WorldWideScience

Sample records for single-strand orthodontic wires

  1. Elastic properties of alternative versus single-stranded leveling archwires.

    Science.gov (United States)

    Rucker, Brian K; Kusy, Robert P

    2002-11-01

    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  2. Initial arch wires for tooth alignment during orthodontic treatment with fixed appliances.

    Science.gov (United States)

    Jian, Fan; Lai, Wenli; Furness, Susan; McIntyre, Grant T; Millett, Declan T; Hickman, Joy; Wang, Yan

    2013-04-30

    potentially confounding factor (such as bracket type, slot size, ligation method, extraction of teeth) which is likely to have influenced the outcome and was not controlled in the trial. None of the trials reported the important adverse outcome of root resorption.Three groups of comparisons were made.(1) Multistrand stainless steel initial arch wires compared to superelastic nickel titanium (NiTi) initial arch wires. There were four trials in this group, with different comparisons and outcomes reported at different times. No meta-analysis was possible. There is insufficient evidence from these trials to determine whether or not there is a difference in either rate of alignment or pain between stainless steel and NiTi initial arch wires.(2) Conventional (stabilised) NiTi initial arch wires compared to superelastic NiTi initial arch wires. There were two trials in this group, one reporting the outcome of alignment over 6 months and the other reporting pain over 1 week. There is insufficient evidence from these trials to determine whether or not there is any difference between conventional (stabilised) and superelastic NiTi initial arch wires with regard to either alignment or pain.(3) Single-strand superelastic NiTi initial arch wires compared to other NiTi (coaxial, copper NiTi (CuNiTi) or thermoelastic) initial arch wires. The three trials in this comparison each compared a different product against single-strand superelastic NiTi. There is very weak unreliable evidence, based on one very small study (n = 24) at high risk of bias, that coaxial superelastic NiTi may produce greater tooth movement over 12 weeks, but no information on associated pain or root resorption. This result should be interpreted with caution until further research evidence is available. There is insufficient evidence to determine whether or not there is a difference between either thermoelastic or CuNiTi and superelastic NiTi initial arch wires. There is no reliable evidence from the trials included in

  3. Load-Deflection and Friction Properties of PEEK Wires as Alternative Orthodontic Wires.

    Science.gov (United States)

    Tada, Yoshifumi; Hayakawa, Tohru; Nakamura, Yoshiki

    2017-08-09

    Polyetheretherketone (PEEK) is now attracting attention as an alternative to metal alloys in the dental field. In the present study, we evaluated the load-deflection characteristics of PEEK wires in addition to their frictional properties. Three types of PEEK wires are used: two sizes of rectangular shape, 0.016 × 0.022 in² and 0.019 × 0.025 in² (19-25PEEK), and rounded shape, diameter 0.016 in (16PEEK). As a control, Ni-Ti orthodontic wire, diameter 0.016 in, was used. The three-point bending properties were evaluated in a modified three-point bending system for orthodontics. The static friction between the orthodontic wire and the bracket was also measured. The load-deflection curves were similar among Ni-Ti and PEEK wires, except for 16PEEK with slot-lid ligation. The bending force of 19-25PEEK wire was comparable with that of Ni-Ti wire. 19-25PEEK showed the highest load at the deflection of 1500 μm ( p 0.05). No significant difference was seen in static friction between all three PEEK wires and Ni-Ti wire ( p > 0.05). It is suggested that 19-25PEEK will be applicable for orthodontic treatment with the use of slot-lid ligation.

  4. Deflection load characteristics of laser-welded orthodontic wires.

    Science.gov (United States)

    Watanabe, Etsuko; Stigall, Garrett; Elshahawy, Waleed; Watanabe, Ikuya

    2012-07-01

    To compare the deflection load characteristics of homogeneous and heterogeneous joints made by laser welding using various types of orthodontic wires. Four kinds of straight orthodontic rectangular wires (0.017 inch × 0.025 inch) were used: stainless-steel (SS), cobalt-chromium-nickel (Co-Cr-Ni), beta-titanium alloy (β-Ti), and nickel-titanium (Ni-Ti). Homogeneous and heterogeneous end-to-end joints (12 mm long each) were made by Nd:YAG laser welding. Two types of welding methods were used: two-point welding and four-point welding. Nonwelded wires were also used as a control. Deflection load (N) was measured by conducting the three-point bending test. The data (n  =  5) were statistically analyzed using analysis of variance/Tukey test (P wires measured were as follows: SS: 21.7 ± 0.8 N; Co-Cr-Ni: 20.0 ± 0.3 N; β-Ti: 13.9 ± 1.3 N; and Ni-Ti: 6.6 ± 0.4 N. All of the homogeneously welded specimens showed lower deflection loads compared to corresponding control wires and exhibited higher deflection loads compared to heterogeneously welded combinations. For homogeneous combinations, Co-Cr-Ni/Co-Cr-Ni showed a significantly (P wires provide a deflection load that is comparable to that of homogeneously welded orthodontic wires.

  5. Degradation of orthodontic wires under simulated cariogenic and erosive conditions

    Directory of Open Access Journals (Sweden)

    Laura Cavalcante Lima JABER

    2014-08-01

    Full Text Available This study examined the effect of cariogenic and erosive challenges (CCs and ECs, respectively on the degradation of copper-nickel-titanium (CuNiTi orthodontic wires. Sixty wire segments were divided into four treatment groups and exposed to CCs, ECs, artificial saliva, or dry storage (no-treatment control. CC and EC were simulated using a demineralizing solution (pH 4.3 and a citric acid solution (pH 2.3, respectively. Following treatment, the average surface roughness (Ra of the wires was assessed, and friction between the wires and a passive self-ligating bracket was measured. CuNiTi wires subjected to ECs exhibited significantly higher Ra values than did those that were stored in artificial saliva. In contrast, surface roughness was not affected by CCs. Finally, friction between the treated wires and brackets was not affected by ECs or CCs. Our results indicate that CuNiTi orthodontic wires may suffer degradation within the oral cavity, as ECs increased the surface roughness of these wires. However, rougher surfaces did not increase friction between the wire and the passive self-ligating bracket.

  6. Degradation of orthodontic wires under simulated cariogenic and erosive conditions.

    Science.gov (United States)

    Jaber, Laura Cavalcante Lima; Rodrigues, José Augusto; Amaral, Flávia Lucisano Botelho; França, Fabiana Mantovani Gomes; Basting, Roberta Tarkany; Turssi, Cecilia Pedroso

    2014-01-01

    This study examined the effect of cariogenic and erosive challenges (CCs and ECs, respectively) on the degradation of copper-nickel-titanium (CuNiTi) orthodontic wires. Sixty wire segments were divided into four treatment groups and exposed to CCs, ECs, artificial saliva, or dry storage (no-treatment control). CC and EC were simulated using a demineralizing solution (pH 4.3) and a citric acid solution (pH 2.3), respectively. Following treatment, the average surface roughness (Ra) of the wires was assessed, and friction between the wires and a passive self-ligating bracket was measured. CuNiTi wires subjected to ECs exhibited significantly higher Ra values than did those that were stored in artificial saliva. In contrast, surface roughness was not affected by CCs. Finally, friction between the treated wires and brackets was not affected by ECs or CCs. Our results indicate that CuNiTi orthodontic wires may suffer degradation within the oral cavity, as ECs increased the surface roughness of these wires. However, rougher surfaces did not increase friction between the wire and the passive self-ligating bracket.

  7. Joining characteristics of orthodontic wires with laser welding.

    Science.gov (United States)

    Iijima, Masahiro; Brantley, William A; Yuasa, Toshihiro; Muguruma, Takeshi; Kawashima, Isao; Mizoguchi, Itaru

    2008-01-01

    Laser welding 0.016 x 0.022 in. beta-Ti, Ni-Ti, and Co-Cr-Ni orthodontic wires was investigated by measuring joint tensile strength, measuring laser penetration depth, determining metallurgical phases using micro X-ray diffraction (micro-XRD), and examining microstructures with an scanning electron microscope (SEM). Welding was performed from 150 to 230 V. Mean tensile strength for Ni-Ti groups was significantly lower (p Ni was significantly lower than for control specimens joined by silver soldering, it was sufficient for clinical use. The beta-Ti orthodontic wire showed deeper penetration depth from laser welding than the Ni-Ti and Co-Cr-Ni orthodontic wires. Micro-XRD patterns of laser-welded beta-Ti and Ni-Ti obtained 2 mm from the boundary were similar to as-received specimens, indicating that original microstructures were maintained. When output voltages of 190 V and higher were used, most peaks from joint areas disappeared or were much weaker, perhaps because of a directional solidification effect, evidenced by SEM observation of fine striations in welded beta-Ti. Laser welding beta-Ti and Co-Cr-Ni wires may be acceptable clinically, since joints had sufficient strength and metallurgical phases in the original wires were not greatly altered.

  8. A comparative study of frictional resistance and surface roughness between orthodontic bracket and arch wire

    OpenAIRE

    Kazuro, SATOH; Masaru, ISHIGAME; Yukiko, NAKAMURA; Kazushi, OGASAWARA; Shigeru, TANAKA; Hiroyuki, MIURA; Department of Orthodontics, School of Dentistry, Iwate Medical University; Department of Orthodontics, School of Dentistry, Iwate Medical University; Department of Orthodontics, School of Dentistry, Iwate Medical University; Department of Orthodontics, School of Dentistry, Iwate Medical University; Department of Orthodontics, School of Dentistry, Iwate Medical University; Department of Orthodontics, School of Dentistry, Iwate Medical University

    2003-01-01

    The frictional resistance between an orthodontic bracket and arch wire is closely related to the efficiency of tooth movement in sliding mechanics. Frictional resistance may arise from the materials, geometrical configuration between the orthodontic bracket and arch wire, ligation system and its force, wire stiffness, direction and degree of orthodontic force, and surface roughness of bracket and wire. This study examined the relationship between the frictional resistance and surface roughnes...

  9. Mechanical characterisation of orthodontic superelastic Ni-Ti wires

    Energy Technology Data Exchange (ETDEWEB)

    Arrigoni, M.; Pietrabissa, R. [Politecnico di Milano, Milano (Italy). Lab. of Biological Structure Mechanics; Auricchio, F.; Petrini, L. [Politecnico di Milano, Milano (Italy). Lab. of Biological Structure Mechanics; Pavia Univ. (Italy). Dept. of Structural Mechanics; Cacciafesta, V. [Politecnico di Milano, Milano (Italy). Lab. of Biological Structure Mechanics; Pavia Univ. (Italy). Dept. of Orthodontia

    2001-11-01

    Nowadays, the orthodontic treatment is improving thanks to the introduction of Ni-Ti super-elastic alloy wires in the ordinary therapy. Indeed, laboratory tests performed in the last decade have shown that Ni-Ti superelastic wires are able to satisfy the ideal requirements for fixed arch-wire appliance: high flexibility, minimal distortion or plastic deformation, light constant force production over a wide range of displacements. On the other hand, many orthodontic companies produce Ni-Ti arch-wires, without giving detailed specifications on their superelastic characteristics. To improve the knowledge on real properties for these products, an experimental campaign on different commercial arch-wires has been started at the Laboratory of Biological Structure Mechanics (LABS) at the Politecnico di Milano (Italy). This work presents the first step of the research, concerning the comparison between the behaviour of four types of wires (two produced by ORMCO and two produced by 3M/Unitek) under monotonic and cyclic isothermal tensile tests. The results show significant differences between the products in terms of elastic modulus, stress values of the loading-unloading plateau, hysteresis amplitude, spring-back capacity, shape recovery capability, strain rate effect and fatigue behaviour. (orig.)

  10. Initial arch wires for alignment of crooked teeth with fixed orthodontic braces.

    LENUS (Irish Health Repository)

    Wang, Yan

    2010-01-01

    The initial arch wire is the first arch wire to be inserted into the fixed appliance at the beginning of orthodontic treatment and is used mainly for correcting crowding and rotations of teeth. With a number of orthodontic arch wires available for initial tooth alignment, it is important to understand which wire is most efficient, as well as which wires cause the least amount of root resorption and pain during the initial aligning stage of treatment.

  11. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.

    1978-01-01

    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  12. Influence of fluoridated mouthwashes on corrosion resistance of orthodontics wires.

    Science.gov (United States)

    Schiff, Nicolas; Grosgogeat, Brigitte; Lissac, Michèle; Dalard, Francis

    2004-08-01

    The aim of the present study was to classify the different alloys commonly used to make orthodontic wire according to their corrosion resistance in different media. The four materials analysed were titanium-based alloys: TMA, TiNb, NiTi and CuNiTi, which were tested in three fluoride mouthwashes: Elmex, Meridol and Acorea as well as in Fusayama Meyer artificial saliva. The electrochemical study showed that the alloys could be divided into two groups. In one group were the NiTi-based alloys which were subject to strong corrosion in the presence of monofluorophosphate found in Acorea solution. In the other group were TiNb, which was the most resistant to corrosion, and TMA, which corroded strongly with the stannous fluoride found in Meridol mouthwash. The results obtained in the present study will enable us to provide attending practitioners with advice concerning fluoride mouthwash to recommend, depending on the treatment phase and the alloy used. So we can advise Elmex mouthwash for patients with TMA and NiTi-based orthodontics wires but we suggest Acorea or Meridol mouthwashes for patients with TiNb orthodontics wires.

  13. Friction in Sliding Orthodontic Mechanics: Ceramic Brackets, Teflon-Coated Wires and Comparative Resistances

    Science.gov (United States)

    1989-01-01

    N Tn FRICTION IN SLIDING ORTHODONTIC MECHANICS: N CERAMIC BRACKETS, TEFLON-COATED WIRES , AND COMPARATIVE RESISTANCES 0 DTICSFLECTED James R. Gill1...obsolete. SECURITY CLASSIFICATION OF THIS PAGE AFIT/CI "OVERPRINT" I FRICTION IN SLIDING ORTHODONTIC MECHANICS: CERAMIC BRACKETS, TEFLON-COATED WIRES ...brackets, arch- wires , and ligations during simulated orthodontic edgewise sliding mechanics. Independent variables and their values were 1) bracket

  14. Biofilm formation on stainless steel and gold wires for bonded retainers in vitro and in vivo and their susceptibility to oral antimicrobials.

    Science.gov (United States)

    Jongsma, Marije A; Pelser, Floris D H; van der Mei, Henny C; Atema-Smit, Jelly; van de Belt-Gritter, Betsy; Busscher, Henk J; Ren, Yijin

    2013-05-01

    Bonded retainers are used in orthodontics to maintain treatment result. Retention wires are prone to biofilm formation and cause gingival recession, bleeding on probing and increased pocket depths near bonded retainers. In this study, we compare in vitro and in vivo biofilm formation on different wires used for bonded retainers and the susceptibility of in vitro biofilms to oral antimicrobials. Orthodontic wires were exposed to saliva, and in vitro biofilm formation was evaluated using plate counting and live/dead staining, together with effects of exposure to toothpaste slurry alone or followed by antimicrobial mouthrinse application. Wires were also placed intra-orally for 72 h in human volunteers and undisturbed biofilm formation was compared by plate counting and live/dead staining, as well as by denaturing gradient gel electrophoresis for compositional differences in biofilms. Single-strand wires attracted only slightly less biofilm in vitro than multi-strand wires. Biofilms on stainless steel single-strand wires however, were much more susceptible to antimicrobials from toothpaste slurries and mouthrinses than on single-strand gold wires and biofilms on multi-strand wires. Also, in vivo significantly less biofilm was found on single-strand than on multi-strand wires. Microbial composition of biofilms was more dependent on the volunteer involved than on wire type. Biofilms on single-strand stainless steel wires attract less biofilm in vitro and are more susceptible to antimicrobials than on multi-strand wires. Also in vivo, single-strand wires attract less biofilm than multi-strand ones. Use of single-strand wires is preferred over multi-strand wires, not because they attract less biofilm, but because biofilms on single-strand wires are not protected against antimicrobials as in crevices and niches as on multi-strand wires.

  15. Load-Deflection and Friction Properties of PEEK Wires as Alternative Orthodontic Wires

    OpenAIRE

    Tada, Yoshifumi; Hayakawa, Tohru; Nakamura, Yoshiki

    2017-01-01

    Polyetheretherketone (PEEK) is now attracting attention as an alternative to metal alloys in the dental field. In the present study, we evaluated the load-deflection characteristics of PEEK wires in addition to their frictional properties. Three types of PEEK wires are used: two sizes of rectangular shape, 0.016 ? 0.022 in2 and 0.019 ? 0.025 in2 (19-25PEEK), and rounded shape, diameter 0.016 in (16PEEK). As a control, Ni-Ti orthodontic wire, diameter 0.016 in, was used. The three-point bendin...

  16. Evaluation of Effects of Sterilization on Mechanical Properties of Orthodontic Wires

    Directory of Open Access Journals (Sweden)

    Sridhar Kannan

    2012-01-01

    Results: Dry heat sterilization, autoclave, 2% glutaraldehyde solution had no effect on ultimate tensile strength, 0.1% yield strength, modulus of elasticity and percentage elongation of stainless steel and elgiloy wires. Tensile strength and yield strength of Nitinol and b-titanium wires together with percentage elongation of b-titanium wires significantly increased following dry heat sterilization and autoclave. No detrimental effects on properties of wires were observed. These sterilization procedures could be safely recommended for sterilization of orthodontic wires.

  17. Surface characterization of nickel titanium orthodontic arch wires

    Science.gov (United States)

    Krishnan, Manu; Seema, Saraswathy; Tiwari, Brijesh; Sharma, Himanshu S.; Londhe, Sanjay; Arora, Vimal

    2015-01-01

    Background Surface roughness of nickel titanium orthodontic arch wires poses several clinical challenges. Surface modification with aesthetic/metallic/non metallic materials is therefore a recent innovation, with clinical efficacy yet to be comprehensively evaluated. Methods One conventional and five types of surface modified nickel titanium arch wires were surface characterized with scanning electron microscopy, energy dispersive analysis, Raman spectroscopy, Atomic force microscopy and 3D profilometry. Root mean square roughness values were analyzed by one way analysis of variance and post hoc Duncan's multiple range tests. Results Study groups demonstrated considerable reduction in roughness values from conventional in a material specific pattern: Group I; conventional (578.56 nm) > Group V; Teflon (365.33 nm) > Group III; nitride (301.51 nm) > Group VI (i); rhodium (290.64 nm) > Group VI (ii); silver (252.22 nm) > Group IV; titanium (229.51 nm) > Group II; resin (158.60 nm). It also showed the defects with aesthetic (resin/Teflon) and nitride surfaces and smooth topography achieved with metals; titanium/silver/rhodium. Conclusions Resin, Teflon, titanium, silver, rhodium and nitrides were effective in decreasing surface roughness of nickel titanium arch wires albeit; certain flaws. Findings have clinical implications, considering their potential in lessening biofilm adhesion, reducing friction, improving corrosion resistance and preventing nickel leach and allergic reactions. PMID:26843749

  18. Autoclaving and clinical recycling: Effects on mechanical properties of orthodontic wires

    Directory of Open Access Journals (Sweden)

    M Oshagh

    2012-01-01

    Conclusion: Although recycle wires were softer than those of control group, relatively small differences and also various properties of available wires have obscured the clinical predictability of their application. There is seemingly no problem in terms of mechanical properties to recycle orthodontic wires.

  19. Adhesive Properties of Bonded Orthodontic Retainers to Enamel : Stainless Steel Wire vs Fiber-reinforced Composites

    NARCIS (Netherlands)

    Foek, Dave Lie Sam; Krebs, Eliza; Sandham, John; Ozcan, Mutlu

    2009-01-01

    Purpose: The objectives of this study were to compare the bond strength of a stainless steel orthodontic wire vs various fiber-reinforced composites (FRC) used as orthodontic retainers on enamel, analyze the failure types after debonding, and investigate the influence of different application

  20. A comparative study of bio degradation of various orthodontic arch wires: an in vitro study.

    Science.gov (United States)

    Gopikrishnan, S; Melath, Anil; Ajith, V V; Mathews, N Binoy

    2015-01-01

    Orthodontic wires are the corner stones of the science and art of orthodontics and they remain in the patient's mouth for a prolonged period of 18-24 months. It is but natural to expect that they will undergo some biodegradation when in the oral environment during that period. This study aims to compare the biodegradation characteristics of four different orthodontic wires, stainless steel, nickel titanium (NiTi), titanium molybdenum alloy (TMA), and copper NiTi and to assess whether these biodegradation products, are within acceptable limits. This study involved the incubation of four different wires in artificial saliva and analyzing the amount of metal released from them at the end of a 28 days study period. The metals analyzed for where nickel, chromium, copper, cobalt, manganese, iron, molybdenum, and titanium. The artificial saliva was changed on days 7, 14, and 21 to prevent the saturation of metals in the artificial saliva. At the end of 28 days, these four samples of artificial saliva of each wire were mixed together and analyzed for the eight metals using an inductively coupled plasma spectroscope. The results showed only the release of nickel, chromium, and iron from stainless steel wire, nickel from NiTi wire, nickel, and chromium from copper NiTi and none from TMA wire. The metals released from arch wires are of such minute quantities to be of any biologic hazard. The amount of metals released is well within acceptable biocompatible limits. Though this study has analyzed the biodegradation of various orthodontic wires, orthodontic wires are never used alone in mechanotherapy. Orthodontic wires along with multiband appliance system with which it is always used and in combination with accessories like face bows may release more metals.

  1. Fluoride influences nickel-titanium orthodontic wires' surface texture and friction resistance.

    Science.gov (United States)

    Abbassy, Mona Aly

    2016-01-01

    The aim of this study was to investigate the effects exerted by the acidulated fluoride gel on stainless steel and nickel-titanium (Ni-Ti) orthodontic wires. Sixty stainless steel and Ni-Ti orthodontic archwires were distributed into forty archwires used for in vitro study and twenty for in situ study. Fluoride was applied for 1 h in the in vitro experiment while it was applied for 5 min in the in situ experiment. The friction resistance of all wires with ceramic brackets before/after topical fluoride application was measured using a universal testing machine at 1 min intervals of moving wire. Moreover, surface properties of the tested wires before/after fluoride application and before/after friction test were examined by a scanning electron microscope (SEM). Dunnett's t -test was used to compare frictional resistance of as-received stainless steel wires and Ni-Ti wires to the wires treated by fluoride in vitro and in situ ( P wire on friction resistance in vitro and in situ ( P wires recorded significantly high friction resistance after fluoride application when compared to stainless steel wires in vitro , P wires in situ , P wires after fluoride application in vitro and in situ . The in vitro fluoride application caused an increase in friction resistance of Ni-Ti wires when compared to stainless steel wires. In vitro and in situ fluoride application caused deterioration in surface properties of Ni-Ti wires.

  2. Autoclaving and clinical recycling: effects on mechanical properties of orthodontic wires.

    Science.gov (United States)

    Oshagh, M; Hematiyan, M R; Mohandes, Y; Oshagh, M R; Pishbin, L

    2012-01-01

    About half of the orthodontists recycle and reuse orthodontic wires because of their costs. So when talking about reuse and sterilization of wires, their effects on mechanical properties of wires should be clarified. The purpose of this study was to assess the effects of sterilization and clinical use on mechanical properties of stainless steel wires. Thirty stainless steel orthodontic wires were divided into three equal groups of control, autoclave (sterilized by autoclave), and recycle group (wires were used for orthodontic patients up to 4 weeks, cleaned by isopropyl alcohol and sterilized by autoclave). The mechanical properties (tensile test, three-point loading test for load-deflection curve) were determined. Fracture force, yield strength, stiffness and modulus of elasticity in recycle groups were significantly lower than the other groups (P < 0.05). Although recycle wires were softer than those of control group, relatively small differences and also various properties of available wires have obscured the clinical predictability of their application. There is seemingly no problem in terms of mechanical properties to recycle orthodontic wires.

  3. Torque resistance of different stainless steel wires commonly used for fixed retainers in orthodontics

    DEFF Research Database (Denmark)

    Arnold, Dario; Dalstra, Michel; Verna, Carlalberta

    2016-01-01

    retainers in orthodontics. Materials and Methods: Torquing moments acting on a retainer wire were measured in a mechanical force testing system by applying buccal crown torque to an upper lateral incisor in both a 3-teeth and in a 2-teeth setup. Seven stainless steel wires with different shape, type (plain...

  4. [Evaluation of the corrosion resistance of orthodontic wires by electrochemical measures and scanning electron microscopy (SEM)].

    Science.gov (United States)

    Zoghbi, André El; Klein, Lorena; Frateur, Isabelle

    2013-12-01

    The objective of this paper is to study the corrosion resistance of orthodontic wires made of different alloys (stainless steel, chrome-cobalt, nickel-titanium and β-titanium) and for the same alloy from different vendors (GAC(®), RMO(®), 3M(®) and ORMCO(®)). Different electrochemical techniques (corrosion potential monitoring as a function of immersion time, current-potential curves, electrochemical impedance spectroscopy (EIS)) were used. The wires' resistance to corrosion was measured and compared with the surface condition, assessed by scanning electron microscopy (SEM). Using the recorded data, a rating system based on the corrosion resistance of orthodontic wires was developed. The comparison of these data with the results of SEM shows that the surface chemical composition plays a primary role in the electrochemical behavior of the orthodontic wires and, unlike surface defects, is a key parameter for the corrosion resistance of the alloy. © EDP Sciences, SFODF, 2013.

  5. Effect of Sodium Fluoride Mouthwash on the Frictional Resistance of Orthodontic Wires

    Directory of Open Access Journals (Sweden)

    Allahyar Geramy

    2017-12-01

    Full Text Available Objectives: The friction between the brackets and orthodontic wire during sliding mechanics inflicts difficulties such as decreasing the applied force and tooth movement and also the loss of anchorage. Therefore, many studies have focused on the factors that affect the friction. The purpose of this study was to assess the effect of 0.05% sodium fluoride mouthwash on the friction between orthodontic brackets and wire.Materials and Methods: Four types of orthodontic wires including rectangular standard stainless steel (SS, titanium molybdenum alloy (TMA, nickel-titanium (NiTi and copper-nickel-titanium (Cu-NiTi were selected. In each group, half of the samples were immersed in 0.05% sodium fluoride mouthwash and the others were immersed in artificial saliva for 10 hours. An elastomeric ligature was used for ligating the wires to brackets. The frictional test was performed in a universal testing machine at the speed of 10 mm/minute. Two-way ANOVA was used for statistical analysis of the friction rate.Results: The friction rate was significantly higher after immersion in 0.05% sodium fluoride mouthwash in comparison with artificial saliva (P=0.00. Cu-NiTi wire showed the highest friction value followed by TMA, NiTi and SS wires.  Conclusions: According to the results of the current study, 0.05% sodium fluoride mouthwash increased the frictional characteristics of all the evaluated orthodontic wires.

  6. Effect of Sodium Fluoride Mouthwash on the Frictional Resistance of Orthodontic Wires.

    Science.gov (United States)

    Geramy, Allahyar; Hooshmand, Tabassom; Etezadi, Tahura

    2017-09-01

    The friction between the brackets and orthodontic wire during sliding mechanics inflicts difficulties such as decreasing the applied force and tooth movement and also the loss of anchorage. Therefore, many studies have focused on the factors that affect the friction. The purpose of this study was to assess the effect of 0.05% sodium fluoride mouthwash on the friction between orthodontic brackets and wire. Four types of orthodontic wires including rectangular standard stainless steel (SS), titanium molybdenum alloy (TMA), nickel-titanium (NiTi) and copper-nickel-titanium (Cu-NiTi) were selected. In each group, half of the samples were immersed in 0.05% sodium fluoride mouthwash and the others were immersed in artificial saliva for 10 hours. An elastomeric ligature was used for ligating the wires to brackets. The frictional test was performed in a universal testing machine at the speed of 10 mm/minute. Two-way ANOVA was used for statistical analysis of the friction rate. The friction rate was significantly higher after immersion in 0.05% sodium fluoride mouthwash in comparison with artificial saliva (P=0.00). Cu-NiTi wire showed the highest friction value followed by TMA, NiTi and SS wires. According to the results of the current study, 0.05% sodium fluoride mouthwash increased the frictional characteristics of all the evaluated orthodontic wires.

  7. Surface topography, hardness, and frictional properties of GFRP for esthetic orthodontic wires.

    Science.gov (United States)

    Inami, Toshihiro; Tanimoto, Yasuhiro; Yamaguchi, Masaru; Shibata, Yo; Nishiyama, Norihiro; Kasai, Kazutaka

    2016-01-01

    In our previous study, glass-fiber-reinforced plastics (GFRPs) made from polycarbonate and glass fiber for esthetic orthodontic wires were prepared by using pultrusion. The purpose of the present study was to investigate the surface topography, hardness, and frictional properties of GFRPs. To investigate how fiber diameter affects surface properties, GFRP round wires with a diameter of 0.45 mm (0.018 in.) were prepared incorporating either 13 μm (GFRP-13) or 7 μm (GFRP-7) glass fibers. As controls, stainless steel (SS), cobalt-chromium-nickel alloy, β-titanium (β-Ti) alloy, and nickel-titanium (Ni-Ti) alloy were also evaluated. Under scanning electron microscopy and scanning probe microscopy, the β-Ti samples exhibited greater surface roughness than the other metallic wires and the GFRP wires. The dynamic hardness and elastic modulus of GFRP wires obtained by the dynamic micro-indentation method were much lower than those of metallic wires (p wires and Ni-Ti wire were nearly half as low as those of SS, Co-Cr, and β-Ti wires. In conclusion, there was no significant difference in surface properties between GFRP-13 and GFRP-7; presumably because both share the same polycarbonate matrix. We expect that GFRP wires will deliver superior sliding mechanics with low frictional resistance between the wire and bracket during orthodontic treatment. © 2015 Wiley Periodicals, Inc.

  8. Mechanical properties of orthodontic wires on ceramic brackets associated with low friction ligatures

    Directory of Open Access Journals (Sweden)

    Fernando KOIKE

    2017-03-01

    Full Text Available Abstract Introduction Few studies investigated the mechanical properties of orthodontic wires on ceramic brackets associated the ligatures. Objective This study aimed to compare the load-deflection of orthodontic wires with round section of 0.016” made of stainless steel (SS, nickel-titanium (NiTi and glass fiber-reinforced polymer composite (GFRPC. Material and method Sixty specimens obtained from 10 sectioned pre-contoured arches (TP Orthodontics, were divided into 3 groups of 20 according to each type of material (1 esthetic-type wire and 2 not esthetic and length of 50 mm. The methodology consisted of a 3-point bending test using esthetic ceramic brackets (INVU, TP Orthodontics, Edgewise, 0.022”x 0.025” as points of support. The tensile tests were performed on a mechanical test machine, at a speed of 10 mm/min, deflection of 1 mm, 2 mm and 3 mm. Friedman’s Non Parametric Multiple comparisons test was used (P<0.05. Result The nickel-titanium wire presented smaller load/ deflection compared with stainless steel. GFRPC wires had lower strength values among all groups evaluated (P<.05. The steel wire showed permanent deformation after 3 mm deflection, NiTi wire demonstrated memory effect and the esthetic type had fractures with loss of strength. Conclusion It can be concluded that steel wires have high strength values, requiring the incorporation of loops and folds to reduce the load / deflection. NiTi and GFRPC wires produced low levels of force, however the esthetic wire was shown to fracture and break.

  9. Deflection and Flexural Strength Effects on the Roughness of Aesthetic-Coated Orthodontic Wires.

    Science.gov (United States)

    Albuquerque, Cibele Gonçalves de; Correr, Américo Bortolazzo; Venezian, Giovana Cherubini; Santamaria, Milton; Tubel, Carlos Alberto; Vedovello, Silvia Amélia Scudeler

    2017-01-01

    The aim was to evaluate the flexural strength and the effects of deflection on the surface roughness of esthetic orthodontic wires. The sample consisted of 70 archwire 0.014-inch: polytetrafluorethylene (PTFE)-coated Nickel-Titanium (Niti) archwires (Titanol Cosmetic-TC, Flexy Super Elastic Esthetic-FSE, esthetic Nickel Titanium Wire-ANT); epoxy resin-coated Niti archwires (Spectra-S, Niticosmetic-TEC); gold and rhodium coated Niti (Sentalloy-STC) and a control group (superelastic Niti (Nitinol-NS). The initial roughness was evaluated with a rugosimeter. After that, the wires were submitted to flexural test in an universal testing machine. Each wire was deflected up to 2 mm at a speed of 1 mm/min. After flexural test, the roughness of the wires was evaluted on the same surface as that used for the initial evaluation. The data of roughness and flexural strength were analyzed by one-way ANOVA and Tukey's test (a=0.05). Student t-test compared roughness before and after deflection (a =0.05). The roughness of S and ANT (epoxy resin and PTFE-coated wires, respectively), before and after deflection, was significantly higher than the other groups (pWire deflection significantly increased the roughness of the wires S and STC (porthodontic wires does not depend on the type of the esthetic coating, but it is influenced by the method of application of this coating. The deflection can increase the roughness of the esthetic orthodontic wires.

  10. Initial arch wires for alignment of crooked teeth with fixed orthodontic braces.

    Science.gov (United States)

    Wang, Yan; Jian, Fan; Lai, Wenli; Zhao, Zhihe; Yang, Zhi; Liao, Zhengyu; Shi, Zongdao; Wu, Taixiang; Millett, Declan T; McIntyre, Grant T; Hickman, Joy

    2010-04-14

    The initial arch wire is the first arch wire to be inserted into the fixed appliance at the beginning of orthodontic treatment and is used mainly for correcting crowding and rotations of teeth. With a number of orthodontic arch wires available for initial tooth alignment, it is important to understand which wire is most efficient, as well as which wires cause the least amount of root resorption and pain during the initial aligning stage of treatment. To identify and assess the evidence for the effects of initial arch wires for alignment of teeth with fixed orthodontic braces in relation to alignment speed, root resorption and pain intensity. We searched the following electronic databases: the Cochrane Oral Health Group's Trials Register (30th November 2009), CENTRAL (The Cochrane Library 2009, Issue 4), MEDLINE (1950 to 30th November 2009) and EMBASE (1980 to 30th November 2009). Reference lists of articles were also searched. There was no restriction with regard to publication status or language of publication. We contacted all authors of included studies to identify additional studies. Randomised controlled trials (RCTs) of initial arch wires to align crooked teeth with fixed orthodontic braces were selected. Only studies involving patients with upper and/or lower full arch fixed orthodontic appliances were included. Two review authors were responsible for study selection, validity assessment and data extraction. All disagreements were resolved by discussion amongst the review team. Corresponding authors of included studies were contacted to obtain missing information. Seven RCTs, with 517 participants, provided data for this review. Among them, five trials investigated the speed of initial tooth alignment comparing: 0.016 inch ion-implanted A-NiTi wire versus 0.016 inch A-NiTi versus 0.0175 multistrand stainless steel wire; 0.016x0.022 inch medium force active M-NiTi wire versus 0.016x0.022 inch graded force active M-NiTi wire versus 0.0155 inch multistrand

  11. Nickel release from orthodontic retention wires: the action of mechanical loading and pH

    NARCIS (Netherlands)

    Milheiro, A.; Kleverlaan, C.; Muris, J.; Feilzer, A.; Pallav, P.

    2012-01-01

    Nickel (Ni) is a potent sensitizer and may induce innate and adaptive immune responses. Ni is an important component of orthodontic appliances (8-50 wt%). Due to chemical and mechanical factors in the oral environment, Ni is released from these appliances. Retention wires are in situ for a long

  12. Torque resistance of different stainless steel wires commonly used for fixed retainers in orthodontics.

    Science.gov (United States)

    Arnold, Dario T; Dalstra, Michel; Verna, Carlalberta

    2016-06-01

    Movements of teeth splinted by fixed retention wires after orthodontic treatment have been observed. The aetiological factors for these movements are unknown. The aim of this in vitro study was to compare the resistance to torque of different stainless steel wires commonly used for fixed retainers in orthodontics. Torquing moments acting on a retainer wire were measured in a mechanical force testing system by applying buccal crown torque to an upper lateral incisor in both a 3-teeth and in a 2-teeth setup. Seven stainless steel wires with different shape, type (plain, braided, coaxial, or chain) and dimensions were selected for this study. For a torquing angle of 16.2° in the 3-teeth setup torsion moments can vary between 390 cNmm and 3299 cNmm depending on the retainer wire. For the 2-teeth setup the torsion moments are much smaller. Exposure to the flame of a butane-gas torch for 10 seconds to anneal the wire reduces the stiffness of the retainer wire. Clinicians must select wires for fixed retainers very carefully since the difference in resistance to torque is large. A high level of torque control can be achieved with a plain 0.016 × 0.016-inch or a braided 0.016 × 0.022-inch stainless steel wire. A tooth attached by a retainer wire to only one neighbouring tooth is less resistant to torque than a tooth connected to two neighbouring teeth. Annealing a retainer wire with a flame reduces the stiffness of the wire markedly and can lead to a non-uniform and non-reproducible effect.

  13. Effect of electrical spot welding on load deflection rate of orthodontic wires.

    Science.gov (United States)

    Alavi, Shiva; Abrishami, Arezoo

    2015-01-01

    One of the methods used for joining metals together is welding, which can be carried out using different techniques such as electric spot welding. This study evaluated the effect of electric spot welding on the load deflection rate of stainless steel and chromium-cobalt orthodontic wires. In this experimental-laboratory study, load deflection rate of 0.016 × 0.022 inch stainless steel and chromium cobalt wires were evaluated in five groups (n =18): group one: Stainless steel wires, group two: chromium-cobalt wires, group three: stainless steel wires welded to stainless steel wires, group four: Stainless steel wires welded to chromium-cobalt wires, group five: chromium-cobalt wire welded to chromium-cobalt wires. Afterward, the forces induced by the samples in 0.5 mm, 1 mm, 1.5 mm deflection were measured using a universal testing machine. Then mean force measured for each group was compared with other groups. The data were analyzed using repeated measure analysis of variance (ANOVA), one-way ANOVA, and paired t-test by the SPSS software. The significance level was set as 0.05. The Tukey test showed that there were significant differences between the load deflection rates of welded groups compared to control ones (P wires increased their load deflection rates.

  14. A comparison of titanium alloy orthodontic wires for surface roughness using a confocal optical microscope

    OpenAIRE

    Hirokazu, Nakano; Akihide, Yoshida; Kazushi, Ogasawara; Akira, Sanjo; Shigeru, Tanaka; Takuya, Kamegai; Kazuro, Satoh; Hiroyuki, Miura; Department of Orthodontics, School of Dentistry, Iwate Medical University; Department of Orthodontics, School of Dentistry, Iwate Medical University; Department of Orthodontics, School of Dentistry, Iwate Medical University; Department of Orthodontics, School of Dentistry, Iwate Medical University; Department of Orthodontics, School of Dentistry, Iwate Medical University; Department of Orthodontics, School of Dentistry, Iwate Medical University; Department of Orthodontics, School of Dentistry, Iwate Medical University

    2001-01-01

    The purpose of this study was to clarify the surface roughness of 31 brands of titanium alloy orthodontic wires from 13 manufacturers using a confocal optical microscope. Cobalt-chrome and stainless steel wire were also examined as a reference of comparison. The following results were obtained ; (1) Mean Ra, as determined from the lengthway axis of titanium alloy wires, was 0.296μm, and that determined from the widthway axis was 0.440μm. The modulus of Ra was 0.368μm. (2) For titanium alloy o...

  15. Characterization and coating stability evaluation of nickel-titanium orthodontic esthetic wires: an in vivo study

    Directory of Open Access Journals (Sweden)

    Nina ARGALJI

    2017-08-01

    Full Text Available Abstract The objective of this study was to compare coating dimensions and surface characteristics of two different esthetic covered nickel-titanium orthodontic rectangular archwires, as-received from the manufacturer and after oral exposure. The study was designed for comparative purposes. Both archwires, as-received from the manufacturer, were observed using a stereomicroscope to measure coating thickness and inner metallic dimensions. The wires were also exposed to oral environment in 11 orthodontic active patients for 21 days. After removing the samples, stereomicroscopy images were captured, coating loss was measured and its percentage was calculated. Three segments of each wire (one as-received and two after oral exposure were observed using scanning electron microscopy for a qualitative analysis of the labial surface of the wires. The Lilliefors test and independent t-test were applied to verify normality of data and statistical differences between wires, respectively. The significance level adopted was 0.05. The results showed that the differences between the wires while comparing inner height and thickness were statistically significant (p < 0.0001. In average, the most recently launched wire presented a coating thickness twice that of the control wire, which was also a statistically significant difference. The coating loss percentage was also statistically different (p = 0.0346 when the latest launched wire (13.27% was compared to the control (29.63%. In conclusion, the coating of the most recent wire was thicker and more uniform, whereas the control had a thinner coating on the edges. After oral exposure, both tested wires presented coating loss, but the most recently launched wire exhibited better results.

  16. Analysis in vitro of direct bonding system with cyanoacrylate ester and orthodontic wires.

    Science.gov (United States)

    Manfrin, Thais Mara; Poi, Wilson Roberto; de Mendonça, Marcos Rogério; Cardoso, Leandro Carvalho; Massa Sundefeld, Maria Lúcia Marçal; Sonoda, Celso Koogi; Panzarini, Sônia Regina

    2009-04-01

    The aim of this study was to evaluate the tensile strength of orthodontic wires bonded onto the enamel with cyanoacrylate ester. To obtain the specimens, 120 human premolars (extracted for orthodontic or periodontal reasons) were included in acrylic blocks of rapid polymerization with three teeth each. Four groups were formed with ten specimens each. In the specimens, a dental splint model was made with cyanoacrylate ester and round stainless steel wire. In groups I, II and III, cyanoacrylate ester was used with round steel wires, with variation in diameter: 0.014 inches; 0.016 inches and 0.018 inches, respectively. In group IV, round steel wire 0.018 inches was used with photo polymerizing resin composite with previous acid etching. The adhesive force of the materials was measured in two points under the action of the tensiometer (ETM-USA). The number of loose wires was counted along with those that remained fixed according to the different levels of force applied because of the direction of the tensile force (vertical or horizontal) and the diameter of the wire used. The data obtained were first submitted to a descriptive analysis and then submitted to a statistical analysis (Friedman's Test and Dunn's Test of Multiple Comparison - Epi-info 3.2). Within the limitations of the experimental conditions presented, the cyanoacrylate ester or 'Super Bonder' maintained bonded to enamel and steel wires (0.016 and 0.018 inches) during the tensile strength tests under different levels of applied forces.

