capture-based assays in the context of personalized lymphoma management. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  12. Illumina MiSeq 16S amplicon sequence analysis of bovine respiratory disease associated bacteria in lung and mediastinal lymph node tissue.

    Science.gov (United States)

    Johnston, Dayle; Earley, Bernadette; Cormican, Paul; Murray, Gerard; Kenny, David Anthony; Waters, Sinead Mary; McGee, Mark; Kelly, Alan Kieran; McCabe, Matthew Sean

    2017-05-02

    Bovine respiratory disease (BRD) is caused by growth of single or multiple species of pathogenic bacteria in lung tissue following stress and/or viral infection. Next generation sequencing of 16S ribosomal RNA gene PCR amplicons (NGS 16S amplicon analysis) is a powerful culture-independent open reference method that has recently been used to increase understanding of BRD-associated bacteria in the upper respiratory tract of BRD cattle. However, it has not yet been used to examine the microbiome of the bovine lower respiratory tract. The objective of this study was to use NGS 16S amplicon analysis to identify bacteria in post-mortem lung and lymph node tissue samples harvested from fatal BRD cases and clinically healthy animals. Cranial lobe and corresponding mediastinal lymph node post-mortem tissue samples were collected from calves diagnosed as BRD cases by veterinary laboratory pathologists and from clinically healthy calves. NGS 16S amplicon libraries, targeting the V3-V4 region of the bacterial 16S rRNA gene were prepared and sequenced on an Illumina MiSeq. Quantitative insights into microbial ecology (QIIME) was used to determine operational taxonomic units (OTUs) which corresponded to the 16S rRNA gene sequences. Leptotrichiaceae, Mycoplasma, Pasteurellaceae, and Fusobacterium were the most abundant OTUs identified in the lungs and lymph nodes of the calves which died from BRD. Leptotrichiaceae, Fusobacterium, Mycoplasma, Trueperella and Bacteroides had greater relative abundances in post-mortem lung samples collected from fatal cases of BRD in dairy calves, compared with clinically healthy calves without lung lesions. Leptotrichiaceae, Mycoplasma and Pasteurellaceae showed higher relative abundances in post-mortem lymph node samples collected from fatal cases of BRD in dairy calves, compared with clinically healthy calves without lung lesions. Two Leptotrichiaceae sequence contigs were subsequently assembled from bacterial DNA-enriched shotgun sequences

  13. Accessing memory

    Science.gov (United States)

    Yoon, Doe Hyun; Muralimanohar, Naveen; Chang, Jichuan; Ranganthan, Parthasarathy

    2017-09-26

    A disclosed example method involves performing simultaneous data accesses on at least first and second independently selectable logical sub-ranks to access first data via a wide internal data bus in a memory device. The memory device includes a translation buffer chip, memory chips in independently selectable logical sub-ranks, a narrow external data bus to connect the translation buffer chip to a memory controller, and the wide internal data bus between the translation buffer chip and the memory chips. A data access is performed on only the first independently selectable logical sub-rank to access second data via the wide internal data bus. The example method also involves locating a first portion of the first data, a second portion of the first data, and the second data on the narrow external data bus during separate data transfers.

  14. Accessible Knowledge - Knowledge on Accessibility

    DEFF Research Database (Denmark)

    Kirkeby, Inge Mette

    2015-01-01

    Although serious efforts are made internationally and nationally, it is a slow process to make our physical environment accessible. In the actual design process, architects play a major role. But what kinds of knowledge, including research-based knowledge, do practicing architects make use of when...... designing accessible environments? The answer to the question is crucially important since it affects how knowledge is distributed and how accessibility can be ensured. In order to get first-hand knowledge about the design process and the sources from which they gain knowledge, 11 qualitative interviews...... were conducted with architects with experience of designing for accessibility. The analysis draws on two theoretical distinctions. The first is research-based knowledge versus knowledge used by architects. The second is context-independent knowledge versus context-dependent knowledge. The practitioners...

  15. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Bacterial 16S ribosomal DNA (rDNA amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90% were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969-983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies.

  16. Cowpea mosaic virus RNA-1 acts as an amplicon whose effects can be counteracted by a RNA-2-encoded suppressor of silencing

    International Nuclear Information System (INIS)

    Liu Li; Grainger, Jef; Canizares, M. Carmen; Angell, Susan M.; Lomonossoff, George P.

    2004-01-01

    Lines of Nicotiana benthamiana transgenic for full-length copies of both Cowpea mosaic virus (CPMV) genomic RNAs, either singly or together, have been produced. Plants transgenic for both RNAs developed symptoms characteristic of a CPMV infection. When plants transgenic for RNA-1 were agro-inoculated with RNA-2, no infection developed and the plants were also resistant to challenge with CPMV. By contrast, plants transgenic for RNA-2 became infected when agro-inoculated with RNA-1 and were fully susceptible to CPMV infection. The resistance of RNA-1 transgenic plants was shown to be related to the ability of RNA-1 to self-replicate and act as an amplicon. The ability of transgenically expressed RNA-2 to counteract the amplicon effect suggested that it encodes a suppressor of posttranscriptional gene silencing (PTGS). By examining the ability of portions of RNA-2 to reverse PTGS in N. benthamiana, we have identified the small (S) coat protein as the CPMV RNA-2-encoded suppressor of PTGS

  17. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  18. Open access

    CERN Document Server

    Suber, Peter

    2012-01-01

    The Internet lets us share perfect copies of our work with a worldwide audience at virtually no cost. We take advantage of this revolutionary opportunity when we make our work "open access": digital, online, free of charge, and free of most copyright and licensing restrictions. Open access is made possible by the Internet and copyright-holder consent, and many authors, musicians, filmmakers, and other creators who depend on royalties are understandably unwilling to give their consent. But for 350 years, scholars have written peer-reviewed journal articles for impact, not for money, and are free to consent to open access without losing revenue. In this concise introduction, Peter Suber tells us what open access is and isn't, how it benefits authors and readers of research, how we pay for it, how it avoids copyright problems, how it has moved from the periphery to the mainstream, and what its future may hold. Distilling a decade of Suber's influential writing and thinking about open access, this is the indispe...

  19. Access French

    CERN Document Server

    Grosz, Bernard

    2014-01-01

    Access is the major new language series designed with the needs of today's generation of students firmly in mind. Whether learning for leisure or business purposes or working towards a curriculum qualification, Access French is specially designed for adults of all ages and gives students a thorough grounding in all the skills required to understand, speak, read and write contemporary French from scratch. The coursebook consists of 10 units covering different topic areas, each of which includes Language Focus panels explaining the structures covered and a comprehensive glossary. Learning tips

  20. Analysis of the genetic diversity of physic nut, Jatropha curcas L. accessions using RAPD markers.

    Science.gov (United States)

    Rafii, M Y; Shabanimofrad, M; Puteri Edaroyati, M W; Latif, M A

    2012-06-01

    A sum of 48 accessions of physic nut, Jatropha curcas L. were analyzed to determine the genetic diversity and association between geographical origin using RAPD-PCR markers. Eight primers generated a total of 92 fragments with an average of 11.5 amplicons per primer. Polymorphism percentages of J. curcas accessions for Selangor, Kelantan, and Terengganu states were 80.4, 50.0, and 58.7%, respectively, with an average of 63.04%. Jaccard's genetic similarity co-efficient indicated the high level of genetic variation among the accessions which ranged between 0.06 and 0.81. According to UPGMA dendrogram, 48 J. curcas accessions were grouped into four major clusters at coefficient level 0.3 and accessions from same and near states or regions were found to be grouped together according to their geographical origin. Coefficient of genetic differentiation (G(st)) value of J. curcas revealed that it is an outcrossing species.

  1. A need for standardization in drinking water analysis – an investigation of DNA extraction procedure, primer choice and detection limit of 16S rRNA amplicon sequencing

    DEFF Research Database (Denmark)

    Brandt, Jakob; Nielsen, Per Halkjær; Albertsen, Mads

    have been made to illuminate the effects specifically related to bacterial communities in drinking water. In this study, we investigated the impact of the DNA extraction and primer choice on the observed community structure, and we also estimated the detection limit of the 16S rRNA amplicon sequencing....... The PowerWater DNA Isolation Kit resulted in significantly higher amounts of isolated DNA compared to the FastDNA SPIN Kit for Soil. Furthermore, extraction with the PowerWater kit lead to detection of a significantly higher number of OTUs. Likewise, the primer experiment revealed great discrepancies in OTU....... coli could be detected in all samples. However, samples with 101 cells/mL had several contaminating OTUs, constituting approximately 8% of the read abundances. For 16S rRNA gene analysis in drinking water samples, we recommend using the PowerWater DNA Isolation Kit for DNA extraction in combination...

  2. Large-scale benchmarking reveals false discoveries and count transformation sensitivity in 16S rRNA gene amplicon data analysis methods used in microbiome studies

    DEFF Research Database (Denmark)

    Thorsen, Jonathan; Brejnrod, Asker Daniel; Mortensen, Martin Steen

    2016-01-01

    detection power. For beta-diversity-based sample separation, we show that library size normalization has very little effect and that the distance metric is the most important factor in terms of separation power. CONCLUSIONS: Our results, generalizable to datasets from different sequencing platforms......, demonstrate how the choice of method considerably affects analysis outcome. Here, we give recommendations for tools that exhibit low false positive rates, have good retrieval power across effect sizes and case/control proportions, and have low sparsity bias. Result output from some commonly used methods......BACKGROUND: There is an immense scientific interest in the human microbiome and its effects on human physiology, health, and disease. A common approach for examining bacterial communities is high-throughput sequencing of 16S rRNA gene hypervariable regions, aggregating sequence-similar amplicons...

  3. Simplified strategy for rapid first-line screening of fragile X syndrome: closed-tube triplet-primed PCR and amplicon melt peak analysis.

    Science.gov (United States)

    Rajan-Babu, Indhu-Shree; Law, Hai-Yang; Yoon, Chui-Sheun; Lee, Caroline G; Chong, Samuel S

    2015-05-04

    Premutation and full-mutation hyperexpansion of CGG-triplets in the X-linked Fragile X Mental Retardation 1 (FMR1) gene have been implicated in fragile X-associated tremor/ataxia syndrome, fragile X-associated primary ovarian insufficiency, and fragile X syndrome (FXS), respectively. The currently available molecular diagnostic tests are either costly or labour-intensive, which prohibits their application as a first-line FMR1 test in large-scale population-based screening programs. In this study, we demonstrate the utility of a simplified closed-tube strategy for rapid first-line screening of FXS based on melt peak temperature (Tm) analysis of direct triplet-primed polymerase chain reaction amplicons (dTP-PCR MCA). In addition, we also evaluated the correlation between Tm and CGG-repeat size based on capillary electrophoresis (CE) of dTP-PCR amplicons. The assays were initially tested on 29 FMR1 reference DNA samples, followed by a blinded validation on 107 previously characterised patient DNA samples. The dTP-PCR MCA produced distinct melt profiles of higher Tm for samples carrying an expanded allele. Among the samples tested, we also observed a good correlation between Tm and CGG-repeat size. In the blinded validation study, dTP-PCR MCA accurately classified all normal and expansion carriers, and the FMR1 genotypic classification of all samples was completely concordant with the previously determined genotypes as well as the dTP-PCR CE results. This simple and cost-effective MCA-based assay may be useful as a first-line FXS screening tool that could rapidly screen out the large majority of unaffected individuals, thus minimising the number of samples that need to be analysed by Southern blot analysis.

  4. A performance evaluation of Nextera XT and KAPA HyperPlus for rapid Illumina library preparation of long-range mitogenome amplicons.

    Science.gov (United States)

    Ring, Joseph D; Sturk-Andreaggi, Kimberly; Peck, Michelle A; Marshall, Charla

    2017-07-01

    Next-generation sequencing (NGS) facilitates the rapid and high-throughput generation of human mitochondrial genome (mitogenome) data to build population and reference databases for forensic comparisons. To this end, long-range amplification provides an effective method of target enrichment that is amenable to library preparation assays employing DNA fragmentation. This study compared the Nextera XT DNA Library Preparation Kit (Illumina, San Diego, CA) and the KAPA HyperPlus Library Preparation Kit (Kapa Biosystems, Wilmington, MA) for enzymatic fragmentation and indexing of ∼8500bp mitogenome amplicons for Illumina sequencing. The Nextera XT libraries produced low-coverage regions that were consistent across all samples, while the HyperPlus libraries resulted in uniformly high coverage across the mitogenome, even with reduced-volume reaction conditions. The balanced coverage observed from KAPA HyperPlus libraries enables not only low-level variant calling across the mitogenome but also increased sample multiplexing for greater processing efficiency. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Tandem multiplication of the IS26-flanked amplicon with the bla(SHV-5) gene within plasmid p1658/97.