  17. Release of nickel and chromium ions from orthodontic wires following the use of teeth whitening mouthwashes

    Directory of Open Access Journals (Sweden)

    AmirHossein Mirhashemi

    2018-02-01

    Full Text Available Abstract Background Corrosion resistance is an important requirement for orthodontic appliances. Nickel and chromium may be released from orthodontic wires and can cause allergic reactions and cytotoxicity when patients use various mouthwashes to whiten their teeth. Our study aimed to assess the release of nickel and chromium ions from nickel titanium (NiTi and stainless steel (SS orthodontic wires following the use of four common mouthwashes available on the market. Methods This in vitro, experimental study was conducted on 120 orthodontic appliances for one maxillary quadrant including five brackets, one band and half of the required length of SS, and NiTi wires. The samples were immersed in Oral B, Oral B 3D White Luxe, Listerine, and Listerine Advance White for 1, 6, 24, and 168 h. The samples immersed in distilled water served as the control group. Atomic absorption spectroscopy served to quantify the amount of released ions. Results Nickel ions were released from both wires at all time-points; the highest amount was in Listerine and the lowest in Oral B mouthwashes. The remaining two solutions were in-between this range. The process of release of chromium from the SS wire was the same as that of nickel. However, the release trend in NiTi wires was not uniform. Conclusions Listerine caused the highest release of ions. Listerine Advance White, Oral B 3D White Luxe, and distilled water were the same in terms of ion release. Oral B showed the lowest amount of ion release.

  18. Orthodontic Wire Ingestion during Treatment: Reporting a Case and Review the Management of Foreign Body Ingestion or Aspiration (Emergencies

    Directory of Open Access Journals (Sweden)

    Mohammad Hoseini

    2013-01-01

    Full Text Available Today orthodontic treatment is in growing demand and is not limited to a specific age or social group. The nature of orthodontic treatment is such that the orthodontic wires and appliances, which are used to apply force and move the teeth, are exposed to the oral cavity. Shaping and replacing these wires in oral cavity are the major assignments of orthodontist on appointments. Therefore, we can say that orthodontic treatment requires working with dangerous tools in a sensitive place like oral cavity which is the entrance of respiratory and digestive systems. In this paper, a case of ingesting a broken orthodontic wire during eating is reported, and also necessary remedial measures at the time of encountering foreign body ingestion or aspiration are provided.

  19. Characterization and coating stability evaluation of nickel-titanium orthodontic esthetic wires: an in vivo study.

    Science.gov (United States)

    Argalji, Nina; Silva, Eduardo Moreira da; Cury-Saramago, Adriana; Mattos, Claudia Trindade

    2017-08-21

    The objective of this study was to compare coating dimensions and surface characteristics of two different esthetic covered nickel-titanium orthodontic rectangular archwires, as-received from the manufacturer and after oral exposure. The study was designed for comparative purposes. Both archwires, as-received from the manufacturer, were observed using a stereomicroscope to measure coating thickness and inner metallic dimensions. The wires were also exposed to oral environment in 11 orthodontic active patients for 21 days. After removing the samples, stereomicroscopy images were captured, coating loss was measured and its percentage was calculated. Three segments of each wire (one as-received and two after oral exposure) were observed using scanning electron microscopy for a qualitative analysis of the labial surface of the wires. The Lilliefors test and independent t-test were applied to verify normality of data and statistical differences between wires, respectively. The significance level adopted was 0.05. The results showed that the differences between the wires while comparing inner height and thickness were statistically significant (p coating thickness twice that of the control wire, which was also a statistically significant difference. The coating loss percentage was also statistically different (p = 0.0346) when the latest launched wire (13.27%) was compared to the control (29.63%). In conclusion, the coating of the most recent wire was thicker and more uniform, whereas the control had a thinner coating on the edges. After oral exposure, both tested wires presented coating loss, but the most recently launched wire exhibited better results.

  20. Effects of a diamond-like carbon coating on the frictional properties of orthodontic wires.

    Science.gov (United States)

    Muguruma, Takeshi; Iijima, Masahiro; Brantley, William A; Mizoguchi, Itaru

    2011-01-01

    To test the hypothesis that a diamond-like carbon coating does not affect the frictional properties of orthodontic wires. Two types of wires (nickel-titanium and stainless steel) were used, and diamond-like carbon (DLC) films were deposited on the wires. Three types of brackets, a conventional stainless steel bracket and two self-ligating brackets, were used for measuring static friction. DLC layers were observed by three-dimensional scanning electron microscopy (3D-SEM), and the surface roughness was measured. Hardness and elastic modulus were obtained by nanoindentation testing. Frictional forces and surface roughness were compared by the Kruskal-Wallis and Mann-Whitney U-tests. The hardness and elastic modulus of the wires were compared using Student's t-test. When angulation was increased, the DLC-coated wires showed significantly less frictional force than the as-received wires, except for some wire/bracket combinations. Thin DLC layers were observed on the wire surfaces by SEM. As-received and DLC-coated wires had similar surface morphologies, and the DLC-coating process did not affect the surface roughness. The hardness of the surface layer of the DLC-coated wires was much higher than for the as-received wires. The elastic modulus of the surface layer of the DLC-coated stainless steel wire was less than that of the as-received stainless steel wire, whereas similar values were found for the nickel-titanium wires. The hypothesis is rejected. A DLC-coating process does reduce the frictional force.

  1. Ion Release and Galvanic Corrosion of Different Orthodontic Brackets and Wires in Artificial Saliva.

    Science.gov (United States)

    Tahmasbi, Soodeh; Sheikh, Tahereh; Hemmati, Yasamin B

    2017-03-01

    To investigate the galvanic corrosion of brackets manufactured by four different companies coupled with stainless steel (SS) or nickel-titanium (NiTi) wires in an artificial saliva solution. A total of 24 mandibular central incisor Roth brackets of four different manufacturers (American Orthodontics, Dentaurum, Shinye, ORJ) were used in this experimental study. These brackets were immersed in artificial saliva along with SS or NiTi orthodontic wires (0.016'', round) for 28 days. The electric potential difference of each bracket/ wire coupled with a saturated calomel reference electrode was measured via a voltmeter and recorded constantly. Corrosion rate (CR) was calculated, and release of ions was measured with an atomic absorption spectrometer. Stereomicroscope was used to evaluate all samples. Then, samples with corrosion were further assessed by scanning electron microscope and energy-dispersive X-ray spectroscopy. Two-way analysis of variance was used to analyze data. Among ions evaluated, release of nickel ions from Shinye brackets was significantly higher than that of other brackets. The mean potential difference was significantly lower in specimens containing a couple of Shinye brackets and SS wire compared with other specimens. No significant difference was observed in the mean CR of various groups (p > 0.05). Microscopic evaluation showed corrosion in two samples only: Shinye bracket coupled with SS wire and American Orthodontics bracket coupled with NiTi wire. Shinye brackets coupled with SS wire showed more susceptibility to galvanic corrosion. There were no significant differences among specimens in terms of the CR or released ions except the release of Ni ions, which was higher in Shinye brackets.

  2. A Comparison of pical Root Resorption in Incisors after Fixed Orthodontic Treatment with Standard Edgewise and Straight Wire (MBT) Method

    OpenAIRE

    Zahed Zahedani, SM; Oshagh, M; Momeni Danaei, Sh; Roeinpeikar, SMM

    2013-01-01

    Statement of Problem: One of the major outcomes of orthodontic treatment is the apical root resorption of teeth moved during the treatment. Identifying the possible risk factors, are necessary for every orthodontist. Purpose: The aim of this study was to compare the rate of apical root resorption after fixed orthodontic treatment with standard edgewise and straight wire (MBT) method, and also to evaluate other factors effecting the rate of root resorption in orthodontic treatments. Materials ...

  3. A Comparison of Apical Root Resorption in Incisors after Fixed Orthodontic Treatment with Standard Edgewise and Straight Wire (MBT) Method

    OpenAIRE

    Zahed Zahedani SM.; Oshagh M.; Momeni Danaei Sh.; Roeinpeikar SMM.

    2013-01-01

    Statement of Problem: One of the major outcomes of orthodontic treatment is the apical root resorption of teeth moved during the treatment. Identifying the possible risk factors, are necessary for every orthodontist. Purpose: The aim of this study was to compare the rate of apical root resorption after fixed orthodontic treatment with standard edgewise and straight wire (MBT) method, and also to evaluate other factors effecting the rate of root resorption in orthodontic treatments.Materials a...

  4. Clinical evaluation of dental alignment and leveling with three different types of orthodontic wires

    Directory of Open Access Journals (Sweden)

    Marco Abdo Gravina

    2013-12-01

    Full Text Available INTRODUCTION: A wide variety of orthodontic wires made of different alloys is available to be used in orthodontic practice and may produce different clinical responses during tooth movement. OBJECTIVE: This research evaluated the alignment and leveling of lower dental arches after the use of three types of orthodontic wires. METHODS: A sample of 36 patients was randomly divided into 3 groups: stainless steel, multistranded steel and superelastic nickel-titanium, according to the first leveling arches used. In order to observe differences in tooth position and axial inclination of the lower incisors, all patients had lateral cephalometric radiographs taken before the insertion of the first arches and 2 months later. The irregularity index and the curve of Spee were measured, compared between groups and considered influential on the proclination of incisors during the initial phase of alignment and leveling. The Reflex microscope was used to measure the irregularity index, whereas the ANOVA analysis of variance was used to verify differences between groups with regard to the degree of dental alignment and leveling. RESULTS: There were significant differences between groups only at T2 for the irregularity index. CONCLUSION: The NiTi and multistranded steel wires showed greater aligning capacity when compared with stainless steel wires.

  5. Clinical evaluation of dental alignment and leveling with three different types of orthodontic wires.

    Science.gov (United States)

    Gravina, Marco Abdo; Brunharo, Ione Helena Vieira Portella; Fraga, Marcelo Reis; Artese, Flavia; Campos, Marcio José da Silva; Vitral, Robert Willer Farinazzo; Quintão, Cátia Cardoso Abdo

    2013-01-01

    A wide variety of orthodontic wires made of different alloys is available to be used in orthodontic practice and may produce different clinical responses during tooth movement. This research evaluated the alignment and leveling of lower dental arches after the use of three types of orthodontic wires. A sample of 36 patients was randomly divided into 3 groups: stainless steel, multistranded steel and superelastic nickel-titanium, according to the first leveling arches used. In order to observe differences in tooth position and axial inclination of the lower incisors, all patients had lateral cephalometric radiographs taken before the insertion of the first arches and 2 months later. The irregularity index and the curve of Spee were measured, compared between groups and considered influential on the proclination of incisors during the initial phase of alignment and leveling. The Reflex microscope was used to measure the irregularity index, whereas the ANOVA analysis of variance was used to verify differences between groups with regard to the degree of dental alignment and leveling. There were significant differences between groups only at T2 for the irregularity index. The NiTi and multistranded steel wires showed greater aligning capacity when compared with stainless steel wires.

  6. Force systems in the initial phase of orthodontic treatment -- a comparison of different leveling arch wires.

    Science.gov (United States)

    Fuck, Lars-Michael; Drescher, Dieter

    2006-01-01

    The determination of orthodontically-effective forces and moments places great demands on the technical equipment. Many patients report severe pain after fixed appliance insertion. Since it is assumed that pain from orthodontic appliances is associated with the force and moment levels applied to the teeth and since the occurrence of root resorption is a common therapeutic side effect, it would seem important to know the actual magnitudes of the components of the active orthodontic force systems. The aim of the present study was therefore to measure initial force systems produced by different leveling arch-wires in a complete multi-bracket appliance and to assess whether force and moment levels can be regarded as biologically acceptable or not. The actual bracket position in 42 patients was transferred onto a measurement model. Forces and moments produced by a super-elastic nickel-titanium (NiTi) archwire, a 6-strand stainless steel archwire, and a 7-strand super-elastic NiTi archwire were determined experimentally on different teeth. Average forces and moments produced by the super-elastic NiTi arch wires were found to be the highest. In spite if their larger diameter, the stranded arch wires' average force and moment levels were lower, especially that of the stranded super-elastic archwire. Nevertheless, maximum force levels sometimes exceeded recommended values in the literature and must be considered as too high. The measured arch wires' initial force systems differed significantly depending on the type of archwire and its material structure. Stranded arch wires produced lower force and moment levels, and we recommend their use in the initial phase of orthodontic treatment.

  7. Evaluation of the effect of three mouthwashes on the mechanical properties and surface morphology of several orthodontic wires: Anin vitrostudy.

    Science.gov (United States)

    Aghili, Hossein; Yassaei, Sogra; Eslami, Farzaneh

    2017-01-01

    The aim of this study was to evaluate and compare the changes in the mechanical properties and surface morphology of different orthodontic wires after immersion in three mouthwash solutions. In this in vitro study, five specimens of each of 0.016 inch nickel titanium (NiTi), coated NiTi, and stainless steel orthodontic wires were selected. The specimens were immersed in 0.05% sodium fluoride (NaF), 0.2% chlorhexidine, Zataria multiflora extract, and distilled water (control) for 1.5 h at 37°C. After immersion, loading and unloading forces at 0.5 mm intervals and the elastic modulus (E) of the wires were measured using a three-point bending test. Surface changes were observed with a scanning electron microscope (SEM). Two-way analysis of variance and Bonferroni tests were used to compare the properties of the wires. The level of significance was set at 0.05. Statistically significant changes in loading and unloading forces and E of the orthodontic wires were observed after immersion in different mouthwash solutions ( P wires ( P > 0.05). SEM images showed surface changes in some types ofthe orthodontic wires. The mouthwashes used in this study seemed to change the mechanical properties and surface quality of the orthodontic wires.

  8. Relationship between friction force and orthodontic force at the leveling stage using a coated wire

    Directory of Open Access Journals (Sweden)

    Masaki MURAYAMA

    2013-12-01

    Full Text Available The relationship between orthodontic force and friction produced from an archwire and brackets affects the sliding of the wire in the leveling stage. Objective: The purpose of this study was to evaluate the relationship between force and friction in a small esthetic nickel-titanium (Ni-Ti wire. Material and Methods: Five esthetic wires (three coated and two plated and two small, plain Ni-Ti wires (0.012 and 0.014 inches were used. We performed a three-point bending test according to ISO 15841 and the drawing test with a dental arch model designed with upper linguoversion of the lateral incisor in the arch (displacements of 0.5, 1.0, 2.0 and 3.0 mm, and evaluated the relationship between them. Results: Unloading bending forces of all wires at displacements of less than 1.0 mm were larger than friction forces, but all friction forces at displacements exceeding 2.0 mm were larger than unloading bending forces. The arch likely expands when displacement from the proximal brackets exceeds 1.0 mm. The friction force of a martensite 0.014-inch Ni-Ti wire was significantly greater than those of the other esthetic and austenitic wires. Conclusions: A wire with the smallest possible friction force should be used in cases with more than 1.0 mm displacement.

  9. The Mechanical Behavior Variation of Nickel - Titanium Orthodontic Wires in Different Fluoride Mouthwash

    Directory of Open Access Journals (Sweden)

    Ilnaz haj Hemati

    2016-12-01

    Full Text Available In this study, an orthodontic arch wire of Ni-Ti alloy made by Germany in four different mouthwashes contain fluoride was investigated in mechanical behavior. This research focused on the mechanical behavior changes in different mouthwashes. The Mouthwashes were chosen from most popular one in Iran including Oral-B, Gum, and Behsa Mouthwash. The wires after 3 month in touch with mouthwashes were studied and the result was presented. The result show that the lowest power to reshape the wire, is for the wire in Crest case (3. The maximum power assigns to wire in Behsa case (1. Also, the shortest treatment period is for wire in Behsa mouthwash case (1 with 0.087 Nm strain energy and the maximum duration of therapy is related to case (3 Crest mouthwash with 0.039 Nm. Moreover, the wires in Oral-b (0.095 Nm has the lowest and Gum mouthwash (0.140 Nm has the highest energy intake. The energy absorbed by the wires in Behsa and Crest is in the middle. Finally, it is proposed that patient could used all mouthwash but based on their condition, one product will be useful.

  10. Mechanical properties and surface characterization of beta titanium and stainless steel orthodontic wire following topical fluoride treatment.

    Science.gov (United States)

    Walker, Mary P; Ries, David; Kula, Katherine; Ellis, Micheal; Fricke, Brian

    2007-03-01

    To study the effect of fluoride prophylactic agents on the loading and unloading mechanical properties and surface quality of beta titanium and stainless steel orthodontic wires. Rectangular beta titanium and stainless steel wires were immersed in either an acidulated fluoride agent, a neutral fluoride agent, or distilled water (control) for 1.5 hours at 37 degrees C. After immersion, the loading and unloading elastic modulus and yield strength of the wires were measured using a 3-point bend test in a water bath at 37 degrees C. A one-way analysis of variance and Dunnett's post hoc, alpha = .05, were used to analyze the mechanical testing data. Scanning electron microscopy was also used to qualitatively evaluate the wire topography as a function of the fluoride treatments. Unloading mechanical properties of beta titanium and stainless steel wires were significantly decreased (P steel wire could decrease the functional unloading mechanical properties of the wires and potentially contribute to prolonged orthodontic treatment.

  11. Evaluation of Microbial Contamination of Different Orthodontic as Received Arch Wires from Manufacturers

    Directory of Open Access Journals (Sweden)

    Hassan Suha Saad

    2017-12-01

    Full Text Available Aims of study: The present study was carried out to assess whether as received arch wires from manufactures are free of microbial contamination as well as to identify the bacterial count and types attached to arch wires. Materials and Methods: Eighty samples were included in this study consisting of two types of arch wires (nitinol and stainlesssteel; they were from four companies (3 M, Ortho-Technology, Jiscop and G&H. The wires were inserted into plane tubes that contain 10 ml of BHI broth and tris-EDTA. Further 0.1 ml was withdrawn from plane tube and spread on agar plates. Moreover 16 plane tubes (8 tubes with brain heart infusion broth and 8 with tris-EDTA without arch wires were considered as controls group. Results: Microbial sampling yielded growth from 7 of the 80 arch wires studied, the predominant bacteria isolated were staphylococci spp. No growth was recovered from 73 of the samples and from controls. The total viable count of bacteria in BHI reagent is more than that in Tris-EDTA reagent with statistically significant difference (P0.05. In regard to the presence and distribution of bacteria according to types of wires, the stainless-steel wires have more viable count (49.58 than that in nitinol (47.42 but statistically not significant (P0.05. Conclusion: The arch wires received from manufacturer are often contaminated and therefore there is a need for routine disinfection of such items. This study found that the BHI more is effective in dislodging the bacteria from orthodontic arch wires than tris- EDTA. However, the stainless-steel arch wires were more contaminated than nitinol and most common contaminant were Staphylococci spp

  12. Evaluation of corrosion resistance and surface characteristics of orthodontic wires immersed in different mouthwashes.

    Science.gov (United States)

    Nalbantgil, Didem; Ulkur, Feyza; Kardas, Gulfeza; Culha, Mustafa

    2016-11-25

    Patients use mouthwashes in addition to mechanical cleaning during orthodontic treatment. The effects of mouthwashes on the archwires have not been examined yet. To compare the corrosion resistance of four different arch wires and corrosion effects of different mouthwashes to formulate a biocompatible and mechanically useful arch wire and mouthwash combination. Each group comprised of 4 wire samples of 2 cm 0.016 × 0.022 inch. 1st group: ion implanted nickel titanium (INT), 2nd group: nickel titanium, without ion implantation (NT), 3rd group: micro layered esthetic nickel titanium (ENT), 4th group: stainless steel (SS) wires. They were immersed inside 2 ml of artificial saliva solutions (AS) for the control, or AS (9%) combined with 1 of the 3 mouthwashes (91%) for study groups, for 24 hours. These mouthwashes were essential oil (EO), chlorhexidine (CHX), sodium-fluoride (NaF). An electrochemical analyzer was used for electrochemical impedance spectroscopy measurements. High corrosion resistance was obtained for ENT than the other wires. The corrosion potentials are 0.007, -0.042, 0.074 and -0.015 V (Ag/AgCl) for ENT, INT, SS and NT in the artificial salivary, respectively. In NaF containing mouthwash Rp value of ENT is significantly high in comparison to others. The impedance responses of all materials increased significantly in the presence of NaF mouthwash as well as in the CHX mouthwash. Low frequencies are seen at all materials in EO mouthwash. Diameters of loops are 22, 5.9, 5.9 and 3.7 MΩ at ENT, INT, SS and NT. In this study, micro layered esthetic nickel titanium wires are found biocompatible among other wires and NaF and CHX mouthwashes can be recommend for their good corrosion resistance during fixed orthodontic therapy.

  13. Localized corrosion behaviour in simulated human body fluids of commercial Ni-Ti orthodontic wires.

    Science.gov (United States)

    Rondelli, G; Vicentini, B

    1999-04-01

    The corrosion performances in simulated human body fluids of commercial equiatomic Ni-Ti orthodontic wires having various shape and size and produced by different manufacturers were evaluated; for comparison purposes wires made of stainless steel and of cobalt-based alloy were also examined. Potentiodynamic tests in artificial saliva at 40 degrees C indicated a sufficient pitting resistance for the Ni-Ti wires, similar to that of cobalt-based alloy wire; the stainless steel wire, instead, exhibited low pitting potential. Potentiodynamic tests at 40 degrees C in isotonic saline solution (0.9% NaCl) showed, for Ni-Ti and stainless steel wires, pitting potential values in the range approximately 200-400 mV and approximately 350 mV versus SCE, respectively: consequently, according to literature data (Hoar TP, Mears DC. Proc Roy Soc A 1996;294:486-510), these materials should be considered potentially susceptible to pitting; only the cobalt-based alloy should be immune from pitting. The localized corrosion potentials determined in the same environment by the ASTM F746 test (approximately 0-200 mV and 130 mV versus SCE for Ni-Ti and stainless steel, respectively) pointed out that for these materials an even higher risk of localized corrosion. Slight differences in localized corrosion behaviour among the various Ni-Ti wires were detected.

  14. Influence of surface layer on mechanical and corrosion properties of nickel-titanium orthodontic wires.

    Science.gov (United States)

    Katić, Višnja; Curković, Helena Otmačić; Semenski, Damir; Baršić, Gorana; Marušić, Katarina; Spalj, Stjepan

    2014-11-01

    To analyze the effect of various coating formulations on the mechanical and corrosion properties of nickel-titanium (NiTi) orthodontic wires. Uncoated, rhodium-coated, and nitrified NiTi wires were observed with a three-point-bend test, surface roughness (Ra) measurement, scanning electron microscopy, energy dispersive spectroscopy, and electrochemical testing (open circuit potential, electrochemical impedance spectroscopy, and cyclic polarization scan). Differences in the properties of tested wire types were analyzed with analysis of variance and Tukey post hoc test. Uncoated and nitrified NiTi wires showed similar mechanical and anticorrosive properties, while rhodium-coated NiTi wires showed the highest Ra and significantly higher modulus of elasticity, yield strength, and delivery of forces during loading but not in unloading. Rhodium-coated NiTi wires also had the highest corrosion current density and corrosion potential, lowest impedance modulus, and two time constants on Bode plot, one related to the Rh/Au coating and the other to underlying NiTi. Working properties of NiTi wires were unaffected by various coatings in unloading. Nitrification improved corrosion resistance. Rhodium coating reduced corrosion resistance and pronounced susceptibility to pitting corrosion in artificial saliva because of galvanic coupling between the noble coating and the base alloy.

  15. Comparison of Superelasticity of Nickel Titanium Orthodontic Arch wires using Mechanical Tensile Testing and Correlating with Electrical Resistivity.

    Science.gov (United States)

    Sivaraj, Aravind

    2013-06-01

    Application of light and continuous forces for optimum physiological response and least damage to the tooth supporting structures should be the primary aim of the orthodontist. Nickel titanium alloys with the properties of excellent spring back, super elasticity and wide range of action is one of the natural choices for the clinicians to achieve this goal. In recent periods, various wire manufacturers have come with a variety of wires exhibiting different properties. It is the duty of the clinician to select appropriate wires during various stages of treatment for excellent results. For achieving this evaluation of the properties of these wires is essential. This study is focussed on evaluating the super elastic property of eight groups of austenite active nickel titanium wires. Eight groups of archwires bought from eight different manufacturers were studied. These wires were tested through mechanical tensile testing and electrical resistivity methods. Unloading curves were carefully assessed for superelastic behaviour on deactivation. Rankings of the wires tested were based primarily upon the unloading curve's slope Conclusion: Ortho organisers wires ranked first and superior, followed by American Orthodontics and Ormco A wires. Morelli and GAClowland NiTi wires were ranked last. It can be concluded that the performance of these wires based on rankings should be further evaluated by clinical studies. How to cite this article: Sivaraj A. Comparison of Superelasticity of Nickel Titanium Orthodontic Arch wires using Mechanical Tensile Testing and Correlating with Electrical Resistivity. J Int Oral Health 2013; 5(3):1-12.

  16. Influence of autoclave sterilization on the surface parameters and mechanical properties of six orthodontic wires.

    Science.gov (United States)

    Pernier, C; Grosgogeat, B; Ponsonnet, L; Benay, G; Lissac, M

    2005-02-01

    Orthodontic wires are frequently packaged in individual sealed bags in order to avoid cross-contamination. The instructions on the wrapper generally advise autoclave sterilization of the package and its contents if additional protection is desired. However, sterilization can modify the surface parameters and the mechanical properties of many types of material. The aim of this research was to determine the influence of one of the most widely used sterilization processes, autoclaving (18 minutes at 134 degrees C, as recommended by the French Ministry of Health), on the surface parameters and mechanical properties of six wires currently used in orthodontics (one stainless steel alloy: Tru-Chrome RMO; two nickel-titanium shape memory alloys: Neo Sentalloy and Neo Sentalloy with Ionguard GAC; and three titanium-molybdenum alloys: TMA(R) and Low Friction TMA Ormco and Resolve GAC). The alloys were analysed on receipt and after sterilization, using surface structure observation techniques, including optical, scanning electron and atomic force microscopy and profilometry. The mechanical properties were assessed by three-point bending tests. The results showed that autoclave sterilization had no adverse effects on the surface parameters or on the selected mechanical properties. This supports the possibility for practitioners to systematically sterilize wires before placing them in the oral environment.

  17. Mechanical properties of orthodontic wires covered with a polyether ether ketone tube.

    Science.gov (United States)

    Shirakawa, Nobukazu; Iwata, Toshio; Miyake, Shinjiro; Otuka, Takero; Koizumi, So; Kawata, Toshitugu

    2018-03-21

    To evaluate the esthetics and frictional force of an orthodontic wire passed through a newly designed tube made of a polyether ether ketone (PEEK) resin. Two types of standard PEEK tubes were prepared at 0.5 × 0.6ф and 0.8 × 0.9ф, and different archwires were passed through the tubes. Color values were determined according to brightness and hues. Friction was assessed with different bracket-wire combinations, and surface roughness was determined by stereomicroscopy before and after the application of friction. The PEEK tube showed a color difference that was almost identical to that of coated wires conventionally used in clinical practice, indicating a sufficient esthetic property. The result of the friction test showed that the frictional force was greatly reduced by passing the archwire through the PEEK tube in almost all of the archwires tested. Use of the new PEEK tube demonstrated a good combination of esthetic and functional properties for use in orthodontic appliances.

  18. Interlot variations of transition temperature range and force delivery in copper-nickel-titanium orthodontic wires.

    Science.gov (United States)

    Pompei-Reynolds, Renée C; Kanavakis, Georgios

    2014-08-01

    The manufacturing process for copper-nickel-titanium archwires is technique sensitive. The primary aim of this investigation was to examine the interlot consistency of the mechanical properties of copper-nickel-titanium wires from 2 manufacturers. Wires of 2 sizes (0.016 and 0.016 × 0.022 in) and 3 advertised austenite finish temperatures (27°C, 35°C, and 40°C) from 2 manufacturers were tested for transition temperature ranges and force delivery using differential scanning calorimetry and the 3-point bend test, respectively. Variations of these properties were analyzed for statistical significance by calculating the F statistic for equality of variances for transition temperature and force delivery in each group of wires. All statistical analyses were performed at the 0.05 level of significance. Statistically significant interlot variations in austenite finish were found for the 0.016 in/27°C (P = 0.041) and 0.016 × 0.022 in/35°C (P = 0.048) wire categories, and in austenite start for the 0.016 × 0.022 in/35°C wire category (P = 0.01). In addition, significant variations in force delivery were found between the 2 manufacturers for the 0.016 in/27°C (P = 0.002), 0.016 in/35.0°C (P = 0.049), and 0.016 × 0.022 in/35°C (P = 0.031) wires. Orthodontic wires of the same material, dimension, and manufacturer but from different production lots do not always have similar mechanical properties. Clinicians should be aware that copper-nickel-titanium wires might not always deliver the expected force, even when they come from the same manufacturer, because of interlot variations in the performance of the material. Copyright © 2014 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.

  19. Stress distribution in delayed replanted teeth splinted with different orthodontic wires: a three-dimensional finite element analysis.

    Science.gov (United States)

    de Souza, Fernando Isquierdo; Poi, Wilson Roberto; da Silva, Vanessa Ferreira; Martini, Ana Paula; Melo, Regis Alexandre da Cunha; Panzarini, Sonia Regina; Rocha, Eduardo Passos

    2015-06-01

    The aim was to evaluate the biomechanical behavior of the supporting bony structures of replanted teeth and the periodontal ligament (PDL) of adjacent teeth when orthodontic wires with different mechanical properties are applied, with three-dimensional finite element analysis. Based on tomographic and microtomographic data, a three-dimensional model of the anterior maxilla with the corresponding teeth (tooth 13-tooth 23) was generated to simulate avulsion and replantation of the tooth 21. The teeth were splinted with orthodontic wire (Ø 0.8 mm) and composite resin. The elastic modulus of the three orthodontic wires used, that is, steel wire (FA), titanium-molybdenum wire (FTM), and nitinol wire (FN) were 200 GPa, 84 GPa, and 52 GPa, respectively. An oblique load (100 N) was applied at an angle of 45° on the incisal edge of the replanted tooth and was analyzed using Ansys Workbench software. The maximum (σmax) and minimum (σmin) principal stresses generated in the PDL, cortical and alveolar bones, and the modified von Mises (σvM) values for the orthodontic wires were obtained. With regard to the cortical bone and PDL, the highest σmin and σmax values for FTM, FN, and FA were checked. With regard to the alveolar bone, σmax and σmin values were highest for FA, followed by FTM and FN. The σvM values of the orthodontic wires followed the order of rigidity of the alloys, that is, FA > FTM > FN. The biomechanical behavior of the analyzed structures with regard to all the three patterns of flexibility was similar. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Evaluation of force released by deflection of orthodontic wires in conventional and self-ligating brackets

    Directory of Open Access Journals (Sweden)

    Rodrigo Hitoshi Higa

    Full Text Available ABSTRACT Introduction: The aim of the study was to evaluate deflection forces of rectangular orthodontic wires in conventional (MorelliTM, active (In-Ovation RTM and passive (Damon 3MXTM self-ligating brackets. Material and Methods: Two brands of stainless steel and nickel-titanium (NiTi wires (MorelliTM and GACTM, in addition to OrmcoTM copper-nickel-titanium wires were used. Specimens were assembled in a clinical simulation device especially designed for this study and tested in an Instron universal testing machine. For the testing procedures, an acrylic structure representative of the maxillary right central incisor was lingually moved in activations of 0 to 1 mm, with readings of the force released by deflection in unloading of 0.5, 0.8 and 1 mm at a constant speed of 2 mm/min. Inter-bracket forces with stainless steel, NiTi and CuNiTi were individually compared by two-way ANOVA, followed by Tukey’s tests. Results: Results showed that there were lower forces in conventional brackets, followed by active and passive self-ligating brackets. Within the brands, only for NiTi wires, the MorelliTM brand presented higher forces than GACTM wires. Conclusions: Bracket systems provide different degrees of deflection force, with self-ligating brackets showing the highest forces.

  1. Evaluation of force released by deflection of orthodontic wires in conventional and self-ligating brackets.

    Science.gov (United States)

    Higa, Rodrigo Hitoshi; Semenara, Nayara Thiago; Henriques, José Fernando Castanha; Janson, Guilherme; Sathler, Renata; Fernandes, Thais Maria Freire

    2016-01-01

    The aim of the study was to evaluate deflection forces of rectangular orthodontic wires in conventional (MorelliTM), active (In-Ovation RTM) and passive (Damon 3MXTM) self-ligating brackets. Two brands of stainless steel and nickel-titanium (NiTi) wires (MorelliTM and GACTM), in addition to OrmcoTM copper-nickel-titanium wires were used. Specimens were assembled in a clinical simulation device especially designed for this study and tested in an Instron universal testing machine. For the testing procedures, an acrylic structure representative of the maxillary right central incisor was lingually moved in activations of 0 to 1 mm, with readings of the force released by deflection in unloading of 0.5, 0.8 and 1 mm at a constant speed of 2 mm/min. Inter-bracket forces with stainless steel, NiTi and CuNiTi were individually compared by two-way ANOVA, followed by Tukey's tests. Results showed that there were lower forces in conventional brackets, followed by active and passive self-ligating brackets. Within the brands, only for NiTi wires, the MorelliTM brand presented higher forces than GACTM wires. Bracket systems provide different degrees of deflection force, with self-ligating brackets showing the highest forces.

  2. Assessment of the dimensions and surface characteristics of orthodontic wires and bracket slots.

    Science.gov (United States)

    Dolci, Gabriel Schmidt; Spohr, Ana Maria; Zimmer, Eduardo Rigon; Marchioro, Ernani Menezes

    2013-01-01

    The purpose of this study was to evaluate the dimensions and surface characteristics of orthodontic wires and bracket slots of different commercial brands. Thirty metallic brackets (0.022 x 0.028-in and 0.022 x 0.030-in) were divided into three groups: DYN/3M group = Dyna-Lock, 3M/Unitek (stainless steel, or SS); STD/MO group = Slim Morelli (SS); and Ni-Free/MO group = Slim Morelli (Ni-Free). The stainless steel wires (0.019 x 0.025-in) were divided into two groups: MO group = Morelli; and 3M group = 3M/Unitek. The bracket and wire measurements were done by two methods: (a) Surface Electron Microscopy (SEM), and (b) Profile Projection. The surface analysis was done qualitatively, based on SEM images and/or by a rugosimeter. The quantitative results were analyzed by ANOVA with Tukey's test (p wires, groups showed statistically different mean heights. It was concluded that wires and brackets slots can present altered dimensions, which might directly and unintentionally affect the planned tooth movement.

  3. Assessment of the dimensions and surface characteristics of orthodontic wires and bracket slots

    Directory of Open Access Journals (Sweden)

    Gabriel Schmidt Dolci

    2013-04-01

    Full Text Available OBJECTIVE: The purpose of this study was to evaluate the dimensions and surface characteristics of orthodontic wires and bracket slots of different commercial brands. METHODS: Thirty metallic brackets (0.022 x 0.028-in and 0.022 x 0.030-in were divided in three groups: DYN/3M group = Dyna-Lock, 3M/Unitek (stainless steel, or SS; STD/MO group = Slim Morelli (SS; and Ni-Free/MO group = Slim Morelli (Ni-Free. The stainless steel wires (0.019 x 0.025in were divided into two groups: MO group = Morelli; and 3M group = 3M/Unitek. The bracket and wire measurements were done by two methods: (a Surface Electron Microscopy (SEM, and (b Profile projection. The surface analysis was done qualitatively, based on SEM images and/or by a rugosimeter. The quantitative results were analyzed by ANOVA with Tukey's test (p < 0.05 and Student's t test. RESULTS: A significant difference in the dimensions of slots was observed, and the NiFree/MO group showed the greatest changes when compared to the other groups. The analysis of surface topography of the brackets indicated greater homogeneity of the metallic matrix for DYN/3M and STD/MO groups. As for the dimensions of the wires, groups showed statistically different mean heights. CONCLUSIONS: It was concluded that wires and brackets slots can present altered dimensions, which might directly and unintentionally affect the planned tooth movement.

  4. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  5. The effect of electric spot-welding on the mechanical properties of different orthodontic wire alloys

    OpenAIRE

    Leonard Euler Andrade Gomes Nascimento; Rogério Lacerda dos Santos; Matheus Melo Pithon; Mônica Tirre de Souza Araújo; Matilde Gonçalves Nojima; Lincoln Issamu Nojima

    2012-01-01

    The aim of this study was to test the hypothesis that there is a direct relationship between surface structure and tensile strength of orthodontic alloys submitted to different levels of welding current. Three types of alloys were assessed. One hundred and eight cross-sectional test specimens ("X") were made, 18 for each wire combination, and divided into 6 groups: SS (steel-steel); SN (steel-NiTi); SB (steel-Beta-Ti); NN (NiTi-NiTi); NB (NiTi-Beta-Ti) and BB (Beta-Ti-Beta-Ti), submitted to 6...

  6. Estimation of changes in nickel and chromium content in nickel-titanium and stainless steel orthodontic wires used during orthodontic treatment: An analytical and scanning electron microscopic study

    Directory of Open Access Journals (Sweden)

    Vandana Kararia

    2015-01-01

    Full Text Available Introduction: The biocompatibility of orthodontic dental alloys has been investigated over the past 20 years, but the results have been inconclusive. The study compares standard 3 M Unitek nickel-titanium (NiTi and stainless steel archwires with locally available JJ orthodontics wires. Scanning electron microscope (SEM study of surface changes and complexometric titration to study compositional change was performed. Materials and Methods: Ten archwires each of group 1-3 M 0.016" NiTi, group 2-JJ 0.016" NiTi, group 3-3 M 0.019" FNx010.025" SS and group 4-JJ SS contributed a 10 mm piece of wire for analysis prior to insertion in the patient and 6 weeks post insertion. SEM images were recorded at Χ2000, Χ4000 and Χ6000 magnification. The same samples were subjected to complexiometric titration using ethylenediaminetetraacetic acid to gauge the actual change in the composition. Observations and Results: The SEM images of all the archwires showed marked changes with deep scratches and grooves and dark pitting corrosion areas post intraoral use. 3M wires showed an uniform criss-cross pattern in as received wires indicating a coating which was absent after intraoral use. There was a significant release of Nickel and Chromium from both group 3 and 4. Group 2 wires released ions significantly more than group 1 (P = 0.0. Conclusion: Extensive and stringent trials are required before certifying any product to be used in Orthodontics.

  7. Estimation of changes in nickel and chromium content in nickel-titanium and stainless steel orthodontic wires used during orthodontic treatment: An analytical and scanning electron microscopic study.

    Science.gov (United States)

    Kararia, Vandana; Jain, Pradeep; Chaudhary, Seema; Kararia, Nitin

    2015-01-01

    The biocompatibility of orthodontic dental alloys has been investigated over the past 20 years, but the results have been inconclusive. The study compares standard 3 M Unitek nickel-titanium (NiTi) and stainless steel archwires with locally available JJ orthodontics wires. Scanning electron microscope (SEM) study of surface changes and complexometric titration to study compositional change was performed. Ten archwires each of group 1-3 M 0.016" NiTi, group 2-JJ 0.016" NiTi, group 3-3 M 0.019" *0.025" SS and group 4-JJ SS contributed a 10 mm piece of wire for analysis prior to insertion in the patient and 6 weeks post insertion. SEM images were recorded at ×2000, ×4000 and ×6000 magnification. The same samples were subjected to complexiometric titration using ethylenediaminetetraacetic acid to gauge the actual change in the composition. The SEM images of all the archwires showed marked changes with deep scratches and grooves and dark pitting corrosion areas post intraoral use. 3M wires showed an uniform criss-cross pattern in as received wires indicating a coating which was absent after intraoral use. There was a significant release of Nickel and Chromium from both group 3 and 4. Group 2 wires released ions significantly more than group 1 (P = 0.0). Extensive and stringent trials are required before certifying any product to be used in Orthodontics.

  8. Mechanical properties of different esthetic and conventional orthodontic wires in bending tests : An in vitro study.

    Science.gov (United States)

    Alobeid, Ahmad; Dirk, Cornelius; Reimann, Susanne; El-Bialy, Tarek; Jäger, Andreas; Bourauel, Christoph

    2017-05-01

    The goal of this study was to determine the mechanical properties of different esthetic and conventional orthodontic wires in three-point and four-point bending tests, and in a biomechanical test employing three bracket systems. The behavior of round wires with a diameter of 0.46 mm (0.018″) were investigated: uncoated nickel titanium (NiTi) wires, surface modified NiTi wires; FLI ® Orthonol Wire ® and glass fiber reinforced plastic wires. The biomechanical bending test was performed using the following bracket types: metal brackets (Discovery ® , Dentaurum), ceramic brackets (Fascination ® , Dentaurum), and plastic brackets (Elegance ® , Dentaurum). All bending tests were performed in the orthodontic measurement and simulation system (OMSS) at a temperature of 37 °C. The classical three-point bending test was performed according to an ISO standard (DIN EN ISO 15841:2007) using the appropriate thrust die and supports with a predefined span of 10 mm. In the other tests the supports or interbracket distances were chosen such that the free wire length was also 10 mm (5 mm between adjacent brackets). All wires were loaded centrally to a maximum of 3.1 and 3.3 mm in the biomechanical test, respectively. The force was measured upon unloading with a loading velocity of 1 mm/min. Each specimen was loaded twice and a total of 10 specimens tested for each product. Weighted means and the error of the weighted mean were calculated for each product. Fiber reinforced wires displayed lowest forces in three-point bending with values of 0.4 N at a displacement of 1 mm and 0.7 N at a 2 mm displacement. In four-point bending the forces were 0.9 N and 1.4 N, respectively, at the same displacements. Almost all of the translucent wires showed fracture upon bending at displacements greater than 3 mm, independent of the bending test and bracket type. The different investigated NiTi wires, surface modified or conventional, only showed minor variation, e.g., 2.2 N for

  9. Clinical effectiveness of 2 orthodontic retainer wires on mandibular arch retention.

    Science.gov (United States)

    Gunay, Firdevs; Oz, Abdullah Alper

    2018-02-01

    The aim of this study was to evaluate and compare the clinical success of 2 lingual retainer wires. The 120 patients included in the study were divided into 2 groups randomly. In group 1, 0.0175-in 6-strand stainless steel wire (Ortho Technology, Lutz, Fla) was used, the lingual retainers were fabricated on plaster models, and a silicon transfer key was used. In group 2, 0.0195-in dead-soft coaxial wire (Respond; Ormco, Orange, Calif) was used, and the lingual retainers were fabricated directly in the patient's mandibular arch without a study model. Pretreatment, posttreatment, and posttreatment 3-month, 6-month, 9-month, and 12-month 3-dimensional orthodontic models were evaluated. Failure rates, mandibular arch irregularity values, intercanine distances, and arch lengths were compared. The clinical bond failure rates were 13.2% for the 0.0175-in 6-strand stainless steel wire and 18.9% for the 0.0195-in dead-soft wire. The difference in bond failures between the 2 groups was not statistically significant. There was a statistically significant increase in mandibular arch irregularity in both groups during the 12-month follow-up. However, the increase was significantly higher in the second group than in the first one. Furthermore, the intercanine distance decreased over time in the second group. Our findings regarding mandibular arch measurements indicate that fabrication of lingual retainers can be more safely accomplished with 0.0175-in 6-strand stainless steel wire than with 0.0195-in dead-soft coaxial wire. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.

  10. Wire Roughness Assessment of 0.016'' × 0.022'' the Technique Lingual Orthodontics.

    Science.gov (United States)

    Facchini, Fátima Mm; Filho, Mario Vedovello; Vedovello, Silvia As; Cotrim, Flávio A; Cotrim-Ferreira, Andrຟa; Tubel, Carlos Am

    2017-04-01

    To evaluate the difference in surface roughness of stainless steel archwires of different commercial brands used in lingual orthodontics. Precontoured arches measuring 0.016'' × 0.022'' were selected of the following brands: Tecnident, Adenta, G&H, Highland Metals Inc., Ormco, Incognito, and Ebraces. Quantitative evaluation of the surface roughness of archwires was performed by means of an atomic force microscope in contact mode. Three surface readouts were taken of each sample, analyzing areas of 20 × 20 μm. Each scan of the samples produced a readout of 512 lines, generating three-dimensional images of the wires. The analysis of variance statistical test was applied to prove significant variables (p > 0.05), with H 0 being rejected and H 1 accepted. The Incognito brand showed the lowest surface roughness. The archwires of brands Adenta, Tecnident, Highland, and Ormco showed similar values among them, and all close to these obtained by the Incognito brand. The archwires of the Ebraces brand showed the highest surface roughness, with values being close to those of the G&H Brand. There was a statistical difference in surface roughness of orthodontic archwires among the brands studied. Companies should pay attention to the quality control of their materials, as these may directly affect the quality of orthodontic treatment.

  11. Evaluation of deflection forces of orthodontic wires with different ligation types

    Directory of Open Access Journals (Sweden)

    José Fernando Castanha HENRIQUES

    2017-07-01

    Full Text Available Abstract The aim of this study was to evaluate deflection forces of orthodontic wires of different alloys engaged into conventional brackets using several ligation types. Stainless steel, conventional superelastic nickel-titanium and thermally activated nickel-titanium archwires tied into conventional brackets by a ring-shaped elastomeric ligature (RSEL, a 8-shaped elastomeric ligature (8SEL and a metal ligature (ML were tested. A clinical simulation device was created especially for this study and forces were measured with an Instron Universal Testing Machine. For the testing procedure, the block representing the maxillary right central incisor was moved 0.5 and 1 mm bucco-lingually at a constant speed of 2 mm/min, and the forces released by the wires were recorded, in accordance with the ISO 15841 guidelines. In general, the RSEL showed lighter forces, while 8SEL and ML showed higher values. At the 0.5 mm deflection, the 8SEL presented the greatest force, but at the 1.0 mm deflection the ML had a statistically similar force. Based on our evaluations, to obtain lighter forces, the thermally activated nickel-titanium wire with the RSEL are recommended, while the steel wire with the 8SEL or the ML are recommended when larger forces are desired. The ML exhibited the highest force increase with increased deflections, compared with the elastomeric ligatures.

  12. Galvanic Corrosion of and Ion Release from Various Orthodontic Brackets and Wires in a Fluoride-containing Mouthwash

    Directory of Open Access Journals (Sweden)

    Soodeh Tahmasbi

    2015-09-01

    Full Text Available Background and aims. This study compared the galvanic corrosion of orthodontic wires and brackets from various man-ufacturers following exposure to a fluoride mouthwash. Materials and methods. This study was conducted on 24 lower central incisor 0.022” Roth brackets of four different commercially available brands (Dentaurum, American Orthodontics, ORJ, Shinye. These brackets along with stainless steel (SS or nickel-titanium (NiTi orthodontic wires (0.016", round were immersed in Oral-B mouthwash containing 0.05% sodium fluoride for 28 days. The electric potential (EP difference of each bracket-wire couple was measured with a Satu-rated Calomel Reference Electrode (Ag/AgCl saturated with KCl via a voltmeter. The ions released in the electrolyte weremeasured with an atomic absorption spectrometer. All the specimens were assessed under a stereomicroscope and speci-mens with corrosion were analyzed with scanning electron microscopy (SEM. Data were analyzed using ANOVA. Results. The copper ions released from specimens with NiTi wire were greater than those of samples containing SS wire. ORJ brackets released more Cu ions than other samples. The Ni ions released from Shinye brackets were significantly more than those of other specimens (P < 0.05. Corrosion rate of brackets coupled with NiTi wires was higher than that of brack-ets coupled with SS wires. Light and electron microscopic observations showed greater corrosion of ORJ brackets. Conclusion. In fluoride mouthwash, Shinye and ORJ brackets exhibited greater corrosion than Dentaurum and American Orthodontics brackets. Stainless steel brackets used with NiTi wires showed greater corrosion and thus caution is recom-mended when using them.

  13. Galvanic Corrosion of and Ion Release from Various Orthodontic Brackets and Wires in a Fluoride-containing Mouthwash.

    Science.gov (United States)

    Tahmasbi, Soodeh; Ghorbani, Mohammad; Masudrad, Mahdis

    2015-01-01

    Background and aims. This study compared the galvanic corrosion of orthodontic wires and brackets from various manufacturers following exposure to a fluoride mouthwash. Materials and methods. This study was conducted on 24 lower central incisor 0.022" Roth brackets of four different commercially available brands (Dentaurum, American Orthodontics, ORJ, Shinye). These brackets along with stainless steel (SS) or nickel-titanium (NiTi) orthodontic wires (0.016", round) were immersed in Oral-B mouthwash containing 0.05% sodium fluoride for 28 days. The electric potential (EP) difference of each bracket-wire couple was measured with a Saturated Calomel Reference Electrode (Ag/AgCl saturated with KCl) via a voltmeter. The ions released in the electrolyte weremeasured with an atomic absorption spectrometer. All the specimens were assessed under a stereomicroscope and specimens with corrosion were analyzed with scanning electron microscopy (SEM). Data were analyzed using ANOVA. Results. The copper ions released from specimens with NiTi wire were greater than those of samples containing SS wire. ORJ brackets released more Cu ions than other samples. The Ni ions released from Shinye brackets were significantly more than those of other specimens (P wires was higher than that of brackets coupled with SS wires. Light and electron microscopic observations showed greater corrosion of ORJ brackets. Conclusion. In fluoride mouthwash, Shinye and ORJ brackets exhibited greater corrosion than Dentaurum and American Orthodontics brackets. Stainless steel brackets used with NiTi wires showed greater corrosion and thus caution is recommended when using them.

  14. The effect of ZnO nanoparticle coating on the frictional resistance between orthodontic wires and ceramic brackets

    Directory of Open Access Journals (Sweden)

    Ahmad

    2016-06-01

    Full Text Available Background. Any decrease in friction between orthodontic wire and bracket can accelerate tooth movement in the sliding technique and result in better control of anchorage. This study was carried out to evaluate frictional forces by coating orthodontic wires and porcelain brackets with zinc oxide nanoparticles (ZnO. Methods. In this in vitro study, we evaluated a combination of 120 samples of 0.019×0.025 stainless steel (SS orthodontic wires and 22 mil system edgewise porcelain brackets with and without spherical zinc oxide nanoparticles. Spherical ZnO nanoparticles were deposited on wires and brackets by immersing them in ethanol solution and SEM (scanning electron microscope evaluation confirmed the presence of the ZnO coating. The frictional forces were calculated between the wires and brackets in four groups: group ZZ (coated wire and bracket, group OO (uncoated wire and bracket, group ZO (coated wire and uncoated bracket and group OZ (uncoated wire and coated bracket. Kolmogorov-Smirnov, Mann-Whitney and Kruskal-Wallis tests were used for data analysis. Results. The frictional force in ZZ (3.07±0.4 N was the highest (P <0.05, and OZ (2.18±0.5 N had the lowest amount of friction (P <0.05 among the groups. There was no significant difference in frictional forces between the ZO and OO groups (2.65±0.2 and 2.70±0.2 N, respectively. Conclusion. Coating of porcelain bracket surfaces with ZnO nanoparticles can decrease friction in the sliding technique, and wire coating combined with bracket coating is not recommended due to its effect on friction.

  15. Joining characteristics of titanium-based orthodontic wires connected by laser and electrical welding methods.

    Science.gov (United States)

    Matsunaga, Junko; Watanabe, Ikuya; Nakao, Noriko; Watanabe, Etsuko; Elshahawy, Waleed; Yoshida, Noriaki

    2015-01-01

    This study investigated the possibility of electrical and laser welding to connect titanium-based alloy (beta-titanium and nickel-titanium) wires and stainless-steel or cobalt-chromium alloy wires for fabrication of combination arch-wires. Four kinds of straight orthodontic rectangular wires (0.017 × 0.025 inch) were used: stainless-steel (S-S), cobalt-chromium (Co-Cr), beta-titanium alloy (β-Ti), and nickel-titanium (Ni-Ti). Homogeneous and heterogeneous end-to-end joints (15 mm long each) were made by electrical welding and laser welding. Non-welded wires (30 mm long) were also used as a control. Maximum loads at fracture (N) and elongation (%) were measured by conducting tensile test. The data (n = 10) were statistically analyzed using analysis of variance/Tukey test (P < 0.05).The S-S/S-S and Co-Cr/Co-Cr specimens showed significantly higher values of the maximum load (ML) at fracture and elongation (EL) than those of the Ni-Ti/Ni-Ti and β-Ti/β-Ti specimens for electrical welding and those of the S-S/S-S and Co-Cr/Co-Cr specimens welded by laser. On the other hand, the laser-welded Ni-Ti/Ni-Ti and β-Ti/β-Ti specimens exhibited higher values of the ML and EL compared to those of the corresponding specimens welded by electrical method. In the heterogeneously welded combinations, the electrically welded Ni-Ti/S-S, β-Ti/S-S and β-Ti/Co-Cr specimens showed significantly (P < 0.05) higher ML and EL than those of the corresponding specimens welded by laser. Electrical welding exhibited the higher values of maximum load at fracture and elongation for heterogeneously welded combinations than laser-welding.

  16. Mechanical properties of orthodontic wires derived by instrumented indentation testing (IIT) according to ISO 14577.

    Science.gov (United States)

    Zinelis, Spiros; Al Jabbari, Youssef S; Gaintantzopoulou, Marianna; Eliades, George; Eliades, Theodore

    2015-01-01

    The aim of this study was the characterization of mechanical properties of representative types of orthodontic wires employing instrumented indentation testing (IIT) according to ISO 14577. Segments were cut from ten wires. The first six are made of stainless steel (SS), two are made of Ni-Ti, and the last two are made of titanium molybdenum alloys (TMA). Then, the Martens hardness (HM), the Vickers hardness (HVIT) based on indentation hardness (H IT), the indentation modulus (E IT), the ratio of elastic to total work (η IT), and the traditional Vickers hardness (HV1) were measured by IIT. The results were statistically analyzed by one-way ANOVA followed by Student-Newman-Keuls (SNK) test at a = 0.05. The HVIT and HV1 data were analyzed by paired t test (a = 0.05). SS wires showed the highest hardness followed by TMA and Ni-Ti alloys. However, all wires showed significantly lower HVIT compared to corresponding HV1, a finding probably appended to elastic recovery around the indentation. E IT for all wires tested was determined much lower than the nominal values of the corresponding alloys due to the implication of residual stress field at the slope of unloading curve. Elastic to total work ratio was ranged from 45.8 to 64.4 % which is higher than that expected for ductile alloys (<30 %). The products tested illustrated significant differences in their mechanical properties. Although IIT provides reliable data for hardness and elastic index of materials tested, the intense residual stress field developed during the manufacturing process significantly affects the determination of modulus of elasticity.

  17. Frictional resistance of orthodontic wires tied with 3 types of elastomeric ligatures

    Directory of Open Access Journals (Sweden)

    Amanda Carneiro da Cunha

    2011-12-01

    Full Text Available The aims of this study were to determine and compare frictional resistance obtained by low-friction and conventional elastomeric ligatures in the presence of artificial saliva, and observe whether this variable changed after 21 days. Super Slick® low-friction elastomeric ligatures and conventional ligatures of the brands TP conventional® and Unitek® were placed on standard edgewise maxillary central incisor metal brackets, slot .022" × .028" tying rectangular orthodontic wires .018" × .025". Three experimental groups were arranged according to the type of ligature and a control group in which no wires were used. The friction values obtained between the bracket/wire/ligature set were measured using a Universal Test Machine at a speed of 20 mm/minute, at two experimental time intervals: T0 - immediately after specimen fabrication; and T1 - 21 days after fabrication and immersion in artificial saliva at 37 ºC. Conventional Unitek ligatures and the low-friction ligature (Super Slick showed the lowest friction values at T0. After 21 days (T1, however, conventional Unitek ligatures presented the lowest value. All groups assessed from T0 to T1 showed a numerical reduction in friction values, suggesting that time, heat and humidity may cause elastic degradation, however this was not verified statistically (P > 0.05.

  18. The effect of residence time on the tensile properties of superelastic and thermal activated Ni-Ti orthodontic wires

    Directory of Open Access Journals (Sweden)

    Kathia Maria Fosenca de Britto

    2011-09-01

    Full Text Available Since the 1980s, different devices based on superelastic alloys have been developed to fulfill orthodontic applications. Particularly in the last decades several researches have been carried out to evaluate the mechanical behavior of Ni-Ti alloys, including their tensile, torsion and fatigue properties. However, studies regarding the dependence of elastic properties on residence time of Ni-Ti wires in the oral cavity are scarce. Such approach is essential since metallic alloys are submitted to mechanical stresses during orthodontic treatment as well as pH and temperature fluctuations. The goal of the present contribution is to provide elastic stress-strain results to guide the orthodontic choice between martensitic thermal activated and austenitic superelastic Ni-Ti alloys. From the point of view of an orthodontist, the selection of appropriate materials and the correct maintenance of the orthodontic apparatus are essential needs during clinical treatment. The present work evaluated the elastic behavior of Ni-Ti alloy wires with diameters varying from 0.014 to 0.020 inches, submitted to hysteresis tensile tests with 8% strain. Tensile tests were performed after periods of use of 1, 2 and 3 months in the oral cavity of patients submitted to orthodontic treatment. The results from the hysteresis tests allowed to exam the strain range covered by isostress lines upon loading and unloading, as well as the residual strain after unloading for both superelastic and thermal activated Ni-Ti wires. Superelastic Ni-Ti wires exhibited higher load isostress values compared to thermal activated wires. It was found that such differences in the load isostress values can increase with increasing residence time.

  19. Evaluation of tensile strength and surface topography of orthodontic wires after infection control procedures: An in vitro study.

    Science.gov (United States)

    Brindha, M; Kumaran, N Kurunji; Rajasigamani, K

    2014-07-01

    The aim of this study is to evaluate, the influence of four types of sterilization/disinfection procedures (autoclave, hot air oven, glutaraldehyde, and ultraviolet [UV] light) on the tensile strength and surface topography of three orthodontic wires (stainless steel (SS), titanium - molybdenum alloy [TMA], and cobalt chromium (CoCr)). Sample comprised of three types of 8 inches straight length segments of orthodontic wires. They were divided into three groups according to wire composition comprising of 50 samples each. Totally 50 samples of each group were then equally divided into five subgroups according to sterilization method. After sterilization and disinfection of the experimental group, surface topography was examined with scanning electron microscope (SEM) and tensile strength was tested using universal testing machine. The results of this study show that the mean ultimate tensile strength (UTS) of SS wire after four sterilization procedures were similar to the control group (1845.815 ± 142.29 MPa). The mean UTS of TMA wire increases after four sterilization procedures when compared with the control group (874.107 ± 275.939 MPa). The mean UTS of CoCr wire remains same after UV light disinfection, but increases after other three sterilization procedures when compared with the control group (1449.759 ± 156.586 MPa). SEM photographs of the present study shows gross increase in pitting roughness of the surface topography of all the three types of wires after four types of sterilization. Orthodontists who want to offer maximum safety for their patients can sterilize orthodontic wires before placement, as it does not deteriorate the tensile strength and surface roughness of the alloys.

  20. In-vitro evaluation of the material characteristics of stainless steel and beta-titanium orthodontic wires.

    Science.gov (United States)

    Verstrynge, Astrid; Van Humbeeck, Jan; Willems, Guy

    2006-10-01

    The exact composition and material properties of the metal alloys used in orthodontics are usually not identified by or even available from manufacturers. This makes meaningful comparisons between wires impossible and is unacceptable with regard to biocompatibility issues. The aim of this study was to investigate the material characteristics of contemporary stainless steel (SS) and beta-titanium (beta-Ti) wires, also known as titanium-molybdenum alloy (TMA), for comparison. Twenty-two different SS and beta-Ti wires, preferably straight wires sized 0.43 x 0.64 mm, (0.017 x 0.025 in) were tested blindly for wire dimensions, chemical compositions, bending and tensile properties, and surface characteristics. Four chemical compositions were found for the beta-Ti wires: titanium-11.5, molybdenum-6, zirconium-4.5 tin; titanium-3, aluminum-8, vanadium-6, chromium-4, molybdenum-4, zirconium; titanium-6, aluminum-4, vanadium, and titanium-45 niobium. The SS wires were of AISI type 304 or the nickel-free variant BioDur 108. All beta-Ti wires showed high surface roughness values. TMA 02 significantly had the highest E-modulus, TMA 02 and TMA 11 had the highest 0.2% yield strength, TMA 02 had the highest hardness, and TMA 12 was the most ductile wire of the beta-Ti wires. All SS wires showed high 0.2% yield strength, SS 10 significantly had the lowest E-modulus and was the most ductile wire, and SS 08 significantly showed the lowest hardness values of all SS wires. Significant differences were found between SS and beta-Ti wires, but there was little or no difference between the mechanical and physical characteristics tested in each subgroup. However, the morphological analysis clearly demonstrated that the finishing phase (annealing, polishing) of the wires' production process lacks the quality one would expect with regard to good mechanical properties and biocompatibility issues. Accurate specifications are urgently needed concerning the quality of orthodontic wires on the

  1. Effects of nanostructured, diamondlike, carbon coating and nitrocarburizing on the frictional properties and biocompatibility of orthodontic stainless steel wires.

    Science.gov (United States)

    Zhang, Hao; Guo, Shuyu; Wang, Dongyue; Zhou, Tingting; Wang, Lin; Ma, Junqing

    2016-09-01

    To evaluate and compare the effects of nanostructured, diamondlike, carbon (DLC) coating and nitrocarburizing on the frictional properties and biocompatibility of orthodontic stainless steel archwires. Plasma-enhanced chemical vapor deposition technology was applied to coat DLC films onto the surface of austenitic stainless steel wires, and salt-bath nitrocarburizing technology was employed to achieve surface hardening of other wires. Surface and cross-sectional characteristics, microhardness, modulus of elasticity, friction resistance, corrosion resistance, and cell toxicity of the modified and control wires were analyzed. The surfaces of the DLC-coated and nitrocarburized wires were both smooth and even. Compared with the control, the DLC-coated wires were increased in surface hardness 1.46 times, decreased in elastic modulus, reduced in kinetic friction coefficient by 40.71%, and decreased in corrosion current density by two orders of magnitude. The nitrocarburized wire was increased in surface hardness 2.39 times, exhibited an unchanged elastic modulus, demonstrated a decrease in maximum static friction force of 22.2%, and rose in corrosion current density two orders of magnitude. Cytotoxicity tests revealed no significant toxicity associated with the modified wires. DLC coating and nitrocarburizing significantly improved the surface hardness of the wires, reduced friction, and exhibited good biocompatibility. The nanostructured DLC coating provided excellent corrosion resistance and good elasticity, and while the nitrocarburizing technique substantially improved frictional properties, it reduced the corrosion resistance of the stainless steel wires to a lesser extent.

  2. Force delivery of NiTi orthodontic arch wire at different magnitude of deflections and temperatures: A finite element study.

    Science.gov (United States)

    Razali, M F; Mahmud, A S; Mokhtar, N

    2018-01-01

    NiTi arch wires are used widely in orthodontic treatment due to its superelastic and biocompatibility properties. In brackets configuration, the force released from the arch wire is influenced by the sliding resistances developed on the arch wire-bracket contact. This study investigated the evolution of the forces released by a rectangular NiTi arch wire towards possible intraoral temperature and deflection changes. A three dimensional finite element model was developed to measure the force-deflection behavior of superelastic arch wire. Finite element analysis was used to distinguish the martensite fraction and phase state of arch wire microstructure in relation to the magnitude of wire deflection. The predicted tensile and bending results from the numerical model showed a good agreement with the experimental results. As contact developed between the wire and bracket, binding influenced the force-deflection curve by changing the martensitic transformation plateau into a slope. The arch wire recovered from greater magnitude of deflection released lower force than one recovered from smaller deflection. In contrast, it was observed that the plateau slope increased from 0.66N/mm to 1.1N/mm when the temperature was increased from 26°C to 46°C. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Do Mechanical and Physicochemical Properties of Orthodontic NiTi Wires Remain Stable In Vivo?

    Directory of Open Access Journals (Sweden)

    Michał Sarul

    2016-01-01

    Full Text Available Introduction and Aim. Exceptional properties of the NiTi archwires may be jeopardized by the oral cavity; thus its long-term effect on the mechanical and physiochemical properties of NiTi archwires was the aim of work. Material and Methods. Study group comprised sixty 0.016 × 0.022 NiTi archwires from the same manufacturer evaluated (group A after the first 12 weeks of orthodontic treatment. 30 mm long pieces cut off from each wire prior to insertion formed the control group B. Obeying the strict rules of randomization, all samples were subjected to microscopic evaluation and nanoindentation test. Results. Both groups displayed substantial presence of nonmetallic inclusions. Heterogeneity of the structure and its alteration after usage were found in groups B and A, respectively. Conclusions. Long-term, reliable prediction of biomechanics of NiTi wires in vivo is impossible, especially new archwires from the same vendor display different physiochemical properties. Moreover, manufacturers have to decrease contamination in the production process in order to minimize risk of mutual negative influence of nickel-titanium archwires and oral environment.

  4. The effect of electric spot-welding on the mechanical properties of different orthodontic wire alloys

    Directory of Open Access Journals (Sweden)

    Leonard Euler Andrade Gomes Nascimento

    2012-06-01

    Full Text Available The aim of this study was to test the hypothesis that there is a direct relationship between surface structure and tensile strength of orthodontic alloys submitted to different levels of welding current. Three types of alloys were assessed. One hundred and eight cross-sectional test specimens ("X" were made, 18 for each wire combination, and divided into 6 groups: SS (steel-steel; SN (steel-NiTi; SB (steel-Beta-Ti; NN (NiTi-NiTi; NB (NiTi-Beta-Ti and BB (Beta-Ti-Beta-Ti, submitted to 6 spot-welding procedures at different levels of current (Super Micro Ponto 3000. Student-Newman-Keuls, Wilcoxon signed-rank, and Kruskal-Wallis tests were used (p < .05. Statistical difference was found between SN group and all the other alloy combinations (p < .05. Initial roughness of alloys ranged from .04 to .55 Ra, with statistical difference between groups (p < .001. The hypothesis was rejected and the tensile strength of Ti-alloys combinations Steel × Beta-Ti was significantly affected by the current level at P50, which changed the properties and structure of the wires.

  5. Do Mechanical and Physicochemical Properties of Orthodontic NiTi Wires Remain Stable In Vivo?

    Science.gov (United States)

    Sarul, Michał; Rutkowska-Gorczyca, Małgorzata; Detyna, Jerzy; Zięty, Anna; Kawala, Maciej; Antoszewska-Smith, Joanna

    2016-01-01

    Introduction and Aim. Exceptional properties of the NiTi archwires may be jeopardized by the oral cavity; thus its long-term effect on the mechanical and physiochemical properties of NiTi archwires was the aim of work. Material and Methods . Study group comprised sixty 0.016 × 0.022 NiTi archwires from the same manufacturer evaluated (group A) after the first 12 weeks of orthodontic treatment. 30 mm long pieces cut off from each wire prior to insertion formed the control group B. Obeying the strict rules of randomization, all samples were subjected to microscopic evaluation and nanoindentation test. Results. Both groups displayed substantial presence of nonmetallic inclusions. Heterogeneity of the structure and its alteration after usage were found in groups B and A, respectively. Conclusions. Long-term, reliable prediction of biomechanics of NiTi wires in vivo is impossible, especially new archwires from the same vendor display different physiochemical properties. Moreover, manufacturers have to decrease contamination in the production process in order to minimize risk of mutual negative influence of nickel-titanium archwires and oral environment.

  6. A Comparison of pical Root Resorption in Incisors after Fixed Orthodontic Treatment with Standard Edgewise and Straight Wire (MBT) Method.

    Science.gov (United States)

    Zahed Zahedani, Sm; Oshagh, M; Momeni Danaei, Sh; Roeinpeikar, Smm

    2013-09-01

    One of the major outcomes of orthodontic treatment is the apical root resorption of teeth moved during the treatment. Identifying the possible risk factors, are necessary for every orthodontist. The aim of this study was to compare the rate of apical root resorption after fixed orthodontic treatment with standard edgewise and straight wire (MBT) method, and also to evaluate other factors effecting the rate of root resorption in orthodontic treatments. In this study, parallel periapical radiographs of 127 patients imaging a total of 737 individual teeth, were collected. A total of 76 patients were treated by standard edgewise and 51 patients by straight wire method. The periapical radiographs were scanned and then the percentage of root resorption was calculated by Photoshop software. The data were analyzed by Paired-Samples t-test and the Generalized Linear Model adopting the SPSS 15.0. In patients treated with straight wire method (MBT), mean root resorption was 18.26% compared to 14.82% in patients treated with standard edgewise technique (ptechnique can be attributed to more root movement in pre-adjusted MBT technique due to the brackets employed in this method.

  7. Combined effects of different heat treatments and Cu element on transformation behavior of NiTi orthodontic wires.

    Science.gov (United States)

    Seyyed Aghamiri, S M; Ahmadabadi, M Nili; Raygan, Sh

    2011-04-01

    The shape memory nickel-titanium alloy has been applied in many fields due to its unique thermal and mechanical performance. One of the successful applications of NiTi wires is in orthodontics because of its good characteristics such as low stiffness, high spring back, high stored energy, biocompatibility, superelasticity and shape memory effect. The mechanical properties of wires are paid special attention which results in achieving continuous optimal forces and eventually causing rapid tooth movement without any damage. The behavior of the alloy can be controlled by chemical composition and thermo-mechanical treatment during the manufacturing process. In this study two kinds of commercial superelastic NiTi archwires of 0.41 mm diameter were investigated: Copper NiTi and Highland Metal. The chemical analysis of both wires was estimated by energy dispersive spectroscopy (EDS). It was showed that Copper NiTi wire contained copper and chromium. The two types of wires were exposed to different heat treatment conditions at 400 and 500 °C for 10 and 60 min to compare the behavior of the wires at aged and as-received conditions. Phase transformation temperatures clarified by differential scanning calorimetry (DSC) showed B2 R B19 transformation in Highland Metal wire and B2 B19(') transformation in Copper NiTi wire. Three point bending (TPB) tests in the certain designed fixture were performed at 37 °C to evaluate the mechanical behavior of the wires. The experimental results revealed the superelastic behavior of the Highland Metal wire after 60 min ageing at 400 and 500 °C and the plastic deformation of the Copper NiTi wire after annealing due to the effect of copper in the alloy composition. Copyright © 2010 Elsevier Ltd. All rights reserved.

  8. Comparison of the initial orthodontic force systems produced by a new lingual bracket system and a straight-wire appliance.

    Science.gov (United States)

    Fuck, Lars-Michael; Wiechmann, Dirk; Drescher, Dieter

    2005-09-01

    Over the last few years, lingual appliances have become an established orthodontic treatment technique. Many studies have concentrated on various esthetic aspects, on laboratory and clinical procedures, and on patient comfort and compliance. The orthodontic force systems of these appliances, however, have not yet been investigated. The aim of this study was thus to determine the forces and moments produced by a new lingual bracket system during the leveling phase of orthodontic treatment and to compare those with the corresponding force system of a labial straight-wire appliance. The intra-oral situation of ten patients undergoing orthodontic treatment was replicated in measurement casts fitted with lingual and labial brackets. Special care was taken to precisely reproduce each patient's interbracket geometry. We measured each tooth's force systems as generated by a leveling arch inserted into the lingual and labial brackets. The resulting force systems of both appliances were found to be quite similar with regard to the magnitude of most force and moment components. Only the first molars were subjected to considerably greater single forces with the lingual appliance. Tipping moments were found to be significantly smaller with the lingual technique, whereas the rotational moments were significantly smaller with the labial appliance. All in all we noted significant differences between the two techniques only in certain areas which upon closer examination were distributed over only a few tooth types. The initial force systems produced by the new lingual bracket system proved to be comparable with those delivered by a conventional straight-wire appliance. The actual levels of forces and moments, however, were found in certain cases to be too heavy with both techniques. We therefore recommend the development of leveling wires producing considerably lighter forces and moments.

  9. Effect of heat treatment on the tensile strength of 'Elgiloy' orthodontic wire.

    Science.gov (United States)

    Philip, S M; Darvell, B W

    2016-08-01

    Elgiloy is the trade name of a cobalt-chromium-nickel superalloy that is offered for orthodontic use as wire. Despite some years of use, there is very little information in the dental literature on its mechanical properties, and especially on the effect of the hardening heat treatment (HT), that may be used after forming, on the tensile strength (TS) in relation to the four 'tempers' that are available. Straight lengths of round wire of the four available tempers, Blue, Yellow, Green and Red, were tested in direct tension at 5mm/min in air at 23°C to fracture, both as-supplied (AS) and with HT at 500°C for 5h, in air. HT was done in a high-uniformity, three-zone tube furnace in an alumina boat. The wires were then allowed to cool to room temperature in the boat, outside the furnace. The nominal (original cross-sectional area) peak stress was calculated. TS varied from 1.4 to 2.1GPa, AS, and 1.6 to 2.8GPa HT, according to temper, but with appreciable variation within tempers. Even so, the TS plot of HT vs. AS was very straight and of narrow distribution (intercept: -0.638±0.064GPa, slope: 1.575±0.036, r(2): 0.994918, n=12, F=1957.7, p∼8×10(-13)). The strengthening due to HT was highly regular and TS can be reliably predicted on the basis of the AS value, but this of course cannot be known without specific batch testing. However, the unexpectedly large variation in the AS values within tempers renders such a prediction of lower reliability and usefulness in practice. Indeed, the distinction between tempers can be negligible, making selection according to application demands problematic, and differential property expectation less than certain. No such product data are provided commercially. Quality control is not as tight as might be expected. The implications for treatment need to be explored. Copyright © 2016 The Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

  10. Influence of different brazing and welding methods on tensile strength and microhardness of orthodontic stainless steel wire.

    Science.gov (United States)

    Bock, Jens Johannes; Fraenzel, Wolfgang; Bailly, Jacqueline; Gernhardt, Christian Ralf; Fuhrmann, Robert Andreas Werner

    2008-08-01

    The aim of this study was to compare the mechanical strength and microhardness of joints made by conventional brazing and tungsten inert gas (TIG) and laser welding. A standardized end-to-end joint configuration of the orthodontic wire material in spring hard quality was used. The joints were made using five different methods: brazing (soldering > 450 degrees C) with universal silver solder, two TIG, and two laser welders. Laser parameters and welding conditions were used according to the manufacturers' guidance. The tensile strengths were measured with a universal testing machine (Zwick 005). The microhardness measurements were carried out with a hardness tester (Zwick 3202). Data were analysed using one-way analysis of variance and Bonferroni's post hoc correction (P tensile strength (198 +/- 146 MPa). Significant differences (P tensile strength (369-520 MPa) compared with TIG welding. Significant differences (P < 0.001) were found between the original orthodontic wire and the mean microhardness at the centre of the welded area. The mean microhardness differed significantly between brazing (1.99 GPa), TIG (2.22-2.39 GPa) and laser welding (2.21-2.68 GPa). For orthodontic purposes, laser and TIG welding are solder-free alternatives to joining metal. TIG welding with a lower investment cost is comparable with laser welding. However, while expensive, the laser technique is a sophisticated and simple method.

  11. Effect of Punica granatum L. Flower Water Extract on Five Common Oral Bacteria and Bacterial Biofilm Formation on Orthodontic Wire

    Science.gov (United States)

    VAHID DASTJERDI, Elahe; ABDOLAZIMI, Zahra; GHAZANFARIAN, Marzieh; AMDJADI, Parisa; KAMALINEJAD, Mohammad; MAHBOUBI, Arash

    2014-01-01

    Background: Use of herbal extracts and essences as natural antibacterial compounds has become increasingly popular for the control of oral infectious diseases. Therefore, finding natural antimicrobial products with the lowest side effects seems necessary. The present study sought to assess the effect of Punica granatum L. water extract on five oral bacteria and bacterial biofilm formation on orthodontic wire. Methods: Antibacterial property of P. granatum L. water extract was primarily evaluated in brain heart infusion agar medium using well-plate method. The minimum inhibitory concentration and minimum bactericidal concentration were determined by macro-dilution method. The inhibitory effect on orthodontic wire bacterial biofilm formation was evaluated using viable cell count in biofilm medium. At the final phase, samples were fixed and analyzed by Scanning Electron Microscopy. Results: The growth inhibition zone diameter was proportional to the extract concentration. The water extract demonstrated the maximum antibacterial effect on Streptococcus sanguinis ATCC 10556 with a minimum inhibitory concentration of 6.25 mg/ml and maximum bactericidal effect on S. sanguinis ATCC 10556 and S. sobrinus ATCC 27607 with minimum bactericidal concentration of 25 mg/ml. The water extract decreased bacterial biofilm formation by S. sanguinis, S. sobrinus, S. salivarius, S. mutans ATCC 35608 and E. faecalis CIP 55142 by 93.7–100%, 40.6–99.9%, 85.2–86.5%, 66.4–84.4% and 35.5–56.3% respectively. Conclusion: Punica granatum L. water extract had significant antibacterial properties against 5 oral bacteria and prevented orthodontic wire bacterial biofilm formation. However, further investigations are required to generalize these results to the clinical setting. PMID:26171362

  12. Effect of Punica granatum L. Flower Water Extract on Five Common Oral Bacteria and Bacterial Biofilm Formation on Orthodontic Wire.

    Science.gov (United States)

    Vahid Dastjerdi, Elahe; Abdolazimi, Zahra; Ghazanfarian, Marzieh; Amdjadi, Parisa; Kamalinejad, Mohammad; Mahboubi, Arash

    2014-12-01

    Use of herbal extracts and essences as natural antibacterial compounds has become increasingly popular for the control of oral infectious diseases. Therefore, finding natural antimicrobial products with the lowest side effects seems necessary. The present study sought to assess the effect of Punica granatum L. water extract on five oral bacteria and bacterial biofilm formation on orthodontic wire. Antibacterial property of P. granatum L. water extract was primarily evaluated in brain heart infusion agar medium using well-plate method. The minimum inhibitory concentration and minimum bactericidal concentration were determined by macro-dilution method. The inhibitory effect on orthodontic wire bacterial biofilm formation was evaluated using viable cell count in biofilm medium. At the final phase, samples were fixed and analyzed by Scanning Electron Microscopy. The growth inhibition zone diameter was proportional to the extract concentration. The water extract demonstrated the maximum antibacterial effect on Streptococcus sanguinis ATCC 10556 with a minimum inhibitory concentration of 6.25 mg/ml and maximum bactericidal effect on S. sanguinis ATCC 10556 and S. sobrinus ATCC 27607 with minimum bactericidal concentration of 25 mg/ml. The water extract decreased bacterial biofilm formation by S. sanguinis, S. sobrinus, S. salivarius, S. mutans ATCC 35608 and E. faecalis CIP 55142 by 93.7-100%, 40.6-99.9%, 85.2-86.5%, 66.4-84.4% and 35.5-56.3% respectively. Punica granatum L. water extract had significant antibacterial properties against 5 oral bacteria and prevented orthodontic wire bacterial biofilm formation. However, further investigations are required to generalize these results to the clinical setting.

  13. Effect of time and pH on physical-chemical properties of orthodontic brackets and wires.

    Science.gov (United States)

    Dos Santos, Aretha Aliny Ramos; Pithon, Matheus Melo; Carlo, Fabíola Galbiatti Carvalho; Carlo, Hugo Lemes; de Lima, Bruno Alessandro Silva Guedes; Dos Passos, Tibério Andrade; Lacerda-Santos, Rogério

    2015-03-01

    To test the hypothesis that treatment time, debris/biofilm, and oral pH have an influence on the physical-chemical properties of orthodontic brackets and arch wires. One hundred twenty metal brackets were evaluated. They were divided into four groups (n  =  30) according to treatment time: group C (control) and groups T12, T24, and T36 (brackets recovered after 12, 24, and 36 months of treatment, respectively). Rectangular stainless-steel arch wires that remained in the oral cavity for 12 to 24 months were also analyzed. Dimensional stability, surface morphology, composition of brackets, resistance to sliding of the bracket-wire set, surface roughness of wires, and oral pH were analyzed. One-way analysis of variance, followed by a Tukey multiple comparisons test, was used for statistical analysis (P wires as a function of time of clinical use after 36 months. Oral pH showed a significant difference between group T36 and its control (P  =  .014). The hypothesis was partially accepted: treatment time and biofilm and debris accumulation in bracket slots were shown to have more influence on the degradation process and frictional force of these devices than did oral pH.

  14. Comparison of friction forces between stainless orthodontic steel brackets and TiNi wires in wet and dry conditions.

    Science.gov (United States)

    Phukaoluan, Aphinan; Khantachawana, Anak; Kaewtatip, Pongpan; Dechkunakorn, Surachai; Anuwongnukroh, Niwat; Santiwong, Peerapong; Kajornchaiyakul, Julathep

    2017-03-01

    In sliding mechanics, frictional force is an important counter-balancing element to orthodontic tooth movement, which must be controlled in order to allow application of light continuous forces. The purpose of this study was to compare the frictional forces between a stainless steel bracket and five different wire alloys under dry and wet (artificial saliva) conditions. TiNi, TiNiCu, TiNiCo, commercial wires A and commercial wires B with equal dimensions of 0.016×0.022'' were tested in this experiment. The stainless steel bracket was chosen with a slot dimension of 0.022''. Micro-hardness of the wires was measured by the Vickers micro-hardness test. Surface topography of wires was measured by an optical microscope and quantified using surface roughness testing. Static and kinetic friction forces were measured using a custom-designed apparatus, with a 3-mm stretch of wire alloy at a crosshead speed of 1mm/min. The static and dynamic frictions in the wet condition tended to decrease more slowly than those in the dry condition. Therefore, the friction of TiNiCu and commercial wires B would increase. Moreover, these results were associated with scarred surfaces, i.e. the increase in friction would result in a larger bracket microfracture. From the results, it is seen that copper addition resulted in an increase in friction under both wet and dry conditions. However, the friction in the wet condition was less than that in dry condition due to the lubricating effect of artificial saliva. Copyright © 2016 CEO. Published by Elsevier Masson SAS. All rights reserved.

  15. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.

    1985-01-01

    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  16. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)

    student

    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  17. Characterization of Esthetic Orthodontic Wires Made from Glass-Fiber-Reinforced Thermoplastic Containing High-Strength, Small-Diameter Glass Fibers

    Directory of Open Access Journals (Sweden)

    Yasuhiro Tanimoto

    2018-01-01

    Full Text Available In this work, we investigated the properties of a glass-fiber-reinforced thermoplastic (GFRTP composed of small-diameter (ϕ = 5 μm, high-strength glass (T-glass fibers and polycarbonate for esthetic orthodontic wires formed using pultrusion. After fabricating such GFRTP round wires, the effects of varying fiber diameter (5 to 13 mm on the mechanical properties, durabilities, and color stabilities were evaluated. The results showed that the mechanical properties of GFRTPs tend to increase with decreasing fiber diameter. Additionally, it was confirmed that the present GFRTP wires containing T-glass fibers have better flexural properties than previously reported GFRTP wires containing E-glass fibers. Meanwhile, thermocycling did not significantly affect the flexural properties of the GFRTP wires. Furthermore, the GFRTP wires showed color changes lower than the acceptable threshold level for color differences on immersion in coffee. From these results obtained in the present work, the GFRTP wires containing high-strength glass fibers have excellent properties for orthodontic applications. Our findings suggest that the GFRTPs might be applied to all phases of orthodontic treatment because their properties can be tuned by changing the fiber properties such as fiber type and diameter.