    Science.gov (United States)

    Zienkiewicz, Maksymilian; Kern-Zdanowicz, Izabela; Carattoli, Alessandra; Gniadkowski, Marek; Cegłowski, Piotr

    2013-04-01

    The IncF plasmid p1658/97 (c. 125 kb) from Escherichia coli isolates recovered during a clonal outbreak in a hospital in Warsaw, Poland, in 1997 contains the extended-spectrum β-lactamase (ESBL) gene bla(SHV-5), originated from the Klebsiella pneumoniae chromosome. A region containing the bla(SHV-5) gene is flanked by two IS26 copies and its copy number multiplies spontaneously within p1658/97 and RecA-deficient E. coli strains. Here, we demonstrate that the amplified IS26-bla(SHV-5) units were arranged in tandems, containing up to more than 10 units, which could raise ceftazidime MICs for host strains from 4 μg mL(-1) to more than 128 μg mL(-1). Successive deletions within p1658/97, located outside the amplifiable module and encompassing even as little as c. 15% of the plasmid, blocked the amplification. Moreover, the complementing re-introduction of the deleted fragments in trans did not restore the process. Similarly, insertions of a 1-kb DNA fragment into the amplicon inhibited its self-multiplication ability. The module was able to transmit into another IS26-containing plasmid by recombination. The results prompted us to speculate that local DNA structure, especially favorable in p1658/97, might have been responsible for the IS26-bla(SHV-5) multiplication ability. © 2013 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  6. Application of long amplicon propidium monoazide-PCR to assess the effects of temperature and background microbiota on pathogens in river water.

    Science.gov (United States)

    Banihashemi, Avid; Van Dyke, Michele I; Huck, Peter M

    2017-06-01

    The decay rates of enteric waterborne pathogens were evaluated following the introduction of Yersinia enterocolitica, Salmonella enterica, Campylobacter jejuni and Arcobacter butzleri into river water at different temperatures (5, 15 and 25°C) for a period of 28 days. To improve the accuracy of the results a molecular viability assay, long amplicon propidium monoazide-polymerase chain reaction (PMA-PCR), was used to quantify the viable cell concentration and results from PCR with and without PMA were compared. As well, the effect of background microbiota was assessed for Y. enterocolitica and S. enterica by inoculating cells into sterile and non-sterile river water. Cell persistence was improved by up to 4 log for Y. enterocolitica and 4.5 log for S. enterica in sterile river water compared to natural river water, showing that the autochthonous biological activity in river water can accelerate the die-off of introduced bacteria. Results also showed that low temperature significantly improved the persistence of all four target bacteria in non-sterile river water. There was a more rapid decline in cell concentration in samples with PMA pretreatment; therefore using PMA-PCR analysis can provide more reliable data on viable/active enteric bacteria in aquatic microcosms and allows for improved assessment of pathogens in the environment.

  7. Identification of active denitrifiers by DNA-stable isotope probing and amplicon sequencing reveals Betaproteobacteria as responsible for attenuation of nitrate contamination in a low impacted aquifer.

    Science.gov (United States)

    Bellini, M Inés; Kumaresan, Deepak; Tarlera, Silvana; Murrell, J Colin; Fernández-Scavino, Ana

    2018-02-01

    Groundwater reservoirs constitute important freshwater resources. However, these ecosystems are highly vulnerable to contamination and have to rely on the resident microbiota to attenuate the impact of this contamination. Nitrate is one of the main contaminants found in groundwater, and denitrification is the main process that removes the compound. In this study, the response to nutrient load on indigenous microbial communities in groundwater from a low impacted aquifer in Uruguay was evaluated. Denitrification rates were measured in groundwater samples from three different sites with nitrate, acetate and pyrite amendments. Results showed that denitrification is feasible under in situ nitrate and electron donor concentrations, although the lack of readily available organic energy source would limit the attenuation of higher nitrate concentrations. DNA-stable isotope probing, combined with amplicon sequencing of 16S rRNA, nirS and nirK genes, was used to identify the active denitrifiers. Members of the phylum Betaproteobacteria were the dominant denitrifiers in two of three sites, with different families being observed; members of the genus Vogesella (Neisseriaceae) were key denitrifiers at one site, while the genera Dechloromonas (Rhodocyclaceae) and Comamonas (Comamonadaceae) were the main denitrifiers detected at the other sites. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. The use of genus-specific amplicon pyrosequencing to assess phytophthora species diversity using eDNA from soil and water in Northern Spain.

    Science.gov (United States)

    Català, Santiago; Pérez-Sierra, Ana; Abad-Campos, Paloma

    2015-01-01

    Phytophthora is one of the most important and aggressive plant pathogenic genera in agriculture and forestry. Early detection and identification of its pathways of infection and spread are of high importance to minimize the threat they pose to natural ecosystems. eDNA was extracted from soil and water from forests and plantations in the north of Spain. Phytophthora-specific primers were adapted for use in high-throughput Sequencing (HTS). Primers were tested in a control reaction containing eight Phytophthora species and applied to water and soil eDNA samples from northern Spain. Different score coverage threshold values were tested for optimal Phytophthora species separation in a custom-curated database and in the control reaction. Clustering at 99% was the optimal criteria to separate most of the Phytophthora species. Multiple Molecular Operational Taxonomic Units (MOTUs) corresponding to 36 distinct Phytophthora species were amplified in the environmental samples. Pyrosequencing of amplicons from soil samples revealed low Phytophthora diversity (13 species) in comparison with the 35 species detected in water samples. Thirteen of the MOTUs detected in rivers and streams showed no close match to sequences in international sequence databases, revealing that eDNA pyrosequencing is a useful strategy to assess Phytophthora species diversity in natural ecosystems.

  9. Gastrointestinal Bacterial and Methanogenic Archaea Diversity Dynamics Associated with Condensed Tannin-Containing Pine Bark Diet in Goats Using 16S rDNA Amplicon Pyrosequencing.

    Science.gov (United States)

    Min, Byeng R; Solaiman, Sandra; Shange, Raymon; Eun, Jong-Su

    2014-01-01

    Eighteen Kiko-cross meat goats (n = 6) were used to collect gastrointestinal (GI) bacteria and methanogenic archaea for diversity measures when fed condensed tannin-containing pine bark (PB). Three dietary treatments were tested: control diet (0% PB and 30% wheat straw (WS); 0.17% condensed tannins (CT) dry matter (DM)); 15% PB and 15% WS (1.6% CT DM), and 30% PB and 0% WS (3.2% CT DM). A 16S rDNA bacterial tag-encoded FLX amplicon pyrosequencing technique was used to characterize and elucidate changes in GI bacteria and methanogenic archaea diversity among the diets. Proteobacteria was the most dominant phylum in goats with mean relative abundance values ranging from 39.7 (30% PB) to 46.5% (control) and 47.1% (15% PB). Other phyla individually accounted for fewer than 25% of the relative abundance observed. Predominant methanogens were Methanobrevibacter (75, 72, and 49%), Methanosphaera (3.3, 2.3, and 3.4%), and Methanobacteriaceae (1.2, 0.6, and 0.7%) population in control, 15, and 30% PB, respectively. Among methanogens, Methanobrevibacter was linearly decreased (P = 0.05) with increasing PB supplementation. These results indicate that feeding PB selectively altered bacteria and methanogenic archaeal populations in the GI tract of goats.

  10. Gastrointestinal Bacterial and Methanogenic Archaea Diversity Dynamics Associated with Condensed Tannin-Containing Pine Bark Diet in Goats Using 16S rDNA Amplicon Pyrosequencing

    Directory of Open Access Journals (Sweden)

    Byeng R. Min

    2014-01-01

    Full Text Available Eighteen Kiko-cross meat goats (n=6 were used to collect gastrointestinal (GI bacteria and methanogenic archaea for diversity measures when fed condensed tannin-containing pine bark (PB. Three dietary treatments were tested: control diet (0% PB and 30% wheat straw (WS; 0.17% condensed tannins (CT dry matter (DM; 15% PB and 15% WS (1.6% CT DM, and 30% PB and 0% WS (3.2% CT DM. A 16S rDNA bacterial tag-encoded FLX amplicon pyrosequencing technique was used to characterize and elucidate changes in GI bacteria and methanogenic archaea diversity among the diets. Proteobacteria was the most dominant phylum in goats with mean relative abundance values ranging from 39.7 (30% PB to 46.5% (control and 47.1% (15% PB. Other phyla individually accounted for fewer than 25% of the relative abundance observed. Predominant methanogens were Methanobrevibacter (75, 72, and 49%, Methanosphaera (3.3, 2.3, and 3.4%, and Methanobacteriaceae (1.2, 0.6, and 0.7% population in control, 15, and 30% PB, respectively. Among methanogens, Methanobrevibacter was linearly decreased (P=0.05 with increasing PB supplementation. These results indicate that feeding PB selectively altered bacteria and methanogenic archaeal populations in the GI tract of goats.

  11. Size Matters: Assessing Optimum Soil Sample Size for Fungal and Bacterial Community Structure Analyses Using High Throughput Sequencing of rRNA Gene Amplicons

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2016-06-01

    Full Text Available We examined the effect of different soil sample sizes obtained from an agricultural field, under a single cropping system uniform in soil properties and aboveground crop responses, on bacterial and fungal community structure and microbial diversity indices. DNA extracted from soil sample sizes of 0.25, 1, 5 and 10 g using MoBIO kits and from 10 and 100 g sizes using a bead-beating method (SARDI were used as templates for high-throughput sequencing of 16S and 28S rRNA gene amplicons for bacteria and fungi, respectively, on the Illumina MiSeq and Roche 454 platforms. Sample size significantly affected overall bacterial and fungal community structure, replicate dispersion and the number of operational taxonomic units (OTUs retrieved. Richness, evenness and diversity were also significantly affected. The largest diversity estimates were always associated with the 10 g MoBIO extractions with a corresponding reduction in replicate dispersion. For the fungal data, smaller MoBIO extractions identified more unclassified Eukaryota incertae sedis and unclassified glomeromycota while the SARDI method retrieved more abundant OTUs containing unclassified Pleosporales and the fungal genera Alternaria and Cercophora. Overall, these findings indicate that a 10 g soil DNA extraction is most suitable for both soil bacterial and fungal communities for retrieving optimal diversity while still capturing rarer taxa in concert with decreasing replicate variation.

  12. Hemodialysis access -- self care

    Science.gov (United States)

    ... hemodialysis. Taking good care of your access helps make it last longer. Prevent Infection in Your Access Keep your access clean. Wash the access with soap and water every day to decrease your risk ...

  13. DNA of a circular minichromosome linearized by restriction enzymes or other reagents is resistant to further cleavage: an influence of chromatin topology on the accessibility of DNA.

    Science.gov (United States)

    Kumala, Sławomir; Hadj-Sahraoui, Yasmina; Rzeszowska-Wolny, Joanna; Hancock, Ronald

    2012-10-01

    The accessibility of DNA in chromatin is an essential factor in regulating its activities. We studied the accessibility of the DNA in a ∼170 kb circular minichromosome to DNA-cleaving reagents using pulsed-field gel electrophoresis and fibre-fluorescence in situ hybridization on combed DNA molecules. Only one of several potential sites in the minichromosome DNA was accessible to restriction enzymes in permeabilized cells, and in growing cells only a single site at an essentially random position was cut by poisoned topoisomerase II, neocarzinostatin and γ-radiation, which have multiple potential cleavage sites; further sites were then inaccessible in the linearized minichromosomes. Sequential exposure to combinations of these reagents also resulted in cleavage at only a single site. Minichromosome DNA containing single-strand breaks created by a nicking endonuclease to relax any unconstrained superhelicity was also cut at only a single position by a restriction enzyme. Further sites became accessible after ≥95% of histones H2A, H2B and H1, and most non-histone proteins were extracted. These observations suggest that a global rearrangement of the three-dimensional packing and interactions of nucleosomes occurs when a circular minichromosome is linearized and results in its DNA becoming inaccessible to probes.

  14. Metallization of Single-Stranded Polyl by Zn2+ Ions in Neutral Solutions

    Czech Academy of Sciences Publication Activity Database

    Sorokin, V. A.; Valeev, V. A.; Usenko, E. L.; Andrushchenko, Valery

    2014-01-01

    Roč. 118, č. 43 (2014), s. 12360-12365 ISSN 1520-6106 Institutional support: RVO:61388963 Keywords : nucleic acid metallization * zinc ion * differential UV spectroscopy Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.302, year: 2014

  15. Oligo(dT) is not a correct native PAGE marker for single-stranded DNA

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Kypr, Jaroslav; Vorlíčková, Michaela

    2007-01-01

    Roč. 353, č. 3 (2007), s. 776-779 ISSN 0006-291X R&D Projects: GA AV ČR(CZ) IAA4004201; GA AV ČR(CZ) IAA1004201 Institutional research plan: CEZ:AV0Z50040702 Keywords : polyacrylamide gel electrophoresis * DNA length markers * oligo(dT) Subject RIV: BO - Biophysics Impact factor: 2.749, year: 2007

  16. Determination of nanogram quantities of osmium-labeled single stranded DNA by differential pulse stripping voltammetry

    Czech Academy of Sciences Publication Activity Database

    Kizek, René; Havran, Luděk; Fojta, Miroslav; Paleček, Emil

    2002-01-01

    Roč. 55, 1/2 (2002), s. 199-121 ISSN 1567-5394 R&D Projects: GA ČR GV204/97/K084; GA ČR GA204/00/D049; GA AV ČR IAA4004108 Institutional research plan: CEZ:AV0Z5004920 Keywords : differential pulse stripping voltammetry * microdetermination of DNA * chemical modification of DNA Subject RIV: BO - Biophysics Impact factor: 1.463, year: 2002

  17. Single stranded loops of quadruplex DNA as key benchmark for testing nucleic acids force fields

    Czech Academy of Sciences Publication Activity Database

    Fadrná, E.; Špačková, Naďa; Sarzynska, J.; Koča, J.; Orozco, M.; Cheatham III, T.E.; Kulinski, T.; Šponer, Jiří

    2009-01-01

    Roč. 5, č. 9 (2009), s. 2514-2530 ISSN 1549-9618 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802 Grant - others:GA ČR(CZ) GA203/09/1476 Program:GA Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA quadruplex * MD simulation * force fields Subject RIV: BO - Biophysics Impact factor: 4.804, year: 2009

  18. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-01

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  19. Absorption by DNA single strands of adenine isolated in vacuo: The role of multiple chromophores

    DEFF Research Database (Denmark)

    Nielsen, L.M.; Pedersen, S.O.; Kirketerp, M.-B.S.

    2012-01-01

    to that for the adenine molecule and the dAMP mononucleotide. Desolvation has little effect on the bandwidth, which implies that inhomogenous broadening of the absorption bands in aqueous solution is of minor importance compared to, e.g., conformational disorder. Finally, at high photon energies, internal conversion...

  20. RADX interacts with single-stranded DNA to promote replication fork stability

    DEFF Research Database (Denmark)

    Schubert, Lisa; Ho, Teresa; Hoffmann, Saskia

    2017-01-01

    has an essential genome maintenance role, protecting ssDNA regions from nucleolytic degradation and providing a recruitment platform for proteins involved in responses to replication stress and DNA damage. Here, we identify the uncharacterized protein RADX (CXorf57) as an ssDNA-binding factor in human...... cells. RADX binds ssDNA via an N-terminal OB fold cluster, which mediates its recruitment to sites of replication stress. Deregulation of RADX expression and ssDNA binding leads to enhanced replication fork stalling and degradation, and we provide evidence that a balanced interplay between RADX and RPA...

  1. Heterochromatin Reorganization during Early Mouse Development Requires a Single-Stranded Noncoding Transcript

    Directory of Open Access Journals (Sweden)

    Miguel Casanova

    2013-09-01

    Full Text Available The equalization of pericentric heterochromatin from distinct parental origins following fertilization is essential for genome function and development. The recent implication of noncoding transcripts in this process raises questions regarding the connection between RNA and the nuclear organization of distinct chromatin environments. Our study addresses the interrelationship between replication and transcription of the two parental pericentric heterochromatin (PHC domains and their reorganization during early embryonic development. We demonstrate that the replication of PHC is dispensable for its clustering at the late two-cell stage. In contrast, using parthenogenetic embryos, we show that pericentric transcripts are essential for this reorganization independent of the chromatin marks associated with the PHC domains. Finally, our discovery that only reverse pericentric transcripts are required for both the nuclear reorganization of PHC and development beyond the two-cell stage challenges current views on heterochromatin organization.

  2. Role of Electrostatics in the assembly pathway of a single-stranded RNA virus

    NARCIS (Netherlands)

    Garmann, R.F.; Comas-Garcia, M.; Koay, M.S.T.; Cornelissen, Jeroen Johannes Lambertus Maria; Knobler, C.M.; Gelbart, W.M.

    2014-01-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318–3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of

  3. Comment on "Monomer Dynamics in Double- and Single-Stranded DNA Polymers"

    OpenAIRE

    Tothova, J.; Brutovsky, B.; Lisy, V.

    2005-01-01

    It is discussed that the kinetics observed by Shusterman et al. [Phys. Rev. Lett. 92, 048303] for long dsDNA is not the Rouse one and, in fact, the macromolecule behaves (approximately) as the Zimm polymer.

  4. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-04-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  5. Toxin MqsR Cleaves Single-Stranded mRNA with Various 5 Ends

    Science.gov (United States)

    2016-08-24

    decreases persisence about 2400- fold (Harrison et al. 2009). Another type II TA toxin, MazF, induces growth arrest that results in up to a 700- fold...Life Technologies, Waltham, MA). In brief, 25 pmol of RNA was first treated with 0.1 U of calf intestine alkaline phosphatase (CIP, 0.1 U/μL) for 1...MqsR/MqsA regulate toxin CspD. Environ. Microbiol. 12:1105–1121. Kwan, B. W., J. A. Valenta, M. J. Benedik, and T. K. Wood. 2013. Arrested protein

  6. Detection of short single-strand DNA homopolymers with ultrathin Si3N4 nanopores.

    Science.gov (United States)

    Ma, Jian; Qiu, Yinghua; Yuan, Zhishan; Zhang, Yin; Sha, Jingjie; Liu, Lei; Sun, Litao; Ni, Zhonghua; Yi, Hong; Li, Deyu; Chen, Yunfei

    2015-08-01

    A series of nanopores with diameters ranging from 2.5 to 63 nm are fabricated on a reduced Si3N4 membrane by focused ion beam and high energy electron beam. Through measuring the blocked ionic currents for DNA strands threading linearly through those solid-state nanopores, it is found that the blockade ionic current is proportional to the square of the hydrodynamic diameter of the DNA strand. With the nanopore diameter reduced to be comparable with that of DNA strands, the hydrodynamic diameter of the DNA becomes smaller, which is attributed to the size confinement effects. The duration time for the linear DNA translocation events increases monotonically with the nanopore length. By comparing the spatial configurations of DNA strands through nanopores with different diameters, it is found that the nanopore with large diameter has enough space to allow the DNA strand to translocate through with complex conformation. With the decrease of the nanopore diameter, the folded part of the DNA is prone to be straightened by the nanopore, which leads to the increase in the occurrence frequency of the linear DNA translocation events. Reducing the diameter of the nanopore to 2.5 nm allows the detection and discrimination of three nucleotide "G" and three nucleotide "T" homopolymer DNA strands based on differences in their physical dimensions.

  7. Differentiation of Short Single-Stranded DNA Homopolymers in Solid-State Nanopores

    Science.gov (United States)

    Venta, Kimberly; Shemer, Gabriel; Puster, Matthew; Rodríguez-Manzo, Julio A.; Balan, Adrian; Rosenstein, Jacob K.; Shepard, Ken; Drndić, Marija

    2013-01-01

    In the last two decades, new techniques that monitor ionic current modulations as single molecules pass through a nanoscale pore have enabled numerous single-molecule studies. While biological nanopores have recently shown the ability to resolve single nucleotides within individual DNA molecules, similar developments with solid-state nanopores have lagged, due to challenges both in fabricating stable nanopores of similar dimensions as biological nanopores and in achieving sufficiently low-noise and high-bandwidth recordings. Here we show that small silicon nitride nanopores (0.8 to 2-nm-diameter in 5 to 8-nm-thick membranes) can resolve differences between ionic current signals produced by short (30 base) ssDNA homopolymers (poly(dA), poly(dC), poly(dT)), when combined with measurement electronics that allow a signal-to-noise ratio of better than 10 to be achieved at 1 MHz bandwidth. While identifying intramolecular DNA sequences with silicon nitride nanopores will require further improvements in nanopore sensitivity and noise levels, homopolymer differentiation represents an important milestone in the development of solid-state nanopores. PMID:23621759

  8. Source-based nomenclature for single-strand homopolymers and copolymers (IUPAC Recommendations 2016)

    Czech Academy of Sciences Publication Activity Database

    Jones, R. G.; Kitayama, T.; Hellwich, K. H.; Hess, M.; Jenkins, A. D.; Kahovec, Jaroslav; Kratochvíl, Pavel; Mita, I.; Mormann, W.; Ober, C. K.; Penczek, S.; Stepto, R. F. T.; Thurlow, K.; Vohlídal, J.; Wilks, E. S.

    2016-01-01

    Roč. 88, 10-11 (2016), s. 1073-1100 ISSN 0033-4545 Institutional support: RVO:61389013 Keywords : apparent monomer * copolymer * end-groups Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.626, year: 2016

  9. Theoretical Study of the Transpore Velocity Control of Single-Stranded DNA

    Directory of Open Access Journals (Sweden)

    Weixin Qian

    2014-08-01

    Full Text Available The electrokinetic transport dynamics of deoxyribonucleic acid (DNA molecules have recently attracted significant attention in various fields of research. Our group is interested in the detailed examination of the behavior of DNA when confined in micro/nanofluidic channels. In the present study, the translocation mechanism of a DNA-like polymer chain in a nanofluidic channel was investigated using Langevin dynamics simulations. A coarse-grained bead-spring model was developed to simulate the dynamics of a long polymer chain passing through a rectangular cross-section nanopore embedded in a nanochannel, under the influence of a nonuniform electric field. Varying the cross-sectional area of the nanopore was found to allow optimization of the translocation process through modification of the electric field in the flow channel, since a drastic drop in the electric potential at the nanopore was induced by changing the cross-section. Furthermore, the configuration of the polymer chain in the nanopore was observed to determine its translocation velocity. The competition between the strength of the electric field and confinement in the small pore produces various transport mechanisms and the results of this study thus represent a means of optimizing the design of nanofluidic devices for single molecule detection.

  10. Mismatched single stranded antisense oligonucleotides can induce efficient dystrophin splice switching

    Directory of Open Access Journals (Sweden)

    Kole Ryszard

    2011-10-01

    Full Text Available Abstract Background Antisense oligomer induced exon skipping aims to reduce the severity of Duchenne muscular dystrophy by redirecting splicing during pre-RNA processing such that the causative mutation is by-passed and a shorter but partially functional Becker muscular dystrophy-like dystrophin isoform is produced. Normal exons are generally targeted to restore the dystrophin reading frame however, an appreciable subset of dystrophin mutations are intra-exonic and therefore have the potential to compromise oligomer efficiency, necessitating personalised oligomer design for some patients. Although antisense oligomers are easily personalised, it remains unclear whether all patient polymorphisms within antisense oligomer target sequences will require the costly process of producing and validating patient specific compounds. Methods Here we report preclinical testing of a panel of splice switching antisense oligomers, designed to excise exon 25 from the dystrophin transcript, in normal and dystrophic patient cells. These patient cells harbour a single base insertion in exon 25 that lies within the target sequence of an oligomer shown to be effective at removing exon 25. Results It was anticipated that such a mutation would compromise oligomer binding and efficiency. However, we show that, despite the mismatch an oligomer, designed and optimised to excise exon 25 from the normal dystrophin mRNA, removes the mutated exon 25 more efficiently than the mutation-specific oligomer. Conclusion This raises the possibility that mismatched AOs could still be therapeutically applicable in some cases, negating the necessity to produce patient-specific compounds.