  18. Comparison of three different orthodontic wires for bonded lingual retainer fabrication

    Science.gov (United States)

    Uysal, Tancan; Gul, Nisa; Alan, Melike Busra; Ramoglu, Sabri Ilhan

    2012-01-01

    Objective We evaluated the detachment force, amount of deformation, fracture mode, and pull-out force of 3 different wires used for bonded lingual retainer fabrication. Methods We tested 0.0215-inch five-stranded wire (PentaOne, Masel; group I), 0.016 × 0.022-inch dead-soft eight-braided wire (Bond-A-Braid, Reliance; group II), and 0.0195-inch dead-soft coaxial wire (Respond, Ormco; group III). To test detachment force, deformation, and fracture mode, we embedded 94 lower incisor teeth in acrylic blocks in pairs. Retainer wires were bonded to the teeth and vertically directed force was applied to the wire. To test pull-out force, wires were embedded in composite that was placed in a hole at the center of an acrylic block. Tensile force was applied along the long axis of the wire. Results Detachment force and mode of fracture were not different between groups. Deformation was significantly higher in groups II and III than in group I (p wires, but greater deformations were seen in dead-soft wires. Wire pull-out force was significantly higher for five-stranded coaxial wire than for the other wires tested. Five-stranded coaxial wires are suggested for use in bonded lingual retainers. PMID:23112930

  19. Effect of Different Types of Toothpaste on the Frictional Resistance Between Orthodontic Stainless Steel Brackets and Wires

    Science.gov (United States)

    Hosseinzadeh Nik, Tahereh; Hooshmand, Tabassom

    2017-01-01

    Objectives: The purpose of this study was to investigate the effect of different types of toothpaste on the frictional resistance between stainless steel brackets and archwires. Materials and Methods: Ninety stainless steel orthodontic brackets with stainless steel wires were bonded to bovine teeth and were divided into 6 groups for application of the following toothpastes: Colgate® Total® Advanced Whitening, Colgate® Total® Pro Gum Health, Colgate® Anticavity, Ortho.Kin®, and Sunstar GUM® Ortho toothpastes. No toothpaste was applied in the control group. Each group was brushed by a brushing machine with the use of the designated solution for 4.5 minutes. The frictional force was measured in a universal testing machine with a crosshead speed of 10 mm/minute over a 5-mm archwire. Data were analyzed using one-way analysis of variance (ANOVA) at the 0.05 significance level. Results: The frictional resistance values of Ortho.Kin® and GUM® Ortho toothpastes and the control group were not significantly different (P>0.05). However, there were significant differences between the frictional resistance values of Colgate® Total® Pro Gum Health and Colgate® Anticavity toothpastes with that of the control group (Porthodontic toothpastes did not increase the frictional resistance between the orthodontic stainless steel brackets and wires. PMID:29296113

  20. Comparison of frictional forces between aesthetic orthodontic coated wires and self-ligation brackets.

    Science.gov (United States)

    Kim, Yunmi; Cha, Jung-Yul; Hwang, Chung-Ju; Yu, Hyung Seog; Tahk, Seon Gun

    2014-07-01

    The purpose of this study was to evaluate the clinical efficacy of polymer- and rhodium-coated wires compared to uncoated wires by measuring the frictional forces using self-ligation brackets. 0.016-inch nickel titanium (NiTi) wires and 0.017 × 0.025-inch stainless steel (SS) wires were used, and the angulations between the brackets and wires were set to 0°, 5°, and 10°. Upper maxillary premolar brackets (Clippy-C®) with a 0.022-inch slot were selected for the study and a tensile test was performed with a crosshead speed of 5 mm/min. The maximum static frictional forces and kinetic frictional forces were recorded and compared. The maximum static frictional forces and the kinetic frictional forces of coated wires were equal to or higher than those of the uncoated wires (p forces of rhodium-coated wires were significantly higher than those of polymer-coated wires when the angulations between the brackets and wires were set to (i) 5° in the 0.016-inch NiTi wires and (ii) all angulations in the 0.017 × 0.025-inch SS wires (p kinetic frictional forces of rhodium-coated wires were higher than those of polymer-coated wires, except when the angulations were set to 0° in the 0.016-inch NiTi wires (p forces of the coated wires with regards to aesthetics were equal to or greater than those of the uncoated wires, a study under similar conditions regarding the oral cavity is needed in order to establish the clinical implications.

  1. Comparison of frictional forces between aesthetic orthodontic coated wires and self-ligation brackets

    Science.gov (United States)

    Kim, Yunmi; Cha, Jung-Yul; Hwang, Chung-Ju; Tahk, Seon Gun

    2014-01-01

    Objective The purpose of this study was to evaluate the clinical efficacy of polymer- and rhodium-coated wires compared to uncoated wires by measuring the frictional forces using self-ligation brackets. Methods 0.016-inch nickel titanium (NiTi) wires and 0.017 × 0.025-inch stainless steel (SS) wires were used, and the angulations between the brackets and wires were set to 0°, 5°, and 10°. Upper maxillary premolar brackets (Clippy-C®) with a 0.022-inch slot were selected for the study and a tensile test was performed with a crosshead speed of 5 mm/min. The maximum static frictional forces and kinetic frictional forces were recorded and compared. Results The maximum static frictional forces and the kinetic frictional forces of coated wires were equal to or higher than those of the uncoated wires (p wires were significantly higher than those of polymer-coated wires when the angulations between the brackets and wires were set to (i) 5° in the 0.016-inch NiTi wires and (ii) all angulations in the 0.017 × 0.025-inch SS wires (p wires were higher than those of polymer-coated wires, except when the angulations were set to 0° in the 0.016-inch NiTi wires (p wires with regards to aesthetics were equal to or greater than those of the uncoated wires, a study under similar conditions regarding the oral cavity is needed in order to establish the clinical implications. PMID:25133130

  2. Antiadherent and antibacterial properties of stainless steel and NiTi orthodontic wires coated with silver against Lactobacillus acidophilus--an in vitro study.

    Science.gov (United States)

    Mhaske, Arun Rameshwar; Shetty, Pradeep Chandra; Bhat, N Sham; Ramachandra, C S; Laxmikanth, S M; Nagarahalli, Kiran; Tekale, Pawankumar Dnyandeo

    2015-01-01

    The purpose of the study is to assess the antiadherent and antibacterial properties of surface-modified stainless steel and NiTi orthodontic wires with silver against Lactobacillus acidophilus. This study was done on 80 specimens of stainless steel and NiTi orthodontic wires. The specimens were divided into eight test groups. Each group consisted of 10 specimens. Groups containing uncoated wires acted as a control group for their respective experimental group containing coated wires. Surface modification of wires was carried out by the thermal vacuum evaporation method with silver. Wires were then subjected to microbiological tests for assessment of the antiadherent and antibacterial properties of silver coating against L. acidophilus. Mann-Whitney U test was used to analyze the colony-forming units (CFUs) in control and test groups; and Student's t test (two-tailed, dependent) was used to find the significance of study parameters on a continuous scale within each group. Orthodontic wires coated with silver showed an antiadherent effect against L. acidophilus compared with uncoated wires. Uncoated stainless steel and NiTi wires respectively showed 35.4 and 20.5 % increase in weight which was statistically significant (P  0.001). The groups containing surface-modified wires showed statistically significant decrease in the survival rate of L. acidophilus expressed as CFU and as log of colony count when compared to groups containing uncoated wires. It was 836.60 ± 48.97 CFU in the case of uncoated stainless steel whereas it was 220.90 ± 30.73 CFU for silver-modified stainless steel, 748.90 ± 35.64 CFU for uncoated NiTi, and 203.20 ± 41.94 CFU for surface-modified NiTi. Surface modification of orthodontic wires with silver can be used to prevent the accumulation of dental plaque and the development of dental caries during orthodontic treatment.

  3. Radiographic comparison of apical root resorption after orthodontic treatment between bidimensional and Roth straight-wire techniques.

    Science.gov (United States)

    Zawawi, Khalid H; Malki, Ghadah A

    2014-10-01

    The aim of this study was to compare the amount of root resorption after orthodontic treatment between the bidimensional and the Roth straight-wire techniques. Another objective was to compare the amount of root resorption in the whole sample studied and record the prevalence of root resorption. The sample consisted of 40 patients (age ranged between 11 and 18 years) with Angle Class II division 1 malocclusions, treated nonextraction. Twenty patients were treated with bidimensional technique and 20 with a 0.018-inch Roth straight-wire technique. Root lengths of the maxillary incisors were measured on pre- and post-treatment periapical radiographs. The results demonstrated that the bidimensional and Roth straight-wire groups showed significant root resorption after treatment, 1.11 (0.17) and 0.86 (0.05), respectively, P straight-wire groups, there was no significant difference between the mean change from pre- to post-treatment between bidimensional group (mean = 1.00 ± 1.34) and Roth straight-wire group (mean = 0.88 ± 0.86), P = 0.63. Considering the whole sample, there was no root resoprtion in 32.5% of the analysed teeth. There was only mild resorption in 56.2%, moderate in 8.8% and severe in only 2.5% of the teeth. Treatment with the bidimensional technique did not produce an increase in the amount of root resorption. The prevalence and amount of root resorption was similar between bidimensional and Roth straight-wire techniques.

  4. Effect of Different Types of Toothpaste on the Frictional Resistance between Orthodontic Stainless Steel Brackets and Wires

    Directory of Open Access Journals (Sweden)

    Tahereh Hosseinzadeh Nik

    2017-12-01

    Full Text Available Objectives: The purpose of this study was to investigate the effect of different types of toothpaste on the frictional resistance between stainless steel brackets and archwires.Materials and Methods: Ninety stainless steel orthodontic brackets with stainless steel wires were bonded to bovine teeth and were divided into 6 groups for application of the following toothpastes: Colgate® Total® Advanced Whitening, Colgate® Total® Pro Gum Health, Colgate® Anticavity, Ortho.Kin®, and Sunstar GUM® Ortho toothpastes. No toothpaste was applied in the control group. Each group was brushed by a brushing machine with the use of the designated solution for 4.5 minutes. The frictional force was measured in a universal testing machine with a crosshead speed of 10 mm/minute over a 5-mm archwire. Data were analyzed using one-way analysis of variance (ANOVA at the 0.05 significance level.Results: The frictional resistance values of Ortho.Kin® and GUM® Ortho toothpastes and the control group were not significantly different (P>0.05. However, there were significant differences between the frictional resistance values of Colgate® Total® Pro Gum Health and Colgate® Anticavity toothpastes with that of the control group (P<0.05. The highest and lowest frictional resistance values were related to Colgate® Total® Pro Gum Health toothpaste and the control group, respectively.Conclusions: Among the evaluated toothpastes, the orthodontic toothpastes did not increase the frictional resistance between the orthodontic stainless steel brackets and wires.

  5. Comparison of frictional forces between aesthetic orthodontic coated wires and self-ligation brackets

    OpenAIRE

    Kim, Yunmi; Cha, Jung-Yul; Hwang, Chung-Ju; Yu, Hyung Seog; Tahk, Seon Gun

    2014-01-01

    Objective The purpose of this study was to evaluate the clinical efficacy of polymer- and rhodium-coated wires compared to uncoated wires by measuring the frictional forces using self-ligation brackets. Methods 0.016-inch nickel titanium (NiTi) wires and 0.017 × 0.025-inch stainless steel (SS) wires were used, and the angulations between the brackets and wires were set to 0°, 5°, and 10°. Upper maxillary premolar brackets (Clippy-C®) with a 0.022-inch slot were selected for the study and a te...

  6. Improved single-strand DNA sizing accuracy in capillary electrophoresis.

    OpenAIRE

    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B

    1997-01-01

    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  7. Evaluation of the force generated by gradual deflection of orthodontic wires in conventional metallic, esthetic, and self-ligating brackets

    Directory of Open Access Journals (Sweden)

    Manoela Fávaro Francisconi

    Full Text Available ABSTRACT Objective: The purpose of this study was to evaluate the deflection forces of Nitinol orthodontic wires placed in different types of brackets: metallic, reinforced polycarbonate with metallic slots, sapphire, passive and active self-ligating, by assessing strength values variation according to gradual increase in wire diameter and deflection and comparing different combinations in the different deflections. Material and Methods: Specimens were set in a clinical simulation model and evaluated in a Universal Testing Machine (INSTRON 3342, using the ISO 15841 protocol. Data were subjected to One-way ANOVA, followed by Tukey tests (p<0.05. Results: Self-ligating brackets presented the most similar behavior to each other. For conventional brackets there was no consistent behavior for any of the deflections studied. Conclusions: Self-ligating brackets presented the most consistent and predictable results while conventional brackets, as esthetic brackets, showed very different patterns of forces. Self-ligating brackets showed higher strength in all deflections when compared with the others, in 0.020-inch wires.

  8. In vitro evaluation of the influence of velocity on sliding resistance of stainless steel arch wires in a self-ligating orthodontic bracket.

    Science.gov (United States)

    Savoldi, F; Visconti, L; Dalessandri, D; Bonetti, S; Tsoi, J K H; Matinlinna, J P; Paganelli, C

    2017-05-01

    Of the variables used by in vitro studies of resistance to sliding (RS) in orthodontics, sliding velocity (SV) of the wire is often the one farthest from its clinical counterpart. We investigated whether velocity influences the RS at values approximating the orthodontic movement. A SS self-ligating bracket with a NiTi clip was fixed onto a custom-made model. Different shaped orthodontic SS wires of four sizes and two types (round, 0.020″ and 0.022″; rectangular, 0.016″×0.022″ and 0.017″×0.025″) were tested using an Instron ® testing machine. Wires were pulled at four velocities (1×10 -2  mm/s, 1×10 -3  mm/s, 1×10 -4  mm/s, 1×10 -5  mm/s). Shapiro-Wilk test was used to evaluate the normal distribution of the data; two-way ANOVA was performed to compare means in the RS with wire characteristics and SV. Significance level was set at P<.05. RS was higher for rectangular wires, and for those with larger diameters. Lower SV was associated with lower RS, with wire type and size having an interaction effect. The RS relatively to SV can be represented as: RS ∝ α[ln(SV)]+β, where α and β are constants. At very low SV and low normal forces, SV influences the RS of SS archwires in orthodontic brackets, and the proportionality is logarithmic. Although respecting these parameters in vitro is challenging, quantitative evaluations of RS should be carried out at clinically relevant velocities if aiming at translational application in the clinical scenario. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Clinical Efficiency of Two Sequences of Orthodontic Wires to Correct Crowding of the Lower Anterior Teeth.

    Science.gov (United States)

    Serafim, Cláudia Maria de Castro; Gurgel, Júlio de Araújo; Tiago, Carollyne Mota; Tavarez, Rudys Rodolfo de Jesus; Maia Filho, Etevaldo Matos

    2015-01-01

    This study compared time to correction of mandibular anterior crowding using two arch wire sequences, one with conventional nickel-titanium (NiTi) arch wires and the other with conventional and NiTi heat-activated arch wires. Twenty-two boys and girls (mean age: 16.68 ± 2.66) with moderate crowding (3-6 mm) were assigned randomly to one of two groups and followed up for five months (six assessments) when arch wires were changed. Time to crowding correction was analyzed statistically using the Kaplan-Meier method. Data were collected during the five-month follow-up, and time to correction was compared between groups using the log rank test. At the end of follow-up, mandibular crowding was corrected in 100% of the cases in the group treated with the sequence that included NiTi heat-activated arch wires, whereas about 30% of those treated with NiTi arch wires were not completely corrected. There was a significant difference in time to complete treatment between groups (log rank = 5.996; p wires, alignment and leveling of mandibular anterior teeth were completed earlier than in the group treated only with conventional NiTi arch wires. Clinical trial registration is found at RBR-7g5zng.

  10. Clinical Efficiency of Two Sequences of Orthodontic Wires to Correct Crowding of the Lower Anterior Teeth

    Directory of Open Access Journals (Sweden)

    Cláudia Maria de Castro Serafim

    2015-01-01

    Full Text Available This study compared time to correction of mandibular anterior crowding using two arch wire sequences, one with conventional nickel-titanium (NiTi arch wires and the other with conventional and NiTi heat-activated arch wires. Twenty-two boys and girls (mean age: 16.68 ± 2.66 with moderate crowding (3–6 mm were assigned randomly to one of two groups and followed up for five months (six assessments when arch wires were changed. Time to crowding correction was analyzed statistically using the Kaplan-Meier method. Data were collected during the five-month follow-up, and time to correction was compared between groups using the log rank test. At the end of follow-up, mandibular crowding was corrected in 100% of the cases in the group treated with the sequence that included NiTi heat-activated arch wires, whereas about 30% of those treated with NiTi arch wires were not completely corrected. There was a significant difference in time to complete treatment between groups (log rank = 5.996; p<0.05. In the group treated with the sequence that included heat-activated wires, alignment and leveling of mandibular anterior teeth were completed earlier than in the group treated only with conventional NiTi arch wires. Clinical trial registration is found at RBR-7g5zng.

  11. A comparative evaluation of the tensile strength of silver soldered joints of stainless steel and cobalt chromium orthodontic wires with band material--an in vitro study.

    Science.gov (United States)

    Dua, R; Nandlal, B

    2004-03-01

    The present study was conducted to compare and evaluate the tensile strength of silver soldered joints of stainless steel and cobalt-chromium orthodontic wires with band material. An attempt was made to observe the effect of joint site preparation by incorporation of tack welding and increasing metal to metal surface contact area by flattening an end of the wire prior to soldering along with the regularly used round wires without tack welding. A total of 180 wire specimens were soldered to 180 band specimens. Fifteen samples according to joint site preparation were included for each of the wire groups i.e. Gloria (S.S.), Remanium (S.S.) and Remaloy (Co-Cr) wires of 0.036" in diameter. The findings of the study were suggestive that all three wires may be used for preparing silver soldered joints irrespective of the quality of the wire. However, when subjecting the wire to joint site preparation, Gloria (S.S.) wire showed less tensile strength as compared to Remanium and Remaloy.

  12. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  13. Programmable autonomous synthesis of single-stranded DNA

    Science.gov (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

    2018-02-01

    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  14. Fios ortodônticos: conhecer para otimizar a aplicação clínica Orthodontic wires: knowledge to optimize clinical application

    Directory of Open Access Journals (Sweden)

    Cátia Cardoso Abdo Quintão

    2009-12-01

    Full Text Available A grande variedade de fios ortodônticos presente no mercado pode gerar dúvidas quanto à melhor escolha para situações clínicas. Assim, o conhecimento das propriedades mecânicas dos mesmos facilita a escolha para aplicação do movimento ortodôntico na dependência da fase em que o tratamento se encontra. A evolução da tecnologia de manufatura dos fios e a elaboração de novas técnicas ortodônticas geraram a busca por uma melhor qualidade das ligas, a fim de torná-los biologicamente mais efetivos no que diz respeito aos dentes e tecidos de suporte. O presente artigo resume as principais características dos fios utilizados em Ortodontia, em relação ao histórico, propriedades mecânicas e aplicação clínica, de acordo com fases específicas de tratamento.The huge variety of orthodontic wires brands available in market might generate confusion as regard to the best choice for clinical application. Therefore mechanical properties knowledge about wires would help the professional to apply the best orthodontic technique depending on the treatment phase. The wires manufacturing evolution and the new orthodontic techniques proposed guided the market into the search for better quality alloys, in order to make them biologically more effective to teeth and support tissues. This paper aims to summarize some main characteristics of orthodontic wires related to their history, mechanical properties and clinical application as regard to individual phase of treatment.

  15. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    Science.gov (United States)

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  16. Assessment of the hardness of different orthodontic wires and brackets produced by metal injection molding and conventional methods

    Directory of Open Access Journals (Sweden)

    Shiva Alavi

    2017-01-01

    Conclusion: MIM orthodontic brackets exhibited hardness values much lower than those of SS orthodontic archwires and were more compatible with NiTi and beta-titanium archwires. A wide range of microhardness values has been reported for conventional orthodontic brackets and it should be considered that the manufacturing method might be only one of the factors affecting the mechanical properties of orthodontic brackets including hardness.

  17. Influence of fluoride-containing acidic artificial saliva on the mechanical properties of Nickel-Titanium orthodontics wires.

    Science.gov (United States)

    Lin, Jun; Han, Shujuan; Zhu, Jiajun; Wang, Xiaoxiang; Chen, Yuan; Vollrath, Oliver; Wang, Huiming; Mehl, Christian

    2012-01-01

    This study aimed to investigate the influence of fluoride and an acidic environment on the mechanical properties of NiTi orthodontic wires (NiTiW) in artificial saliva. A prospective laboratory investigation. Department of Stomatology, First Affiliated Hospital, Zhejiang University, Hangzhou, China. Commercial, round 0.016-inch NiTiW were immersed in 0% or 0.05% Natrium-Fluoride-containing artificial saliva at a pH of 4 or 6 for one or three days, respectively. NiTiW were examined with a three-point bending test, Vickers' microhardness tests and surface morphology observation (SEM). A pH of 4 increased microhardness and decreased the three-point bending strength significantly (P≤0.05), whereas immersion time and fluoride concentration had no significant influence on the microhardness or on the three-point bending strength (P>0.05). When examining the test group NiTiWs after three days of immersion at a pH of 4 the SEM revealed a rough surface morphology, a damaged oxide layer and signs of corrosion. The most influential factor for decreasing the unloading force and increasing the hardness seems to be the pH value, whereas immersion time and NaF addition do not have a major influence.

  18. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.

    1976-02-01

    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  19. Force level of small diameter nickel-titanium orthodontic wires ligated with different methods

    Directory of Open Access Journals (Sweden)

    Rodrigo Hitoshi Higa

    2017-08-01

    Full Text Available Abstract Background The aim of this study was to compare the deflection force in conventional and thermally activated nickel-titanium (NiTi wires in passive (Damon Q and active (Bioquick self-ligating brackets (SLB and in conventional brackets (CB tied by two different methods: elastomeric ligature (EL and metal ligature (ML. Methods Two wire diameters (0.014 and 0.016 in. and 10 specimens per group were used. The specimens were assembled in a clinical simulation device and tested in an Instron Universal Testing Machine, with a load cell of 10 N. For the testing procedures, the acrylic block representative of the right maxillary central incisor was palatally moved, with readings of the force at 0.5, 1, 2, and 3 mm, at a constant speed of 2 mm/min and temperature of 36.5 °C. Results The conventional NiTi released higher forces than the thermally activated NiTi archwires in large deflections. In general, the SLB showed lower forces, while the ML had higher forces, with both showing a similar force release behavior, constantly decreasing as the deflection decreased. The EL showed an irregular behavior. The active SLB showed smaller forces than passive, in large deflections. Conclusions The SLB and the ML exhibit standard force patterns during unloading, while the elastomeric ligatures exhibit a randomly distributed force release behavior.

  20. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.

    1984-01-01

    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  1. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  2. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela

    2010-01-01

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  3. A new orthodontic force system for moment control utilizing the flexibility of common wires: Evaluation of the effect of contractile force and hook length.

    Science.gov (United States)

    Lai, Wei-Jen; Midorikawa, Yoshiyuki; Kanno, Zuisei; Takemura, Hiroshi; Suga, Kazuhiro; Soga, Kohei; Ono, Takashi; Uo, Motohiro

    2018-01-01

    The application of an appropriate force system is indispensable for successful orthodontic treatments. Second-order moment control is especially important in many clinical situations, so we developed a new force system composed of a straight orthodontic wire and two crimpable hooks of different lengths to produce the second-order moment. The objective of this study was to evaluate this new force system and determine an optimum condition that could be used in clinics. We built a premolar extraction model with two teeth according to the concept of a modified orthodontic simulator. This system was activated by applying contractile force from two hooks that generated second-order moment and force. The experimental device incorporated two sensors, and forces and moments were measured along six axes. We changed the contractile force and hook length to elucidate their effects. Three types of commercial wires were tested. The second-order moment was greater on the longer hook side of the model. Vertical force balanced the difference in moments between the two teeth. Greater contractile force generated a greater second-order moment, which reached a limit of 150 g. Excessive contractile force induced more undesired reactions in the other direction. Longer hooks induced greater moment generation, reaching their limit at 10 mm in length. The system acted similar to an off-center V-bend and can be applied in clinical practice as an unconventional loop design. We suggest that this force system has the potential for second-order moment control in clinical applications. Copyright © 2017. Published by Elsevier B.V.

  4. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2003-01-01

    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  5. Analysis of the release of nickel from orthodontic wires using the dimethylglyoxime spot test : in vitro and in vivo study

    OpenAIRE

    Noriko, NAKAO; Hideki, KITAURA; Noriaki, YOSHIDA; Division of Orthodontics and Biomedical Engineering, Department of Developmental and Reconstructive Medicine, Course of Medical and Dental Sciences, Nagasaki University Graduate School of Biomedical Sciences; Division of Orthodontics and Biomedical Engineering, Department of Developmental and Reconstructive Medicine, Course of Medical and Dental Sciences, Nagasaki University Graduate School of Biomedical Sciences; Division of Orthodontics and Biomedical Engineering, Department of Developmental and Reconstructive Medicine, Course of Medical and Dental Sciences, Nagasaki University Graduate School of Biomedical Sciences

    2002-01-01

    Recently, much attention has been focused on allergic diseases thought to be caused by dental metals. Orthodontic materials contain metals that can induce metal allergies, and it is possible that metal ions are eluted from orthodontic materials by the corrosive action of saliva, electrolytes in food debris, and acids produced by bacteria. Nickel (Ni), in particular, is thought to be a typical antigen for metal allergy ; the numbers of patients with Ni allergy are increasing. In this study, we...

  6. Comparison of the Load Deflection Characteristics of Esthetic and Metal Orthodontic Wires on Ceramic Brackets using Three Point Bending Test

    Directory of Open Access Journals (Sweden)

    Umal Hiralal Doshi

    2013-01-01

    Conclusion: Steel wires showed highest strength values, requiring the incorporation of loops and folds to reduce the load/deflection. NiTi and GFRPC wires produced more deflection at low levels of force, however the esthetic wire was shown to fracture and break.

  7. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.

    OpenAIRE

    Barany, F; Boeke, J D

    1983-01-01

    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  8. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  9. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase.

    Science.gov (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias

    2017-06-02

    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi

    1990-01-01

    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  11. Effectiveness of pulsed electromagnetic field for pain caused by placement of initial orthodontic wire in female orthodontic patients: A preliminary single-blind randomized clinical trial.

    Science.gov (United States)

    Jung, Jin-Gon; Park, Jae Hyun; Kim, Sang-Cheol; Kang, Kyung-Hwa; Cho, Jin-Hyoung; Cho, Jin-Woo; Chang, Na-Young; Bay, R Curtis; Chae, Jong-Moon

    2017-11-01

    The purpose of this 2-arm parallel trial was to assess the effects of pulsed electromagnetic field (PEMF) on the reduction of pain caused by initial orthodontic tooth movement. Thirty-three female patients (mean age, 16.8 ± 3.8 years) who began orthodontic treatment using fixed appliances were examined. In the pilot study, male patients were less likely to use the PEMF device (epatchQ; Speed Dental, Seoul, Korea) and answer a survey consistently, so eligibility criteria were female patients who were periodontally and systemically healthy at the initiation of treatment and had no history of dental pain in the prior 2 weeks or who used no medications (anti-inflammatory or analgesic drugs) during the experiment period. Each patient had brackets bonded on the maxillary teeth, and a 0.014-in nickel-titanium archwire was tied with elastomeric rings. Their maxillary arches were randomly divided into left and right sides in a split-mouth design: a normal PEMF device (experimental group) was used on 1 side, and a PEMF device with an inversely inserted battery (placebo group) was used on the opposite side of the arch for 7 hours on 3 consecutive nights. A Google survey link was sent to the patients' mobile phones via text message, and they were instructed to record their current pain on the survey. The survey was sent a total of 6 times after insertion of the initial archwire at 0 (T0), 2 (T1), 6 (T2), 24 (T3), 48 (T4), and 72 (T5) hours. Patients recorded the degree of pain in resting and clenching states using a numeric rating scale (NRS) from 1 (no pain) to 10 (worst pain). PEMF devices were used after T2. Generalized linear mixed models, along with ancillary pairwise analyses, were used to model and evaluate the differences in pain reported over 72 hours. The NRS scores did not differ across the groups during the before-PEMF phase for resting (mean difference, -0.07; 95% confidence interval [CI], -0.73 to 0.59; P = 0.842) and clenching (mean difference, -0

  12. Influence of various fluoride agents on working properties and surface characteristics of uncoated, rhodium coated and nitrified nickel-titanium orthodontic wires.

    Science.gov (United States)

    Katić, Višnja; Mandić, Vilko; Ježek, Damir; Baršić, Gorana; Špalj, Stjepan

    2015-05-01

    To analyze the effect of various fluoride formulations in commercially available agents on working properties of various nickel-titanium orthodontic wires. Uncoated (NiTi), rhodium coated (RhNiTi) and nitrified (NNiTi) wires were immersed to dH2O, MiPaste, Elmex and Mirafluor for 1 h. Unloading slope characteristics (average force, bending action of the force and average plateau length) and the percentage of useable constant force during unloading were observed. Surface roughness (Ra) was measured. SEM and EDS were used for observation of the surface. NiTi had decreased loading and unloading elastic modulus (E) and yield strength (YS) after immersion to MIPaste and Mirafluor. The unloading YS decreased in the RhNiTi by the MIPaste. The loading and unloading YS of the NNiTi increased in Elmex and increased average plateau force. RhNiTi showed higher average plateau length and the percentage of useful constant force during unloading in Mirafluor and the average plateau force lowered after immersion to MIPaste. The unloading slope characteristics for NiTi were affected by all three prophylactic agents, mostly by Mirafluor, and produced significantly lower forces during both loading and unloading, similarly to the NNiTi wires. The RhNiTi had the lowest forces during both loading and unloading in MIPaste. All results were at significance; pwires lose less working force when combined with Elmex. The RhNiTi improve their working properties with Mirafluor and deteriorate when combined with MiPaste.

  13. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der

    1988-01-01

    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  14. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.

    2002-01-01

    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit...

  15. Ion assisted structural collapse of a single stranded DNA: A molecular dynamics approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Soumadwip; Dixit, Himanshu; Chakrabarti, Rajarshi, E-mail: rajarshi@chem.iitb.ac.in

    2015-09-28

    Highlights: • The dynamics of a single-stranded DNA in presence of different concentrations of Mg{sup 2+} is investigated. • The initial DNA chain collapse is characterized by the formation of non-sequentially stacked base pairs. • The DNA chain re-swells at high concentrations of Mg{sup 2+} as a consequence of overcharging. - Abstract: The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counterions. It is well known that the structural collapse of DNA is favoured in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl{sub 2}) single stranded DNA with base sequence 5′-CGCGAATTCGCG-3′ (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  16. Dynamics of RecA filaments on single-stranded DNA

    NARCIS (Netherlands)

    Van Loenhout, M.T.J.; Van der Heijden, T.; Kanaar, R.; Wyman, C.; Dekker, C.

    2009-01-01

    RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on

  17. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2001-01-01

    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  18. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP

    1996-01-01

    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  19. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  20. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket.

    Science.gov (United States)

    Pham, Hanh T; Bergoin, Max; Tijssen, Peter

    2013-03-14

    The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  1. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket

    OpenAIRE

    Pham, Hanh T.; Bergoin, Max; Tijssen, Peter

    2013-01-01

    International audience; The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  2. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.

    1983-01-01

    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  3. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B

    2006-01-01

    by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  4. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud

    2012-06-01

    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  5. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.

    1985-01-01

    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  6. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    Science.gov (United States)

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  7. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.

    1982-01-01

    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  8. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    Science.gov (United States)

    Hong, Ka Lok

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  9. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification

    OpenAIRE

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-01-01

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen...

  10. In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides

    International Nuclear Information System (INIS)

    Oppenheim, Amos B.; Rattray, Alison J.; Bubunenko, Mikhail; Thomason, Lynn C.; Court, Donald L.

    2004-01-01

    We demonstrate that the bacteriophage λ Red functions efficiently recombine linear DNA or single-strand oligonucleotides (ss-oligos) into bacteriophage λ to create specific changes in the viral genome. Point mutations, deletions, and gene replacements have been created. While recombineering with oligonucleotides, we encountered other mutations accompanying the desired point mutational change. DNA sequence analysis suggests that these unwanted mutations are mainly frameshift deletions introduced during oligonucleotide synthesis

  11. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis.

    Science.gov (United States)

    Olszewski, Marcin; Mickiewicz, Małgorzata; Kur, Józef

    2008-07-01

    The thermophilic bacterium Thermoanaerobacter tengcongensis has two single-stranded DNA-binding (SSB) proteins, designated TteSSB2 and TteSSB3. In a SSB complementation assay in Escherichia coli, only TteSSB3 took over the in vivo function of EcoSSB. We have cloned the ssb genes obtained by PCR and have developed E. coli overexpression systems. The TteSSB2 and TteSSB3 consist of 153 and 150 amino acids with a calculated molecular mass of 17.29 and 16.96 kDa, respectively. They are the smallest known bacterial SSB proteins. The homology between amino acid sequences of these proteins is 40% identity and 53% similarity. They are functional as homotetramers, with each monomer encoding one single-stranded DNA binding domain (OB-fold). In fluorescence titrations with poly(dT), both proteins bind single-stranded DNA with a binding site size of about 40 nt per homotetramer. Thermostability with half-life of about 30 s at 95 degrees C makes TteSSB3 similar to the known SSB of Thermus aquaticus (TaqSSB). The TteSSB2 was fully active even after 6 h incubation at 100 degrees C. Here, we show for the first time paralogous thermostable homotetrameric SSBs, which could be an attractive alternative for known homodimeric thermostable SSB proteins in their applications for molecular biology methods and analytical purposes.

  12. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana.

    Science.gov (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L

    2005-04-01

    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  13. Intercalation of single-strand oligonucleotides between nucleolipid anionic membranes: a neutron diffraction study.

    Science.gov (United States)

    Milani, Silvia; Berti, Debora; Dante, Silvia; Hauss, Thomas; Baglioni, Piero

    2009-04-07

    This contribution presents a neutron diffraction investigation of anionic lamellar phases composed of mixtures of 1-palmitoyl, 2-oleoyl phosphatidyl-nucleosides (POPN, where N is either adenosine or uridine), and POPC (1-palmitoyl,2-oleoyl-phosphatidyl-choline). Their behavior is studied for two different mole ratios and in the presence of nucleic acids. The samples are formed by the evaporation of liposomal dispersions prepared in water or in solutions containing single-strand oligonucleotides. Previous small angle X-ray scattering (SAXS) experiments on the system POPA/polyU (polyuridylic acid, high degree of polymerization, synthetic ribonucleic acid) proved that the insertion and ordering of the biopolymer in the phospholipid lamellae were driven by molecular recognition. In the present study, we extend the previous investigation to single-strand monodisperse oligonucleotides (50-mers). Structural details of the membranes were obtained from the analysis of the neutron diffraction scattering length density profiles. The evidence of direct and specific interactions, driven by molecular recognition between the nucleic polar heads of the nucleolipid and the single-strand nucleic acid, is strengthened by the comparison with identically charged bilayers formed by POPG/POPC. These results contribute to the understanding of the parameters governing the interactions between nucleolipid membranes and oligonucleotides, providing a novel strategy for the design of lipid-based vehicles for nucleic acids.

  14. Stretching and controlled motion of single-stranded DNA in locally heated solid-state nanopores.

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B; Aksimentiev, Aleksei

    2013-08-27

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4-8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA.

  15. Repair of ultraviolet light damage in Saccharomyces cerevisiae as studied with double- and single-stranded incoming DNAs

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, D.; Hieda, K.

    1992-01-01

    Purified double- and single-stranded DNAs of the autonomously replicating vector M13RK9-T were irradiated with ultraviolet light (UV) in vitro and introduced into competent whole cells of Saccharomyces cerevisiae. Incoming double-stranded DNA was more sensitive to UV in excision repair-deficient rad2-1 cells than in proficient repair RAD + cells, while single-stranded DNA exhibited high sensitivity in both host cells. The results indicate that in yeast there is no effective rescue of UV-incoming single-stranded DNA by excision repair or other constitutive dark repair processes

  16. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks.

    Science.gov (United States)

    Pachkowski, Brian; Nakamura, Jun

    2013-01-01

    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  17. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.

    1980-01-01

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  18. Um novo fio de aço inoxidável para aplicações ortodônticas A new stainless steel wire for orthodontic purposes

    Directory of Open Access Journals (Sweden)

    André Itman Filho

    2011-08-01

    Full Text Available OBJETIVO: desenvolver uma metodologia para fabricação de fios ortodônticos de aço inoxidável austeno-ferrítico SEW 410 Nr. 14517 por meio dos processos convencionais de laminação e trefilação. MÉTODOS: o aço austeno-ferrítico foi elaborado em um forno elétrico de indução. A qualidade dos fios foi avaliada por ensaios de tração e medidas de microdureza. A ductilidade e a manuseabilidade foram analisadas por meio da confecção de componentes ortodônticos. RESULTADOS E CONCLUSÕES: os valores encontrados mostraram que os fios de aço inoxidável austeno-ferrítico atenderam às normas BS 3507:1976 e ISO 5832-1, e apresentaram ótima ductilidade para confecção de componentes ortodônticos com dobras complexas.OBJECTIVE: To develop a method to manufacture austenitic-ferritic stainless steel orthodontic wires (SEW 410 Nr. 14517 using conventional rolling and wiredrawing processes. METHODS: Austenitic-ferritic steel was produced in an induction furnace. Traction trials and microhardness measurements were used to evaluate wire quality. Orthodontic parts were fabricated to assess ductility and malleability. RESULTS AND CONCLUSIONS: Austenitic-ferritic stainless steel wires meet the BS 3507:1976 and ISO 5832-1 norms and have excellent ductility for the fabrication of orthodontic parts with complex folds.

  19. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth

    2014-01-01

    . We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices......Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells...

  20. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela

    2015-01-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  1. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted

    2014-01-01

    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  2. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams

    2014-01-01

    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  3. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng

    2015-05-08

    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  4. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    Science.gov (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora.

    Science.gov (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E

    2003-08-01

    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  6. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Science.gov (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  7. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification.

    Science.gov (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-10-07

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  8. [Invisible orthodontics: lingual orthodontics].

    Science.gov (United States)

    Fillion, D; Leclerc, J F

    1989-01-01

    After an historical, a description of the appliance and the problems met in lingual orthodontics, the authors show that it has come to maturity. Indirect bonding is one of the main elements contributing to success. A large iconography illustrates the different stages of the laboratory and presents an overview of the clinical possibilities of lingual orthodontics.

  9. Empirical model for matching spectrophotometric reflectance of yarn windings and multispectral imaging reflectance of single strands of yarns.

    Science.gov (United States)

    Luo, Lin; Shen, Hui-Liang; Shao, Si-Jie; Xin, John

    2015-08-01

    The state-of-the-art multispectral imaging system can directly acquire the reflectance of a single strand of yarn that is impossible for traditional spectrophotometers. Instead, the spectrophotometric reflectance of a yarn winding, which is constituted by yarns wound on a background card, is regarded as the yarn reflectance in textile. While multispectral imaging systems and spectrophotometers can be separately used to acquire the reflectance of a single strand of yarn and corresponding yarn winding, the quantitative relationship between them is not yet known. In this paper, the relationship is established based on models that describe the spectral response of a spectrophotometer to a yarn winding and that of a multispectral imaging system to a single strand of yarn. The reflectance matching function from a single strand of yarn to corresponding yarn winding is derived to be a second degree polynomial function, which coefficients are the solutions of a constrained nonlinear optimization problem. Experiments on 100 pairs of samples show that the proposed approach can reduce the color difference between yarn windings and single strands of yarns from 2.449 to 1.082 CIEDE2000 units. The coefficients of the optimal reflection matching function imply that the reflectance of a yarn winding measured by a spectrophotometer consists of not only the intrinsic reflectance of yarn but also the nonignorable interreflection component between yarns.

  10. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  11. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan

    2015-01-01

    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  12. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik

    1992-04-01

    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  13. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.

    1987-01-01

    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  14. Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Gust, I.D.; Feinstone, S.M.; Purcell, R.H.; Alter, H.J.

    1980-01-01

    A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

  15. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata).

    Science.gov (United States)

    Jackson, Elliot W; Bistolas, Kalia S I; Button, Jason B; Hewson, Ian

    2016-01-01

    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates.

  16. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.

    1980-01-01

    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  17. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux

    2016-12-01

    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  18. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  19. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif

    Science.gov (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  20. Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1

    DEFF Research Database (Denmark)

    Yang, Jay; Bachrati, Csanad Z; Ou, Jiongwen

    2010-01-01

    -passage mechanism. We generated single-stranded catenanes that resemble the proposed dissolution intermediate recognized by human topoisomerase IIIalpha. We demonstrate that human topoisomerase IIIalpha is a single-stranded DNA decatenase that is specifically stimulated by the BLM-RMI1 pair. In addition, RMI1......Human topoisomerase IIIalpha is a type IA DNA topoisomerase that functions with BLM and RMI1 to resolve DNA replication and recombination intermediates. BLM, human topoisomerase IIIalpha, and RMI1 catalyze the dissolution of double Holliday junctions into noncrossover products via a strand...

  1. Mechanical properties of NiTi and CuNiTi wires used in orthodontic treatment. Part 2: Microscopic surface appraisal and metallurgical characteristics

    Directory of Open Access Journals (Sweden)

    Marco Abdo Gravina

    2014-01-01

    Full Text Available OBJECTIVE: This research aimed at comparing the qualitative chemical compositions and the surface morphology of fracture regions of eight types of Nickel (Ni Titanium (Ti conventional wires, superelastic and heat-activated (GAC, TP, Ormco, Masel, Morelli and Unitek, to the wires with addition of copper (CuNiTi 27oC and 35oC, Ormco after traction test. METHODS: The analyses were performed in a scanning electronic microscope (JEOL, model JSM-5800 LV with EDS system of microanalysis (energy dispersive spectroscopy. RESULTS : The results showed that NiTi wires presented Ni and Ti as the main elements of the alloy with minimum differences in their composition. The CuNiTi wires, however, presented Ni and Ti with a significant percentage of copper (Cu. As for surface morphology, the wires that presented the lowest wire-surface roughness were the superelastic ones by Masel and Morelli, while those that presented the greatest wire-surface roughness were the CuNiTi 27oC and 35oC ones by Ormco, due to presence of microcavity formed as a result of pulling out some particles, possibly of NiTi. 4 The fracture surfaces presented characteristics of ductile fracture, with presence of microcavities. The superelastic wires by GAC and the CuNiTi 27oC and the heat-activated ones by Unitek presented the smallest microcavities and the lowest wire-surface roughness with regard to fracture, while the CuNiTi 35oC wires presented inadequate wire-surface roughness in the fracture region. CONCLUSION: CuNiTi 35oC wires did not present better morphologic characteristics in comparison to the other wires with regard to surfaces and fracture region.

  2. Mechanical properties of NiTi and CuNiTi wires used in orthodontic treatment. Part 2: Microscopic surface appraisal and metallurgical characteristics.