  11. Telomerase suppresses formation of ALT-associated single-stranded telomeric C-circles.

    Science.gov (United States)

    Plantinga, Matthew J; Pascarelli, Kara M; Merkel, Anna S; Lazar, Alexander J; von Mehren, Margaret; Lev, Dina; Broccoli, Dominique

    2013-06-01

    Telomere maintenance is an essential characteristic of cancer cells, most commonly achieved by activation of telomerase. Telomeres can also be maintained by a recombination-based mechanism, alternative lengthening of telomeres (ALT). Cells using ALT are characterized by the presence of ALT-associated promyelocytic leukemia (PML) bodies (APB), long, heterogeneously sized telomeres, extrachromosomal telomeric circular DNA, and elevated telomeric recombination. Consistent with other reports, we found that liposarcomas containing APBs, but lacking telomerase expression, always contained C-rich circles (C-circles), and these C-circles were never present in the absence of APBs, indicating a tight link between these features in ALT cells. However, a rare subgroup of tumors showing evidence of telomere maintenance by both telomerase and ALT did not contain C-circles. To test the hypothesis that telomerase expression disrupts the tight link between APBs and C-circles, we used ALT cell lines that were engineered to express telomerase. Introduction of telomerase activity in these ALT cells resulted in, on average, shorter telomeres with retention of APBs. However, at high passage, the level of C-circles was significantly reduced, which was paralleled by a switch from C-strand overhangs to G-strand overhangs. We propose that by extending critically short telomeres in these cells, telomerase is disrupting a key step in the ALT pathway necessary for production and/or maintenance of C-circles. ©2013 AACR.

  12. Electric light scattering from single-stranded DNA in linear polyacrylamide solutions.

    Science.gov (United States)

    Todorov, R; Starchev, K; Stoylov, S P

    2001-01-01

    The electric light scattering (ELS) of ssDNA (calf thymus, 10 kbp, 55 micrograms/mL) in denaturing polyacrylamide (PAA) solutions was studied as a function of applied sinusoidal electric field and polymer concentration. Electric fields of strengths up to 300 V/cm and of frequencies between 100 and 5000 Hz were applied. It was found that the ELS effect increases with the field strength and decreases at high frequencies. The dependence of the ELS effect of ssDNA on polymer concentration passes through a maximum at 1% PAA. The relaxation times of decay of the ELS effect increase with increasing polymer concentrations. It was demonstrated that ELS is a useful method for investigation of ssDNA behavior in the course of pulse-field electrophoresis in polymer solutions.

  13. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin.

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-13

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecule, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G • U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G • U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  14. Therapeutic Effect of Novel Single-Stranded RNAi Agent Targeting Periostin in Eyes with Retinal Neovascularization

    Directory of Open Access Journals (Sweden)

    Takahito Nakama

    2017-03-01

    Full Text Available Retinal neovascularization (NV due to retinal ischemia remains one of the principal causes of vision impairment in patients with ischemic retinal diseases. We recently reported that periostin (POSTN may play a role in the development of preretinal fibrovascular membranes, but its role in retinal NV has not been determined. The purpose of this study was to examine the expression of POSTN in the ischemic retinas of a mouse model of oxygen-induced retinal NV. We also studied the function of POSTN on retinal NV using Postn KO mice and human retinal endothelial cells (HRECs in culture. In addition, we used a novel RNAi agent, NK0144, which targets POSTN to determine its effect on the development of retinal NV. Our results showed that the expression of POSTN was increased in the vascular endothelial cells, pericytes, and M2 macrophages in ischemic retinas. POSTN promoted the ischemia-induced retinal NV by Akt phosphorylation through integrin αvβ3. NK0144 had a greater inhibitory effect than canonical double-stranded siRNA on preretinal pathological NV in vivo and in vitro. These findings suggest a causal relationship between POSTN and retinal NV, and indicate a potential therapeutic role of intravitreal injection of NK0144 for retinal neovascular diseases.

  15. Expansion during PCR of short single-stranded DNA fragments carrying nonselfcomplementary dinucleotide or trinucleotide repeats

    Czech Academy of Sciences Publication Activity Database

    Reichová, Naďa; Kypr, Jaroslav

    2003-01-01

    Roč. 30, č. 3 (2003), s. 155-163 ISSN 0301-4851 R&D Projects: GA ČR GA301/01/0590 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA * PCR * expansion Subject RIV: BO - Biophysics Impact factor: 0.565, year: 2003

  16. Double-stranded DNA dissociates into single strands when dragged into a poor solvent.

    Science.gov (United States)

    Cui, Shuxun; Yu, Jin; Kühner, Ferdinand; Schulten, Klaus; Gaub, Hermann E

    2007-11-28

    DNA displays a richness of biologically relevant supramolecular structures, which depend on both sequence and ambient conditions. The effect of dragging double-stranded DNA (dsDNA) from water into poor solvent on the double-stranded structure is still unclear because of condensation. Here, we employed single molecule techniques based on atomic force microscopy and molecular dynamics (MD) simulations to investigate the change in structure and mechanics of DNA during the ambient change. We found that the two strands are split apart when the dsDNA is pulled at one strand from water into a poor solvent. The findings were corroborated by MD simulations where dsDNA was dragged from water into poor solvent, revealing details of the strand separation at the water/poor solvent interface. Because the structure of DNA is of high polarity, all poor solvents show a relatively low polarity. We speculate that the principle of spontaneous unwinding/splitting of dsDNA by providing a low-polarity (in other word, hydrophobic) micro-environment is exploited as one of the catalysis mechanisms of helicases.

  17. Genomic analysis of Pseudomonas putida phage tf with localized single-strand DNA interruptions.

    Directory of Open Access Journals (Sweden)

    Anatoly S Glukhov

    Full Text Available The complete sequence of the 46,267 bp genome of the lytic bacteriophage tf specific to Pseudomonas putida PpG1 has been determined. The phage genome has two sets of convergently transcribed genes and 186 bp long direct terminal repeats. The overall genomic architecture of the tf phage is similar to that of the previously described Pseudomonas aeruginosa phages PaP3, LUZ24 and phiMR299-2, and 39 out of the 72 products of predicted tf open reading frames have orthologs in these phages. Accordingly, tf was classified as belonging to the LUZ24-like bacteriophage group. However, taking into account very low homology levels between tf DNA and that of the other phages, tf should be considered as an evolutionary divergent member of the group. Two distinguishing features not reported for other members of the group were found in the tf genome. Firstly, a unique end structure--a blunt right end and a 4-nucleotide 3'-protruding left end--was observed. Secondly, 14 single-chain interruptions (nicks were found in the top strand of the tf DNA. All nicks were mapped within a consensus sequence 5'-TACT/RTGMC-3'. Two nicks were analyzed in detail and were shown to be present in more than 90% of the phage population. Although localized nicks were previously found only in the DNA of T5-like and phiKMV-like phages, it seems increasingly likely that this enigmatic structural feature is common to various other bacteriophages.

  18. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-02-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  19. Ion Density Analysis of Single-Stranded DNA in Liquid Crystal

    Science.gov (United States)

    Iwabata, Kazuki; Seki, Yasutaka; Toizumi, Ryota; Shimada, Yuki; Furue, Hirokazu; Sakaguchi, Kengo

    2013-09-01

    With the widespread use of liquid crystals (LCs) in liquid crystal displays, we have looked into the application of liquid crystals in biotechnology. The purpose of the study described here is to investigate the physical properties of DNA using LCs. Synthetic oligonucleotide molecules were dispersed in MLC6884, the sample injected into antiparallel cells, and the amount of mobile ions was measured. The LC cell doped with oligonucleotide molecules showed a sequence-dependent, specific correlation between oligonucleotide concentration and the amount of mobile ions in the LC cells. In the framework of the Stokes model and polyacrylamide gel electrophoresis (PAGE) analysis, we speculate that this result arises from the difference in ion mobility, which is caused by the shape of the oligonucleotide molecule in the LC.

  20. A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B.

    Directory of Open Access Journals (Sweden)

    Jeffrey A DeGrasse

    Full Text Available The bacterium Staphylococcus aureus is a common foodborne pathogen capable of secreting a cocktail of small, stable, and strain-specific, staphylococcal enterotoxins (SEs. Staphylococcal food poisoning (SFP results when improperly handled food contaminated with SEs is consumed. Gastrointestinal symptoms of SFP include emesis, diarrhea and severe abdominal pain, which manifest within hours of ingesting contaminated food. Immuno-affinity based methods directly detect, identify, and quantify several SEs within a food or clinical sample. However, the success of these assays depends upon the availability of a monoclonal antibody, the development of which is non-trivial and costly. The current scope of the available immuno-affinity based methods is limited to the classical SEs and does not encompass all of the known or emergent SEs. In contrast to antibodies, aptamers are short nucleic acids that exhibit high affinity and specificity for their targets without the high-costs and ethical concerns of animal husbandry. Further, researchers may choose to freely distribute aptamers and develop assays without the proprietary issues that increase the per-sample cost of immuno-affinity assays. This study describes a novel aptamer, selected in vitro, with affinity to staphylococcal enterotoxin B (SEB that may be used in lieu of antibodies in SE detection assays. The aptamer, designated APT(SEB1, successfully isolates SEB from a complex mixture of SEs with extremely high discrimination. This work sets the foundation for future aptamer and assay development towards the entire family of SEs. The rapid, robust, and low-cost identification and quantification of all of the SEs in S. aureus contaminated food is essential for food safety and epidemiological efforts. An in vitro generated library of SE aptamers could potentially allow for the comprehensive and cost-effective analysis of food samples that immuno-affinity assays currently cannot provide.

  1. Lactococcus lactis Diversity in Undefined Mixed Dairy Starter Cultures as Revealed by Comparative Genome Analyses and Targeted Amplicon Sequencing of epsD.

    Science.gov (United States)

    Frantzen, Cyril A; Kleppen, Hans Petter; Holo, Helge

    2018-02-01

    Undefined mesophilic mixed (DL) starter cultures are used in the production of continental cheeses and contain unknown strain mixtures of Lactococcus lactis and leuconostocs. The choice of starter culture affects the taste, aroma, and quality of the final product. To gain insight into the diversity of Lactococcus lactis strains in starter cultures, we whole-genome sequenced 95 isolates from three different starter cultures. Pan-genomic analyses, which included 30 publically available complete genomes, grouped the strains into 21 L. lactis subsp . lactis and 28 L. lactis subsp. cremoris lineages. Only one of the 95 isolates grouped with previously sequenced strains, and the three starter cultures showed no overlap in lineage distributions. The culture diversity was assessed by targeted amplicon sequencing using purR , a core gene, and epsD , present in 93 of the 95 starter culture isolates but absent in most of the reference strains. This enabled an unprecedented discrimination of starter culture Lactococcus lactis and revealed substantial differences between the three starter cultures and compositional shifts during the cultivation of cultures in milk. IMPORTANCE In contemporary cheese production, standardized frozen seed stock starter cultures are used to ensure production stability, reproducibility, and quality control of the product. The dairy industry experiences significant disruptions of cheese production due to phage attacks, and one commonly used countermeasure to phage attack is to employ a starter rotation strategy, in which two or more starters with minimal overlap in phage sensitivity are used alternately. A culture-independent analysis of the lactococcal diversity in complex undefined starter cultures revealed large differences between the three starter cultures and temporal shifts in lactococcal composition during the production of bulk starters. A better understanding of the lactococcal diversity in starter cultures will enable the development of

  2. Improving the genotyping resolution of Cryptosporidium hominis subtype IbA10G2 using one step PCR-based amplicon sequencing.

    Science.gov (United States)

    Beser, Jessica; Hallström, Björn M; Advani, Abdolreza; Andersson, Sofia; Östlund, Gabriel; Winiecka-Krusnell, Jadwiga; Lebbad, Marianne; Alm, Erik; Troell, Karin; Arrighi, Romanico B G

    2017-11-01

    Cryptosporidium hominis gp60 subtype IbA10G2 is a common cause of cryptosporidiosis. This subtype is responsible for many waterborne outbreaks as well as sporadic cases and is considered virulent and highly important in the epidemiology of cryptosporidiosis. Due to low heterogeneity within the genome of C. hominis it has been difficult to identify epidemiological markers with higher resolution than gp60. However, new markers are required in order to improve outbreak investigations and studies of the transmission dynamics of this clinically important subtype. Based on the whole genome sequences of 17 C. hominis isolates, we have identified several differential loci and developed a new sequence based typing panel with higher resolution than gp60. An amplicon sequencing method was also developed which is based on a one-step PCR which can be sequenced using a Next Generation Sequencing (NGS) platform. Such a system provides a rapid and high-throughput workflow. A panel of nine loci with 10 single nucleotide variants (SNV) was selected and evaluated using clinical IbA10G2 isolates from sporadic, cluster and outbreak associated cases. The specimens were separated into 10 different genetic profiles named sequence types (STs). All isolates within an outbreak or cluster belonged to the same ST, including several samples from the two large waterborne outbreaks which occurred in Sweden between 2010 and 2011 indicating that these outbreaks might be linked. The results demonstrate the methods suitability for improved genotyping of C. hominis IbA10G2. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. VT Limited Access Highways

    Data.gov (United States)

    Vermont Center for Geographic Information — A limited-access road, known by various terms worldwide, including limited-access highway, dual carriageway, expressway, and partial controlled access highway, is a...

  4. Accessibility and sensory experiences

    DEFF Research Database (Denmark)

    Ryhl, Camilla

    2010-01-01

    and accessibility. Sensory accessibility accommodates aspects of a sensory disability and describes architectural design requirements needed to ensure access to architectural experiences. In the context of architecture accessibility has become a design concept of its own. It is generally described as ensuring...... physical access to the built environment by accommodating physical disabilities. While the existing concept of accessibility ensures the physical access of everyone to a given space, sensory accessibility ensures the choice of everyone to stay and be able to participate and experience....

  5. Fishing Access Areas

    Data.gov (United States)

    Vermont Center for Geographic Information — The Vermont Fish & Wildlife Department maintains developed fishing access areas. These sites provide public access to waters in Vermont for shore fishing...

  6. Fluorescent duplex allele-specific PCR and amplicon melting for rapid homogeneous mtDNA haplogroup H screening and sensitive mixture detection.

    Directory of Open Access Journals (Sweden)

    Harald Niederstätter

    Full Text Available BACKGROUND: For large scale studies aiming at a better understanding of mitochondrial DNA (mtDNA, sequence variation in particular mt haplogroups (hgs and population structure, reliable low-cost high-throughput genotyping assays are needed. Furthermore, methods facilitating sensitive mixture detection and relative quantification of allele proportions are indispensable for the study of heteroplasmy, mitochondrial sequence evolution, and mitochondrial disorders. Here the properties of a homogeneous competitive duplex allele specific PCR (ARMS assay were scrutinized in the light of these requirements. METHODOLOGY/PRINCIPAL FINDINGS: A duplex ARMS assay amplifying either the ancestral mtDNA 2706G allele (non-hg H samples or the derived 7028C allele (hg H samples in the presence of SYBR Green fluorescent reporter dye was developed and characterized. Product detection, allele calling, and hg inference were based on the amplicon-characteristic melting-point temperatures obtained with on-line post-PCR fluorescent dissociation curve analysis (DCA. The analytical window of the assay covered at least 5 orders of magnitude of template DNA input with a detection limit in the low picogram range of genomic DNA. A set of forensically relevant test specimens was analyzed successfully. The presence of mtDNA mixtures was detected over a broad range of input DNA amounts and mixture ratios, and the estimation of allele proportions in samples with known total mtDNA content was feasible with limitations. A qualified DNA analyst successfully analyzed approximately 2,200 DNA extracts within three regular working days, without using robotic lab-equipment. By performing the amplification on-line, the assay also facilitated absolute mtDNA quantification. CONCLUSIONS: Although this assay was developed just for a particular purpose, the approach is general in that it is potentially suitable in a broad variety of assay-layouts for many other applications, including the

  7. Illumina MiSeq Phylogenetic Amplicon Sequencing Shows a Large Reduction of an Uncharacterised Succinivibrionaceae and an Increase of the Methanobrevibacter gottschalkii Clade in Feed Restricted Cattle.

    Directory of Open Access Journals (Sweden)

    Matthew Sean McCabe

    Full Text Available Periodic feed restriction is used in cattle production to reduce feed costs. When normal feed levels are resumed, cattle catch up to a normal weight by an acceleration of normal growth rate, known as compensatory growth, which is not yet fully understood. Illumina Miseq Phylogenetic marker amplicon sequencing of DNA extracted from rumen contents of 55 bulls showed that restriction of feed (70% concentrate, 30% grass silage for 125 days, to levels that caused a 60% reduction of growth rate, resulted in a large increase of relative abundance of Methanobrevibacter gottschalkii clade (designated as OTU-M7, and a large reduction of an uncharacterised Succinivibrionaceae species (designated as OTU-S3004. There was a strong negative Spearman correlation (ρ = -0.72, P = <1x10(-20 between relative abundances of OTU-3004 and OTU-M7 in the liquid rumen fraction. There was also a significant increase in acetate:propionate ratio (A:P in feed restricted animals that showed a negative Spearman correlation (ρ = -0.69, P = <1x10(-20 with the relative abundance of OTU-S3004 in the rumen liquid fraction but not the solid fraction, and a strong positive Spearman correlation with OTU-M7 in the rumen liquid (ρ = 0.74, P = <1x10(-20 and solid (ρ = 0.69, P = <1x10(-20 fractions. Reduced A:P ratios in the rumen are associated with increased feed efficiency and reduced production of methane which has a global warming potential (GWP 100 years of 28. Succinivibrionaceae growth in the rumen was previously suggested to reduce methane emissions as some members of this family utilise hydrogen, which is also utilised by methanogens for methanogenesis, to generate succinate which is converted to propionate. Relative abundance of OTU-S3004 showed a positive Spearman correlation with propionate (ρ = 0.41, P = <0.01 but not acetate in the liquid rumen fraction.

  8. JISC Open Access Briefing Paper

    OpenAIRE

    Swan, Alma

    2005-01-01

    What Open Access is. What Open Access is not. How is Open Access provided? Open Access archives or repositories. Open Access journals. Why should authors provide Open Access to their work? Further information and resources

  9. World Wide Access: Accessible Web Design.

    Science.gov (United States)

    Washington Univ., Seattle.

    This brief paper considers the application of "universal design" principles to Web page design in order to increase accessibility for people with disabilities. Suggestions are based on the World Wide Web Consortium's accessibility initiative, which has proposed guidelines for all Web authors and federal government standards. Seven guidelines for…

  10. Professional Access 2013 programming

    CERN Document Server

    Hennig, Teresa; Hepworth, George; Yudovich, Dagi (Doug)

    2013-01-01

    Authoritative and comprehensive coverage for building Access 2013 Solutions Access, the most popular database system in the world, just opened a new frontier in the Cloud. Access 2013 provides significant new features for building robust line-of-business solutions for web, client and integrated environments.  This book was written by a team of Microsoft Access MVPs, with consulting and editing by Access experts, MVPs and members of the Microsoft Access team. It gives you the information and examples to expand your areas of expertise and immediately start to develop and upgrade projects. Exp

  11. Access 2010 Programmer's Reference

    CERN Document Server

    Hennig, Teresa; Griffith, Geoffrey L

    2010-01-01

    A comprehensive guide to programming for Access 2010 and 2007. Millions of people use the Access database applications, and hundreds of thousands of developers work with Access daily. Access 2010 brings better integration with SQL Server and enhanced XML support; this Wrox guide shows developers how to take advantage of these and other improvements. With in-depth coverage of VBA, macros, and other programming methods for building Access applications, this book also provides real-world code examples to demonstrate each topic.: Access is the leading database that is used worldwide; While VBA rem

  12. Overview: Routes to Open Access

    OpenAIRE

    Tullney, Marco; van Wezenbeek, Wilma

    2017-01-01

    Slides of an overview presentation given at a CESAER workshop on Open Access, February 2nd, 2017, in Brussels Cover major routes to more open access as discussed in the Task Force Open Science of CESAER: (national) open access strategies open access mandates open access incentives open access awareness open access publishing open access infrastructure

  13. SNP diversity within and among Brassica rapa accessions reveals no geographic differentiation.

    Science.gov (United States)

    Tanhuanpää, P; Erkkilä, M; Tenhola-Roininen, T; Tanskanen, J; Manninen, O

    2016-01-01

    Genetic diversity was studied in a collection of 61 accessions of Brassica rapa, which were mostly oil-type turnip rapes but also included two oil-type subsp. dichotoma and five subsp. trilocularis accessions, as well as three leaf-type subspecies (subsp. japonica, pekinensis, and chinensis) and five turnip cultivars (subsp. rapa). Two-hundred and nine SNP markers, which had been discovered by amplicon resequencing, were used to genotype 893 plants from the B. rapa collection using Illumina BeadXpress. There was great variation in the diversity indices between accessions. With STRUCTURE analysis, the plant collection could be divided into three groups that seemed to correspond to morphotype and flowering habit but not to geography. According to AMOVA analysis, 65% of the variation was due to variation within accessions, 25% among accessions, and 10% among groups. A smaller subset of the plant collection, 12 accessions, was also studied with 5727 GBS-SNPs. Diversity indices obtained with GBS-SNPs correlated well with those obtained with Illumina BeadXpress SNPs. The developed SNP markers have already been used and will be used in future plant breeding programs as well as in mapping and diversity studies.

  14. Design for Accessibility

    DEFF Research Database (Denmark)

    Herriott, Richard

    2012-01-01

    A report on how nine rail builder, operators and transport designers deal with design for accessibility......A report on how nine rail builder, operators and transport designers deal with design for accessibility...

  15. Physical Access Control Database -

    Data.gov (United States)

    Department of Transportation — This data set contains the personnel access card data (photo, name, activation/expiration dates, card number, and access level) as well as data about turnstiles and...

  16. Open Access Alternatives

    Science.gov (United States)

    Tenopir, Carol

    2004-01-01

    Open access publishing is a hot topic today. But open access publishing can have many different definitions, and pros and cons vary with the definitions. Open access publishing is especially attractive to companies and small colleges or universities that are likely to have many more readers than authors. A downside is that a membership fee sounds…

  17. Open Access @ DTU

    DEFF Research Database (Denmark)

    Ekstrøm, Jeannette

    Open Access is high on the agenda in Denmark and internationally. Denmark has announced a national strategy for Open Access that aims to achieve Open Access to 80% in 2017 and 100% in 2022 to peer review research articles. All public Danish funders as well as H2020 requires that all peer review a...

  18. Android Access Control Extension

    Directory of Open Access Journals (Sweden)

    Anton Baláž

    2015-12-01

    Full Text Available The main objective of this work is to analyze and extend security model of mobile devices running on Android OS. Provided security extension is a Linux kernel security module that allows the system administrator to restrict program's capabilities with per-program profiles. Profiles can allow capabilities like network access, raw socket access, and the permission to read, write, or execute files on matching paths. Module supplements the traditional Android capability access control model by providing mandatory access control (MAC based on path. This extension increases security of access to system objects in a device and allows creating security sandboxes per application.

  19. Access 2013 for dummies

    CERN Document Server

    Ulrich Fuller, Laurie

    2013-01-01

    The easy guide to Microsoft Access returns with updates on the latest version! Microsoft Access allows you to store, organize, view, analyze, and share data; the new Access 2013 release enables you to build even more powerful, custom database solutions that integrate with the web and enterprise data sources. Access 2013 For Dummies covers all the new features of the latest version of Accessand serves as an ideal reference, combining the latest Access features with the basics of building usable databases. You'll learn how to create an app from the Welcome screen, get support

  20. Pro Access 2010 Development

    CERN Document Server

    Collins, Mark

    2011-01-01

    Pro Access 2010 Development is a fundamental resource for developing business applications that take advantage of the features of Access 2010 and the many sources of data available to your business. In this book, you'll learn how to build database applications, create Web-based databases, develop macros and Visual Basic for Applications (VBA) tools for Access applications, integrate Access with SharePoint and other business systems, and much more. Using a practical, hands-on approach, this book will take you through all the facets of developing Access-based solutions, such as data modeling, co

  1. Access Data Analysis Cookbook

    CERN Document Server

    Bluttman, Ken

    2008-01-01

    This book offers practical recipes to solve a variety of common problems that users have with extracting Access data and performing calculations on it. Whether you use Access 2007 or an earlier version, this book will teach you new methods to query data, different ways to move data in and out of Access, how to calculate answers to financial and investment issues, how to jump beyond SQL by manipulating data with VBA, and more.

  2. Strategic Accessibility Competition

    OpenAIRE

    Bacchiega, Emanuele; Randon, Emanuela; Zirulia, Lorenzo

    2010-01-01

    We analyze the effect of competition in market-accessibility enhancement among quality-differentiated firms. Firms are located in regions with different ex-ante transport costs to reach the final market. We characterize the equilibrium of the two-stage game in which firms first invest to improve market accessibility and then compete in prices. Efforts in accessibility improvement crucially depend on the interplay between the willingness to pay for the quality premium of the median consumer an...

  3. Access control Tutorial 5

    CERN Document Server

    CERN. Geneva; Oberknapp, Bernd

    2007-01-01

    This tutorial will review current access management technologies and invite participants to discuss use cases and requirements for access management, particularly with respect to scholarly archives and their users. The presenters will describe the concepts and architecture of Federated Access Management (FAM) with reference to some large-scale federation implementations, and discuss the challenges faced particularly in Identity Management by academic institutions. The tutorial will include a practical demonstration of how FAM can be applied to an Open Archive repository.