    Science.gov (United States)

    Gravina, Marco Abdo; Canavarro, Cristiane; Elias, Carlos Nelson; das Graças Afonso Miranda Chaves, Maria; Brunharo, Ione Helena Vieira Portella; Quintão, Cátia Cardoso Abdo

    2014-01-01

    This research aimed at comparing the qualitative chemical compositions and the surface morphology of fracture regions of eight types of Nickel/Titanium (NiTi) conventional wires, superelastic and heat-activated (GAC, TP, Ormco, Masel, Morelli and Unitek), to the wires with addition of copper (CuNiTi 27ºC and 35ºC, Ormco) after traction test. The analyses were performed in a scanning electronic microscope (JEOL, model JSM-5800 LV) with EDS system of microanalysis (energy dispersive spectroscopy). The results showed that NiTi wires presented Ni and Ti as the main elements of the alloy with minimum differences in their composition. The CuNiTi wires, however, presented Ni and Ti with a significant percentage of copper (Cu). As for surface morphology, the wires that presented the lowest wire-surface roughness were the superelastic ones by Masel and Morelli, while those that presented the greatest wire-surface roughness were the CuNiTi 27ºC and 35ºC by Ormco, due to the presence of microcavity formed as a result of pulling out some particles, possibly of NiTi4. The fracture surfaces presented characteristics of ductile fracture, with presence of microcavities. The superelastic wires by GAC and the CuNiTi 27ºC and the heat-activated ones by Unitek presented the smallest microcavities and the lowest wire-surface roughness with regard to fracture, while the CuNiTi 35ºC wires presented inadequate wire-surface roughness in the fracture region. CuNiTi 35ºC wires did not present better morphologic characteristics in comparison to the other wires with regard to surfaces and fracture region.

  3. Mechanical properties of NiTi and CuNiTi wires used in orthodontic treatment. Part 2: Microscopic surface appraisal and metallurgical characteristics

    Science.gov (United States)

    Gravina, Marco Abdo; Canavarro, Cristiane; Elias, Carlos Nelson; Chaves, Maria das Graças Afonso Miranda; Brunharo, Ione Helena Vieira Portella; Quintão, Cátia Cardoso Abdo

    2014-01-01

    Objective This research aimed at comparing the qualitative chemical compositions and the surface morphology of fracture regions of eight types of Nickel (Ni) Titanium (Ti) conventional wires, superelastic and heat-activated (GAC, TP, Ormco, Masel, Morelli and Unitek), to the wires with addition of copper (CuNiTi 27ºC and 35ºC, Ormco) after traction test. Methods The analyses were performed in a scanning electronic microscope (JEOL, model JSM-5800 LV) with EDS system of microanalysis (energy dispersive spectroscopy). Results The results showed that NiTi wires presented Ni and Ti as the main elements of the alloy with minimum differences in their composition. The CuNiTi wires, however, presented Ni and Ti with a significant percentage of copper (Cu). As for surface morphology, the wires that presented the lowest wire-surface roughness were the superelastic ones by Masel and Morelli, while those that presented the greatest wire-surface roughness were the CuNiTi 27ºC and 35ºC ones by Ormco, due to presence of microcavity formed as a result of pulling out some particles, possibly of NiTi.4 The fracture surfaces presented characteristics of ductile fracture, with presence of microcavities. The superelastic wires by GAC and the CuNiTi 27ºC and the heat-activated ones by Unitek presented the smallest microcavities and the lowest wire-surface roughness with regard to fracture, while the CuNiTi 35ºC wires presented inadequate wire-surface roughness in the fracture region. Conclusion CuNiTi 35ºC wires did not present better morphologic characteristics in comparison to the other wires with regard to surfaces and fracture region. PMID:24713562

  4. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.

    1988-01-01

    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  5. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.

    2012-01-01

    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  6. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues

    Science.gov (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak

    2006-01-01

    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  7. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes

    Science.gov (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.

    2015-01-01

    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  8. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos

    2015-09-01

    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  9. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair

    Science.gov (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.

    2009-01-01

    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  10. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-05

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity*

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.

    2015-01-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  12. Substrate-assisted 2D DNA lattices and algorithmic lattices from single-stranded tiles.

    Science.gov (United States)

    Kim, Junghoon; Ha, Tai Hwan; Park, Sung Ha

    2015-08-07

    We present a simple route to circumvent kinetic traps which affect many types of DNA nanostructures in their self-assembly process. Using this method, a new 2D DNA lattice made up of short, single-stranded tile (SST) motifs was created. Previously, the growth of SST DNA assemblies was restricted to 1D (tubes and ribbons) or finite-sized 2D (molecular canvases). By utilizing the substrate-assisted growth method, sets of SSTs were designed as unit cells to self-assemble into periodic and aperiodic 2D lattices which continuously grow both along and orthogonal to the helical axis. Notably, large-scale (∼1 μm(2)) fully periodic 2D lattices were fabricated using a minimum of just 2 strand species. Furthermore, the ability to create 2D lattices from a few motifs enables certain rules to be encoded into these SSTs to carry out algorithmic self-assembly. A set of these motifs was designed to execute simple 1-input 1-output COPY and NOT algorithms, the space-time manifestations which were aperiodic 2D algorithmic SST lattices. The methodology presented here can be straightforwardly applied to other motifs which fall into this type of kinetic trap to create novel DNA crystals.

  13. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol

    2010-05-01

    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  14. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.

    2007-01-01

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  15. Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems.

    Science.gov (United States)

    Musumeci, Domenica; Rozza, Lucia; Merlino, Antonello; Paduano, Luigi; Marzo, Tiziano; Massai, Lara; Messori, Luigi; Montesarchio, Daniela

    2015-08-21

    The interaction of the anticancer Ru(iii) complex AziRu - in comparison with its analogue NAMI-A, currently in advanced clinical trials as an antimetastatic agent - with DNA model systems, both single stranded and duplex oligonucleotides, was investigated using a combined approach, including absorption UV-vis spectroscopy, circular dichroism (CD) and electrospray mass spectrometry (ESI-MS) techniques. UV-vis absorption spectra of the Ru complexes were recorded at different times in a pseudo-physiological solution, to monitor the ligand exchange processes in the absence and in the presence of the examined oligonucleotides. CD experiments provided information on the overall conformational changes of the DNA model systems induced by these metal complexes. UV- and CD-monitored thermal denaturation studies were performed to analyse the effects of AziRu and NAMI-A on the stability of the duplex structures. ESI-MS experiments, carried out on the oligonucleotide/metal complex mixtures under investigation, allowed us to detect the formation of stable adducts between the guanine-containing oligomers and the ruthenium complexes. These data unambiguously demonstrate that both AziRu and NAMI-A can interact with the DNA model systems. Although very similar in their structures, the two metal compounds manifest a markedly different reactivity with the examined sequences, respectively, with either a naked Ru(3+) ion or a Ru(Im)(3+) (Im = imidazole) fragment being incorporated into the oligonucleotide structure via stable linkages.

  16. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop.

    Science.gov (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S

    2009-05-01

    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  17. Biophysical characterization of the association of histones with single-stranded DNA.

    Science.gov (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier

    2017-11-01

    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong

    2008-01-01

    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  19. Effect of Conformational Entropy on the Nanomechanics of Microcantilever-Based Single-Stranded DNA Sensors

    Directory of Open Access Journals (Sweden)

    Zou-Qing Tan

    2014-09-01

    Full Text Available An entropy-controlled bending mechanism is presented to study the nanomechanics of microcantilever-based single-stranded DNA (ssDNA sensors. First; the conformational free energy of the ssDNA layer is given with an improved scaling theory of thermal blobs considering the curvature effect; and the mechanical energy of the non-biological layer is described by Zhang’s two-variable method for laminated beams. Then; an analytical model for static deflections of ssDNA microcantilevers is formulated by the principle of minimum energy. The comparisons of deflections predicted by the proposed model; Utz–Begley’s model and Hagan’s model are also examined. Numerical results show that the conformational entropy effect on microcantilever deflections cannot be ignored; especially at the conditions of high packing density or long chain systems; and the variation of deflection predicted by the proposed analytical model not only accords with that observed in the related experiments qualitatively; but also appears quantitatively closer to the experimental values than that by the preexisting models. In order to improve the sensitivity of static-mode biosensors; it should be as small as possible to reduce the substrate stiffness.

  20. In vitro selection and characterization of single stranded DNA aptamers for luteolin: A possible recognition tool.

    Science.gov (United States)

    Tuma Sabah, Jinan; Zulkifli, Razauden Mohamed; Shahir, Shafinaz; Ahmed, Farediah; Abdul Kadir, Mohammed Rafiq; Zakaria, Zarita

    2018-03-06

    Distinctive bioactivities possessed by luteolin (3', 4', 5, 7-tetrahydroxy-flavone) are advantageous for sundry practical applications. This paper reports the in vitro selection and characterization of single stranded-DNA (ssDNA) aptamers, specific for luteolin (LUT). 76-mer library containing 1015 randomized ssDNA were screened via systematic evolution of ligands by exponential enrichment (SELEX). The recovered ssDNA pool from the 8th round was amplified with unlabeled primers and cloned into PSTBlue-1 vector prior to sequencing. 22 of LUT-binding aptamer variants were further classified into one of the seven groups based on their N40 random sequence regions, wherein one representative from each group was characterized. The dissociation constant of aptamers designated as LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively with high binding affinity towards LUT. Prediction analysis of the secondary structure suggested discrete features with typical loop and stem motifs. Furthermore, LUT#3 displayed higher specificity with insignificant binding toward kaempferol and quercetin despite its structural and functional similarity compared to LUT#28 and LUT#20. Further LUT#3 can detect free luteolin within 0.2-1 mM in solution. It was suggested that LUT#3 aptamer were the most suitable for LUT recognition tool at laboratory scale based on the condition tested. Copyright © 2018. Published by Elsevier Inc.

  1. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska

    2017-12-01

    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  2. Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages.

    Science.gov (United States)

    Kodaira, K; Godson, N G; Taketo, A

    1995-01-25

    The minus origins for complementary strand DNA synthesis (-ori) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, phi K, alpha 3, and St-1 closely resemble each other in DNA structure and contain two potential secondary hairpin loops (I and II) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the -ori regions of phi K and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the phi K mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several phi K and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway.

  3. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.

    1985-01-01

    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  4. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  5. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.

    1987-01-01

    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  6. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks.

    Science.gov (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P

    2012-09-01

    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  7. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  8. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.

    1995-01-01

    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  9. Distinct circular single-stranded DNA viruses exist in different soil types.

    Science.gov (United States)

    Reavy, Brian; Swanson, Maud M; Cock, Peter J A; Dawson, Lorna; Freitag, Thomas E; Singh, Brajesh K; Torrance, Lesley; Mushegian, Arcady R; Taliansky, Michael

    2015-06-15

    The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  10. A high throughput system for the preparation of single stranded templates grown in microculture.

    Science.gov (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M

    1994-01-01

    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  11. Complex shapes self-assembled from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng

    2012-05-30

    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  12. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)

    1994-09-01

    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  13. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  14. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

    Science.gov (United States)

    Richardson, Tomas T; Harran, Omar; Murray, Heath

    2016-06-16

    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

  15. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses.

    Science.gov (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn

    2011-06-01

    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  16. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  17. Electrical conduction and photoresponses of gamma-ray-irradiated single-stranded DNA/single-walled carbon nanotube composite systems

    Energy Technology Data Exchange (ETDEWEB)

    Hong, W.; Lee, E.M.; Kim, D.W.; Lee, Cheol Eui, E-mail: rscel@korea.ac.kr

    2015-04-15

    Highlights: •Effects of gamma-ray irradiation on single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. •Barrier for thermally activated conduction in the composite systems modified by the gamma-ray irradiation. •Photoresponses reveal photoexcitation and oxygen photodesorption modified by gamma-ray irradiation. -- Abstract: Effects of gamma-ray irradiation on the electrical conductivity and photoresponse have been studied for single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. The temperature-dependent electrical conductivity of the ssDNA/SWNT composite films, well described by a fluctuation-induced tunneling model, indicated modification of the barrier for thermally activated conduction by the gamma-ray irradiation. Besides, the photoresponse measurements indicated modified photoexcited charge carrier generation and oxygen photodesorption in the composite systems due to the gamma-ray irradiation.

  18. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.

    2006-01-01

    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  19. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    Science.gov (United States)

    2014-09-30

    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  20. Selective binding and reverse transcription inhibition of single-strand poly(A) RNA by metal TMPyP complexes.

    Science.gov (United States)

    Zhou, Zhu-Xin; Gao, Feng; Chen, Xing; Tian, Xiang-Jing; Ji, Liang-Nian

    2014-10-06

    Ni-, Cu-, and Zn-TMPyP are capable of binding to single-strand poly(A) RNA with high preference and affinity and inhibiting the reverse transcription of RNA by both M-MuLV and HIV-1 reverse transcriptase. With 10 nM azidothymidine, the IC50 value of M-TMPyP could be lowered to 10(-1) μM order.

  1. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.

    2013-01-01

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  2. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.

    1977-01-01

    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  3. The Adsorption of Short Single-Stranded DNA Oligomers on Mineral Surfaces

    Science.gov (United States)

    Kopstein, M.; Sverjensky, D. A.; Hazen, R. M.; Cleaves, H. J.

    2009-12-01

    Previous studies have described feasible pathways for the synthesis of simple organic building blocks such as formaldehyde and hydrogen cyanide, and their reaction to form more complex biomolecules such as nucleotide bases, amino acids and sugars (Miller and Orgel 1974, Miller and Cleaves 2006). However, the polymerization of monomers into a useful genetic material remains problematic (Orgel 2004). Organic building blocks were unlikely to polymerize from very dilute aqueous solution in the primitive oceans. Mineral surface adsorption has been suggested as a possible mechanism for concentrating the necessary building blocks (Bernal 1951). This study focused on the adsorption behavior of single-stranded DNA homo-oligomers of adenine and thymine (including the monomers, dimers, tetramers, hexamers, octomers, and decamers) with five different mineral surfaces (pyrite, rutile, hematite, olivine and calcite). Adsorption was studied in 0.1 M pH 8.1 KHCO3 with0.05 M NaCl as background electrolyte. Solutions were mixed for 24 hours at room temperature, centrifuged and the supernatants analyzed by UV/visible spectrophotometry. Equilibrium solution concentrations were measured and used to determine the number of moles adsorbed per square meter. Langmuir isotherms were constructed using the experimental data. It was found that adenine-containing molecules tend to bind much more strongly than thymine-containing molecules. It was also found that the number of moles adsorbed at saturation tends to fall with increasing chain length, while adsorption affinity tends to rise. Oligomer length appears to affect adsorption more than the mineral type. These results may have implications for the primordial organization of the first nucleic acid molecules as the persistence of extra-cellular nucleic acids in the environment. References Bernal, J. D. (1951) The Physical Basis of Life (Routledge, London). Miller S.L. and Cleaves, H.J. (2006) Prebiotic chemistry on the primitive Earth. In

  4. Role of electrostatics in the assembly pathway of a single-stranded RNA virus.

    Science.gov (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M

    2014-09-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  5. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids.

    Science.gov (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R

    2015-04-08

    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  6. Variations in surface roughness of seven orthodontic archwires: an SEM-profilometry study

    Science.gov (United States)

    Rakhshan, Vahid; Pousti, Maryam; Rahimi, Hajir; Shariati, Mahsa; Aghamohamadi, Bahareh

    2012-01-01

    Objective The purpose of this study was to evaluate the surface roughness (SR) of 2 types of orthodontic archwires made by 4 different manufacturers. Methods This in vitro experimental study was conducted on 35 specimens of 7 different orthodontic archwires, namely, 1 nickel-titanium (NiTi) archwire each from the manufacturers American Orthodontics, OrthoTechnology, All-Star Orthodontics, and Smart Technology, and 1 stainless steel (SS) archwire each from the manufacturers American Orthodontics, OrthoTechnology, and All-Star Orthodontics. After analyzing the composition of each wire by energy-dispersive X-ray analysis, the SR of each wire was determined by scanning electron microscopy (SEM) and surface profilometry. Data were analyzed using the Kruskal-Wallis and Mann-Whitney U tests (α wires manufactured by Smart Technology, American Orthodontics, OrthoTechnology, and All-Star Orthodontics were 1,289 ± 915 A°, 1,378 ± 372 A°, 2,444 ± 369 A°, and 5,242 ± 2,832 A°, respectively. The average SR of SS wires manufactured by All-Star Orthodontics, OrthoTechnology, and American Orthodontics were 710 ± 210 A°, 1,831 ± 1,156 A°, and 4,018 ± 2,214 A°, respectively. Similar to the results of profilometry, the SEM images showed more defects and cracks on the SS wire made by American Orthodontics and the NiTi wire made by All-Star Orthodontics than others. Conclusions The NiTi wire manufactured by All-Star Orthodontics and the SS wire made by American Orthodontics were the roughest wires. PMID:23112943

  7. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong

    2011-04-01

    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  8. Modifications in straight wire treatment.

    Science.gov (United States)

    Cardona, Alvin

    2010-01-01

    Orthodontic treatments have been modified with each new generation of clinicians. Today the emphasis is on facial esthetics and healthy temporomandibular joints. With orthopedic treatment, we can develop dental arches to get the necessary space to align the teeth and we can reach adequate function and esthetics, all within relatively good stability. By combining two-phase treatment with low friction fixed orthodontics and super elastic wires we produce light but continuous forces and we can provide better treatment than before. These types of forces cause physiological and functional orthopedic orthodontic reactions. The purpose of this article is to demonstrate our fixed orthopedic and orthodontic approach called "Modified Straight Wire" or "Physiologic Arch Technique." This technique is very successful with our patients because it can exert slow and continuous forces with minimal patient cooperation.

  9. Orthodontics at a Pivotal Point of Transformation

    Science.gov (United States)

    Mao, Jeremy J.

    2014-01-01

    The profession of orthodontics is projected to face a multitude of challenges. Do cyclic forces accelerate the rate of tooth movement and hence the speed of orthodontic treatment? Would bioengineered cementum and dentine be a solution to root resorption? What would orthodontics be like when bioengineered periodontal ligament and alveolar bone become clinical practice, or one day, entire teeth are bioengineered? Would it be possible to selectively differentiate stem cells into osteoblasts or osteoclasts by either static or cyclic forces? What is the new demand on orthodontic expertise with increasingly automated appliances? What will be the impact of the next generation of dental implants or rapid prototyped crowns on orthodontics? A century ago, Edward Angle’s practice of fixed appliances, along with other seminal contributions, such as functional appliances, established the profession of orthodontics. Today, the biophysical principles of orthodontics remain largely unchanged from Angle’s era, despite incremental refinements of brackets and wires. The paucity of fundamental innovations in orthodontics for decades presents intrinsic risks for the profession. This review will identify challenges for contemporary orthodontics and delineate strategies for the profession to evolve in an era of unprecedented scientific and technological advances, and serve as a call to action for the orthodontic profession. PMID:25018618

  10. Orthodontics at a Pivotal Point of Transformation.

    Science.gov (United States)

    Mao, Jeremy J

    2010-06-01

    The profession of orthodontics is projected to face a multitude of challenges. Do cyclic forces accelerate the rate of tooth movement and hence the speed of orthodontic treatment? Would bioengineered cementum and dentine be a solution to root resorption? What would orthodontics be like when bioengineered periodontal ligament and alveolar bone become clinical practice, or one day, entire teeth are bioengineered? Would it be possible to selectively differentiate stem cells into osteoblasts or osteoclasts by either static or cyclic forces? What is the new demand on orthodontic expertise with increasingly automated appliances? What will be the impact of the next generation of dental implants or rapid prototyped crowns on orthodontics? A century ago, Edward Angle's practice of fixed appliances, along with other seminal contributions, such as functional appliances, established the profession of orthodontics. Today, the biophysical principles of orthodontics remain largely unchanged from Angle's era, despite incremental refinements of brackets and wires. The paucity of fundamental innovations in orthodontics for decades presents intrinsic risks for the profession. This review will identify challenges for contemporary orthodontics and delineate strategies for the profession to evolve in an era of unprecedented scientific and technological advances, and serve as a call to action for the orthodontic profession.

  11. Clinical bending of nickel titanium wires

    OpenAIRE

    Stephen Chain; Priyank Seth; Namrata Rastogi; Kenneth Tan; Mayank Gupta; Richa Singh

    2015-01-01

    Since the evolution and the involvement of Nickel Titanium wires in the field of Orthodontics. The treatment plan has evolved with the use of low force Nickel Titanium wires. Because of their high springback, low stiffness, they are the key initial wires in leveling and alignment but have poor formability. Since poor formability limits its ability to create variable arch forms thus; limits the form of treatment. We have devised a method to bend the Nickel Titanium wires to help in our invento...

  12. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes

    OpenAIRE

    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  13. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity.

    Science.gov (United States)

    Monnet, Jordan; Kozelka, Jiří

    2012-10-01

    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. The super-elastic Japanese NiTi alloy wire for use in orthodontics. Part III. Studies on the Japanese NiTi alloy coil springs.

    Science.gov (United States)

    Miura, F; Mogi, M; Ohura, Y; Karibe, M

    1988-08-01

    Closed and open Japanese nickel titanium (NiTi) alloy coil springs were fabricated from the Japanese NiTi alloy wire. The closed coil springs were subjected to a tensile test and the open coil springs were subjected to a compression test to evaluate the mechanical properties. At the same time, a test with the commercially available steel coil springs also was done. It was clearly established that the Japanese NiTi alloy coil springs exhibited superior springback and super-elastic properties similar to the properties of the Japanese NiTi alloy arch wires. In addition, it was shown that the load value of super-elastic activity can be effectively controlled by changing the diameter of the wire, the size of lumen, the martensite transformation temperature, and the pitch of the open coil spring. The most important characteristic of the Japanese NiTi alloy coil springs is the ability to exert a very long range of constant light, continuous force. It is possible to use this coil selectively to obtain optimal tooth movement.

  15. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris

    2016-01-01

    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA-binding pro......Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...... leads to enhanced cooperative binding to DNA.Conclusions: Our findings contribute to the emerging picture that bacterial proteins, exemplified here by SsbA, undergo phosphorylation at multiple residues. This results in a complex regulation of cellular functions, and suggests that the complexity...

  16. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  17. Development of an Interaction Assay between Single-Stranded Nucleic Acids Trapped with Silica Particles and Fluorescent Compounds

    Directory of Open Access Journals (Sweden)

    R. Maeda

    2012-09-01

    Full Text Available Biopolymers are easily denatured by heating, a change in pH or chemical substances when they are immobilized on a substrate. To prevent denaturation of biopolymers, we developed a method to trap a polynucleotide on a substrate by hydrogen bonding using silica particles with surfaces modified by aminoalkyl chains ([A-AM silane]/SiO2. [A-AM silane]/SiO2 was synthesized by silane coupling reaction of N-2-(aminoethyl-3-aminopropyltrimethoxysilane (A-AM silane with SiO2 particles with a diameter of 5 μm at 100 °C for 20 min. The surface chemical structure of [A-AM silane]/SiO2 was characterized by Fourier transform infrared spectroscopy and molecular orbital calculations. The surface of the silica particles was modified with A-AM silane and primary amine groups were formed. [A-AM silane]/SiO2 was trapped with single-stranded nucleic acids [(Poly-X; X = A (adenine, G (guanine and C (cytosine] in PBS solution at 37 °C for 1 h. The single-stranded nucleic acids were trapped on the surface of the [A-AM silane]/SiO2 by hydrogen bonding to form conjugated materials. The resulting complexes were further conjugated by derivatives of acridine orange (AO as fluorescent labels under the same conditions to form [AO:Poly-X:A-AM silane]/SiO2 complexes. Changes in the fluorescence intensity of these complexes originating from interactions between the single-stranded nucleic acid and aromatic compounds were also evaluated. The change in intensity displayed the order [AO: Poly-G: A-AM silane]/SiO2 > [AO:Poly-A:A-AM silane]/SiO2 >> [AO:Poly-C:A-AM silane]/SiO2. This suggests that the single-stranded nucleic acids conjugated with aminoalkyl chains on the surfaces of SiO2 particles and the change in fluorescence intensity reflected the molecular interaction between AO and the nucleic-acid base in a polynucleotide.

  18. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide

    Science.gov (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio

    1998-01-01

    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  19. Enhancing wire-composite bond strength of bonded retainers with wire surface treatment.

    Science.gov (United States)

    Oesterle, L J; Shellhart, W C; Henderson, S

    2001-06-01

    Bonded orthodontic retainers with wires embedded in composite resin are commonly used for orthodontic retention. The purpose of this study was to test, in vitro, various wire surface treatments to determine the optimal method of enhancing the wire-composite bond strength. Coaxial wires and stainless steel wires with different surface treatments were bonded to bovine enamel and then pulled along their long axes with an Instron universal testing machine. Wire surface treatments included placing a right-angle bend in the wire, microetching the wire, and treating the wire with adhesion promoters; combinations of treatments were also examined. The results demonstrated a 24-fold increase in the wire-composite bond strength of wire that was microetched (sandblasted), compared with that of untreated straight wire. The difference between the amount of force required to break the bond produced by microetching alone (246.1 +/- 46.0 MPa) and that required for the bonds produced by the retentive bend (87.8 +/- 16.3 MPa), the adhesion promoters (silane, 11.0 +/- 3.1 MPa; Metal Primer, 28.5 +/- 15.8 MPa), or for any combination of surface treatments, was statistically significant. Microetching a stainless steel wire produced a higher wire-composite bond strength than that obtained from a coaxial wire (113.5 +/- 27.5 MPa). The results of this study indicate that microetching or sandblasting a stainless steel wire significantly increases the strength of the wire-composite bond.

  20. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism.

    Science.gov (United States)

    Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong

    2016-07-01

    A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.

  1. Characterization of the single-stranded DNA binding protein pV(VGJΦ) of VGJΦ phage from Vibrio cholerae.

    Science.gov (United States)

    Falero, Alina; Caballero, Andy; Trigueros, Sonia; Pérez, Celso; Campos, Javier; Marrero, Karen; Fando, Rafael

    2011-09-01

    pV(VGJΦ), a single-stranded DNA binding protein of the vibriophage VGJΦ was subject to biochemical analysis. Here, we show that this protein has a general affinity for single-stranded DNA (ssDNA) as documented by Electrophoretic Mobility Shift Assay (EMSA). The apparent molecular weight of the monomer is about 12.7kDa as measured by HPLC-SEC. Moreover, isoelectrofocusing showed an isoelectric point for pV(VGJΦ) of 6.82 pH units. Size exclusion chromatography in 150mM NaCl, 50mM sodium phosphate buffer, pH 7.0 revealed a major protein species of 27.0kDa, suggesting homodimeric protein architecture. Furthermore, pV(VGJΦ) binds ssDNA at extreme temperatures and the complex was stable after extended incubation times. Upon frozen storage at -20°C for a year the protein retained its integrity, biological activity and oligomericity. On the other hand, bioinformatics analysis predicted that pV(VGJΦ) protein has a disordered C-terminal, which might be involved in its functional activity. All the aforementioned features make pV(VGJΦ) interesting for biotechnological applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles.

    Science.gov (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng

    2015-11-21

    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  3. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  4. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.

    1978-01-01

    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  5. [Orthodontic treatment possibilities of allergic patients].

    Science.gov (United States)

    Vitályos, Géza; Török, Judit; Márton, Ildikó; Szepesi, Marta; Radics, Tonde; Hegedus, Csaba

    2007-04-01

    During the past two decades the incidence of allergies against dental materials has been rising. The most common allergens are nickel, mercury, benzoxyl-peroxide, formaldehyde, MMA, HEMA, EGDMA and TEGDMA. Contact allergy develops in predisposed individuals as a consequence of environmental exposures to allergens. Although the relatively high frequency of contact allergies in children is well documented, its importance during orthodontic treatments is still often underestimated. The most common metal to cause dental allergic reactions is nickel. Nickel-containing metal alloys, such as nickel-titanium, are widely used in orthodontics because of their favorable physical properties. Coated wires (epoxi coating, teflon, etc.) are not only more aesthetic, but can play a role in the orthodontic treatment of patients with nickel allergy. In our case report we present two patients with nickel allergy, and their treatment with alternative orthodontic appliances. During the orthodontic treatment our patients did not have any objective or subjective allergy-related symptoms.

  6. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail: meicun2006@163.com; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

    2016-12-01

    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  7. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  8. Highly stable triple helix formation by homopyrimidine (l)-acyclic threoninol nucleic acids with single stranded DNA and RNA

    DEFF Research Database (Denmark)

    Kumar, Vipin; Kesavan, Venkitasamy; Gothelf, Kurt Vesterager

    2015-01-01

    Acyclic (l)-threoninol nucleic acid (aTNA) containing thymine, cytosine and adenine nucleobases were synthesized and shown to form surprisingly stable triplexes with complementary single stranded homopurine DNA or RNA targets. The triplex structures consist of two (l)-aTNA strands and one DNA...... or RNA, and these triplexes are significantly stronger than the corresponding DNA or RNA duplexes as shown in competition experiments. As a unique property the (l)-aTNAs exclusively form triplex structures with DNA and RNA and no duplex structures are observed by gel electrophoresis. The results were...... compared to the known enantiomer (d)-aTNA, which forms much weaker triplexes depending upon temperature and time. It was demonstrated that (l)-aTNA triplexes are able to stop primer extension on a DNA template, showing the potential of (l)-aTNA for antisense applications....

  9. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample.

    Science.gov (United States)

    Cui, Lunbiao; Wu, Binyao; Zhu, Xiaojuan; Guo, Xiling; Ge, Yiyue; Zhao, Kangchen; Qi, Xian; Shi, Zhiyang; Zhu, Fengcai; Sun, Lixin; Zhou, Minghao

    2017-11-01

    Metagenomic analysis through high-throughput sequencing is a tool for detecting both known and novel viruses. Using this technique, a novel circular single-stranded DNA (ssDNA) virus genome was discovered in respiratory secretions from a febrile traveler. The virus, named human respiratory-associated PSCV-5-like virus (HRAPLV), has a genome comprising 3,018 bases, with two major putative ORFs inversely encoding capsid (Cap) and replicase (Rep) protein and separated by two intergenic regions. One stem-loop structure was predicted in the larger intergenic region (LIR). The predicted amino acid sequences of the Cap and Rep proteins of HRAPLV showed highest identity to those of porcine stool-associated circular virus 5 isolate CP3 (PoSCV 5) (53.0% and 48.9%, respectively). The host tropism of the virus is unknown, and further study is warranted to determine whether this novel virus is associated with human disease.

  10. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Vrushali S. [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Gokhale, Suresh P.; Patil, Kashinath R. [Physical and Material Chemistry Division, National Chemical Laboratory, Pune (India); Haram, Santosh K., E-mail: haram@chem.unipune.ernet.i [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)

    2010-02-15

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 +- 2 mum and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, alpha-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k{sup 0}) and electron transfer coefficient (alpha) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  11. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    International Nuclear Information System (INIS)

    Joshi, Vrushali S.; Gokhale, Suresh P.; Patil, Kashinath R.; Haram, Santosh K.

    2010-01-01

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 ± 2 μm and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, α-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k 0 ) and electron transfer coefficient (α) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  12. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  13. Quenching of Single-Walled Carbon Nanotube Fluorescence by Dissolved Oxygen Reveals Selective Single-Stranded DNA Affinities.

    Science.gov (United States)

    Zheng, Yu; Bachilo, Sergei M; Weisman, R Bruce

    2017-05-04

    The selective interactions between short oligomers of single-stranded DNA (ssDNA) and specific structures of single-walled carbon nanotubes have been exploited in powerful methods for nanotube sorting. We report here that nanotubes coated with ssDNA also display selective interactions through the selective quenching of nanotube fluorescence by dissolved oxygen. In aqueous solutions equilibrated under 1 atm of O 2 , emission intensity from semiconducting nanotubes is reduced by between 9 and 40%, varying with the combination of ssDNA sequence and nanotube structure. This quenching reverses promptly and completely on the removal of dissolved O 2 and may be due to physisorption on nanotube surfaces. Fluorescence quenching offers a simple, nondestructive approach for studying the structure-selective interactions of ssDNA with single-walled carbon nanotubes and identifying recognition sequences.

  14. Surface treatment on amorphous InGaZnO4 thin film for single-stranded DNA biosensing

    Science.gov (United States)

    Sun, Dali; Matsui, Hiroaki; Wu, Chun-Nan; Tabata, Hitoshi

    2015-01-01

    Amorphous InGaZnO4 (aIGZO) has been widely used as a transparent semiconductor. However, no research has been found yet applying aIGZO to biosensing. This paper examined the single strand DNA (ssDNA) immobilization on aIGZO by absorption with a comparison to ITO, which is the first step for many biosensing schemas. The DNA quantification by florescence intensity shows that the absorption capacity of aIGZO film to ssDNA is 6.7 times greater than that of ITO. XPS and contact angle analysis proved the high DNA absorption affinity on aIGZO film is related to its high effectiveness to OH- attachment. A feasible method to immobilized ssDNA on aIGZO thin film is evaluated in this paper, and consequently, enables a possible approach to apply aIGZO in biosensing.

  15. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol

    2013-01-01

    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  16. The differences of orthodontic tooth movement on menstrual and ovulation cycle

    OpenAIRE

    Sonya Grecila Susilo; Rahmi Amtha; Boedi Oetomo Roeslan; Joko Kusnoto

    2014-01-01

    Background: Estrogens are sex hormon that play an important role in bone metabolism, including in bone remodeling during orthodontic treatment. Women has a monthly cycle which is affected by fluctuations of estrogen that is menstruation and ovulation. Purpose: The study was aimed to determine the differences of orthodontic tooth movement during menstrual an ovulation cycle. Methods: Five women were given ± 100 g orthodontic force using fixed orthodontic appliance with straight wire technique ...

  17. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana.

    Science.gov (United States)

    Olszewski, Marcin; Grot, Anna; Wojciechowski, Marek; Nowak, Marta; Mickiewicz, Małgorzata; Kur, Józef

    2010-10-15

    In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. We report the characterization of single-stranded DNA binding proteins (SSBs) from the thermophilic bacteria Thermotoga maritima (TmaSSB) and Thermotoga neapolitana (TneSSB). They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively). They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold) in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC) the melting temperature (Tm) was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR).

  18. Charge enhancement of single-stranded DNA in negative electrospray ionization using the supercharging reagent meta-nitrobenzyl alcohol.

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1% m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1% m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  19. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  20. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB).

    Science.gov (United States)

    van Loon, Barbara; Samson, Leona D

    2013-03-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  1. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata

    2010-10-01

    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  2. Aptamer based voltammetric determination of ampicillin using a single-stranded DNA binding protein and DNA functionalized gold nanoparticles.

    Science.gov (United States)

    Wang, Jun; Ma, Kui; Yin, Huanshun; Zhou, Yunlei; Ai, Shiyun

    2017-12-20

    An aptamer based method is described for the electrochemical determination of ampicillin. It is based on the use of DNA aptamer, DNA functionalized gold nanoparticles (DNA-AuNPs), and single-stranded DNA binding protein (ssDNA-BP). When the aptamer hybridizes with the target DNA on the AuNPs, the ssDNA-BP is captured on the electrode surface via its specific interaction with ss-DNA. This results in a decreased electrochemical signal of the redox probe Fe(CN) 6 3- which is measured best at a voltage of 0.188 mV (vs. reference electrode). In the presence of ampicillin, the formation of aptamer-ampicillin conjugate blocks the further immobilization of DNA-AuNPs and ssDNA-BP, and this leads to an increased response. The method has a linear reposne that convers the 1 pM to 5 nM ampicillin concentration range, with a 0.38 pM detection limit (at an S/N ratio of 3). The assay is selective, stable and reproducible. It was applied to the determination of ampicillin in spiked milk samples where it gave recoveries ranging from 95.5 to 105.5%. Graphical abstract Schematic of a simple and sensitive electrochemical apta-biosensor for ampicillin detection. It is based on the use of gold nanoparticles (AuNPs), DNA aptamer, DNA functionalized AuNPs (DNA-AuNPs), and single-strand DNA binding protein (SSBP).

  3. Load-deflection characteristics of superelastic nickel-titanium wires.

    NARCIS (Netherlands)

    Bartzela, T.; Senn, C.; Wichelhaus, A.

    2007-01-01

    OBJECTIVE: To determine the mechanical properties of commercially available thermodynamic wires and to classify these wires mathematically into different groups. MATERIALS AND METHODS: The samples examined were 48 nickel-titanium (NiTi) alloy orthodontic wires commercially available from five

  4. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.

    1994-01-01

    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  5. Clinical bending of nickel titanium wires

    Directory of Open Access Journals (Sweden)

    Stephen Chain

    2015-01-01

    Full Text Available Since the evolution and the involvement of Nickel Titanium wires in the field of Orthodontics. The treatment plan has evolved with the use of low force Nickel Titanium wires. Because of their high springback, low stiffness, they are the key initial wires in leveling and alignment but have poor formability. Since poor formability limits its ability to create variable arch forms thus; limits the form of treatment. We have devised a method to bend the Nickel Titanium wires to help in our inventory but also customized the wire according to the treatment.

  6. Genetic evidence for single-strand lesions initiating Nbs1-dependent homologous recombination in diversification of Ig v in chicken B lymphocytes.

    Directory of Open Access Journals (Sweden)

    Makoto Nakahara

    2009-01-01

    Full Text Available Homologous recombination (HR is initiated by DNA double-strand breaks (DSB. However, it remains unclear whether single-strand lesions also initiate HR in genomic DNA. Chicken B lymphocytes diversify their Immunoglobulin (Ig V genes through HR (Ig gene conversion and non-templated hypermutation. Both types of Ig V diversification are initiated by AID-dependent abasic-site formation. Abasic sites stall replication, resulting in the formation of single-stranded gaps. These gaps can be filled by error-prone DNA polymerases, resulting in hypermutation. However, it is unclear whether these single-strand gaps can also initiate Ig gene conversion without being first converted to DSBs. The Mre11-Rad50-Nbs1 (MRN complex, which produces 3' single-strand overhangs, promotes the initiation of DSB-induced HR in yeast. We show that a DT40 line expressing only a truncated form of Nbs1 (Nbs1(p70 exhibits defective HR-dependent DSB repair, and a significant reduction in the rate--though not the fidelity--of Ig gene conversion. Interestingly, this defective gene conversion was restored to wild type levels by overproduction of Escherichia coli SbcB, a 3' to 5' single-strand-specific exonuclease, without affecting DSB repair. Conversely, overexpression of chicken Exo1 increased the efficiency of DSB-induced gene-targeting more than 10-fold, with no effect on Ig gene conversion. These results suggest that Ig gene conversion may be initiated by single-strand gaps rather than by DSBs, and, like SbcB, the MRN complex in DT40 may convert AID-induced lesions into single-strand gaps suitable for triggering HR. In summary, Ig gene conversion and hypermutation may share a common substrate-single-stranded gaps. Genetic analysis of the two types of Ig V diversification in DT40 provides a unique opportunity to gain insight into the molecular mechanisms underlying the filling of gaps that arise as a consequence of replication blocks at abasic sites, by HR and error

  7. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian

    2012-07-06

    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  8. Management of pediatric mandibular fracture using orthodontic ...

    African Journals Online (AJOL)

    ... mandibular symphysis managed by closed reduction using a vacuum formed thermoplastic splint and circummandibular wiring is presented. This article also provides a review of the literature regarding the management of mandibular fracture in young children. Keywords: Orthodontic vacuum‑formed thermoplastic splint, ...

  9. Electropolishing-Orthodontic Office: A Simplified Approach

    Directory of Open Access Journals (Sweden)

    Sudhir Munjal

    2014-01-01

    Full Text Available Electropolishing plays an important role in dentistry by providing enhanced mechanical properties, better corrosion protection, physical appearance and ease of cleaning various metallic attachments. To achieve all these objectives, we present here a simple and economical way to fabricate a electropolisher which has wide applications in orthodontic office (recycle brackets, anneal retention wires, etc..

  10. Identification and characterization of single-stranded DNA-binding protein from the facultative psychrophilic bacteria Pseudoalteromonas haloplanktis.

    Science.gov (United States)

    Olszewski, Marcin; Nowak, Marta; Cyranka-Czaja, Anna; Kur, Józef

    2014-01-01

    Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism such as DNA replication, repair, and recombination, and is essential for cell survival. This study reports on the ssb-like gene cloning, gene expression and characterization of a single-stranded DNA-binding protein of Pseudoalteromonas haloplanktis (PhaSSB) and is the first report of such a protein from psychrophilic microorganism. PhaSSB possesses a high sequence similarity to Escherichia coli SSB (48% identity and 57% similarity) and has the longest amino acid sequence (244 amino acid residues) of all the known bacterial SSBs with one OB-fold per monomer. An analysis of purified PhaSSB by means of chemical cross-linking experiments, sedimentation analysis and size exclusion chromatography revealed a stable tetramer in solution. Using EMSA, we characterized the stoichiometry of PhaSSB complexed with a series of ssDNA homopolymers, and the size of the binding site was determined as being approximately 35 nucleotides long. In fluorescence titrations, the occluded site size of PhaSSB on poly(dT) is 34 nucleotides per tetramer under low-salt conditions (2mM NaCl), but increases to 54-64 nucleotides at higher-salt conditions (100-300mM NaCl). This suggests that PhaSSB undergoes a transition between ssDNA binding modes, which is observed for EcoSSB. The binding properties of PhaSSB investigated using SPR technology revealed that the affinity of PhaSSB to ssDNA is typical of SSB proteins. The only difference in the binding mode of PhaSSB to ssDNA is a faster association phase, when compared to EcoSSB, though compensated by faster dissociation rate. When analyzed by differential scanning calorimetry (DSC), the melting temperature (Tm) was determined as 63 °C, which is only a few degrees lower than for EcoSSB. Copyright © 2013 Elsevier GmbH. All rights reserved.

  11. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  12. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii.

    Science.gov (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten

    2012-01-01

    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  13. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der

    1978-01-01

    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  14. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.

    1982-01-01

    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  15. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

    1982-01-01

    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  16. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.

    2006-01-01

    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  17. Adjunctive orthodontic treatment with lingual orthodontic system.

    Science.gov (United States)

    Kafle, D; Humagain, M; Upadhaya, C

    2011-01-01

    The lingual orthodontic therapy though started in 1972, could not be popular till the beginning of 1990. In Nepal it does not have a history of more than a year. It is started in Dhulikhel Hospital for the first time in Nepal. Usually orthodontic therapy is meant for putting braces on the labial surface of the teeth which is called labial orthodontic system. Lingual orthodontic system is a purely invisible kind of orthodontic therapy in which braces are placed behind the teeth. The advantages of lingual orthodontic therapy are: invisibility, better biomechanics and improved patient compliance. On the other hand it is difficult to master and costlier than labial orthodontics. We have presented six adjunctive orthodontic cases treated by lingual system with the same end result comparable to labial orthodontic system.

  18. Functional analysis of multiple single-stranded DNA-binding proteins from Methanosarcina acetivorans and their effects on DNA synthesis by DNA polymerase BI.

    Science.gov (United States)

    Robbins, Justin B; Murphy, Mary C; White, Bryan A; Mackie, Roderick I; Ha, Taekjip; Cann, Isaac K O

    2004-02-20

    Single-stranded DNA-binding proteins and their functional homologs, replication protein A, are essential components of cellular DNA replication, repair and recombination. We describe here the isolation and characterization of multiple replication protein A homologs, RPA1, RPA2, and RPA3, from the archaeon Methanosarcina acetivorans. RPA1 comprises four single-stranded DNA-binding domains, while RPA2 and RPA3 are each composed of two such domains and a zinc finger domain. Gel filtration analysis suggested that RPA1 exists as homotetramers and homodimers in solution, while RPA2 and RPA3 form only homodimers. Unlike the multiple RPA proteins found in other Archaea and eukaryotes, each of the M. acetivorans RPAs can act as a distinct single-stranded DNA-binding protein. Fluorescence resonance energy transfer and fluorescence polarization anisotropy studies revealed that the M. acetivorans RPAs bind to as few as 10 single-stranded DNA bases. However, more stable binding is achieved with single-stranded DNA of 18-23 bases, and for such substrates the estimated Kd was 3.82 +/- 0.28 nM, 173.6 +/- 105.17 nM, and 5.92 +/- 0.23 nM, for RPA1, RPA2, and RPA3, respectively. The architectures of the M. acetivorans RPAs are different from those of hitherto reported homologs. Thus, these proteins may represent novel forms of replication protein A. Most importantly, our results show that the three RPAs and their combinations highly stimulate the primer extension capacity of M. acetivorans DNA polymerase BI. Although bacterial SSB and eukaryotic RPA have been shown to stimulate DNA synthesis by their cognate DNA polymerases, our findings provide the first in vitro biochemical evidence for the conservation of this property in an archaeon.

  19. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  20. EFFECTOR OF TRANSCRIPTION2 is involved in xylem differentiation and includes a functional DNA single strand cutting domain.

    Science.gov (United States)

    Ivanov, Rumen; Tiedemann, Jens; Czihal, Andreas; Schallau, Anna; Diep, Le Hong; Mock, Hans-Peter; Claus, Bernhard; Tewes, Annegret; Bäumlein, Helmut

    2008-01-01

    EFFECTORS OF TRANSCRIPTION2 (ET) are plant-specific regulatory proteins characterized by the presence of two to five C-terminal DNA- and Zn-binding repeats, and a highly conserved cysteine pattern. We describe the structural characterization of the three member Arabidopsis thaliana ET gene family and reveal some allelic sequence polymorphisms. A mutation analysis showed that AtET2 affects the expression of various KNAT genes involved in the maintenance of the undifferentiated state of cambial meristem cells. It also plays a role in the regulation of GA5 (gibberellin 3-beta-dioxygenase) and the cell-cycle-related GASA4. A correlation was established between AtET2 expression and the cellular differentiation state. AtET-GFP fusion proteins shuttle between the cytoplasm and nucleus, with the AtET2 product prevented from entering the nucleus in non-differentiating cells. Within the nucleus, AtET2 probably acts via a single strand cutting domain. A more general regulatory role for ET factors is proposed, governing cell differentiation in cambial meristems, a crucial process for the development of plant vascular tissues.

  1. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)

    2012-04-04

    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  2. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)

    2015-04-22

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  3. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.

    1985-01-01

    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  4. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA

    Science.gov (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana

    2009-04-01

    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  5. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia

    2009-01-01

    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  6. Capillary electrophoresis ribosomal RNA single-stranded conformation polymorphism: a new approach for characterization of low-diversity microbial communities.

    Science.gov (United States)

    Nai, Yi H; Zemb, Oliver; Gutierrez-Zamora, Maria-Luisa; Manefield, Mike; Powell, Shane M; Breadmore, Michael C

    2012-10-01

    Capillary electrophoresis (CE) has been the principle system for nucleic acid analysis since the early 1990s due to its inherent advantages such as fast analysis time, high resolution and efficiency, minimal sample requirement, high detection sensitivity, and automation. In the past few decades, microbial community fingerprinting methods such as terminal restriction fragment length polymorphism and single-stranded conformation polymorphism (SSCP) have migrated to CE to utilize its advantages over conventional slab gel electrophoresis. Recently, a gel-based direct rRNA fingerprint method was demonstrated. Different from other existing microbial community characterization approaches, this novel approach is polymerase chain reaction free and capable of providing information on the relative abundance of rRNA from individual phylotypes in low-diversity samples. As a gel-based method, it has a long analysis time and relatively large reagent and sample requirements. Here, we addressed these limitations by transferring the RNA fingerprint approach to the CE platform. Analysis time significantly improved from 24 h to 60 min, and the use of a fluorescently labeled hybridization probe as the detection strategy decreased the sample requirement by ten-fold. The combination of fast analysis time, low sample requirement, and sensitive fluorescence detection makes CE-RNA-SSCP an appealing new approach for characterizing low-diversity microbial communities.

  7. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))

    1993-03-01

    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  8. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA.

    Science.gov (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi

    2008-03-28

    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  9. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  10. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  11. Effects of Fluoride on NiTi Orthodontic Archwires: An X-ray Diffraction Study

    Directory of Open Access Journals (Sweden)

    Sumit Kumar Yadav

    2013-01-01

    Results: Unloading force values of NiTi orthodontic wires were significantly decreased after exposure to both fluoride solutions (p < 0.001. Corrosive changes in surface topography were observed for both fluoride solutions. Wires exposed to acidic fluoride appeared as more severely affected. X-ray diffraction analysis showed no change in crystal lattice of NiTi wires in both solutions. Conclusion: The results suggest that using topical fluoride agents with NiTi wire could decrease the functional unloading mechanical properties of the wire and contribute to prolonged orthodontic treatment.

  12. Effect of Fluoride Prophylactic Agents on the Mechanical Properties of Nickel-Titanium Wires: An in vitro Study

    Directory of Open Access Journals (Sweden)

    S R Harish Koushik

    2011-01-01

    Conclusion : The results suggest that using topical fluoride agents with NiTi wire could decrease the functional unloading mechanical properties of the wire and contribute to prolonged orthodontic treatment.

  13. Effects of Intraoral Ageing on Ultimate Tensile Strength and Surface Topography of Superelastic NiTi Wires from Two Different Manufacturers: A Comparative in vivo Study

    Directory of Open Access Journals (Sweden)

    A Pravin Devaprasad

    2012-01-01

    Conclusion: Super elastic NiTi wires from 3M Unitek were found to be superior to the wires from American orthodontics in as received condition, after 3 months of clinical use and 6 months of clinical use. The surface topography of 3M Unitek wires was found to have less pitting and indentations than American orthodontic wires of comparable use. Wires from both manufactures were found to undergo degradation after clinical use. During the study, it was found that 3M Unitek NiTi superelastic wires had better ultimate tensile strength and surface topography than superelastic NiTi from American orthodontics.

  14. Mechanical properties of a new thermoplastic polymer orthodontic archwire

    Energy Technology Data Exchange (ETDEWEB)

    Varela, Juan Carlos; Velo, Marcos [Grupo de investigación en Ortodoncia, Facultad de Odontología, Universidad Santiago de Compostela, Santiago de Compostela (Spain); Espinar, Eduardo; Llamas, Jose Maria [Grupo de investigación en Ortodoncia, Facultad de Odontología, Universidad de Sevilla (Spain); Rúperez, Elisa; Manero, Jose Maria [Dept. C. Materiales e Ing. Metalúrgica, Universitat Politècnica de Catalunya, Centre de Recerca Nanoenginyeria, Member of Biomedical Research Networking Center in Bioengineering, Biomaterials and Nanomedicine, CIBER-BBN (Spain); Javier Gil, F., E-mail: francesc.xavier.gil@upc.edu [Dept. C. Materiales e Ing. Metalúrgica, Universitat Politècnica de Catalunya, Centre de Recerca Nanoenginyeria, Member of Biomedical Research Networking Center in Bioengineering, Biomaterials and Nanomedicine, CIBER-BBN (Spain)

    2014-09-01

    A new thermoplastic polymer for orthodontic applications was obtained and extruded into wires with round and rectangular cross sections. We evaluated the potential of new aesthetic archwire: tensile, three point bending, friction and stress relaxation behaviour, and formability characteristics were assessed. Stresses delivered were generally slightly lower than typical beta-titanium and nickel-titanium archwires. The polymer wire has good instantaneous mechanical properties; tensile stress decayed about 2% over 2 h depending on the initial stress relaxation for up to 120 h. High formability allowed shape bending similar to that associated with stainless steel wires. The friction coefficients were lower than the metallic conventional archwires improving the slipping with the brackets. This new polymer could be a good candidate for aesthetic orthodontic archwires. - Highlights: • A new thermoplastic polymer for orthodontic applications was obtained. • This polymer could be a good candidate for aesthetic orthodontic archwires. • The polymer has good mechanical properties as orthodontic wire coating. • The friction coefficients were lower than the metallic archwires improving the slipping with the brackets. • High formability allowed shape bending similar to that associated with stainless steel wires.

  15. Assessing single-stranded oligonucleotide drug-induced effects in vitro reveals key risk factors for thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Sabine Sewing

    Full Text Available Single-stranded oligonucleotides (ON comprise a promising therapeutic platform that enables selective modulation of currently undruggable targets. The development of novel ON drug candidates has demonstrated excellent efficacy, but in certain cases also some safety liabilities were reported. Among them are events of thrombocytopenia, which have recently been evident in late stage trials with ON drugs. The underlying mechanisms are poorly understood and the risk for ON candidates causing such events cannot be sufficiently assessed pre-clinically. We investigated potential thrombocytopenia risk factors of ONs and implemented a set of in vitro assays to assess these risks. Our findings support previous observations that phosphorothioate (PS-ONs can bind to platelet proteins such as platelet collagen receptor glycoprotein VI (GPVI and activate human platelets in vitro to various extents. We also show that these PS-ONs can bind to platelet factor 4 (PF4. Binding to platelet proteins and subsequent activation correlates with ON length and connected to this, the number of PS in the backbone of the molecule. Moreover, we demonstrate that locked nucleic acid (LNA ribosyl modifications in the wings of the PS-ONs strongly suppress binding to GPVI and PF4, paralleled by markedly reduced platelet activation. In addition, we provide evidence that PS-ONs do not directly affect hematopoietic cell differentiation in culture but at higher concentrations show a pro-inflammatory potential, which might contribute to platelet activation. Overall, our data confirm that certain molecular attributes of ONs are associated with a higher risk for thrombocytopenia. We propose that applying the in vitro assays discussed here during the lead optimization phase may aid in deprioritizing ONs with a potential to induce thrombocytopenia.

  16. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA.

    Science.gov (United States)

    Rogers, Cody M; Bochman, Matthew L

    2017-05-13

    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold.

    Science.gov (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G

    2005-05-24

    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  18. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage

    Science.gov (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio

    1998-01-01

    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  19. Slowing single-stranded DNA translocation through a solid-state nanopore by decreasing the nanopore diameter.

    Science.gov (United States)

    Akahori, Rena; Haga, Takanobu; Hatano, Toshiyuki; Yanagi, Itaru; Ohura, Takeshi; Hamamura, Hirotaka; Iwasaki, Tomio; Yokoi, Takahide; Anazawa, Takashi

    2014-07-11

    To slow the translocation of single-stranded DNA (ssDNA) through a solid-state nanopore, a nanopore was narrowed, and the effect of the narrowing on the DNA translocation speed was investigated. In order to accurately measure the speed, long (5.3 kb) ssDNA (namely, ss-poly(dA)) with uniform length (±0.4 kb) was synthesized. The diameters of nanopores fabricated by a transmission electron microscope were controlled by atomic-layer deposition. Reducing the nanopore diameter from 4.5 to 2.3 nm slowed down the translocation of ssDNA by more than 16 times (to 0.18 μs base(-1)) when 300 mV was applied across the nanopore. It is speculated that the interaction between the nanopore and the ssDNA dominates the translocation speed. Unexpectedly, the translocation speed of ssDNA through the 4.5 nm nanopore is more than two orders of magnitude higher than that of double-stranded DNA (dsDNA) through a nanopore of almost the same size. The cause of such a faster translocation of ssDNA can be explained by the weaker drag force inside the nanopore. Moreover, the measured translocation speeds of ssDNA and dsDNA agree well with those calculated by molecular-dynamics (MD) simulation. The MD simulation predicted that reducing the nanopore diameter to almost the same as that of ssDNA (i.e. 1.4 nm) decreases the translocation speed (to 1.4 μs base(-1)). Narrowing the nanopore is thus an effective approach for accomplishing nanopore DNA sequencing.

  20. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  1. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler

    2007-12-01

    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  2. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines.

    Science.gov (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao

    2017-07-01

    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  3. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA.

    Science.gov (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee

    2011-03-24

    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  4. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Invisible orthodontics part 3: aesthetic orthodontic brackets.

    Science.gov (United States)

    Waring, David; McMullin, Ailbhe; Malik, Ovais H

    2013-09-01

    In this, the third part of the series, aesthetic orthodontic treatment will be considered. The previous two articles have looked at invisible orthodontics with Invisalign and lingual brackets. This article will discuss the properties and use of aesthetic brackets, along with examples of orthodontic treatment cases using the aesthetic brackets. Increasing demand for aesthetics during orthodontic treatment has resulted in a significant increase in the use of aesthetic brackets. Clinicians need to be aware of the benefits and drawbacks of aesthetic brackets.

  6. Fibrotic encapsulation of orthodontic appliance in palate.

    Science.gov (United States)

    Muthu, Jananni; Muthanandam, Sivaramakrishnan; Umapathy, Gubernath; Kannan, Anitha Logaranjani

    2017-01-01

    Iatrogenic trauma though not serious is very common in dental practice. Orthodontic treatment can inflict such injuries as they are prolonged over a long period of time. Ill-fabricated orthodontic appliances, such as wires and brackets, or the patients' habits such as application of constant pressure over the appliance can traumatize the adjacent oral soft tissues. In rare cases, these appliances can get embedded into the mucosa and gingival tissues. This case report describes one such case of iatrogenic trauma to the palatal mucosa due to entrapment of a tongue spike appliance and its surgical management.

  7. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis.

    Science.gov (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J

    2012-01-01

    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  8. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.

    1992-01-01

    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  9. Basic Wiring.

    Science.gov (United States)

    Kaltwasser, Stan; And Others

    This module is the first in a series of three wiring publications; it serves as the foundation for students enrolled in a wiring program. It is a prerequisite to either "Residential Wiring" or "Commercial and Industrial Wiring." The module contains 16 instructional units that cover the following topics: occupational…

  10. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  11. Synthesis of a gene for the HIV transactivator protein TAT by a novel single stranded approach involving in vivo gap repair.

    OpenAIRE

    Adams, S E; Johnson, I D; Braddock, M; Kingsman, A J; Kingsman, S M; Edwards, R M

    1988-01-01

    The synthesis of a gene for the HIV TAT protein is described using a novel approach that capitalises on the ability to synthesise oligonucleotides of greater than 100 bp in length. It involves the synthesis of large oligomers covering one strand of the desired gene in its entirety and the use of small complementary bridging and adapter oligonucleotides to direct the assembly and cloning of the large oligomers. After ligation to the cloning vector the partially single stranded intermediate is ...

  12. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers

    OpenAIRE

    Antolin, M. F.; Bosio, C. F.; Cotton, J.; Sweeney, W.; Strand, M. R.; Black-IV, W. C.

    1996-01-01

    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  13. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr

    2015-01-01

    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single- strand ed DNA -binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  14. [History and development of Chinese orthodontics].

    Science.gov (United States)

    Lin, Jiu-Xiang; Xu, Tian-Min

    2008-02-18

    Orthodontics in China has experienced two important stages. At its early stage from 1950's to 1970's orthodontics was a division of prosthodontic department in China. There were 3 top professors in this field, who got partly training at one time or another in USA and returned to China working in Beijing Medical College, the Fourth Military Medical University and Shanghai Second Medical College. Among them, Professor Mao of Beijing Medical College was regarded as the father of Chinese Orthodontics. Removable appliance was the main tool at that stage and Prof.Mao brought forward Mao's Classification of Malocclusion which is still used in China. The rapid developing stage began in the 1980's when China opened its door to the world. More and more orthodontists got further training abroad and brought back advanced techniques since then. Up to now, we have already had more than one thousand of orthodontic specialists and established its own organization--the Chinese Orthodontic Society (COS), which holds domestic orthodontic meetings and organize its members to attend international meetings. Right now, almost all advanced techniques in diagnosis and treatment are adopted in China, including 3D imaging, self-ligating bracket appliance, and implant anchorage. Chinese orthodontists have started to present or publish papers in international meetings and journals and more than that, started to develop new appliances, such as Driving-Force Straight Wire Appliance, which has shown advantages in treating skeletal Class III malocclusion.

  15. Trends in contemporary orthodontic research publications: Evaluation of three major orthodontic journals

    Directory of Open Access Journals (Sweden)

    M P Kumar Prasanna

    2017-01-01

    Full Text Available Background: In this study, we aimed to evaluate the inclination of orthodontic research published in original articles in three of the most popular and recognized orthodontic journals with high impact factor; American Journal of Orthodontics and Dentofacial Orthopedics (AJODO, the Angle Orthodontist (AO, and European Journal of Orthodontics (EJO published in a 5-year duration time frame (2010–2014. Materials and Methods: Online search with supplementary hand searching was undertaken for original research articles in these three orthodontic journals from 2010 to 2014. Classification of data was completed autonomously by manual and direct appraisal of the manuscript of each journal. Results and Conclusion: Three thousand one hundred and forty articles published in AJODO, AO, and EJO in the particular time period were selected, out of which 1783 original research study articles (56.78% were appraised for classification in their various respective knowledge domains. AO (82.73% and EJO (76.99% were relatively more committed toward publication of research work in comparison to AJODO (34.55%. Research articles based on perception and questionnaires (12%, temporary anchorage devices (11%, cone-beam computed tomography (8%, invisible orthodontics (lingual orthodontics, clear aligners, esthetic brackets, and wires (5%, and airway examination (5% were the five most recurrently selected subjects of interest (41% in these three journals during the observation period. The total number of research articles published in the three journals reduced statistically significantly in 2014 when compared to 2010.

  16. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.

    1979-10-01

    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  17. Escherichia coli Single-Stranded DNA-Binding Protein: NanoESI-MS Studies of Salt-Modulated Subunit Exchange and DNA Binding Transactions

    Science.gov (United States)

    Mason, Claire E.; Jergic, Slobodan; Lo, Allen T. Y.; Wang, Yao; Dixon, Nicholas E.; Beck, Jennifer L.

    2013-02-01

    Single-stranded DNA-binding proteins (SSBs) are ubiquitous oligomeric proteins that bind with very high affinity to single-stranded DNA and have a variety of essential roles in DNA metabolism. Nanoelectrospray ionization mass spectrometry (nanoESI-MS) was used to monitor subunit exchange in full-length and truncated forms of the homotetrameric SSB from Escherichia coli. Subunit exchange in the native protein was found to occur slowly over a period of hours, but was significantly more rapid in a truncated variant of SSB from which the eight C-terminal residues were deleted. This effect is proposed to result from C-terminus mediated stabilization of the SSB tetramer, in which the C-termini interact with the DNA-binding cores of adjacent subunits. NanoESI-MS was also used to examine DNA binding to the SSB tetramer. Binding of single-stranded oligonucleotides [one molecule of (dT)70, one molecule of (dT)35, or two molecules of (dT)35] was found to prevent SSB subunit exchange. Transfer of SSB tetramers between discrete oligonucleotides was also observed and is consistent with predictions from solution-phase studies, suggesting that SSB-DNA complexes can be reliably analyzed by ESI mass spectrometry.

  18. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  19. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.

    1992-01-01

    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  20. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  1. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: simonaclichici@yahoo.com [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)

    2012-03-15

    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  2. Influência da secção transversa de fios ortodônticos na fricção superficial de braquetes autoligados Influence of the cross-section of orthodontic wires on the surface friction of self-ligating brackets

    Directory of Open Access Journals (Sweden)

    Roberta Buzzoni

    2011-08-01

    Full Text Available OBJETIVO: o objetivo do presente trabalho foi determinar a força de atrito estático entre braquetes de aço inoxidável autoligados com sistema de fechamento resiliente e fios ortodônticos redondos e retangulares do mesmo material. MÉTODOS: empregaram-se 30 braquetes referentes aos caninos superiores divididos em 6 grupos formados por braquetes autoligados Smartclip, In-Ovation R e convencionais Gemini amarrados com ligaduras elásticas. A hipótese testada neste trabalho foi quanto à possibilidade dos braquetes autoligados ativos serem suscetíveis à elevação da força de atrito com o aumento e alteração da secção transversal dos fios ortodônticos. Os ensaios foram realizados com tração de 30s em fios de aço inoxidável 0,020" e 0,019"X0,025" na máquina de ensaios Emic DL 10000, com uma célula de carga de 20 newtons. Cada conjunto braquete/fio foi responsável pela geração de quatro corpos de prova, totalizando 120 leituras. As comparações entre as médias foram realizadas através da Análise de Variância (one way ANOVA com correções pelo coeficiente de Bonferroni. RESULTADOS E CONCLUSÃO: os braquetes autoligados apresentaram maior força de atrito do que os braquetes convencionais amarrados com ligaduras elásticas. O grupo Smartclip foi o mais efetivo no controle do atrito (pOBJECTIVES: The purpose of this study was to assess the surface friction produced by self-ligating stainless steel brackets equipped with a resilient closure system and compare the friction generated during traction of round and rectangular orthodontic wires made from the same material. METHODS: Thirty maxillary canine brackets were divided into six groups comprising SmartClip and In-Ovation R self-ligating brackets, and conventional Gemini brackets tied with elastomeric ligatures. This investigation tested the hypothesis that self-ligating brackets are susceptible to increases in friction that are commensurate with increases and changes in the

  3. Temperature Changes of Pulp Chamber during In Vitro Laser Welding of Orthodontic Attachments

    Science.gov (United States)

    İşman, Eren; Okşayan, Rıdvan; Sökücü, Oral; Üşümez, Serdar

    2014-01-01

    The use of lasers has been suggested for orthodontists to fabricate or repair orthodontic appliances by welding metals directly in the mouth. This work aimed to evaluate the temperature changes in the pulp chamber during welding of an orthodontic wire to an orthodontic molar band using Nd : YAG laser in vitro. A freshly extracted human third molar with eliminated pulpal tissues was used. J-type thermocouple wire was positioned in the pulp chamber. A conductor gel was used in the transferring of outside temperature changes to the thermocouple wire. An orthodontic band was applied to the molar tooth and bonded using light cured orthodontic cement. Twenty five mm length of 0.6 mm diameter orthodontic stainless steel wires was welded to the orthodontic band using Nd : YAG laser operated at 9.4 watt. Temperature variation was determined as the change from baseline temperature to the highest temperature was recorded during welding. The recorded temperature changes were between 1.8 and 6.8°C (mean: 3.3 ± 1.1°C). The reported critical 5.5°C level was exceeded in only one sample. The results of this study suggest that intraoral use of lasers holds great potential for the future of orthodontics and does not present a thermal risk. Further studies with larger samples and structural analysis are required. PMID:24550714

  4. Temperature Changes of Pulp Chamber during In Vitro Laser Welding of Orthodontic Attachments

    Directory of Open Access Journals (Sweden)

    Eren İşman

    2014-01-01

    Full Text Available The use of lasers has been suggested for orthodontists to fabricate or repair orthodontic appliances by welding metals directly in the mouth. This work aimed to evaluate the temperature changes in the pulp chamber during welding of an orthodontic wire to an orthodontic molar band using Nd : YAG laser in vitro. A freshly extracted human third molar with eliminated pulpal tissues was used. J-type thermocouple wire was positioned in the pulp chamber. A conductor gel was used in the transferring of outside temperature changes to the thermocouple wire. An orthodontic band was applied to the molar tooth and bonded using light cured orthodontic cement. Twenty five mm length of 0.6 mm diameter orthodontic stainless steel wires was welded to the orthodontic band using Nd : YAG laser operated at 9.4 watt. Temperature variation was determined as the change from baseline temperature to the highest temperature was recorded during welding. The recorded temperature changes were between 1.8 and 6.8°C (mean: 3.3 ± 1.1°C. The reported critical 5.5°C level was exceeded in only one sample. The results of this study suggest that intraoral use of lasers holds great potential for the future of orthodontics and does not present a thermal risk. Further studies with larger samples and structural analysis are required.

  5. Photobiomodulation accelerates orthodontic alignment in the early phase of treatment.

    Science.gov (United States)

    Kau, Chung How; Kantarci, Alpdogan; Shaughnessy, Tim; Vachiramon, Amornpong; Santiwong, Peerapong; de la Fuente, Alvaro; Skrenes, Darya; Ma, Dennis; Brawn, Peter

    2013-09-19

    Numerous strategies have been proposed to decrease the treatment time a patient requires in orthodontic treatment. Recently, a number of device-accelerated therapies have emerged in orthodontics. Photobiomodulation is an emerging area of science that has clinical applications in a number of human biological processes. The aim of this study was to determine if photobiomodulation reduces the treatment time in the alignment phase of orthodontic treatment. This multicenter clinical trial was performed on 90 subjects (73 test subjects and 17 controls), and Little's Index of Irregularity (LII) was used as a measure of the rate of change of tooth movement. Subjects requiring orthodontic treatment were recruited into the study, and the LII was measured at regular time intervals. Test subjects used a device which produced near-infrared light with a continuous 850-nm wavelength. The surface of the cheek was irradiated with a power density of 60 mW/cm2 for 20 or 30 min/day or 60 min/week to achieve total energy densities of 72, 108, or 216 J/cm2, respectively. All subjects were fitted with traditional orthodontic brackets and wires. The wire sequences for each site were standardized to an initial round alignment wire (014 NiTi or 016 NiTi) and then advanced through a progression of stiffer arch wires unit alignment occurred (LIIorthodontic treatment.

  6. Precision multiloop (PM Design with space closing circles for lingual orthodontics

    Directory of Open Access Journals (Sweden)

    Mugdha P Mankar

    2016-01-01

    Full Text Available The proficiency of ancient orthodontics has been benefitted colossally and is being continually promoted over the present, by use of multiple loop wires designed for correction of dentoalveolar malocclusions. The presented discussion provides an insight into a simple, frictionless biomechanical concept of anterior space closure in lingual orthodontics by means of precision multiloop design with incorporated space closing circles. A multiple loop wire design has been demonstrated where the entire interbracket distance is used as loop area.

  7. Precision multiloop (PM Design) with space closing circles for lingual orthodontics

    OpenAIRE

    Mugdha P Mankar; Achint Chachada; Harish Atram; Avanti Kulkarni

    2016-01-01

    The proficiency of ancient orthodontics has been benefitted colossally and is being continually promoted over the present, by use of multiple loop wires designed for correction of dentoalveolar malocclusions. The presented discussion provides an insight into a simple, frictionless biomechanical concept of anterior space closure in lingual orthodontics by means of precision multiloop design with incorporated space closing circles. A multiple loop wire design has been demonstrated where the ent...

  8. Contemporary Esthetic Orthodontic Archwires – A Review

    Directory of Open Access Journals (Sweden)

    Jitesh Haryani

    2016-09-01

    Full Text Available Growing demand of invisible braces byesthetically conscious patients has led to remarkable inventions in materials for esthetic labial archwires. Archwires with excellent optical clarity and mechanical properties comparable to conventional archwires have been manufactured by almost all the leading companies of orthodontic products in the past two decades, but their clinical use is still limited. Esthetic archwires can be divided into two main types, which are transparent non-metallic archwires (composite wires and metallic wires with esthetic coatings. This article intends to provide an overview of various types of esthetic archwires available, and to gather evidence from the literature regarding their clinical applicability.

  9. Clinicians' Choices in Selecting Orthodontic Archwires

    Directory of Open Access Journals (Sweden)

    Silvia-Izabella Pop

    2013-08-01

    Full Text Available Objective: The aim of this study was to assess the choices made by clinicians in selecting archwires during the initial, intermediate and final stages of orthodontic treatment with fixed appliances. Methods: We carried out a questionnaire-based study at the Orthodontics and Pedodontics Clinic Târgu Mureș, between March 2012 and September 2012. The questionnaires consisted of two parts: the first included questions related to the dimension, alloy used in fabrication, section (round or rectangular and manufacturer of the archwires used by the orthodontists in their orthodontic practice, the second part was concerned with their personal opinion about the physical properties and disadvantages of the archwires. Results: From a total number of 90 distributed questionnaires, 62 were returned. The majority of clinicians are using stainless steel (SS and nickel-titanium alloy (NiTi wires in their fixed orthodontic treatments, very few are using beta-titanium (Beta Ti, copper nickel-titanium (Co- NiTi and esthetic archwires. The preferred dimension seem to be 0.022 inches in the appliance system. Regarding the wire dimensions, 0.014, 0.016 inch wires are mostly used from the round section group and 0.016 × 0.022 inch, 0.017 × 0.025 inch from the rectangular ones. Conclusions: There is a general lack of agreement between the clinicians surveyed regarding the properties of an ideal archwire and the disadvantages of the used wires. The most frequently used alloys seemed to be the SS and NiTi

  10. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus

    Science.gov (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.

    2016-01-01

    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  11. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy

    OpenAIRE

    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried

    2013-01-01

    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  12. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  13. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.

    1989-01-01

    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  14. A single-stranded RNA copy of the Giardia lamblia virus double-stranded RNA genome is present in the infected Giardia lamblia.

    OpenAIRE

    Furfine, E S; White, T C; Wang, A L; Wang, C C

    1989-01-01

    An isolate of Giardia lamblia infected with the double-stranded RNA virus (GLV) has two major species of RNA that are not present in an uninfected isolate. One of these species is the previously characterized double-stranded RNA genome of GLV (1). The second species of RNA appears to be a full length copy of one strand of the double-stranded RNA genome. This full length single-stranded RNA is not present in viral particles isolated from the growth medium. The cellular concentration of the sin...

  15. Corticotomy-assisted orthodontics

    OpenAIRE

    Cano, J.; Campo, Julián; Bonilla, Elena; Colmenero Ruiz, César

    2012-01-01

    The use of orthodontic treatment in adult patients is becoming more common and these patients have different requirements specially regarding duration of treatment and facial and dental aesthetics. Alveolar corticotomy is an effective means of accelerating orthodontic treatment. This literature revision include an historical background, biological and orthodontic fundamentals and the most significant clinical applications of this technique. Orthodontic treatment time is reduced with this tech...

  16. Wire Chamber

    CERN Multimedia

    Magnetoscriptive readout wire chamber. Multi-wire detectors contain layers of positively and negatively charged wires enclosed in a chamber full of gas. A charged particle passing through the chamber knocks negatively charged electrons out of atoms in the gas, leaving behind positive ions. The electrons are pulled towards the positively charged wires. They collide with other atoms on the way, producing an avalanche of electrons and ions. The movement of these electrons and ions induces an electric pulse in the wires which is collected by fast electronics. The size of the pulse is proportional to the energy loss of the original particle.

  17. Wire chamber

    CERN Multimedia

    1967-01-01

    Magnetoscriptive readout wire chamber.Multi-wire detectors contain layers of positively and negatively charged wires enclosed in a chamber full of gas. A charged particle passing through the chamber knocks negatively charged electrons out of atoms in the gas, leaving behind positive ions. The electrons are pulled towards the positively charged wires. They collide with other atoms on the way, producing an avalanche of electrons and ions. The movement of these electrons and ions induces an electric pulse in the wires which is collected by fast electronics. The size of the pulse is proportional to the energy loss of the original particle.

  18. wire chamber

    CERN Multimedia

    Proportional multi-wire chamber. Multi-wire detectors contain layers of positively and negatively charged wires enclosed in a chamber full of gas. A charged particle passing through the chamber knocks negatively charged electrons out of atoms in the gas, leaving behind positive ions. The electrons are pulled towards the positively charged wires. They collide with other atoms on the way, producing an avalanche of electrons and ions. The movement of these electrons and ions induces an electric pulse in the wires which is collected by fast electronics. The size of the pulse is proportional to the energy loss of the original particle. Proportional wire chambers allow a much quicker reading than the optical or magnetoscriptive readout wire chambers.

  19. [The prehistory of orthodontics].

    Science.gov (United States)

    Philippe, Julien

    2015-06-01

    Orthodontics came into being in 1728. Previously, practitioners were at a loss when confronted with crooked teeth. A Latin philosopher had an ingenious flash of orthodontic inspiration. Other authors were content to either extract the malposed teeth or to modify their shape. However, interest in an approach to preventive orthodontics had now begun. © EDP Sciences, SFODF, 2015.

  20. Understanding the Shape-Memory Alloys Used in Orthodontics

    OpenAIRE

    Fernandes, Daniel J.; Peres, Rafael V.; Mendes, Alvaro M.; Elias, Carlos N.

    2011-01-01

    Nickel-titanium (NiTi) shape-memory alloys (SMAs) have been used in the manufacture of orthodontic wires due to their shape memory properties, super-elasticity, high ductility, and resistance to corrosion. SMAs have greater strength and lower modulus of elasticity when compared with stainless steel alloys. The pseudoelastic behavior of NiTi wires means that on unloading they return to their original shape by delivering light continuous forces over a wider range of deformation which is claimed...

  1. Craniofacial orthodontics and postgraduate orthodontic training in ...

    African Journals Online (AJOL)

    2015-06-21

    Jun 21, 2015 ... Introduction: Craniofacial orthodontics has been shown to be a critical component of the care of patients with craniofacial anomalies such as cleft lip and palate. Thus, the purpose of this study was to assess the perceptions and clinical experience in cleft and craniofacial care, of orthodontic residents in ...

  2. FiberWire is superior in strength to stainless steel wire for tension band fixation of transverse patellar fractures.

    Science.gov (United States)

    Wright, P B; Kosmopoulos, V; Coté, R E; Tayag, T J; Nana, A D

    2009-11-01

    The metal implants used to achieve fixation of displaced transverse patellar fractures are associated with implant failure, postoperative pain and a significant re-operation rate. Recent studies have examined braided suture as a possible alternative to stainless steel wire to increase patient satisfaction and decrease re-operation rates, but suture has not demonstrated clearly superior fixation strength. FiberWire is a reinforced braided polyblend suture that has demonstrated superior characteristics to the previous sutures studied and has not to our knowledge been examined as a material for tension band fixation of transverse patellar fractures. Materials testing was performed on repeated samples of No. 5 FiberWire suture and 18-gauge stainless steel wire. The strength and stiffness of each material was measured. The two materials were then used for tension band fixation on a novel transverse patellar fracture model and tested to failure by three-point bending. The constructs included a single stainless steel wire, a single-strand FiberWire tied with a sliding knot, double-strand FiberWire tied with sliding knots and double-strand FiberWire tied with a Wagoner's Hitch. The fixation strength and stiffness of the constructs were measured. Unlike stainless steel, FiberWire maintained its initial stiffness until failure. Furthermore, during three-point-bend testing, double-strand FiberWire was found to have a significantly higher failure load than stainless steel wire when the suture was tied and locked under the tension produced by a modified Wagoner's Hitch. FiberWire is a potentially superior alternative to stainless steel wire in tension band fixation of transverse patellar fractures.

  3. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  4. Oxidized base damage and single-strand break repair in mammalian genomes: role of disordered regions and posttranslational modifications in early enzymes.

    Science.gov (United States)

    Hegde, Muralidhar L; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic endonuclease 1 (APE1), form complexes with downstream repair (and other noncanonical) proteins via pairwise interactions. Furthermore, a unique feature of mammalian early BER/SSBR enzymes is the presence of a disordered terminal extension that is absent in their Escherichia coli prototypes. These nonconserved segments usually contain organelle-targeting signals, common interaction interfaces, and sites of posttranslational modifications that may be involved in regulating their repair function including lesion scanning. Finally, the linkage of BER/SSBR deficiency to cancer, aging, and human neurodegenerative diseases, and therapeutic targeting of BER/SSBR are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples.

    Science.gov (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J

    2006-03-01

    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  6. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast.

    Science.gov (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A

    2010-08-05

    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  7. Isolation and characterization of a single-stranded DNA virus infecting the marine diatom Chaetoceros sp. strain SS628-11 isolated from western Japan.

    Directory of Open Access Journals (Sweden)

    Kei Kimura

    Full Text Available Diatoms are significant organisms for primary production in the earth's aquatic environment. Hence, their dynamics are an important focus area in current studies. Viruses are a great concern as potential factors of diatom mortality, along with other physical, chemical, and biological factors. We isolated and characterized a new diatom virus (Csp07DNAV that lyses the marine planktonic diatom Chaetoceros sp. strain SS628-11. This paper examines the physiological, morphological, and genomic characteristics of Csp07DNAV. The virus was isolated from a surface water sample that was collected at Hiroshima Bay, Japan. It was icosahedral, had a diameter of 34 nm, and accumulated in the nuclei of host cells. Rod-shaped virus particles also coexisted in the host nuclei. The latent period and burst size were estimated to be <12 h and 29 infectious units per host cell, respectively. Csp07DNAV had a closed circular single-stranded DNA genome (5,552 nucleotides, which included a double-stranded region and 3 open reading frames. The monophyly of Csp07DNAV and other Bacilladnavirus group single-stranded DNA viruses was supported by phylogenetic analysis that was based on the amino acid sequence of each virus protein. On the basis of these results, we considered Csp07DNAV to be a new member of the genus Bacilladnavirus.

  8. Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library.

    Directory of Open Access Journals (Sweden)

    Sumate Pengpumkiat

    Full Text Available Chemical synthesis of oligonucleotides is a widely used tool in the field of biochemistry. Several methods for gene synthesis have been introduced in the growing area of genomics. In this paper, a novel method of constructing dsDNA is proposed. Short (28-mer oligo fragments from a library were assembled through successive annealing and ligation processes, followed by PCR. First, two oligo fragments annealed to form a dsDNA molecule. The double-stranded oligo was immobilized onto magnetic beads (solid support via streptavidin-biotin binding. Next, single-stranded oligo fragments were added successively through ligation to form the complete DNA molecule. The synthesized DNA was amplified through PCR and gel electrophoresis was used to characterize the product. Sanger sequencing showed that more than 97% of the nucleotides matched the expected sequence. Extending the length of the DNA molecule by adding single-stranded oligonucleotides from a basis set (library via ligation enables a more convenient and rapid mechanism for the design and synthesis of oligonucleotides on the go. Coupled with an automated dispensing system and libraries of short oligo fragments, this novel DNA synthesis method would offer an efficient and cost-effective method for producing dsDNA.

  9. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  10. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H

    2012-02-22

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  11. On-site detection of Phytophthora spp.—single-stranded target DNA as the limiting factor to improve on-chip hybridization

    International Nuclear Information System (INIS)

    Schwenkbier, Lydia; Pollok, Sibyll; Popp, Jürgen; Weber, Karina; König, Stephan; Wagner, Stefan; Werres, Sabine; Weber, Jörg; Hentschel, Martin

    2014-01-01

    We report on a lab-on-a-chip approach for on-site detection of Phytophthora species that allows visual signal readout. The results demonstrate the significance of single-stranded DNA (ssDNA) generation in terms of improving the intensity of the hybridization signal and to improve the reliability of the method. Conventional PCR with subsequent heat denaturation, sodium hydroxide-based denaturation, lambda exonuclease digestion and two asymmetric PCR methods were investigated for the species P. fragariae, P. kernoviae, and P. ramorum. The positioning of the capture probe within the amplified yeast GTP-binding protein (YPT1) target DNA was also of interest because it significantly influences the intensity of the signal. Statistical tests were used to validate the impact of the ssDNA generation methods and the capture-target probe position. The single-stranded target DNA generated by Linear-After-The-Exponential PCR (LATE-PCR) was found to produce signal intensities comparable to post-PCR exonuclease treatment. The LATE-PCR is the best method for the on-site detection of Phytophthora because the enzymatic digestion after PCR is more laborious and time-consuming. (author)

  12. [Evaluation of three dimensional orthodontic force produced by magnet of fix appliance].

    Science.gov (United States)

    Dai, Xin; Hou, Zhi-ming; Yao, Ge; Wen, Jing-long

    2008-12-01

    To analyze the feature and magnitude of three dimensional orthodontic force produced by the magnet of fix appliance. Forces detected by universal fatigue test system included the attractive and repulsive,the inclined and rotated orthodontic forces of two magnets in different air gaps, and the integrated inclined and rotated orthodontic forces of two magnets and NiTi wire. The attractive and repulsive forces of two magnets were 4.68 to 0.45 N and 3.00 to 0.40 N respectively in the air gaps of 0 to 5 mm. The inclined orthodontic forces were 1.54 to 1.67 N, 0.63 to 0.69 N, 0.47 to 0.54 N when the magnets were vertically inclined 10 degrees to 40 degrees in the air gaps of 0, 1, 2mm. The rotated orthodontic forces were 0.97 to 1.32 N, 0.53 to 0.59 N, 0.39 to 0.48 N when the magnets were horizontally rotated 10 degrees to 40 degrees in the air gaps of 0, 1, 2mm. The integrated orthodontic force of two magnets and 0.014-inch NiTi wire was 0.32 to 0.5 N when the magnets was vertically inclined 10 degrees to 40 degrees in the air gap of 4 mm. The integrated orthodontic force of two magnets and 0.012-inch NiTi wire was 0.32 to 0.39 N when the magnets were horizontally rotated 10 degrees to 40 degrees in the air gap of 3 mm. Magnets made into orthodontic brackets to some extent could replace the mechanical orthodontic force produced by orthodontic wires and elastics.

  13. wire chamber

    CERN Multimedia

    Was used in ISR (Intersecting Storage Ring) split field magnet experiment. Multi-wire detectors contain layers of positively and negatively charged wires enclosed in a chamber full of gas. A charged particle passing through the chamber knocks negatively charged electrons out of atoms in the gas, leaving behind positive ions. The electrons are pulled towards the positively charged wires. They collide with other atoms on the way, producing an avalanche of electrons and ions. The movement of these electrons and ions induces an electric pulse in the wires which is collected by fast electronics. The size of the pulse is proportional to the energy loss of the original particle.

  14. Wire chamber

    CERN Multimedia

    Multi-wire detectors contain layers of positively and negatively charged wires enclosed in a chamber full of gas. A charged particle passing through the chamber knocks negatively charged electrons out of atoms in the gas, leaving behind positive ions. The electrons are pulled towards the positively charged wires. They collide with other atoms on the way, producing an avalanche of electrons and ions. The movement of these electrons and ions induces an electric pulse in the wires which is collected by fast electronics. The size of the pulse is proportional to the energy loss of the original particle.