  4. Are PDF Documents Accessible?

    Directory of Open Access Journals (Sweden)

    Mireia Ribera Turró

    2008-09-01

    Full Text Available Adobe PDF is one of the most widely used formats in scientific communications and in administrative documents. In its latest versions it has incorporated structural tags and improvements that increase its level of accessibility. This article reviews the concept of accessibility in the reading of digital documents and evaluates the accessibility of PDF according to the most widely established standards.

  5. Open Access Monitor - DK

    DEFF Research Database (Denmark)

    Svendsen, Michael; Hansen, Lars Asger Juel; Andersen, Dorte

    2017-01-01

    Open Access Monitor - DK (OAM-DK) is a 2-year DEFF funded [DEFF.2016-0018] national project running in 2017-2018 with the aim of collecting, documenting and administrating Open Access publishing costs. OAM-DK is lead by Copenhagen University Library under the Royal Danish Library with participation...... of all Danish University Libraries. This poster presents the first results of Open Access costs related to 2015 publications at the The University of Copenhagen....

  6. Access 2013 bible

    CERN Document Server

    Alexander, Michael

    2013-01-01

    A comprehensive reference to the updated and new features of Access 2013 As the world's most popular database management tool, Access enables you to organize, present, analyze, and share data as well as build powerful database solutions. However, databases can be complex. That's why you need the expert guidance in this comprehensive reference. Access 2013 Bible helps you gain a solid understanding of database purpose, construction, and application so that whether you're new to Access or looking to upgrade to the 2013 version, this well-rounded resource provides you with a th

  7. Demystifying Open Access

    International Nuclear Information System (INIS)

    Mele, Salvatore

    2007-01-01

    The tenets of Open Access are to grant anyone, anywhere and anytime free access to the results of scientific research. HEP spearheaded the Open Access dissemination of scientific results with the mass mailing of preprints in the pre-WWW era and with the launch of the arXiv preprint system at the dawn of the '90s. The HEP community is now ready for a further push to Open Access while retaining all the advantages of the peer-review system and, at the same time, bring the spiralling cost of journal subscriptions under control. I will present a possible plan for the conversion to Open Access of HEP peer-reviewed journals, through a consortium of HEP funding agencies, laboratories and libraries: SCOAP3 (Sponsoring Consortium for Open Access Publishing in Particle Physics). SCOAP3 will engage with scientific publishers towards building a sustainable model for Open Access publishing, which is as transparent as possible for HEP authors. The current system in which journals income comes from subscription fees is replaced with a scheme where SCOAP3 compensates publishers for the costs incurred to organise the peer-review service and give Open Access to the final version of articles. SCOAP3 will be funded by all countries active in HEP under a 'fair share' scenario, according to their production of HEP articles. In this talk I will present a short overview of the history of Open Access in HEP, the details of the SCOAP3 model and the outlook for its implementation.

  8. Market Access and Welfare

    DEFF Research Database (Denmark)

    Raimondos-Møller, Pascalis; Woodland, Alan D.

    According to the literature, well known tariff reform rules that are guaranteed to increase welfare will not necessarily increase market access, while rules that are guaranteed to increase market access will not necessarily increase welfare. Such conflict between welfare and market access...... access and consumer welfare will always be weakly compatible, in the sense that reforms based on each objective have the same signed effect on the other objective. For strong compatibility, whereby both objectives increase as a result of a locally optimal tariff reform, we derive both a necessary...

  9. OGIS Access System

    Data.gov (United States)

    National Archives and Records Administration — The OGIS Access System (OAS) provides case management, stakeholder collaboration, and public communications activities including a web presence via a web portal.

  10. Market Access and Welfare

    DEFF Research Database (Denmark)

    Raimondos-Møller, Pascalis; Woodland, Alan D.

    2015-01-01

    Well known tariff reform rules that are guaranteed to increase welfare will not necessarily increase market access, while rules that are guaranteed to increase market access will not necessarily increase welfare. The present paper proposes a new set of tariff reforms that can achieve both...

  11. Accessibility of public services

    NARCIS (Netherlands)

    Poort, J.P.; Groot, I.; Kok, L.; de Graaf, D.; Hof, B.J.F.

    2005-01-01

    The accessibility of certain products and services to all people, irrespective of their income, age, health and geographical location is considered to be of great social importance. Think for instance of health care, education, electricity, and sanitation. Accessibility can be secured in a variety

  12. (Cicer sp.) accessions

    Indian Academy of Sciences (India)

    nent and that of Western Asian Mediterranean. Asian region and wild chickpea accessions, molecular diversity study was undertaken with 50 accessions of chickpea obtained from ICARDA, Aleppo, Syria, ICRISAT, Hyderabad, India,. NBPGR, New Delhi ... cultural Research in the Dry Areas (ICARDA), 12 from. International ...

  13. Self-Access Systems.

    Science.gov (United States)

    Miller, Lindsay; Rogerson-Revell, Pamela

    1993-01-01

    Four self-access centers (SAC) are described, as well as their rationale, human resources, and end users. A framework for establishing a SAC is proposed; an informed decision about the type of self-access system, based on the rationale of the institution and the human resources available, will ensure a system suited to end users. (Contains 13…

  14. Comparing Information Access Approaches.

    Science.gov (United States)

    Chalmers, Matthew

    1999-01-01

    Presents a broad view of information access, drawing from philosophy and semiology in constructing a framework for comparative discussion that is used to examine the information representations that underlie four approaches to information access--information retrieval, workflow, collaborative filtering, and the path model. Contains 32 references.…

  15. Standards and Access.

    Science.gov (United States)

    Fox, Tom

    1993-01-01

    Argues that easy claims about the relationship between language mastery and academic or economic access (made by both conservative commentators on education and mainstream writing teachers) are false and obscure real social and political boundaries, such as racism, sexism, elitism, and homophobia, that really do prevent access. (SR)

  16. Targeted Amplicon Sequencing for Single-Nucleotide-Polymorphism Genotyping of Attaching and Effacing Escherichia coli O26:H11 Cattle Strains via a High-Throughput Library Preparation Technique.

    Science.gov (United States)

    Ison, Sarah A; Delannoy, Sabine; Bugarel, Marie; Nagaraja, Tiruvoor G; Renter, David G; den Bakker, Henk C; Nightingale, Kendra K; Fach, Patrick; Loneragan, Guy H

    2016-01-15

    Enterohemorrhagic Escherichia coli (EHEC) O26:H11, a serotype within Shiga toxin-producing E. coli (STEC) that causes severe human disease, has been considered to have evolved from attaching and effacing E. coli (AEEC) O26:H11 through the acquisition of a Shiga toxin-encoding gene. Targeted amplicon sequencing using next-generation sequencing technology of 48 phylogenetically informative single-nucleotide polymorphisms (SNPs) and three SNPs differentiating Shiga toxin-positive (stx-positive) strains from Shiga toxin-negative (stx-negative) strains were used to infer the phylogenetic relationships of 178 E. coli O26:H11 strains (6 stx-positive strains and 172 stx-negative AEEC strains) from cattle feces to 7 publically available genomes of human clinical strains. The AEEC cattle strains displayed synonymous SNP genotypes with stx2-positive sequence type 29 (ST29) human O26:H11 strains, while stx1 ST21 human and cattle strains clustered separately, demonstrating the close phylogenetic relatedness of these Shiga toxin-negative AEEC cattle strains and human clinical strains. With the exception of seven stx-negative strains, five of which contained espK, three stx-related SNPs differentiated the STEC strains from non-STEC strains, supporting the hypothesis that these AEEC cattle strains could serve as a potential reservoir for new or existing pathogenic human strains. Our results support the idea that targeted amplicon sequencing for SNP genotyping expedites strain identification and genetic characterization of E. coli O26:H11, which is important for food safety and public health. Copyright © 2016 Ison et al.

  17. A remark on accessibility

    International Nuclear Information System (INIS)

    Wu, Xinxing; Wang, Jianjun

    2016-01-01

    Highlights: • Obtain some characteristics of accessibility and Kato’s chaos. • Answer negatively a question in [Li R, Wang H, Zhao Y. Kato’s chaos in duopoly games. Chaos Solit Fract 2016;84:69–72]. • A dynamical system is indecomposable if and only if it is weakly transitive. - Abstract: This note obtains some characteristics of accessibility and Kato’s chaos. Applying these results, an accessible dynamical system whose product system is not accessible is constructed, giving a negative answer to a question in [Li R, Wang H, Zhao Y. Kato’s chaos in duopoly games. Chaos Solit Fract 2016;84:69–72]. Besides, it is proved that every transitive interval self-map is accessible.

  18. The Open Access Divide

    Directory of Open Access Journals (Sweden)

    Jingfeng Xia

    2013-10-01

    Full Text Available This paper is an attempt to review various aspects of the open access divide regarding the difference between those academics who support free sharing of data and scholarly output and those academics who do not. It provides a structured description by adopting the Ws doctrines emphasizing such questions as who, what, when, where and why for information-gathering. Using measurable variables to define a common expression of the open access divide, this study collects aggregated data from existing open access as well as non-open access publications including journal articles and extensive reports. The definition of the open access divide is integrated into the discussion of scholarship on a larger scale.

  19. Coded Random Access

    DEFF Research Database (Denmark)

    Paolini, Enrico; Stefanovic, Cedomir; Liva, Gianluigi

    2015-01-01

    The rise of machine-to-machine communications has rekindled the interest in random access protocols as a support for a massive number of uncoordinatedly transmitting devices. The legacy ALOHA approach is developed under a collision model, where slots containing collided packets are considered...... as waste. However, if the common receiver (e.g., base station) is capable to store the collision slots and use them in a transmission recovery process based on successive interference cancellation, the design space for access protocols is radically expanded. We present the paradigm of coded random access......, in which the structure of the access protocol can be mapped to a structure of an erasure-correcting code defined on graph. This opens the possibility to use coding theory and tools for designing efficient random access protocols, offering markedly better performance than ALOHA. Several instances of coded...

  20. Pediatric vascular access

    International Nuclear Information System (INIS)

    Donaldson, James S.

    2006-01-01

    Pediatric interventional radiologists are ideally suited to provide vascular access services to children because of inherent safety advantages and higher success from using image-guided techniques. The performance of vascular access procedures has become routine at many adult interventional radiology practices, but this service is not as widely developed at pediatric institutions. Although interventional radiologists at some children's hospitals offer full-service vascular access, there is little or none at others. Developing and maintaining a pediatric vascular access service is a challenge. Interventionalists skilled in performing such procedures are limited at pediatric institutions, and institutional support from clerical staff, nursing staff, and technologists might not be sufficiently available to fulfill the needs of such a service. There must also be a strong commitment by all members of the team to support such a demanding service. There is a slippery slope of expected services that becomes steeper and steeper as the vascular access service grows. This review is intended primarily as general education for pediatric radiologists learning vascular access techniques. Additionally, the pediatric or adult interventional radiologist seeking to expand services might find helpful tips. The article also provides education for the diagnostic radiologist who routinely interprets radiographs containing vascular access devices. (orig.)

  1. Access 2010 for dummies

    CERN Document Server

    Ulrich Fuller, Laurie

    2010-01-01

    A friendly, step-by-step guide to the Microsoft Office database application Access may be the least understood and most challenging application in the Microsoft Office suite. This guide is designed to help anyone who lacks experience in creating and managing a database learn to use Access 2010 quickly and easily. In the classic For Dummies tradition, the book provides an education in Access, the interface, and the architecture of a database. It explains the process of building a database, linking information, sharing data, generating reports, and much more.As the Micr

  2. Market Access and Welfare

    DEFF Research Database (Denmark)

    Raimondos-Møller, Pascalis; Woodland, Alan D.

    According to the literature, well known tariff reform rules that are guaranteed to increase welfare will not necessarily increase market access, while rules that are guaranteed to increase market access will not necessarily increase welfare. Such conflict between welfare and market access...... objectives of trade policy is problematic and calls for finding alternative tariff reform rules that can achieve both objectives at the same time. The present paper contributes to this aim by using a new set of tariff reforms that are based on local optimality. Using such reforms it is shown that market...

  3. Access road reclamation

    International Nuclear Information System (INIS)

    Manson, T.; Blok, M.