  15. wire chamber

    CERN Multimedia

    Multi-wire detectors contain layers of positively and negatively charged wires enclosed in a chamber full of gas. A charged particle passing through the chamber knocks negatively charged electrons out of atoms in the gas, leaving behind positive ions. The electrons are pulled towards the positively charged wires. They collide with other atoms on the way, producing an avalanche of electrons and ions. The movement of these electrons and ions induces an electric pulse in the wires which is collected by fast electronics. The size of the pulse is proportional to the energy loss of the original particle.

  16. wire chamber

    CERN Multimedia

    1985-01-01

    Multi-wire detectors contain layers of positively and negatively charged wires enclosed in a chamber full of gas. A charged particle passing through the chamber knocks negatively charged electrons out of atoms in the gas, leaving behind positive ions. The electrons are pulled towards the positively charged wires. They collide with other atoms on the way, producing an avalanche of electrons and ions. The movement of these electrons and ions induces an electric pulse in the wires which is collected by fast electronics. The size of the pulse is proportional to the energy loss of the original particle.

  17. Mini-implants for orthodontic anchorage

    NARCIS (Netherlands)

    Reynders, Reint Meursinge; Ladu, Luisa

    2017-01-01

    Data sourcesPubmed, Embase, Cochrane Central Register of Controlled Trials and the Web of Science databases. Hand searches of the journals European Journal of Orthodontics, Journal of Orthodontics, Journal of Clinical Orthodontics, Seminars in Orthodontics, American Journal of Orthodontics &

  18. Comparação de parâmetros periodontais após utilização de contenção ortodôntica com fio trançado e contenção modificada Comparison of periodontal parameters after the use of orthodontic multi-stranded wire retainers and modified retainers

    Directory of Open Access Journals (Sweden)

    Marlice Azoia Lukiantchuki

    2011-08-01

    Full Text Available OBJETIVO: o presente estudo teve como objetivo comparar dois tipos de contenções ortodônticas fixas, em relação a parâmetros periodontais estabelecidos. A contenção com fio trançado é a mais comumente utilizada e a contenção modificada apresenta dobras que têm a finalidade de permitir o livre acesso do fio dental às áreas interproximais. MÉTODOS: para esse estudo cruzado, foram selecionados 12 voluntários que utilizaram, por 6 meses, A Contenção com fio trançado e B Contenção modificada - sendo essas fixadas em todos os dentes do segmento anterior. Após esse período experimental, foram feitas as seguintes avaliações: Índice de Placa Dentária, Índice Gengival, Índice de Cálculo Dentário e Índice de Cálculo ao longo do fio de contenção. Os voluntários também responderam a um questionário com relação à utilização, conforto e higienização das contenções. RESULTADOS: foi observado que o índice de placa e o índice gengival foram maiores nas faces linguais (pOBJECTIVE: The objective of the present study was to compare two types of fixed orthodontic retainers (a multi-stranded wire retainer and a modified retainer in relation to established periodontal parameters. The multi-stranded wire retainer is commonly used, and the modified retainer has bends to enable free access of dental floss to interproximal areas. METHODS: For this crossover study, 12 volunteers were selected and used the following retainers for six months: (A a multi-stranded wire retainer and (B a modified retainer. Both retainers were fixed to all anterior lower teeth.After this experimental period, the following evaluations were made: Dental Plaque Index, Gingival Index, Dental Calculus Index and Retainer Wire Calculus Index. The volunteers also responded to a questionnaire about the use, comfort and hygiene of the retainers. RESULTS: It was observed that the plaque index and the gingival index were higher on the lingual surface (p<0

  19. Orthodontic Implants: Concepts for the Orthodontic Practitioner

    Directory of Open Access Journals (Sweden)

    Carlos Nelson Elias

    2012-01-01

    Full Text Available Orthodontic implants have become a reliable method in orthodontic practice for providing temporary additional anchorage. These devices are useful to control skeletal anchorage in less compliant patients or in cases where absolute anchorage is necessary. There are a great number of advantages in this new approach which include easy insertion, decreased patient discomfort, low price, immediate loading, reduced diameter, versatility in the forces to be used, ease of cleaning, and ease of removal. However, a proper management of the screws by the practitioner is necessary in order to increase the success rate of the technique. The purpose of this paper is to update practitioners on the current concepts of orthodontic implants and orthodontic mechanics.

  20. Synthesis of a wild-type and three mutant Cucurbita maxima trypsin inhibitor-encoding genes by a single-strand approach.

    Science.gov (United States)

    Botes, D P; Qobose, M D; Corfield, V A

    1991-09-15

    A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.

  1. The casein genes in goat breeds from different Continents: analysis by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP

    Directory of Open Access Journals (Sweden)

    A. Caroli

    2010-04-01

    Full Text Available A screening of casein gene variability was carried out by Polymerase Chain Reaction – Single Strand Conformation Polymorphism in 8 goat breeds from Sudan (Nubian goat, Turkey (Angora Goat Lalahan Tiftic, Angora Goat Yerkoy, Hair goat and India (Jammu, Maharashtra, Rajasthan, South Goat. A total of 16 different alleles or groups of alleles were found, showing conspicuous differences among breeds. The allele frequencies were submitted to cluster analysis in order to highlight differences between breeds, also including data from Red Sokoto, West African Dwarf Nigeria, West African Dwarf Cameroon, and Borno Goat. The tree obtained from the cluster analysis showed two main lineages. The West African goat clustered together, the Indian and Turkish breeds were in the other group. Nubian goat was found in an intermediate position.

  2. Investigation of single-strand conformational polymorphism of the TP53 gene in women with a family history of breast cancer

    Directory of Open Access Journals (Sweden)

    R.R. Burbano

    2000-11-01

    Full Text Available Breast cancer in families with germ line mutations in the TP53 gene has been described in the medical literature. Mutation screening for susceptibility genes should allow effective prophylactic and preventive measures. Using single-strand conformational polymorphism, we screened for mutations in exons 5, 6, 7 and 8 of gene TP53 in the peripheral blood of 8 young non-affected members (17 to 36 years old of families with a history of breast cancer. Studies of this type on young patients (mean age, 25 years are very rare in the literature. The identification of these mutations would contribute to genetic counseling of members of families with predisposition to breast cancer. The results obtained did not show any polymorphism indicating mutation. In our sample, the familial tumorigenesis is probably related to other gene etiologies.

  3. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.

    1994-01-01

    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  4. Influence of the single-strand linker composition on the structural/dynamical properties of a truncated octahedral DNA nano-cage family.

    Science.gov (United States)

    Iacovelli, Federico; Alves, Cassio; Falconi, Mattia; Oteri, Francesco; de Oliveira, Cristiano L P; Desideri, Alessandro

    2014-10-01

    The structural/dynamical properties of three truncated octahedral DNA nano-cages composed by identical double helices but single strand linkers with different composition, namely 7 thymidines, 7 adenines, and 7 alternated thymidines and adenines, have been investigated through classical molecular dynamics simulations. Trajectories have been analyzed to investigate the role of the linkers in defining nano-cages stability and flexibility, including possible influence on the internal cages motions. The data indicate that the cages behavior is almost identical and that the structural/dynamical parameters measured along the trajectories are not particularly affected by the presence of different bases. These results demonstrate that the constraints imposed by the nano-structure geometry are the main factor in modulating these properties

  5. Localization of specific sequences and DNA single-strand breaks in individual UV-A-irradiated human lymphocytes by COMET FISH

    Science.gov (United States)

    Bock, Claudia; Rapp, Alexander; Dittmar, Heike; Monajembashi, Shamci; Greulich, Karl-Otto

    1999-01-01

    The COMET assay, a single cell electrophoresis technique which allows to separate electrophoretically fractionated DNA according to size has been combined with fluorescence in situ hybridization (FISH) which allows to localize specific genes or gene regions. This combination (COMET FISH) allows the detection of DNA single strand breaks in specific regions of the genome of human lymphocytes at the single cell level. Various types of DNA probes, e.g. centromere-, (alpha) - satellite-, telomere-, whole chromosome-, single copy- and region specific DNA probes have been used to investigate whether the UV-A induced DNA single strand breaks are distributed randomly all over the human genome or induced at specific sites ('hot spots'). In the investigated human peripheral blood lymphocytes all but one centromere reveal low sensitivity for UV-A irradiation (500 kJ/m2), while telomeres are randomly distributed over COMET heads and tails. The human chromosome 1 is fractionated by irradiation, but remains in the COMET head, indicating an only moderate degree of fractionation. Among three tested single copy probes, c- myc, p53 and p58, the p53 gene located on chromosome 17p13.1 and the p58 gene (1p36) appear to be located in UV-A stable regions of the human genome in 95% of 65 investigated lymphocytes. In contrast, the c-myc proto-oncogene (8q24) is found in the COMET tail in 90% of the 27 investigated lymphocytes and thus appears to be more sensitive to UV-A irradiation.

  6. Evidence that single-stranded DNA breaks are a normal feature of koala sperm chromatin, while double-stranded DNA breaks are indicative of DNA damage.

    Science.gov (United States)

    Zee, Yeng Peng; López-Fernández, Carmen; Arroyo, F; Johnston, Stephen D; Holt, William V; Gosalvez, Jaime

    2009-08-01

    In this study, we have used single and double comet assays to differentiate between single- and double-stranded DNA damage in an effort to refine the interpretation of DNA damage in mature koala spermatozoa. We have also investigated the likelihood that single-stranded DNA breakage is part of the natural spermiogenic process in koalas, where its function would be the generation of structural bends in the DNA molecule so that appropriate packaging and compaction can occur. Koala spermatozoa were examined using the sperm chromatin dispersion test (SCDt) and comet assays to investigate non-orthodox double-stranded DNA. Comet assays were conducted under 1) neutral conditions; and 2) neutral followed by alkaline conditions (double comet assay); the latter technique enabled simultaneous visualisation of both single-stranded and double-stranded DNA breaks. Following the SCDt, there was a continuum of nuclear morphotypes, ranging from no apparent DNA fragmentation to those with highly dispersed and degraded chromatin. Dispersion morphotypes were mirrored by a similar diversity of comet morphologies that could be further differentiated using the double comet assay. The majority of koala spermatozoa had nuclei with DNA abasic-like residues that produced single-tailed comets following the double comet assay. The ubiquity of these residues suggests that constitutive alkali-labile sites are part of the structural configuration of the koala sperm nucleus. Spermatozoa with 'true' DNA fragmentation exhibited a continuum of comet morphologies, ranging from a more severe form of alkaline-susceptible DNA with a diffuse single tail to nuclei that exhibited both single- and double-stranded breaks with two comet tails.

  7. Functional roles of the N- and C-terminal regions of the human mitochondrial single-stranded DNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Marcos T Oliveira

    2010-10-01

    Full Text Available Biochemical studies of the mitochondrial DNA (mtDNA replisome demonstrate that the mtDNA polymerase and the mtDNA helicase are stimulated by the mitochondrial single-stranded DNA-binding protein (mtSSB. Unlike Escherichia coli SSB, bacteriophage T7 gp2.5 and bacteriophage T4 gp32, mtSSBs lack a long, negatively charged C-terminal tail. Furthermore, additional residues at the N-terminus (notwithstanding the mitochondrial presequence are present in the sequence of species across the animal kingdom. We sought to analyze the functional importance of the N- and C-terminal regions of the human mtSSB in the context of mtDNA replication. We produced the mature wild-type human mtSSB and three terminal deletion variants, and examined their physical and biochemical properties. We demonstrate that the recombinant proteins adopt a tetrameric form, and bind single-stranded DNA with similar affinities. They also stimulate similarly the DNA unwinding activity of the human mtDNA helicase (up to 8-fold. Notably, we find that unlike the high level of stimulation that we observed previously in the Drosophila system, stimulation of DNA synthesis catalyzed by human mtDNA polymerase is only moderate, and occurs over a narrow range of salt concentrations. Interestingly, each of the deletion variants of human mtSSB stimulates DNA synthesis at a higher level than the wild-type protein, indicating that the termini modulate negatively functional interactions with the mitochondrial replicase. We discuss our findings in the context of species-specific components of the mtDNA replisome, and in comparison with various prokaryotic DNA replication machineries.

  8. Numerical Investigation of Corrugated Wire Mesh Laminate

    Directory of Open Access Journals (Sweden)

    Jeongho Choi

    2013-01-01

    Full Text Available The aim of this work is to develop a numerical model of Corrugated Wire Mesh Laminate (CWML capturing all its complexities such as nonlinear material properties, nonlinear geometry and large deformation behaviour, and frictional behaviour. Development of such a model will facilitate numerical simulation of the mechanical behaviour of the wire mesh structure under various types of loading as well as the variation of the CWML configuration parameters to tailor its mechanical properties to suit the intended application. Starting with a single strand truss model consisting of four waves with a bilinear stress-strain model to represent the plastic behaviour of stainless steel, the finite element model is gradually built up to study single-layer structures with 18 strands of corrugated wire meshes consistency and double- and quadruple-layered laminates with alternating crossply orientations. The compressive behaviour of the CWML model is simulated using contact elements to model friction and is compared to the load-deflection behaviour determined experimentally in uniaxial compression tests. The numerical model of the CWML is then employed to conduct the aim of establishing the upper and lower bounds of stiffness and load capacity achievable by such structures.

  9. The Effect of Wire Dimension, Type and Thickness of Coating Layer on Friction of Coated Stainless-Steel Arch Wires

    Directory of Open Access Journals (Sweden)

    Ahmed Abdulhussain Abbas

    2018-03-01

    Full Text Available Background/Purpose: Esthetic coated arch wires are the desired types to match esthetic brackets in the clinical orthodontics, but the presence of coating layer is greatly affect friction during sliding mechanics. The aims of this study were to evaluate the effect of total wire dimension with the type and thickness of coating layer on friction of coated stainless-steel wires. Methods: The sample of this study consisted of 140 segments of coated stainless-steel arch wires involving two wire dimensions (0.016 × 0.022 inch and 0.019 × 0.025 inch. The samples were supplied from seven companies (DB, RMO, TP, DANY, G&H, Highland and Hubit and the uncoated control samples were supplied from IOS company. Wire dimensions and thickness of coating layer were measured by the metallurgical light incident microscope and the static frictional force was measured using pulling the wire through set of ceramic brackets by the universal testing machine. The data were then statistically analyzed using ANOVA tests. Results: Generally measured wire dimensions do not match the stated dimensions by the manufacturer. The frictional forces of coated wires differ from uncoated control being higher in the labially coated wires and lesser in the fully Teflon coated wires owing to differences in the wire dimension, thickness of coating layer, and physical properties of coating materials. Conclusion: when tested in vitro, Teflon fully coated wires produce the least amount of friction.

  10. Corticotomy-assisted orthodontics.

    Science.gov (United States)

    Cano, Jorge; Campo, Julián; Bonilla, Elena; Colmenero, César

    2012-02-01

    The use of orthodontic treatment in adult patients is becoming more common and these patients have different requirements specially regarding duration of treatment and facial and dental aesthetics. Alveolar corticotomy is an effective means of accelerating orthodontic treatment. This literature revision include an historical background, biological and orthodontic fundamentals and the most significant clinical applications of this technique. Orthodontic treatment time is reduced with this technique to one-third of that in conventional orthodontics. Alveolar bone grafting of labial and palatal/lingual surfaces ensures root coverage as the dental arch is expanded. Corticotomy-assisted orthodontics has been reported in a few clinical cases, and seems to be a promising adjuvant technique, indicated for many situations in the orthodontic treatment of adults without active periodontal pathology. Its main advantages are reduction of treatment time and postorthodontic stability. Further controlled prospective and histological studies are needed to study tooth movement, post-retention stability, and microstructural features of teeth, periodontium, and regenerated bone after using this procedure. Key words:Corticotomy, osteotomy, accelerated orthodontics.

  11. [Computer assisted orthodontic diagnosis].

    Science.gov (United States)

    Romeo García, A; González Blanco, A

    1991-03-01

    Quick Ceph is a program to help in orthodontic diagnosis, which is not limited to lateral cephalometric analysis but also allows, thanks to the Macintosh graphic interface the simulation of all orthodontic and surgical movements and so this to establish a treatment plan.

  12. [Preprosthetic orthodontic treatments

    NARCIS (Netherlands)

    Prahl-Andersen, B.; Prahl, C.; Baat, C. de; Creugers, N.H.J.

    2014-01-01

    The objective of a preprosthetic orthodontic treatment is to position the teeth in such a way that a treatment with (fixed) dental prostheses is made possible or simplified or to affect the result of this treatment positively. Conceivable preprosthetic orthodontic treatments are: correcting primary

  13. A Comparative Study of Orthodontic Coil Springs

    OpenAIRE

    Deepak Kumar Agarwal; Anup Razdan; Abhishek Agarwal; Preeti Bhattacharya; Ankur Gupta; D N Kapoor

    2011-01-01

    Several types of force delivering system are used to carry out tooth movement in orthodontics. Coil springs being one of them are used for the same thus requiring minimal operator manipulation. Aims and objectives : The purpose of this study was to determine the effect of wire diameter, lumen size and length of coil spring on the load produced as a function of displacement of SS and NiTi coil spring. Materials and methods : The study consisted of 60 samples of open and closed coil sprin...

  14. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide

    2015-10-01

    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  15. Surface Modification of Orthodontic Bracket Models via Ion Implantation: Effect on Coefficients of Friction

    Science.gov (United States)

    1989-01-01

    was accomplished and tested against the four major orthodontic alloy groups, [stainless steel (S.S.), cobalt-chromium (Co-Cr), nickel-titanium ( NiTi ...premolar extraction case measured friction values as a bracket slid over an arch wire. To deliver a constant ligature force, a coil spring maintained...accomplished and tested against the four major orthodontic alloy groups, [stainless steel (S.S.), cobalt-chromium (Co-Cr), nickel-titanium ( NiTi

  16. Effect of material variation on the biomechanical behaviour of orthodontic fixed appliances: a finite element analysis.

    Science.gov (United States)

    Papageorgiou, Spyridon N; Keilig, Ludger; Hasan, Istabrak; Jäger, Andreas; Bourauel, Christoph

    2016-06-01

    Biomechanical analysis of orthodontic tooth movement is complex, as many different tissues and appliance components are involved. The aim of this finite element study was to assess the relative effect of material alteration of the various components of the orthodontic appliance on the biomechanical behaviour of tooth movement. A three-dimensional finite element solid model was constructed. The model consisted of a canine, a first, and a second premolar, including the surrounding tooth-supporting structures and fixed appliances. The materials of the orthodontic appliances were alternated between: (1) composite resin or resin-modified glass ionomer cement for the adhesive, (2) steel, titanium, ceramic, or plastic for the bracket, and (3) β-titanium or steel for the wire. After vertical activation of the first premolar by 0.5mm in occlusal direction, stress and strain calculations were performed at the periodontal ligament and the orthodontic appliance. The finite element analysis indicated that strains developed at the periodontal ligament were mainly influenced by the orthodontic wire (up to +63 per cent), followed by the bracket (up to +44 per cent) and the adhesive (up to +4 per cent). As far as developed stresses at the orthodontic appliance are concerned, wire material had the greatest influence (up to +155 per cent), followed by bracket material (up to +148 per cent) and adhesive material (up to +8 per cent). The results of this in silico study need to be validated by in vivo studies before they can be extrapolated to clinical practice. According to the results of this finite element study, all components of the orthodontic fixed appliance, including wire, bracket, and adhesive, seem to influence, to some extent, the biomechanics of tooth movement. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  17. Mechanical properties of coated superelastic archwires in conventional and self-ligating orthodontic brackets

    OpenAIRE

    Elayyan, Firas; Silikas, Nick; Bearn, David

    2010-01-01

    Introduction: Coated archwires have been introduced to improve esthetics during orthodontic treatment. Our aim was to investigate the mechanical properties of coated superelastic archwires compared with conventional superelastic archwires with conventional and self-ligating brackets. Methods: Four types of orthodontic archwires were investigated, 2 superelastic nickel-titanium and 2 coated Ultraesthetic archwires in 0.016-in and 0.018 × 0.025-in dimensions (all from G&H Wire, Greenwood, I...

  18. Preparation, mechanical, and in vitro properties of glass fiber-reinforced polycarbonate composites for orthodontic application.

    Science.gov (United States)

    Tanimoto, Yasuhiro; Inami, Toshihiro; Yamaguchi, Masaru; Nishiyama, Norihiro; Kasai, Kazutaka

    2015-05-01

    Generally, orthodontic treatment uses metallic wires made from stainless steel, cobalt-chromium-nickel alloy, β-titanium alloy, and nickel-titanium (Ni-Ti) alloy. However, these wires are not esthetically pleasing and may induce allergic or toxic reactions. To correct these issues, in the present study we developed glass-fiber-reinforced plastic (GFRP) orthodontic wires made from polycarbonate and E-glass fiber by using pultrusion. After fabricating these GFRP round wires with a diameter of 0.45 mm (0.018 inch), we examined their mechanical and in vitro properties. To investigate how the glass-fiber diameter affected their physical properties, we prepared GFRP wires of varying diameters (7 and 13 µm). Both the GFRP with 13-µm fibers (GFRP-13) and GFRP with 7 µm fibers (GFRP-7) were more transparent than the metallic orthodontic wires. Flexural strengths of GFRP-13 and GFRP-7 were 690.3 ± 99.2 and 938.1 ± 95.0 MPa, respectively; flexural moduli of GFRP-13 and GFRP-7 were 25.4 ± 4.9 and 34.7 ± 7.7 GPa, respectively. These flexural properties of the GFRP wires were nearly equivalent to those of available Ni-Ti wires. GFRP-7 had better flexural properties than GFRP-13, indicating that the flexural properties of GFRP increase with decreasing fiber diameter. Using thermocycling, we found no significant change in the flexural properties of the GFRPs after 600 or 1,200 cycles. Using a cytotoxicity detection kit, we found that the glass fiber and polycarbonate components comprising the GFRP were not cytotoxic within the limitations of this study. We expect this metal-free GFRP wire composed of polycarbonate and glass fiber to be useful as an esthetically pleasing alternative to current metallic orthodontic wire. © 2014 Wiley Periodicals, Inc.

  19. Metallurgical characterization, galvanic corrosion, and ionic release of orthodontic brackets coupled with Ni-Ti archwires.

    Science.gov (United States)

    Darabara, Myrsini S; Bourithis, Lefteris I; Zinelis, Spiros; Papadimitriou, George D

    2007-04-01

    In orthodontics, a combination of metallic alloys is placed into the oral cavity during medical treatment and thus the corrosion resistance and ionic release of these appliances is of vital importance. The aim of this study is to investigate the elemental composition, microstructure, hardness, corrosion properties, and ionic release of commercially available orthodontic brackets and Copper Ni-Ti archwires. Following the assessment of the elemental composition of the orthodontic wire (Copper Ni-Ti) and the six different brackets (Micro Loc, Equilibrium, OptiMESH(XRT), Gemini, Orthos2, and Rematitan), cyclic polarization curves were obtained for each material to estimate the susceptibility of each alloy to pitting corrosion in 1M lactic acid. Galvanic corrosion between the orthodontic wire and each bracket took place in 1M lactic acid for 28 days at 37 degrees C and then the ionic concentration of Nickel and Chromium was studied. The orthodontic wire is made up from a Ni-Ti alloy with copper additions, while the orthodontic brackets are manufactured by different stainless steel grades or titanium alloys. All tested wires and brackets with the exception of Gemini are not susceptible to pitting corrosion. In galvanic corrosion, following exposure for 28 days, the lowest potential difference (approximately 250 mV) appears for the orthodontic wire Copper Ni-Ti and the bracket made up from pure titanium (Rematitan) or from the stainless steel AISI 316 grade (Micro Loc). Following completion of the galvanic corrosion experiments, measurable quantities of chromium and nickel ions were found in the residual lactic acid solution. (c) 2006 Wiley Periodicals, Inc.

  20. Phase transitions in coated nickel titanium arch wires: A differential ...

    Indian Academy of Sciences (India)

    Abstract. Shape memory and super-elastic properties of orthodontic nickel titanium wires, which are crucial for its clinical performance are dependent on the austenitic–martensitic phase transitions in its metallic microstructure that happen as a result of temperature or stress. The objective of this study was to compare the ...

  1. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2016-05-28

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  2. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy

    2008-01-01

    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  3. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray.

    Science.gov (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino

    2008-08-25

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  4. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Science.gov (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino

    2008-01-01

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  5. A biomarker model of sublethal genotoxicity (DNA single-strand breaks and adducts) using the sentinel organism Aporrectodea longa in spiked soil

    International Nuclear Information System (INIS)

    Martin, Francis L.; Piearce, Trevor G.; Hewer, Alan; Phillips, David H.; Semple, Kirk T.

    2005-01-01

    There is a need to develop risk biomarkers during the remediation of contaminated land. We employed the earthworm, Aporrectodea longa (Ude), to determine whether genotoxicity measures could be applied to this organism's intestinal tissues. Earthworms were added, for 24 h or 7 days, to soil samples spiked with benzo[a]pyrene (B[a]P) and/or lindane. After exposure, intestinal tissues (crop/gizzard or intestine) were removed prior to the measurement in disaggregated cells of DNA single-strand breaks (SSBs) by the alkaline comet assay. Damage was quantified by comet tail length (CTL, μm). B[a]P 24-h exposure induced dose-related increases (P 32 P-postlabelling, showed a two-adduct-spot pattern. This preliminary investigation suggests that earthworm tissues may be incorporated into genotoxicity assays to facilitate hazard identification within terrestrial ecosystems. - Sublethal genotoxicity in the sentinel organism A. longa can be used to monitor the effects of contaminants in soil

  6. Conformation effects of CpG methylation on single-stranded DNA oligonucleotides: analysis of the opioid peptide dynorphin-coding sequences.

    Directory of Open Access Journals (Sweden)

    Malik Mumtaz Taqi

    Full Text Available Single-stranded DNA (ssDNA is characterized by high conformational flexibility that allows these molecules to adopt a variety of conformations. Here we used native polyacrylamide gel electrophoresis (PAGE, circular dichroism (CD spectroscopy and nuclear magnetic resonance (NMR spectroscopy to show that cytosine methylation at CpG sites affects the conformational flexibility of short ssDNA molecules. The CpG containing 37-nucleotide PDYN (prodynorphin fragments were used as model molecules. The presence of secondary DNA structures was evident from differences in oligonucleotide mobilities on PAGE, from CD spectra, and from formation of A-T, G-C, and non-canonical G-T base pairs observed by NMR spectroscopy. The oligonucleotides displayed secondary structures at 4°C, and some also at 37°C. Methylation at CpG sites prompted sequence-dependent formation of novel conformations, or shifted the equilibrium between different existing ssDNA conformations. The effects of methylation on gel mobility and base pairing were comparable in strength to the effects induced by point mutations in the DNA sequences. The conformational effects of methylation may be relevant for epigenetic regulatory events in a chromatin context, including DNA-protein or DNA-DNA recognition in the course of gene transcription, and DNA replication and recombination when double-stranded DNA is unwinded to ssDNA.

  7. Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Krzysztof Lepek

    2015-01-01

    Full Text Available Monitoring and control of infections are key parts of surveillance systems and epidemiological risk prevention. In the case of influenza A viruses (IAVs, which show high variability, a wide range of hosts, and a potential of reassortment between different strains, it is essential to study not only people, but also animals living in the immediate surroundings. If understated, the animals might become a source of newly formed infectious strains with a pandemic potential. Special attention should be focused on pigs, because of the receptors specific for virus strains originating from different species, localized in their respiratory tract. Pigs are prone to mixed infections and may constitute a reservoir of potentially dangerous IAV strains resulting from genetic reassortment. It has been reported that a quadruple reassortant, A(H1N1pdm09, can be easily transmitted from humans to pigs and serve as a donor of genetic segments for new strains capable of infecting humans. Therefore, it is highly desirable to develop a simple, cost-effective, and rapid method for evaluation of IAV genetic variability. We describe a method based on multitemperature single-strand conformational polymorphism (MSSCP, using a fragment of the hemagglutinin (HA gene, for detection of coinfections and differentiation of genetic variants of the virus, difficult to identify by conventional diagnostic.

  8. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS.

    Science.gov (United States)

    Pachkowski, Brian F; Tano, Keizo; Afonin, Valeriy; Elder, Rhoderick H; Takeda, Shunichi; Watanabe, Masami; Swenberg, James A; Nakamura, Jun

    2009-12-01

    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase beta.

  9. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against the Pesticide Fipronil and Sensitive Detection in River Water

    Directory of Open Access Journals (Sweden)

    Ka L. Hong

    2017-12-01

    Full Text Available Fipronil is a commonly used insecticide that has been shown to have environmental and human health risks. The current standard methods of detection for fipronil and its metabolites, such as GC-MS, are time consuming and labor intensive. In this study, a variant of systematic evolution of ligands by exponential enrichment (SELEX, was utilized to identify the first single-stranded DNA (ssDNA molecular recognition element (MRE that binds to fipronil with high affinity (Kd = 48 ± 8 nM. The selected MRE displayed low cross binding activity on various environmentally relevant, structurally unrelated herbicides and pesticides, in addition to broad-spectrum binding activity on major metabolites of fipronil and a structurally similar pesticide in prepared river samples. Additionally, a proof-of-principle fluorescent detection assay was developed by using the selected ssDNA MRE as a signal-reporting element, with a limit of detection of 105 nM in a prepared river water sample.

  10. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Boye, E.; Johansen, I.; Brustad, T.

    1976-01-01

    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 2 0 C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 2 0 C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  11. Clonal origin of multiple lung cancers: K-ras and p53 mutations determined by nonradioisotopic single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Lau, D H; Yang, B; Hu, R; Benfield, J R

    1997-08-01

    Disease stage is the most important factor in determining prognosis and treatment of lung cancer. Staging of lung cancer is complicated by presentation of multiple pulmonary malignant lesions with a similar histology. It is a dilemma to decide if these lesions are synchronous primaries arising from different malignant clones or metastases from a single clone. Lung cancer is associated with multiple genetic abnormalities including mutations of K-ras and p53, which are believed to occur prior to onset of metastasis. To determine the clonal origin of multiple pulmonary malginant nodules, we analyzed point-mutations of K-ras and p53 by microdissection, polymerase chain reactions (PCR), nonradioisotopic single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. Each pulmonary lesion was microdissected from paraffin slides. Genomic DNA was amplified by two sequential PCRs followed by electrophoresis in a minigel and silver staining. Deoxyribonucleic acid sequencing was performed if necessary to confirm a mutation found upon SSCP analysis. Applying this molecular approach, we were able to differentiate the clonal origins of multiple malignant nodules of the lung as exemplified by the two cases presented.

  12. Simultaneous identification of seven foodborne pathogens and Escherichia coli (pathogenic and nonpathogenic) using capillary electrophoresis-based single-strand conformation polymorphism coupled with multiplex PCR.

    Science.gov (United States)

    Oh, Mi-Hwa; Paek, Se-Hee; Shin, Gi Won; Kim, Hae-Yeong; Jung, Gyoo Yeol; Oh, Sangsuk

    2009-06-01

    The objective of this study was to develop a novel technique for parallel analysis of eight important foodborne microbes using capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) coupled with multiplex PCR. Specific primers for multiplex PCR amplification of the 16S rRNA gene were designed, corresponding to eight species of bacteria, including Escherichia coli, Clostridium perfringens, Campylobacter jejuni, Salmonella enterica, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Bacillus cereus, for the species-specific identification and optimal separation of their PCR products in subsequent analysis by CE-SSCP. Multiplex PCR conditions including annealing temperature, extension time, the number of PCR cycles, and primer concentrations were then optimized for simultaneous detection of all target foodborne bacteria. The diagnostic system using CE-SSCP combined with multiplex PCR developed here can be used for rapid investigation of causative agents of foodborne illness. The simplicity and high sensitivity of the method may lead to improved management of safety and illness related to food.

  13. Selection and Characterization of Single-Stranded DNA Aptamers Binding Human B-Cell Surface Protein CD20 by Cell-SELEX

    Directory of Open Access Journals (Sweden)

    Mansoureh Haghighi

    2018-03-01

    Full Text Available The B-lymphocyte antigen (CD20 is a suitable target for single-stranded (ss nucleic acid oligomer (aptamers. The aim of study was selection and characterization of a ssDNA aptamer against CD20 using Cell-Systematic Evolution of Ligands by Exponential Enrichment (Cell-SELEX. The cDNA clone of CD20 (pcDNA-CD20 was transfected to human embryonic kidney (HEK293T cells. Ten rounds of Cell-SELEX was performed on recombinant HEK-CD20 cells. The final eluted ssDNA pool was amplified and ligated in T/A vector for cloning. The plasmids of positive clones were extracted, sequenced and the secondary structures of the aptamers predicted using DNAMAN® software. The sequencing results revealed 10 different types; three of them had the highest thermodynamic stability, named AP-1, AP-2 and AP-3. The AP-1 aptamer was the most thermodynamically stable one (ΔGAP-1 = −10.87 kcal/mol with the highest binding affinity to CD20 (96.91 ± 4.5 nM. Since, the CD20 is a suitable target for recognition of B-Cell. The selected aptamers could be comparable to antibodies with many advantages. The AP-1, AP-2 and AP-3 could be candidate instead of antibodies for diagnostic and therapeutic applications in immune deficiency, autoimmune diseases, leukemia and lymphoma.

  14. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    Science.gov (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Integrative modelling coupled with ion mobility mass spectrometry reveals structural features of the clamp loader in complex with single-stranded DNA binding protein.

    Science.gov (United States)

    Politis, Argyris; Park, Ah Young; Hall, Zoe; Ruotolo, Brandon T; Robinson, Carol V

    2013-11-29

    DNA polymerase III, a decameric 420-kDa assembly, simultaneously replicates both strands of the chromosome in Escherichia coli. A subassembly of this holoenzyme, the seven-subunit clamp loader complex, is responsible for loading the sliding clamp (β2) onto DNA. Here, we use structural information derived from ion mobility mass spectrometry (IM-MS) to build three-dimensional models of one form of the full clamp loader complex, γ3δδ'ψχ (254 kDa). By probing the interaction between the clamp loader and a single-stranded DNA (ssDNA) binding protein (SSB4) and by identifying two distinct conformational states, with and without ssDNA, we assemble models of ψχ-SSB4 (108 kDa) and the clamp loader-SSB4 (340 kDa) consistent with IM data. A significant increase in measured collision cross-section (~10%) of the clamp loader-SSB4 complex upon DNA binding suggests large conformational rearrangements. This DNA bound conformation represents the active state and, along with the presence of ψχ, stabilises the clamp loader-SSB4 complex. Overall, this study of a large heteromeric complex analysed by IM-MS, coupled with integrative modelling, highlights the potential of such an approach to reveal structural features of previously unknown complexes of high biological importance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system.

    Science.gov (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus

    2011-04-06

    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  17. Orthodontic management of impacted central incisor: A clinical challenge

    Directory of Open Access Journals (Sweden)

    Amit Kumar Khera

    2017-01-01

    Full Text Available Multiple treatment options are available for patients who have impacted incisor. This paper shows a case in which orthodontic as well as surgical considerations in 10-year-old female child were presented in the management of impacted central incisor. The orthodontic treatment plan included three steps – creation of space, exposure of crown, and forced eruption. A unique and innovative technique for orthodontic traction (0.017 × 0.025 TMA wire with palatal extension was employed to move the maxillary incisor into arch, with minimum injury to neighboring soft tissue. After the successful management of impacted teeth, it is very important to periodically review the periodontal condition and stability.

  18. Lingual Orthodontics simplified : Incognito -customization perfected

    Directory of Open Access Journals (Sweden)

    Haroutioun Dedeyan

    2013-01-01

    Full Text Available Esthetic orthodontics is the need of the hour, fuelled by the increasing number of adult patients seeking orthodontic treatment. Alternatives to labial appliance include clear aligners and lingual appliance. Conventional lingual treatment is laborious in terms of laboratory setup and manual dexterity of the operator, coupled with less than optimum treatment results. Customization of the appliance to meet varied requirements of each patient due to highly variable lingual morphology within and amongst patients is the key to successful treatment in lingual orthodontics. Efforts at bracket base customization using intra-oral jigs and laboratory setups are fraught with unavoidable errors affecting treatment outcome. With the advent of computer-aided design and computer-aided manufacturing (CAD/CAM technology the Eldorado of true customization is now a reality. This paper introduces the Incognito Appliance System based on custom-made brackets and custom-made series of pre-bent wires using state of art CAD/CAM manufacturing procedures.

  19. porphyrin with single strand DNAs

    Indian Academy of Sciences (India)

    for organization of porphyrin molecules into extended assemblies, providing opportunities for construction of supramolecular structures.6–8 Among the porphyrin .... and consequently the mono- and bi-exponential nature of the decays were judged by the reduced chi-square. (χ2) values and distribution of the weighted ...

  20. An orthodontic oral appliance.

    Science.gov (United States)

    Marklund, Marie; Legrell, Per Erik

    2010-11-01

    This pilot study was performed to test the hypothesis that an orthodontic oral appliance (OA) that is designed to work against the backwardly directed forces on the upper incisors may counteract the reduction in overjet from these devices. Thirty patients with normal bites, good oral health, and milder sleep apnea were randomized to treatment with either OAs or orthodontic OAs. Bite changes were evaluated on plaster casts and radiographs and by questionnaires after a mean of 2.4 years in 19 frequent users. Four of nine patients in the orthodontic OA group increased their overjet by > or =0.4 mm, while none of the 10 patients in the OA group experienced that effect. Only the orthodontic OA increases the overjet; this design may therefore be beneficial to patients at risk of negative effects on their bite during OA treatment.

  1. Nickel allergy and orthodontics.

    Science.gov (United States)

    Rahilly, G; Price, N

    2003-06-01

    Nickel is the most common metal to cause contact dermatitis in orthodontics. Nickel-containing metal alloys, such as nickel-titanium and stainless steel, are widely used in orthodontic appliances. Nickel-titanium alloys may have nickel content in excess of 50 per cent and can thus potentially release enough nickel in the oral environment to elicit manifestations of an allergic reaction. Stainless steel has a lower nickel content (8 per cent). However, because the nickel is bound in a crystal lattice it is not available to react. Stainless steel orthodontic components are therefore very unlikely to cause nickel hypersensitivity. This article discusses the diagnosis of nickel allergy in orthodontics and describes alternative products that are nickel free or have a very low nickel content, which would be appropriate to use in patients diagnosed with a nickel allergy.

  2. Assessment of perceived orthodontic appliance attractiveness.

    Science.gov (United States)

    Ziuchkovski, James P; Fields, Henry W; Johnston, William M; Lindsey, Delwin T

    2008-04-01

    To date, no studies have been published in the literature evaluating the esthetics of orthodontic appliances. The purpose of this study was to assess appliance variables, including appliance type, brand, wire, and ligature tie, for their relative attractiveness. Demographic factors were also evaluated. Appliances were placed in an adult, and digital images were captured, standardized, and incorporated into a computer-based survey. Subjects (n = 200) rated each image for attractiveness on a visual analog scale. The attractiveness ratings were analyzed by using factorial analysis of variance with repeated measures. Post-hoc testing was done with the Tukey-Kramer test (overall a appliances), ceramic, and all self-ligating/stainless steel appliances. No differences between brands in each appliance type were found. Ratings of some ceramic appliances were significantly affected by archwire and ligature tie, depending on several demographic interactions. Orthodontic appliance attractiveness varies by the following hierarchy of appliance types: alternative > ceramic > all stainless steel/self-ligating. Wire and tie selection can affect the appearance of ceramic appliances but have no impact on stainless steel or self-ligating appliances. Certain demographic factors have variable effects on attractiveness ratings.

  3. Lingual orthodontics (part 2): archwire fabrication.

    Science.gov (United States)

    Wiechmann, D

    1999-01-01

    One essential component of a successful lingual treatment concept is the precise calculation and manufacture of individual lingual arch wires. As in several parts of daily life, the use of modern CAD/CAM technology leads in lingual orthodontic treatment to a rationalisation of working processes with maximized precision. The lingual module developed by the author is a new scanner-independent procedure for calculation and manufacture of individual lingual arch wires with the Orthomate/Orthotherm system (OrthoTel, Berlin/Dallas, Tx). Especially the precise individualization of superelastic, shape-memory materials reduces the archwire sequence and simplifies lingual treatment considerably. Individual second and third order overcorrections (incisal torque, reverse curve of Spee) can be programmed into the first archwire, with further three-dimensional corrections being added for each single tooth during finishing. Embedded in a systematic treatment concept, the use of modern CAD/CAM technology for individual lingual archwire production with the Orthomate/Orthotherm system is an important aid to successful integration of lingual orthodontic treatment into routine practice.

  4. Torsional Elastic Property Measurements of Selected Orthodontic Archwires.

    Science.gov (United States)

    1987-01-01

    properties of denture base acrylics . 26 In this experiment, an inverted pendulum was hung by a fine, fixed wire. The amplitude and frequency of...of Polymers. Polymer Engineering and Science 19:664-675. 26. Braden M, Stafford GD: Viscoelastic Properties of Some Denture Base Materials. J Dent...D-AiB5 669 TORSIONAL ELASTIC PROPERTY MEASUREMENTSO SLECE ORTHODONTIC ARCHWlIRES(U) AIR FORCE INST OF TECH WRIGHT-PATTERSON AFB OH B E LARSON 1987

  5. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA.

    Science.gov (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S

    2000-09-20

    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  6. Flow cytometry analysis of single-strand DNA damage in neuroblastoma cell lines using the F7-26 monoclonal antibody.

    Science.gov (United States)

    Grigoryan, Rita S; Yang, Bo; Keshelava, Nino; Barnhart, Jerry R; Reynolds, C Patrick

    2007-11-01

    The F7-26 monoclonal antibody (Mab) has been reported to be specific for single-strand DNA damage (ssDNA) and to also identify cells in apoptosis. We carriedout studies to determine if F7-26 binding measured by flow cytometry was able to specifically identify exogenous ssDNA as opposed to DNA damage from apoptosis. Neuroblastoma cells were treated with melphalan (L-PAM), fenretinide, 4-hydroperoxycyclophosphamide (4-HC)+/-pan-caspase inhibitor BOC-d-fmk, topotecan or with 10Gy gamma radiation+/-hydrogen peroxide (H2O2) and fixed immediately postradiation. Cytotoxicity was measured by DIMSCAN digital imaging fluorescence assay. The degree of ssDNA damage was analyzed by flow cytometry using Mab F7-26, with DNA visualized by propidium iodide counterstaining. Flow cytometry was used to measure apoptosis detected by terminal deoxynucleotidyltransferase (TUNEL) assay and reactive oxygen species (ROS) by carboxy-dichlorofluorescein diacetate. Irradiated and immediately fixed neuroblastoma cells showed increased ssDNA, but not apoptosis by TUNEL (TUNEL-negative). 4-HC or L-PAM+/-BOC-d-fmk increased ssDNA (F7-26-positive), but BOC-d-fmk prevented TUNEL staining. Fenretinide increased apoptosis by TUNEL but not ssDNA damage detected with F7-26. Enhanced ssDNA in neuroblastoma cells treated with radiation+H2O2 was associated with increased ROS. Topotecan increased both ssDNA and cytotoxicity in 4-HC-treated cells. These data demonstrate that Mab F7-26 recognized ssDNA due to exogenous DNA damage, rather than apoptosis. This assay should be useful to characterize the mechanism of action of antineoplastic drugs. Copyright (c) 2007 International Society for Analytical Cytology.