    1997-01-01

    A general review of the measures involved in restoring abandoned access road sites in British Columbia was presented. Permits and licences are needed for the use of crown land for roads used by the petroleum and natural gas industry for exploration activities. However, the regulatory framework for road site reclamation is not well developed. The nature of access road reclamation is very site-specific. Some of the issues that are considered for all reclamation projects include slope stability, water control, revegetation, soil rehabilitation, access management and monitoring. The primary objective of reclaiming access road sites is to return the site to conditions that are equal or better than pre-disturbance conditions. Restoration measures must be approved by BC Environment and by the Department of Fisheries and Oceans where federal fisheries responsibilities are involved. 54 refs., 5 tabs., 3 figs

  4. Access/AML -

    Data.gov (United States)

    Department of Transportation — The AccessAML is a web-based internet single application designed to reduce the vulnerability associated with several accounts assinged to a single users. This is a...

  5. Open access discount information

    International Development Research Centre (IDRC) Digital Library (Canada)

    Lauren Doyle

    African Development Review. Agricultural Economics. Development & Change. Development Policy Review. Economic Journal. Information Technology for Development. Journal of International Development. Wiley Interdisciplinary Reviews: Climate Change. Wiley offers OA in: Gold: Wiley Open Access. Online Open.

  6. Roundabouts and access management.

    Science.gov (United States)

    2014-03-01

    Transportation engineers and planners are becoming more interested in using roundabouts to address access : management and safety concerns in the transportation system. While roundabouts are being used increasingly in a : variety of contexts, existin...

  7. Vascular Access Procedures

    Science.gov (United States)

    ... vascular access catheters: A peripherally inserted central catheter (PICC) is a long catheter that extends from an ... central catheter may be larger caliber than a PICC, and is designed to be placed via a ...

  8. The universal access handbook

    CERN Document Server

    Stephanidis, Constantine

    2009-01-01

    In recent years, the field of Universal Access has made significant progress in consolidating theoretical approaches, scientific methods and technologies, as well as in exploring new application domains. Increasingly, professionals in this rapidly maturing area require a comprehensive and multidisciplinary resource that addresses current principles, methods, and tools. Written by leading international authorities from academic, research, and industrial organizations and nonmarket institutions, The Universal Access Handbook covers the unfolding scientific, methodological, technological, and pol

  9. CERN access cards

    CERN Multimedia

    HR Department

    2007-01-01

    Holders of CERN access cards are reminded that the card is an official document. It is important to carry it with you at all times when you are on the site. This applies also to those on standby duty who are called out for emergency interventions. As announced in Weekly Bulletin 13/2006, any loss or theft of access cards must be declared to the competent external authorities.

  10. Accessible Geoscience - Digital Fieldwork

    Science.gov (United States)

    Meara, Rhian

    2017-04-01

    Accessible Geoscience is a developing field of pedagogic research aimed at widening participation in Geography, Earth and Environmental Science (GEES) subjects. These subjects are often less commonly associated with disabilities, ethnic minorities, low income socio-economic groups and females. While advancements and improvements have been made in the inclusivity of these subject areas in recent years, access and participation of disabled students remains low. While universities are legally obligated to provide reasonable adjustments to ensure accessibility, the assumed incompatibility of GEES subjects and disability often deters students from applying to study these courses at a university level. Instead of making reasonable adjustments if and when they are needed, universities should be aiming to develop teaching materials, spaces and opportunities which are accessible to all, which in turn will allow all groups to participate in the GEES subjects. With this in mind, the Swansea Geography Department wish to enhance the accessibility of our undergraduate degree by developing digital field work opportunities. In the first instance, we intend to digitise three afternoon excursions which are run as part of a 1st year undergraduate module. Each of the field trips will be digitized into English- and Welsh-medium formats. In addition, each field trip will be digitized into British Sign Language (BSL) to allow for accessibility for D/deaf and hard of hearing students. Subtitles will also be made available in each version. While the main focus of this work is to provide accessible fieldwork opportunities for students with disabilities, this work also has additional benefits. Students within the Geography Department will be able to revisit the field trips, to revise and complete associated coursework. The use of digitized field work should not replace opportunities for real field work, but its use by the full cohort of students will begin to "normalize" accessible field

  11. Time dependent accessibility

    Directory of Open Access Journals (Sweden)

    Nikhil Kaza

    2015-06-01

    Full Text Available Many place based accessibility studies ignore the time component. Relying on theoretical frameworks that treat distance between two fixed points as constant, these methods ignore the diurnal and seasonal changes in accessibility. Network distances between two nodes are dependent on the network structure and weight distribution on the edges. These weights can change quite frequently and the network structure itself is subject to modification because of availability and unavailability of links and nodes. All these reasons point to considering the implications of volatility of accessibility of a place. Furthermore, opportunities have their own diurnal rhythms that may or may not coincide with the rhythms of the transportation networks, impacting accessibility. Using the case of transit, where all these features are readily apparent simultaneously, I demonstrate the volatility in accessibility for two counties in North Carolina. Significant diurnal changes are observed in quarter of the locations and in the rest the changes are minimal mostly because of low levels of transit accessibility. I argue not for minimizing the volatility, but for acknowledging its impacts on mode choices, location choices and therefore on spatial structure of cities.

  12. Vascular Access in Children

    International Nuclear Information System (INIS)

    Krishnamurthy, Ganesh; Keller, Marc S.

    2011-01-01

    Establishment of stable vascular access is one of the essential and most challenging procedures in a pediatric hospital. Many clinical specialties provide vascular service in a pediatric hospital. At the top of the “expert procedural pyramid” is the pediatric interventional radiologist, who is best suited and trained to deliver this service. Growing awareness regarding the safety and high success rate of vascular access using image guidance has led to increased demand from clinicians to provide around-the-clock vascular access service by pediatric interventional radiologists. Hence, the success of a vascular access program, with the pediatric interventional radiologist as the key provider, is challenging, and a coordinated multidisciplinary team effort is essential for success. However, there are few dedicated pediatric interventional radiologists across the globe, and also only a couple of training programs exist for pediatric interventions. This article gives an overview of the technical aspects of pediatric vascular access and provides useful tips for obtaining vascular access in children safely and successfully using image guidance.

  13. Enterprise Dynamic Access Control (EDAC)

    National Research Council Canada - National Science Library

    Fernandez, Richard

    2005-01-01

    .... Resources can represent software applications, web services and even facility access. An effective access control model should be capable of evaluating resource access based on user characteristics and environmentals...

  14. Access control system operation

    International Nuclear Information System (INIS)

    Barnes, L.D.

    1981-06-01

    An automated method for the control and monitoring of personnel movement throughout the site was developed under contract to the Department of Energy by Allied-General Nuclear Services (AGNS) at the Barnwell Nuclear Fuel Plant (BNFP). These automated features provide strict enforcement of personnel access policy without routine patrol officer involvement. Identification methods include identification by employee ID number, identification by voice verification and identification by physical security officer verification. The ability to grant each level of access authority is distributed over the organization to prevent any single individual at any level in the organization from being capable of issuing an authorization for entry into sensitive areas. Each access event is recorded. As access events occur, the inventory of both the entered and the exited control area is updated so that a current inventory is always available for display. The system has been operated since 1979 in a development mode and many revisions have been implemented in hardware and software as areas were added to the system. Recent changes have involved the installation of backup systems and other features required to achieve a high reliability. The access control system and recent operating experience are described

  15. Definitive differentiation between single and mixed mycobacterial infections in red deer (Cervus elaphus) by a combination of duplex amplification of p34 and f57 sequences and Hpy188I enzymatic restriction of duplex amplicons.

    Science.gov (United States)

    Godfroid, Jacques; Delcorps, Cathy; Irenge, Leonid M; Walravens, Karl; Marché, Sylvie; Gala, Jean-Luc

    2005-09-01

    Severe emaciation and mortalities suggestive of mycobacterial infections were recently reported for both adult and young wild red deer (Cervus elaphus) in the southeastern part of Belgium. In deer, tuberculous lesions are not pathognomonic of Mycobacterium bovis infection due to gross and microscopic similarities with lesions caused by Mycobacterium avium subsp. paratuberculosis or M. avium subsp. avium. The aim of this study was to improve molecular methods for the species-specific identification of M. bovis, M. avium subsp. avium, and M. avium subsp. paratuberculosis in mycobacterial infections of deer. DNA banding patterns were assessed prior to and after Hpy188I restriction of f57-upstream (us)-p34 duplex amplicons. The duplex f57-us-p34 PCR differentiated M. bovis from M. avium subsp. paratuberculosis and M. avium subsp. avium infections, whereas the restriction step differentiated single M. avium subsp. paratuberculosis or M. avium subsp. avium infections from mixed M. avium subsp. paratuberculosis/M. avium subsp. avium infections. The endonuclease Hpy188I cleaves DNA between nucleotides N and G in the unique TCNGA sequence. This restriction site was found at position 168 upstream of the us-p34 initiation codon in all M. avium subsp. avium strains tested, regardless of their origin and the results of IS901 PCR. In contrast, the restriction site was abrogated in all M. avium subsp. paratuberculosis strains tested, independent of their origin, Mycobactin J dependency, and IS900 PCR results. Consequently, a two-step strategy, i.e., duplex us-p34-f57 PCR and Hpy188I restriction, allowed us to exclude M. bovis infection and to identify single (M. avium subsp. paratuberculosis or M. avium subsp. avium) or mixed (M. avium subsp. paratuberculosis/M. avium subsp. avium) infections in wild red deer in Belgium. Accordingly, we propose to integrate, in a functional molecular definition of M. avium subsp. paratuberculosis, the absence of the Hpy188I restriction site from

  16. Nuclear information access system

    International Nuclear Information System (INIS)

    Ham, C. H.; Yang, M. H.; Yoon, S. W.

    1998-01-01

    The energy supply in the countries, which have abundant energy resources, may not be affected by accepting the assertion of anti-nuclear and environment groups. Anti-nuclear movements in the countries which have little energy resources may cause serious problem in securing energy supply. Especially, it is distinct in Korea because she heavily depends on nuclear energy in electricity supply(nuclear share in total electricity supply is about 40%).The cause of social trouble surrounding nuclear energy is being involved with various circumstances. However, it is very important that we are not aware of the importance of information access and prepared for such a situation from the early stage of nuclear energy's development. In those matter, this paper analyzes the contents of nuclear information access system in France and Japan which have dynamic nuclear development program and presents the direction of the nuclear access regime through comparing Korean status and referring to progresses of the regime

  17. Accessing offshoring advantages

    DEFF Research Database (Denmark)

    Mykhaylenko, Alona; Motika, Agnes; Wæhrens, Brian Vejrum

    2015-01-01

    of the work include using only the offshoring strategy elements and only their limited variety as factors potentially influencing access to offshoring advantages. Also, the findings are limited to Scandinavian companies. Originality/value – The paper introduces a new concept of access, which can help to more......Purpose – The purpose of this paper is to advance the understanding of factors that affect offshoring performance results. To do so, this paper focuses on the access to location-specific advantages, rather than solely on the properties of the offshoring company, its strategy or environment....... Assuming that different levels of synergy may exist between particular offshoring strategic decisions (choosing offshore outsourcing or captive offshoring and the type of function) and different offshoring advantages, this work advocates that the actual fact of realization of certain offshoring advantages...

  18. Access, ethics and piracy

    Directory of Open Access Journals (Sweden)

    Stuart Lawson

    2017-03-01

    Full Text Available Ownership of intellectual property rights for a large proportion of the scholarly record is held by publishers, so a majority of journal articles are behind paywalls and unavailable to most people. As a result some readers are encouraged to use pirate websites such as Sci-Hub to access them, a practice that is alternately regarded as criminal and unethical or as a justified act of civil disobedience. This article considers both the efficacy and ethics of piracy, placing ‘guerrilla open access’ within a longer history of piracy and access to knowledge. By doing so, it is shown that piracy is an inevitable part of the intellectual landscape that can render the current intellectual property regime irrelevant. If we wish to actively construct a true scholarly commons, open access emerges as a contender for moving beyond proprietary forms of commodifying scholarly knowledge towards the creation of an open scholarly communication system that is fit for purpose.

  19. Support open access publishing

    DEFF Research Database (Denmark)

    Ekstrøm, Jeannette

    2013-01-01

    Projektet Support Open Access Publishing har til mål at få opdateret Sherpa/Romeo databasen (www.sherpa.ac.uk/romeo) med fagligt relevante, danske tidsskrifter. Projektet skal endvidere undersøge mulighederne for at få udviklet en database, hvor forskere på tværs af relevante tidsskriftsinformati......Projektet Support Open Access Publishing har til mål at få opdateret Sherpa/Romeo databasen (www.sherpa.ac.uk/romeo) med fagligt relevante, danske tidsskrifter. Projektet skal endvidere undersøge mulighederne for at få udviklet en database, hvor forskere på tværs af relevante...... tidsskriftsinformationer (faglig disciplin, BFI niveau, Impact Factor, Open Access) vil kunne danne sig et hurtigt overblik, for derved at kunne træffe et kvalificeret valg om, hvor og hvordan man skal publicere sine forskningsresultater....

  20. Kinds of access

    DEFF Research Database (Denmark)

    Overgaard, Morten; Sandberg, Kristian

    2012-01-01

    In experimental investigations of consciousness, participants are asked to reflect upon their own experiences by issuing reports about them in different ways. For this reason, a participant needs some access to the content of her own conscious experience in order to report. In such experiments...... that there is not only a theoretical, but also an empirical difference between different methods of reporting. We hypothesize that differences in the sensitivity of different scales may reveal that different types of access are used to issue direct reports about experiences and metacognitive reports about...

  1. Kinds of Access

    DEFF Research Database (Denmark)

    Overgaard, Morten; Sandberg, Kristian

    2014-01-01

    In experimental investigations of consciousness, participants are asked to reflect upon their own experiences by issuing reports about them in different ways. For this reason, a participant needs some access to the content of her own conscious experience in order to report. In such experiments...... that there is not only a theoretical, but also an empirical difference between different methods of reporting. We hypothesise that differences in the sensitivity of different scales may reveal that different types of access are used to issue direct reports about experiences and metacognitive reports about...

  2. Quantum random access memory

    OpenAIRE

    Giovannetti, Vittorio; Lloyd, Seth; Maccone, Lorenzo

    2007-01-01

    A random access memory (RAM) uses n bits to randomly address N=2^n distinct memory cells. A quantum random access memory (qRAM) uses n qubits to address any quantum superposition of N memory cells. We present an architecture that exponentially reduces the requirements for a memory call: O(log N) switches need be thrown instead of the N used in conventional (classical or quantum) RAM designs. This yields a more robust qRAM algorithm, as it in general requires entanglement among exponentially l...

  3. Disruption - Access cards service

    CERN Multimedia

    2014-01-01

    We would like to inform you that between 10 November and 15 December 2014, the access cards service in Building 55 will be disrupted, as the GS Department has decided to improve the facilities for users of this building. During the work, you will find the registration, biometric registration and dosimeter exchange services on the second floor of Building 55 and the vehicle sticker service on the ground floor along with the access cards service. We thank you for your understanding and apologise for any inconvenience caused.

  4. Sprawl and Accessibility

    Directory of Open Access Journals (Sweden)

    Robert Bruegmann

    2008-07-01

    Full Text Available This essay argues that many of the assumptions that have been made about sprawl are misleading or just wrong. Nowhere has this been more the case than in debates about transportation and access. Because of this, it is not surprising that a good many of the policies advocated by proponents of Smart Growth would almost certainly lead to reduced mobility and impaired accessibility for a large part of the population. At very least, the debates over sprawl have pitted private vs. public transportation in a way that has contributed to serious underfunding of transportation infrastructure of all kinds.

  5. Migrants' access to healthcare

    DEFF Research Database (Denmark)

    Norredam, Marie

    2011-01-01

    according to international human rights principles. The intention of this thesis is to increase the understanding of migrants' access to healthcare by exploring two study aims: 1) Are there differences in migrants' access to healthcare compared to that of non-migrants? (substudy I and II); and 2) Why......' healthcare entitlements. Different definitions of migration and ethnicity were investigated including: country of birth and residence status. Substudy I showed a tendency towards more advanced stage at diagnosis or unknown stage among most subgroups of migrant women with a history of cancer compared to non...

  6. Access envelopes: A new accessibility mapping technique for ...

    African Journals Online (AJOL)

    The article describes the application of a GIS-based accessibility measurement technique suited to assessing the impact of both transport and spatial development strategies on the location-specific affordability of job access for poor households. The access envelope methodology extends existing accessibility measures by: ...

  7. Cyclic voltammetry of echinomycin and its interaction with double-stranded and single-stranded DNA adsorbed at the electrode

    Czech Academy of Sciences Publication Activity Database

    Jelen, František; Erdem, A.; Paleček, Emil

    2002-01-01

    Roč. 55, 1/2 (2002), s. 165-167 ISSN 1567-5394 R&D Projects: GA AV ČR IAA4004901; GA ČR GV204/97/K084 Institutional research plan: CEZ:AV0Z5004920 Keywords : electrochemistry of DNA * interaction of DNA with echinomycin * hanging mercury drop electrode Subject RIV: BO - Biophysics Impact factor: 1.463, year: 2002

  8. Characterization of the Single Stranded DNA Binding Protein SsbB Encoded in the Gonoccocal Genetic Island

    NARCIS (Netherlands)

    Jain, Samta; Zweig, Maria; Peeters, Eveline; Siewering, Katja; Hackett, Kathleen T.; Dillard, Joseph P.; van der Does, Chris

    2012-01-01

    Background: Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in

  9. Guanine quadruplex monoclonal antibody 1H6 cross-reacts with restrained thymidine-rich single stranded DNA

    NARCIS (Netherlands)

    Kazemier, Hinke G.; Paeschke, Katrin; Lansdorp, Peter M.

    2017-01-01

    Previously we reported the production and characterization of monoclonal antibody 1H6 raised against (T(4)G(4))(2) intermolecular guanine quadruplex (G4) DNA structures (Henderson A. et al. (2014) Nucleic Acids Res., 42, 860-869; Hoffmann R. F. et al. (2016) Nucleic Acids Res., 44, 152-163). It was

  10. Human Rad51 filaments on double- and single-stranded DNA: correlating regular and irregular forms with recombination function.

    NARCIS (Netherlands)

    D. Ristic (Dejan); M. Modesti (Mauro); T. van der Heijden (Thijn); J. Noort (John); C. Dekker (Cees); R. Kanaar (Roland); C. Wyman (Claire)

    2005-01-01

    textabstractRecombinase proteins assembled into helical filaments on DNA are believed to be the catalytic core of homologous recombination. The assembly, disassembly and dynamic rearrangements of this structure must drive the DNA strand exchange reactions of homologous recombination. The sensitivity

  11. Genomic sequences of two novel Levivirus single-stranded RNA coliphages (family Leviviridae): Evidence for recombination in environmental strains

    Science.gov (United States)

    Bacteriophages are likely the most abundant entities in the aquatic environment, yet knowledge of their ecology is limited. During a fecal source-tracking study, two genetically novel Leviviridae strains were discovered. Although the novel strains were isolated from coastal wat...

  12. The Effectiveness of a Weight Maintenance Intervention for Adults with Intellectual Disabilities and Obesity: A Single Stranded Study

    Science.gov (United States)

    Spanos, Dimitrios; Hankey, Catherine R.; Melville, Craig A.

    2016-01-01

    Background: The evidence base for weight management programmes incorporating a weight loss and a weight maintenance phase for adults with intellectual disabilities (ID) is limited. This study describes the weight maintenance phase of a multicomponent weight management programme for adults with intellectual disability and obesity (TAKE 5).…

  13. Detection of benzo[a]pyrene-guanine adducts in single-stranded DNA using the α-hemolysin nanopore

    Science.gov (United States)

    Perera, Rukshan T.; Fleming, Aaron M.; Johnson, Robert P.; Burrows, Cynthia J.; White, Henry S.

    2015-02-01

    The carcinogenic precursor benzo[a]pyrene (BP), a polycyclic aromatic hydrocarbon, is released into the environment through the incomplete combustion of hydrocarbons. Metabolism of BP in the human body yields a potent alkylating agent (benzo[a]pyrene diol epoxide, BPDE) that reacts with guanine (G) in DNA to form an adduct implicated in cancer initiation. We report that the α-hemolysin (αHL) nanopore platform can be used to detect a BPDE adduct to G in synthetic oligodeoxynucleotides. Translocation of a 41-mer poly-2‧-deoxycytidine strand with a centrally located BPDE adduct to G through αHL in 1 M KCl produces a unique multi-level current signature allowing the adduct to be detected. This readily distinguishable current modulation was observed when the BPDE-adducted DNA strand translocated from either the 5‧ or 3‧ directions. This study suggests that BPDE adducts and other large aromatic biomarkers can be detected with αHL, presenting opportunities for the monitoring, quantification, and sequencing of mutagenic compounds from cellular DNA samples.

  14. Data mining cDNAs reveals three new single stranded RNA viruses in Nasonia (Hymenopetera:Pteromalidae)

    Science.gov (United States)

    Hymenopteran viruses may provide insights into colony collapse disorder in honey bees and other insect species. Three novel small RNA viruses were discovered during the genomics effort for the beneficial parasitoid of flies in the genus Nasonia (Hymenoptera). Genomics provides a great deal of inform...

  15. Cytogenetic Markers, DNA Single-Strand Breaks, Urinary Metabolites, and DNA Repair Rates in Styrene-Exposed Lamination Workers

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Tuimala, J.; Štětina, R.; Kumar, R.; Manini, P.; Naccarati, Alessio; Maestri, L.; Vodičková, L.; Kuricová, Miroslava; Jarventaus, H.; Majvalková, Z.; Hirvonen, A.; Imbriani, M.; Mutti, A.; Norppa, H.; Hemminki, K.

    2004-01-01

    Roč. 112, č. 8 (2004), s. 867-871 ISSN 0091-6765 R&D Projects: GA ČR GA310/03/0437; GA ČR GA310/01/0802 Institutional research plan: CEZ:AV0Z5039906 Keywords : DNA repair rates * genotoxicity Subject RIV: FM - Hygiene Impact factor: 3.929, year: 2004

  16. The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange.

    Science.gov (United States)

    Qian, Yufeng; Johnson, Kenneth A

    2017-08-04

    The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB-ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB) 30 and (SSB) 60 , defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB) 60 and (SSB) 30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 10 9 m -1 s -1 ) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Activation of 2'-5' oligoadenylate synthetase by single-stranded and double-stranded RNA aptamers

    DEFF Research Database (Denmark)

    Hartmann, R; Norby, P L; Martensen, P M

    1998-01-01

    A number of small RNA molecules that are high affinity ligands for the 46-kDa form of human 2'-5' oligoadenylate synthetase have been identified by the SELEX method. Surface plasmon resonance analysis indicates that these RNAs bind to the enzyme with dissociation constants in the nanomolar range....... Competition experiments indicate that the binding site for the small RNAs on the 2'-5' oligoadenylate synthetase molecule at least partially overlaps that for the synthetic double-stranded RNA, poly(I).poly(C). Several of the RNAs function as potent activators of 2'-5' oligoadenylate synthetase in vitro......-stranded RNA, can also be activated by RNA ligands with little secondary structure. Since 2'-5' oligoadenylate synthetase possesses no homology to other known RNA-binding proteins, the development of small specific ligands by SELEX should facilitate studies of RNA-protein interactions and may reveal novel...

  18. Analysis of major histocompatibility complex class II gene in water voles using capillary electrophoresis-single stranded conformation polymorphism

    Czech Academy of Sciences Publication Activity Database

    Bryja, Josef; Galan, M.; Charbonnel, N.; Cosson, J.-F.

    2005-01-01

    Roč. 5, č. 1 (2005), s. 173-176 ISSN 1471-8278 Institutional research plan: CEZ:AV0Z6093917 Keywords : water vole * population genetics Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.219, year: 2005

  19. Effect of Zn2+ and temperature on the conformational equilibrium of single-stranded polyA in neutral solutions

    Czech Academy of Sciences Publication Activity Database

    Sorokin, V. A.; Valeev, V. A.; Usenko, E. L.; Andrushchenko, Valery

    2013-01-01

    Roč. 61, Oct (2013), s. 448-452 ISSN 0141-8130 R&D Projects: GA ČR GAP208/10/0559 Institutional support: RVO:61388963 Keywords : metal ions * polyA * metal lized form * differential UV spectroscopy * thermal denaturation * phase diagram Subject RIV: CE - Biochemistry Impact factor: 3.096, year: 2013

  20. Cuprolinic Blue: a specific dye for single-stranded RNA in the presence of magnesium chloride. I. Fundamental aspects

    NARCIS (Netherlands)

    Tas, J.; MENDELSON, D.; NOORDEN, C. J. F.

    1983-01-01

    Qualitative and quantitative aspects of the cationic dye Cuprolinic Blue were investigated with model films of polyacrylamide gel in which RNA, DNA and other biological polyanionic compounds had been incorporated. In the presence of 1 M MgCl2, Curpolinic Blue was found to bind specifically to