  7. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani

    2006-09-01

    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  8. Detection of p53 mutations by single-strand conformation polymorphisms (SSCP) gel electrophoresis. A comparative study of radioactive and nonradioactive silver-stained SSCP analysis.

    Science.gov (United States)

    Bosari, S; Marchetti, A; Buttitta, F; Graziani, D; Borsani, G; Loda, M; Bevilacqua, G; Coggi, G

    1995-12-01

    p53 mutations are the most common genetic abnormality in humans tumors, but their clinical significance remains to be precisely elucidated. Conventional single-strand conformation polymorphism (SSCP) analysis, a well-established technique for detecting p53 mutations, uses radioactively labeled polymerase chain reaction (PCR) products, which migrate abnormally in the presence of mutations. We performed radioactive PCR-SSCP analysis in a series of 30 formalin-fixed, paraffin-embedded ovarian carcinomas and two cell lines (SW480 and Caov4) harboring known homozygous p53 mutations and compared the results with nonradioactive silver-stained SSCP. The purpose was to assess whether nonradioactive SSCP is suitable for detecting p53 mutations in a rapid, sensitive, cost-effective fashion, without the need of radioactive isotopes. We accomplished PCR amplification of p53 exons 5 through 8 in 26 carcinomas, and radioactive SSCP detected p53 mutations in 13 tumors; three mutations were localized in exon 5, six in exon 6, two in exon 7, and two in exon 8. All mutations were correctly identified with nonradioactive SSCP, except for one exon 8 mutation. To establish the sensitivity of nonradioactive SSCP, DNA samples of SW480 and Caov4 were mixed with increasing amounts (0-90%) of normal DNA and subjected to PCR-SSCP analysis. Mutations were detected until the concentration of SW480 and Caov4 was 15% and 10%, respectively, of the total sample. The results of our investigation demonstrate that nonradioactive silver-stained SSCP is a sensitive, rapid, and simple technique to detect p53 mutations, even in formalin-fixed tissues, and could be easily used to investigate large series of patients to assess the clinical significance of p53 mutations in human tumors.

  9. Ampelomyces mycoparasites from apple powdery mildew identified as a distinct group based on single-stranded conformation polymorphism analysis of the rDNA ITS region.

    Science.gov (United States)

    Szentiványi, Orsolya; Kiss, Levente; Russell, John C; Kovács, Gábor M; Varga, Krisztina; Jankovics, Tünde; Lesemann, Silke; Xu, Xiang-Ming; Jeffries, Peter

    2005-04-01

    Pycnidial fungi belonging to the genus Ampelomyces are the most common natural antagonists of powdery mildews worldwide. During a study of the interactions between apple powdery mildew (Podosphaera leucotricha) and Ampelomyces mycoparasites, 52 new Ampelomyces isolates were obtained from P. leucotricha and, in addition, 13 new isolates from other species of the Erysiphaceae in four European countries. Their genetic diversity was screened using single-stranded conformation polymorphism (SSCP) analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). For comparison, 24 isolates obtained from genetic resource collections or other sources were included in this study. Based on the ITS-SSCP patterns, the isolates were placed in eight groups. The isolates belonged to two types based on their growth in culture. The faster-growing and the slower-growing isolates were included in different SSCP groups. A phylogenetic analysis of the ITS sequences of representatives of these groups confirmed the results obtained with the SSCP method, and showed that the faster-growing isolates do not belong to Ampelomyces as suggested by earlier studies. All the isolates from P. leucotricha fell into a distinct SSCP group of genetically homogeneous isolates. This suggests that Ampelomyces mycoparasites which occur in apple powdery mildew are slightly different from the other Ampelomyces groups which contain mycoparasites from various powdery mildew species. This may be because the main growth period of Ampelomyces mycoparasites in apple powdery mildew is isolated in time from that of Ampelomyces isolates that occur in other species of the Erysiphaceae. P. leucotricha starts its life-cycle early in the season, usually in March-April, while most powdery mildews are active in the same environments only late in the year.

  10. Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody: a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody.

    Science.gov (United States)

    Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua

    2018-02-01

    Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.

  11. Variabilidad genética de Aedes aegypti en algunas áreas del Perú usando Single Stranded Conformational Polymorphism (SSCP

    Directory of Open Access Journals (Sweden)

    Nélida Leiva G

    2004-07-01

    Full Text Available Aedes aegypti es el vector responsable de la transmisión del virus del dengue, su distribución geográfica se ha ampliado rápidamente debido principalmente a la intervención de los seres humanos. Objetivo: Analizar la variabilidad genética de este mosquito mediante la comparación del Segundo Espaciador Transcrito Interno (ITS 2 perteneciente al ADN ribosomal (rADN. Materiales y Métodos: Se analizaron muestras de ocho localidades (Jaén, Tingo María, Iquitos, Lambayeque, el distrito de El Rimac, Sullana y Zarumilla y uno de la provincia de Huaquillas (Ecuador. El análisis de la variabilidad se determinó usando la técnica conocida como SSCP (Single Stranded Conformation Polymorphism. Resultados: El estudio muestra que existe variabilidad genética entre las poblaciones analizadas, principalmente entre las muestras localizadas en la costa del Perú (Zarumilla, El Rímac, Sullana y Huaquillas y las muestras del nororiente (Tingo María, Iquitos, Jaén y Lambayeque Conclusión: Se determinaron dos variantes genéticas entre las poblaciones de Aedes aegypti: Costeña y Nororiental, que probablemente provienen de dos ancestros diferentes y cuyo ancestro común sufrió de aislamiento por distancia. Se observó que no existe relación entre las distancias genéticas y las distancias geográficas indicando que la migración de estas poblaciones es el resultado de la intervención de los seres humanos que diseminan al vector y no por la migración activa del mosquito. Se plantea el papel de la Cordillera de los Andes en la migración y separación de las poblaciones de Aedes.

  12. Detection of hybridization of single-strand DNA PCR products in temperature change process by a novel metal-clamping piezoelectric sensor.

    Science.gov (United States)

    Chen, Qinghai; Bian, Zhiheng; Hua, Xing; Yao, Chunyan; Wu, Wei; Zhang, Xue; Zhang, Bo; Huang, Junfu; Tang, Wanli; Fu, Weiling

    2010-05-15

    Oligonucleotide probes on the sensor surface can be hybridized with single-strand DNA (ssDNA) that is formed from PCR products in ice bath after degeneration. Thus, detection of PCR products by piezoelectric sensors requires the participation of ssDNA PCR products in ice bath. When PCR products in ice bath are added into the buffer of the sensor well at room temperature, there will be a temperature change process during mixing. However, it still remains unclear whether the temperature change affects the frequency baseline stability of the sensor and the result judgment, which is the basic condition for detecting hybridization of nucleic acid. In this study, we detected the hybridization of HPV PCR products during temperature change process by a self-designed adjustable metal-clamping piezoelectric sensor. The study mainly involves sensor adjustment, probe immobilization and ice bath sample addition (at different concentrations and different volumes). The response curve of basic frequency in temperature change process showed three stages, i.e., increase, decrease to baseline, and continuous decrease to stability. The early increase of frequency and duration of the time can reach 55+/-7.4 Hz and 39 min when 40 microL sample (0-1 degrees C) was added into 110 microL buffer (25 degrees C). The frequency increase effect caused by temperature difference at early stage depends on the volume ratio of two liquids and on the temperature difference. The results indicate that we should pay more attention to possibly small volume of PCR products in ice bath and minor temperature difference of two liquids in operation. 2010 Elsevier B.V. All rights reserved.

  13. Gauging the Nanotoxicity of h2D-C2N toward Single-Stranded DNA: An in Silico Molecular Simulation Approach.

    Science.gov (United States)

    Mukhopadhyay, Titas Kumar; Bhattacharyya, Kalishankar; Datta, Ayan

    2018-04-12

    Recent toxicological assessments of graphene, graphene oxides, and some other two-dimensional (2D) materials have shown them to be substantially toxic at the nanoscale, where they inhibit and eventually disrupt biological processes. These shortfalls of graphene and analogs have resulted in a quest for novel biocompatible 2D materials with minimum cytotoxicity. In this article, we demonstrate C 2 N (h2D-C 2 N), a newly synthesized 2D porous graphene analog, to be non-nanotoxic toward genetic materials from an "in-silico" point of view through sequence-dependent binding of different polynucleotide single-stranded DNA (ssDNA) onto it. The calculated binding energy of nucleobases and the free energy of binding of polynucleotides follow the common trait, cytosine > guanine > adenine > thymine, and are well within the limits of physisorption. Ab-initio simulations completely exclude the possibility of any chemical reaction, demonstrating purely noncovalent binding of nucleobases with C 2 N through a crucial interplay between hydrogen bonding and π-stacking interactions with the surface. Further, we show that the extent of distortion inflicted upon ssDNA by C 2 N is negligible. Analysis of the density of states of the nucleobase-C 2 N hybrids confirms minimum electronic perturbation of the bases after adsorption. Most importantly, we demonstrate the potency of C 2 N in nucleic acid transportation via reversible binding of ssDNA. The plausible use of C 2 N as a template for DNA repair is illustrated through an example of C 2 N-assisted complementary ssDNA winding.

  14. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms.

    Science.gov (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A

    2012-05-01

    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    Science.gov (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Lingual orthodontic education: An insight

    OpenAIRE

    Surya Kanta Das; Sanjay Labh; Ashish Kumar Barik

    2016-01-01

    Despite increasing demand for lingual orthodontics, the technique is not very popular among the orthodontists in general. Lingual orthodontics differs from the conventional labial technique in all aspects. Lack of comprehensive training in this field is a major obstacle in popularizing this science of invisible orthodontics. At present, short-term courses and part-time degree programs are the means to learn this technique and the demand for more comprehensive lingual orthodontic education is ...

  18. Optimal management of orthodontic pain

    OpenAIRE

    Topolski F; Moro A; Correr GM; Schimim SC

    2018-01-01

    Francielle Topolski,1 Alexandre Moro,1,2 Gisele Maria Correr,3 Sasha Cristina Schimim1 1Department of Orthodontics, Positivo University, Curitiba, Paraná, Brazil; 2Department of Orthodontics, Federal University of Paraná, Curitiba, Paraná, Brazil; 3Department of Restorative Dentistry, Positivo University, Curitiba, Paraná, Brazil Abstract: Pain is an undesirable side effect of orthodontic tooth movement, which causes many patients to give up orthodontic treatment o...

  19. Digital workflows in contemporary orthodontics

    Directory of Open Access Journals (Sweden)

    Lars R Christensen

    2017-01-01

    Full Text Available Digital workflows are now increasingly possible in orthodontic practice. Workflows designed to improve the customization of orthodontic appliances are now available through laboratories and orthodontic manufacturing facilities in many parts of the world. These now have the potential to improve certain aspects of patient care.

  20. Sliding mechanics of coated composite wires and the development of an engineering model for binding.

    Science.gov (United States)

    Zufall, S W; Kusy, R P

    2000-02-01

    A tribological (friction and wear) study, which was designed to simulate clinical sliding mechanics, was conducted as part of an effort to determine the suitability of poly(chloro-p-xylylene) coatings for composite orthodontic archwires. Prototype composite wires, having stiffnesses similar to those of current initial and intermediate alignment wires, were tested against stainless steel and ceramic brackets in the passive and active configurations (with and without angulation). Kinetic coefficient of friction values, which were determined to quantify sliding resistances as functions of the normal forces of ligation, had a mean that was 72% greater than uncoated wire couples at 0.43. To improve analysis of the active configuration, a mathematical model was developed that related bracket angulation, bracket width, interbracket distance, wire geometry, and wire elastic modulus to sliding resistance. From this model, kinetic coefficients of binding were determined to quantify sliding resistances as functions of the normal forces of binding. The mean binding coefficient was the same as that of uncoated wire couples at 0.42. Although penetrations through the coating were observed on many specimens, the glass-fiber reinforcement within the composite wires was undamaged for all conditions tested. This finding implies that the risk of glass fiber release during clinical use would be eliminated by the coating. In addition, the frictional and binding coefficients were still within the limits outlined by conventional orthodontic wire-bracket couples. Consequently, the coatings were regarded as an improvement to the clinical acceptability of composite orthodontic archwires.

  1. Contemporary esthetic nickel-titanium wires: do they deliver the same forces?

    Science.gov (United States)

    Washington, Bradford; Evans, Carla A; Viana, Grace; Bedran-Russo, Ana; Megremis, Spiro

    2015-01-01

    To test for differences in loading and unloading forces delivered by six coated nickel-titanium wires and their noncoated equivalents. From six commercial companies, 0.016-inch diameter round and 0.016 × 0.022-inch rectangular cross-section nickel-titanium wires were procured "as is": Rocky Mountain Orthodontics (Denver, Colo), TP Orthodontics (La Porte, Ind), American Orthodontics (AO; Sheboygan, Wis), G&H (Franklin, Ind), Opal Orthodontics (South Jordan, Utah), and Forestadent USA (St Louis, Mo) (round only). The wires were evaluated using a three-point bending test based on the method in ISO Standard 15841. No statistically significant differences (P > .05) in force values were found between coated and noncoated wires, listed by deflection in three-point bending, for these specific groups: 1 mm, TP round; 2 mm, TP round and G&H rectangular; 3 mm, G&H round and G&H rectangular; 2.5 mm,TP round and G&H rectangular; 1.5 mm, TP round, G&H round, G&H rectangular, and AO rectangular; and 0.5 mm, AO rectangular and G&H round. Some manufacturers market esthetic wires delivering forces similar to the equivalent noncoated wires, when tested according to a standard three-point bend method.

  2. The Stability of Double Jaw Surgery: A Comparison of Rigid Fixation versus Skeletal Wire Fixation

    Science.gov (United States)

    1988-08-01

    APPROVED BY THE DEPART M T OF ORTHODONTICS : (signed) 4IA Chairman APPROVED BY THE THESIS COMMITTEE: (signed) APPROVED BY THE GRADUATE COUNCIL...patients had rigid fixation to stabilize the segments and nine patients had skeletal wire fixation. Twenty- seven cephalometric parameters were examined...him has left me with a deep appreciation for his skill and dedication. For the unique opportunity to study Orthodontics here at Baylor, I must thank Dr

  3. Removable orthodontic appliance with nickel-titanium spring to reposition the upper incisors in an autistic patient.

    Science.gov (United States)

    Saito, Kan; Jang, Insan; Kubota, Kazumi; Hoshino, Tomonori; Hotokezaka, Hitoshi; Yoshida, Noriaki; Fujiwara, Taku

    2013-01-01

    A newly designed removable appliance with a shape-memory wire was used for the orthodontic treatment of the anterior teeth in an 11-year-old child who had autism and intellectual disability. The device was designed to reduce the lateral incisor crossbite and the central incisors' labial rotation. The child was treated for 1 year with this removable appliance. Tooth movement was analyzed using cephalograms and surface data were derived from study models. This device proved to be very durable. The lateral incisor crossbite was corrected, and the inclination of the upper central incisors and the interincisal angle were improved. This appliance exerts light and continuous orthodontic force, without requiring any adjustments of the spring wire. The appliance also facilitated orthodontic treatment in a child with intellectual disability in whom treatment with a standard orthodontic device would be unsuitable. ©2012 Special Care Dentistry Association and Wiley Periodicals, Inc.

  4. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W

    2009-12-23

    Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation

  5. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  6. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  7. Contribution of single-strand breaks and alkali-labile bonds to the loss of infectivity of γ-irradiated phiX174 RF-DNA in E. coli cells mutant in various repair functions

    International Nuclear Information System (INIS)

    McKee, R.H.

    1975-01-01

    Twenty-one radiation sensitive mutants have been examined for their capacity to support gamma-irradiated phiX174 RF-DNA. The survival of phiX174 RF-DNA was reduced in essentially all of the sensitive mutants. The irradiated phiX174 RF-DNA was then separated into populations containing either single-strand breaks or alkali-labile bonds to examine the capacity of the mutants to repair each of the classes of lesions. It was found that all E. coli strains are unable to repair 22 percent of the single-strand breaks and all sensitive mutants are unable to repair an additional 10 percent of the breaks. All the repair functions examined are involved in single-strand break repair and none are more or less necessary than any of the others. PhiX174 RF-DNA is also inactivated by alkali-labile bonds. In the normal strains the inactivation efficiency is 0.16 lethal events per lesion with a threshold dose of 15 to 20 krads. The mutants are divided into two classes by their sensitivity to alkali-labile bonds. Both classes of mutants are also inactivated by alkali-labile bonds with efficiencies of about 0.17 and 0.29 lethal events per lesion, respectively. It is proposed that the differences seen in survival curves of phiX174 measured in the sensitive mutants is due to this difference. Although in normal cells the efficiency of inactivation of phiX174 by single-strand breaks is 50 percent greater than by alkali-labile bonds, alkali-labile bonds are produced at approximately twice the rate of single-strand breaks so alkali-labile bonds account for about 61 percent of the overall inactivation. In the mutants of least sensitivity alkali-labile bonds account for about 54 percent of the inactivating events and in the most sensitive about 67 percent

  8. Aesthetic nickel titanium wires--how much do they deliver?

    Science.gov (United States)

    Kaphoor, Anil Abdul; Sundareswaran, Shobha

    2012-10-01

    The purpose of this study was to evaluate and compare the force levels of aesthetic Ni-Ti wires to regular Ni-Ti wires of the same dimension and evaluate their mechanical properties. Aesthetic and regular maxillary superelastic Ni-Ti wires (0.016 × 0.022) from four different manufacturers (G&H Wire Company, TP Orthodontics, GAC International, and Ortho Organizers) were selected and grouped I-IV. The loading and unloading values were compared using a three-point bending test. The unloading end values were also recorded to evaluate the recovery of archwires after each deflection. The unloading values were recorded at 0.5, 1.5, and 2.5 mm after loading deflections of 1, 2, and 3 mm, respectively. Cross-sectional scanning electron microscopy was used to assess the coating thickness of aesthetic wires. The results, statistically analysed, showed a significant decrease in force values for the aesthetic wires in groups I, III, and IV (P wires of the same dimension from the same manufacturer. There was no significant difference in force values for group II wires. A statistically significant decrease in force values of epoxy-coated wires was observed in groups I, III, and IV only. This is of obvious clinical significance during wire selection. The group II coated wires, however, exhibited forces comparable to their regular Ni-ti wires with a difference that was statistically insignificant. The end values of aesthetic wires showed almost complete recovery for groups I, II, and III after 2 and 3 mm deflections.

  9. Noncontextual Wirings

    Science.gov (United States)

    Amaral, Barbara; Cabello, Adán; Cunha, Marcelo Terra; Aolita, Leandro

    2018-03-01

    Contextuality is a fundamental feature of quantum theory necessary for certain models of quantum computation and communication. Serious steps have therefore been taken towards a formal framework for contextuality as an operational resource. However, the main ingredient of a resource theory—a concrete, explicit form of free operations of contextuality—was still missing. Here we provide such a component by introducing noncontextual wirings: a class of contextuality-free operations with a clear operational interpretation and a friendly parametrization. We characterize them completely for general black-box measurement devices with arbitrarily many inputs and outputs. As applications, we show that the relative entropy of contextuality is a contextuality monotone and that maximally contextual boxes that serve as contextuality bits exist for a broad class of scenarios. Our results complete a unified resource-theoretic framework for contextuality and Bell nonlocality.

  10. [Accelerated orthodontic treatment].

    Science.gov (United States)

    Liem, A M L; Hoogeveen, E J; Jansma, J; Ren, Y

    2015-11-01

    An orthodontic treatment usually involves a long process which often represents an obstacle for patients. To overcome this problem, surgical techniques have been developed to support and accelerate the orthodontic treatment. Two systematic reviews of the literature on clinical research and animal experiments were carried out in order to draw reliable conclusions about the effectiveness of the various surgical techniques. A total of 18 clinical studies and 22 animal experimental studies were analysed. In both reviews of the literature, a study was made of whether the surgical techniques resulted in an accelerated rate of tooth movement and which complications may be observed. In addition, which biological mechanisms take place during surgically facilitated orthodontics was investigated. Both reviews reported accelerated tooth movement with minimal complications after surgical procedures in comparison to conventional orthodontics. An increase in catabolic and anabolic activities was observed. It has to be concluded that based on the quality of the current literature there is still insufficient information for general conclusions and that more standardised prospective research is necessary for a reliable conclusion about the optimal method of treatment.

  11. Cephalometry in orthodontic practice

    International Nuclear Information System (INIS)

    Theunissen, J.J.W.; Terlingen, P.J.A.M.

    1980-01-01

    Cephalometry is applied in orthodontic practice to: - obtain information on the growth of the skull - assist diagnosis of the relationship between the jaws and abnormalities in dentition - evaluate the results of treatment. The course of the diagnostic procedure with the aid of the Ricketts analysis and evaluation of the treatment results using five superimpositions is demonstrated by means of two examples. (Auth.)

  12. Periodontally accelerated osteogenic orthodontics

    Directory of Open Access Journals (Sweden)

    Shailesh Mohanlal Bhandari

    2016-01-01

    Full Text Available This case report demonstrates an orthodontic method that offers short treatment time and the ability to simultaneously reshape and increase the buccolingual thickness of the supporting alveolar bone. A 23-year-old female with Angle′s Class I moderately to severely crowded malocclusion with periodontal pocket with 31 and reduced thickness of the buccal cortical plate of lower anteriors, requested shortened orthodontic treatment time. This surgery technique included buccal full-thickness flaps, selective partial decortication of the cortical plates, concomitant bone grafting/augmentation, and primary flap closure. Following the surgery, orthodontic adjustments were made approximately every 2 weeks. From bracketing to debracketing, the case was completed in approximately 7 months and 3 weeks. Posttreatment evaluation of patient revealed good results. Preexisting thin labial bony cortical plate with lower anteriors was covered. This finding suggests credence to the incorporation of the bone augmentation procedure into the corticotomy surgery because this made it possible to complete the orthodontic treatment with a more intact periodontium. The rapid expansive tooth movements with no significant apical root resorption may be attributed to the osteoclastic or catabolic phase of the regional acceleratory phenomenon.

  13. Characterization of a Novel Megabirnavirus from Sclerotinia sclerotiorum Reveals Horizontal Gene Transfer from Single-Stranded RNA Virus to Double-Stranded RNA Virus.

    Science.gov (United States)

    Wang, Minghong; Wang, Yong; Sun, Xiangzhong; Cheng, Jiasen; Fu, Yanping; Liu, Huiquan; Jiang, Daohong; Ghabrial, Said A; Xie, Jiatao

    2015-08-01

    Mycoviruses have been detected in all major groups of filamentous fungi, and their study represents an important branch of virology. Here, we characterized a novel double-stranded RNA (dsRNA) mycovirus, Sclerotinia sclerotiorum megabirnavirus 1 (SsMBV1), in an apparently hypovirulent strain (SX466) of Sclerotinia sclerotiorum. Two similarly sized dsRNA segments (L1- and L2-dsRNA), the genome of SsMBV1, are packaged in rigid spherical particles purified from strain SX466. The full-length cDNA sequence of L1-dsRNA/SsMBV1 comprises two large open reading frames (ORF1 and ORF2), which encode a putative coat protein and an RNA-dependent RNA polymerase (RdRp), respectively. Phylogenetic analysis of the RdRp domain clearly indicates that SsMBV1 is related to Rosellinia necatrix megabirnavirus 1 (RnMBV1). L2-dsRNA/SsMBV1 comprises two nonoverlapping ORFs (ORFA and ORFB) encoding two hypothetical proteins with unknown functions. The 5'-terminal regions of L1- and L2-dsRNA/SsMBV1 share strictly conserved sequences and form stable stem-loop structures. Although L2-dsRNA/SsMBV1 is dispensable for replication, genome packaging, and pathogenicity of SsMBV1, it enhances transcript accumulation of L1-dsRNA/SsMBV1 and stability of virus-like particles (VLPs). Interestingly, a conserved papain-like protease domain similar to a multifunctional protein (p29) of Cryphonectria hypovirus 1 was detected in the ORFA-encoded protein of L2-dsRNA/SsMBV1. Phylogenetic analysis based on the protease domain suggests that horizontal gene transfer may have occurred from a single-stranded RNA (ssRNA) virus (hypovirus) to a dsRNA virus, SsMBV1. Our results reveal that SsMBV1 has a slight impact on the fundamental biological characteristics of its host regardless of the presence or absence of L2-dsRNA/SsMBV1. Mycoviruses are widespread in all major fungal groups, and they possess diverse genomes of mostly ssRNA and dsRNA and, recently, circular ssDNA. Here, we have characterized a novel dsRNA virus

  14. Aesthetic orthodontic archwires: Progress in their knowledge

    OpenAIRE

    Rongo, Roberto

    2014-01-01

    Introduction: In orthodontics, is quickly increasing the demand for treatments with a very low aesthetic impact in the social life. More and more adult patients want satisfy their necessity to have a beautiful smile, with “invisible” appliances. Numerous are the opportunities to perform an aesthetic orthodontic treatment such as lingual orthodontics, clear aligners or clear labial orthodontics. Aesthetic orthodontic archwires are a component of clear labial orthodontics together with aestheti...

  15. Load-deflection characteristics of superelastic and thermal nickel-titanium wires.

    Science.gov (United States)

    Gatto, Elda; Matarese, Giovanni; Di Bella, Guido; Nucera, Riccardo; Borsellino, Chiara; Cordasco, Giancarlo

    2013-02-01

    The aim of this study was to investigate the mechanical properties of superelastic and thermal nickel-titanium (NiTi) archwires for correct selection of orthodontic wires. Seven different NiTi wires of two different sizes (0.014 and 0.016 inches), commonly used during the alignment phase, were tested. A three-point bending test was carried out to evaluate the load-deflection characteristics. The archwires were subjected to bending at a constant temperature of 37°C and deflections of 2 and 4 mm. Analysis of variance showed that thermal NiTi wires exerted significantly lower working forces than superelastic wires of the same size in all experimental tests (P Wire size had a significant effect on the forces produced: with an increase in archwire dimension, the released strength increased for both thermal and superelastic wires. Superelastic wires showed, at a deflection of 2 mm, narrow and steep hysteresis curves in comparison with the corresponding thermal wires, which presented a wide interval between loading and unloading forces. During unloading at 4 mm of deflection, all wires showed curves with a wider plateau when compared with 2 mm deflection. Such a difference for the superelastic wires was caused by the martensite stress induced at higher deformation levels. A comprehensive understanding of mechanical characteristics of orthodontic wires is essential and selection should be undertaken in accordance with the behaviour of the different wires. It is also necessary to take into account the biomechanics used. In low-friction mechanics, thermal NiTi wires are to be preferred to superelastic wires, during the alignment phase due to their lower working forces. In conventional straightwire mechanics, a low force archwire would be unable to overcome the resistance to sliding.

  16. Corrosion of weldments in orthodontic appliances

    International Nuclear Information System (INIS)

    Vazquez, S.M.; Riesgo, O.; Duffo, G.S.

    1997-01-01

    The study of corrosion-related problems of dental materials has undergone a considerable development in recent years in order to avoid the use of materials with insufficient corrosion resistance in patients mouth. The subject of the present work was to study a particular type of corrosion: galvanic corrosion. One of the most common case of galvanic couples in patients mouth are the orthodontic appliances. The materials studied in the present work were stainless steel strips and silver-copper wires, isolated and welded between them. The electrochemical tests were performed in a NaCl 0.1M and Lactic Acid 0.1 M solution (pH2.3), and after test, the specimens were observed using the optical and scanning electron microscope. The results show that when stainless steel is coupled with a silver solder, the last is the anode of the galvanic couple. As a consequence of this, the silver solder undergone a severe attack. Stainless steel orthodontic appliances with silver solder are feasibly destroyed due to a severe attack on the filler metal disjoining the welded parts. (author) 9 refs

  17. Improvement of orthodontic friction by coating archwire with carbon nitride film

    Energy Technology Data Exchange (ETDEWEB)

    Wei Songbo [State Key Laboratory of Tribology, Tsinghua University, Beijing 100084 (China); Shao Tianmin, E-mail: shaotm@mail.tsinghua.edu.cn [State Key Laboratory of Tribology, Tsinghua University, Beijing 100084 (China); Ding Peng [Department of Orthodontics, Peking University School and Hospital of Stomatology, Beijing 100081 (China)

    2011-10-01

    In order to reduce frictional resistance between archwire and bracket during orthodontic tooth movement, carbon nitride (CNx) thin films were deposited on the surface of archwires with ion beam assisted deposition (IBAD). The energy-dispersive X-ray spectrometer (EDS) analysis showed that the CNx film was successfully deposited on the surface of the orthodontic wires. X-ray photoelectron spectroscopy (XPS) analysis suggested that the deposited CNx film was sp{sup 2} carbon dominated structures, and diversiform bonds (N-C, N{identical_to}C, et al.) coexisted in the film. The friction tests indicated that the CNx film significantly reduced the wire-bracket friction both in ambient air and in artificial saliva. The sp{sup 2}C rich structure of the CNx film as well as its protection function for the archwire was responsible for the low friction of the wire-bracket sliding system.

  18. Lingual orthodontic appliances: invisible braces.

    Science.gov (United States)

    Muir, J C

    1991-04-01

    Lingual orthodontics is a relatively new method of delivering orthodontic treatment. These appliances may be used on any patient, but they have a special application for that small group of adult patients who need orthodontic treatment but refuse to accept the appearance of conventional appliances. The technique is difficult to manage and should be used only by experienced orthodontists. Although the patients may experience difficulties, these are usually adequately compensated for by the improved aesthetics.

  19. Optimal management of orthodontic pain

    OpenAIRE

    Topolski,Francielle; Moro,Alexandre; Correr,Gisele Maria; Schimim,Sasha Cristina

    2018-01-01

    Francielle Topolski,1 Alexandre Moro,1,2 Gisele Maria Correr,3 Sasha Cristina Schimim1 1Department of Orthodontics, Positivo University, Curitiba, Paraná, Brazil; 2Department of Orthodontics, Federal University of Paraná, Curitiba, Paraná, Brazil; 3Department of Restorative Dentistry, Positivo University, Curitiba, Paraná, Brazil Abstract: Pain is an undesirable side effect of orthodontic tooth movement, which causes many patients to give up orthodo...

  20. The influence of different types of fixed orthodontic appliance on the growth and adherence of microorganisms (in vitro study).

    Science.gov (United States)

    Saloom, Hayder F; Mohammed-Salih, Harraa S; Rasheed, Shaymaa F

    2013-02-01

    Orthodontic appliances serve as different impact zones and modify microbial adherence and colonization, acting as foreign reserves and possible sources of infection. This study was conducted to investigate the effect of different types of fixed orthodontic appliances on the growth and adherence of microorganisms in oral flora which are Streptococcus mutans (S. mutans) and Candida albicans. Sixty-four of four different fixed orthodontic appliance-samples were used, divided into four groups of sixteen. Type I: Sapphire brackets- Coated wires, type II: Sapphire brackets- Stainless steel wires, type III: Stainless steel brackets- Coated wires and type IV: Stainless steel brackets- Stainless steel wires. Oral strains of S. mutans and Candida albicans were studied in the present study using biochemical test then microbial suspensions were prepared to do the tests of each microorganism including the antimicrobial effects of different appliance-samples on the growth of microorganisms and their adhesion tests. The results showed significant differences between the different appliances in terms of inhibition zone formation (PAppliance with high esthetic appearance, sapphire brackets and coated arch wire, showed the least adherence of S. mutans and Candida albicans in comparison to other appliances with less esthetic and more metal components. Key words:Orthodontic appliance, Adherence, Streptococcus mutans, Candida albicans.

  1. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family.

    Science.gov (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław

    2017-05-01

    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  2. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D

    2010-01-01

    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  3. Increased type I collagen content and DNA binding activity of a single-stranded, cytosine-rich sequence in the high-salt buffer protein extract of the copper-deficient rat heart.

    Science.gov (United States)

    Zeng, Huawei; Saari, Jack T

    2004-11-01

    Dietary copper (Cu) deficiency not only causes a hypertrophic cardiomyopathy but also increases cancer risk in rodent models. However, a possible alteration in gene expression has not been fully examined. The present study was undertaken to determine the effect of Cu deficiency on protein profiles in rat heart tissue. Male Sprague-Dawley rats were fed diets that were either a Cu-adequate diet (6.0 microg Cu/g diet, n = 6) or a Cu-deficient diet (0.3 microg Cu/g diet, n = 6) for 5 weeks. The high-salt buffer (HSB) protein extract from heart tissue of Cu-deficient, but not Cu-adequate rats showed a 132 kDa protein band by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. This protein band stained pink with Coomassie Blue, suggesting the presence of collagens or other proline-rich proteins. Dot immunoblotting demonstrated that total type I collagen was increased by 110% in HSB protein extract from Cu-deficient, relative to Cu-adequate, rats. Liquid chromatography with mass spectrometry analysis indicated that the 132 kDa protein band contained a collagen alpha (I) chain precursor as well as a leucine-rich protein 130 (LRP130) in HSB protein extract from Cu-deficient but not Cu-adequate rats. A gel shift assay showed that HSB protein extract from Cu-deficient rats bound to a single-stranded cytosine-rich DNA with higher affinity than the extract of Cu-adequate rats, similar to reports of an increase in LRP130 single-stranded DNA binding activity in several types of tumor cells. Collectively, these results not only suggest an additional feature of altered collagen metabolism with Cu deficiency but also demonstrate for the first time an increase in single-stranded cytosine-rich DNA binding in Cu-deficient rat heart.

  4. Optimal management of orthodontic pain.

    Science.gov (United States)

    Topolski, Francielle; Moro, Alexandre; Correr, Gisele Maria; Schimim, Sasha Cristina

    2018-01-01

    Pain is an undesirable side effect of orthodontic tooth movement, which causes many patients to give up orthodontic treatment or avoid it altogether. The aim of this study was to investigate, through an analysis of the scientific literature, the best method for managing orthodontic pain. The methodological aspects involved careful definition of keywords and diligent search in databases of scientific articles published in the English language, without any restriction of publication date. We recovered 1281 articles. After the filtering and classification of these articles, 56 randomized clinical trials were selected. Of these, 19 evaluated the effects of different types of drugs for the control of orthodontic pain, 16 evaluated the effects of low-level laser therapy on orthodontic pain, and 21 evaluated other methods of pain control. Drugs reported as effective in orthodontic pain control included ibuprofen, paracetamol, naproxen sodium, aspirin, etoricoxib, meloxicam, piroxicam, and tenoxicam. Most studies report favorable outcomes in terms of alleviation of orthodontic pain with the use of low-level laser therapy. Nevertheless, we noticed that there is no consensus, both for the drug and for laser therapy, on the doses and clinical protocols most appropriate for orthodontic pain management. Alternative methods for orthodontic pain control can also broaden the clinician's range of options in the search for better patient care.

  5. A comparative study of metal artifacts from common metal orthodontic brackets in magnetic resonance imaging

    International Nuclear Information System (INIS)

    Kajan, Zahra Dalili; Alizadeh, Ahmad; Hemmaty, Yasmin Babael; Roushan, Zahra Atrkar; Khademi, Jalil

    2015-01-01

    This study was performed to compare the metal artifacts from common metal orthodontic brackets in magnetic resonance imaging. A dry mandible with 12 intact premolars was prepared, and was scanned ten times with various types of brackets: American, 3M, Dentaurum, and Masel orthodontic brackets were used, together with either stainless steel (SS) or nickel titanium (NiTi) wires. Subsequently, three different sequences of coronal and axial images were obtained: spin-echo T1-weighted images, fast spin-echo T2-weighted images, and fluid-attenuated inversion recovery images. In each sequence, the two sequential axial and coronal images with the largest signal-void area were selected. The largest diameters of the signal voids in the direction of the X-, Y-, and Z-axes were then measured twice. Finally, the mean linear values associated with different orthodontic brackets were analyzed using one-way analysis of variation, and the results were compared using the independent t-test to assess whether the use of SS or NiTi wires had a significant effect on the images. Statistically significant differences were only observed along the Z-axis among the four different brands of orthodontic brackets with SS wires. A statistically significant difference was observed along all axes among the brackets with NiTi wires. A statistically significant difference was found only along the Z-axis between nickel-free and nickel-containing brackets. With respect to all axes, the 3M bracket was associated with smaller signal-void areas. Overall, the 3M and Dentaurum brackets with NiTi wires induced smaller artifacts along all axes than those with SS wires

  6. A comparative study of metal artifacts from common metal orthodontic brackets in magnetic resonance imaging

    Energy Technology Data Exchange (ETDEWEB)

    Kajan, Zahra Dalili; Alizadeh, Ahmad; Hemmaty, Yasmin Babael; Roushan, Zahra Atrkar; Khademi, Jalil [Guilan University of Medical Sciences, Rasht (Iran, Islamic Republic of)

    2015-09-15

    This study was performed to compare the metal artifacts from common metal orthodontic brackets in magnetic resonance imaging. A dry mandible with 12 intact premolars was prepared, and was scanned ten times with various types of brackets: American, 3M, Dentaurum, and Masel orthodontic brackets were used, together with either stainless steel (SS) or nickel titanium (NiTi) wires. Subsequently, three different sequences of coronal and axial images were obtained: spin-echo T1-weighted images, fast spin-echo T2-weighted images, and fluid-attenuated inversion recovery images. In each sequence, the two sequential axial and coronal images with the largest signal-void area were selected. The largest diameters of the signal voids in the direction of the X-, Y-, and Z-axes were then measured twice. Finally, the mean linear values associated with different orthodontic brackets were analyzed using one-way analysis of variation, and the results were compared using the independent t-test to assess whether the use of SS or NiTi wires had a significant effect on the images. Statistically significant differences were only observed along the Z-axis among the four different brands of orthodontic brackets with SS wires. A statistically significant difference was observed along all axes among the brackets with NiTi wires. A statistically significant difference was found only along the Z-axis between nickel-free and nickel-containing brackets. With respect to all axes, the 3M bracket was associated with smaller signal-void areas. Overall, the 3M and Dentaurum brackets with NiTi wires induced smaller artifacts along all axes than those with SS wires.

  7. A comparative study of metal artifacts from common metal orthodontic brackets in magnetic resonance imaging

    Science.gov (United States)

    Khademi, Jalil; Alizadeh, Ahmad; Babaei Hemmaty, Yasamin; Atrkar Roushan, Zahra

    2015-01-01

    Purpose This study was performed to compare the metal artifacts from common metal orthodontic brackets in magnetic resonance imaging. Materials and Methods A dry mandible with 12 intact premolars was prepared, and was scanned ten times with various types of brackets: American, 3M, Dentaurum, and Masel orthodontic brackets were used, together with either stainless steel (SS) or nickel titanium (NiTi) wires. Subsequently, three different sequences of coronal and axial images were obtained: spin-echo T1-weighted images, fast spin-echo T2-weighted images, and fluid-attenuated inversion recovery images. In each sequence, the two sequential axial and coronal images with the largest signal-void area were selected. The largest diameters of the signal voids in the direction of the X-, Y-, and Z-axes were then measured twice. Finally, the mean linear values associated with different orthodontic brackets were analyzed using one-way analysis of variation, and the results were compared using the independent t-test to assess whether the use of SS or NiTi wires had a significant effect on the images. Results Statistically significant differences were only observed along the Z-axis among the four different brands of orthodontic brackets with SS wires. A statistically significant difference was observed along all axes among the brackets with NiTi wires. A statistically significant difference was found only along the Z-axis between nickel-free and nickel-containing brackets. Conclusion With respect to all axes, the 3M bracket was associated with smaller signal-void areas. Overall, the 3M and Dentaurum brackets with NiTi wires induced smaller artifacts along all axes than those with SS wires. PMID:26389058

  8. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: tcheng@ntu.edu.tw [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)

    2013-02-01

    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ► To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ► ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ► PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ► The findings

  9. Stretched Wire Mechanics

    Energy Technology Data Exchange (ETDEWEB)

    Bowden, Gordon; /SLAC

    2005-09-06

    Stretched wires are beginning to play an important role in the alignment of accelerators and synchrotron light sources. Stretched wires are proposed for the alignment of the 130 meter long LCLS undulator. Wire position technology has reached sub-micron resolution yet analyses of perturbations to wire straightness are hard to find. This paper considers possible deviations of stretched wire from the simple 2-dimensional catenary form.

  10. [Nickel allergy and orthodontics].

    Science.gov (United States)

    Leenen, R L J; Kuijpers-Jagtman, A M; Jagtman, B A; Katsaros, C

    2009-04-01

    Nickel hypersensitivity is a common problem, especially among young females, with a prevalence of 5 to 10%, increasing to 30%. In comparison with the oral mucosa, skin is more sensitive to an allergic reaction. The oral mucosa is less sensitive to nickel due to the difference in anatomical structure and the presence of pellicle. Nickel is used in many orthodontic appliances. Due to corrosion nickel ions can be released into the oral cavity. The extent of the corrosion of the appliance depends on the pH, the composition of saliva and plaque, temperature and mechanical loading. In spite of the relatively high amount of nickel processed in orthodontic appliances nickel allergies are rare. In cases of nickel-hypersensitivity, nickel-free appliances should be used.

  11. Efficacy of a prebrushing rinse for orthodontic patients.

    Science.gov (United States)

    Pontier, J P; Pine, C; Jackson, D L; DiDonato, A K; Close, J; Moore, P A

    1990-01-01

    The oral health benefits of a prebrushing rinse, when used in conjunction with an established twice-a-day brushing regimen, was investigated in a population of orthodontic patients. Twenty children (ages 11-18) who were undergoing orthodontic treatment that required brackets and labial wires were enrolled. This randomized, double-blind, cross-over clinical trial compared five weeks of twice-daily use of a commercial prebrushing rinse (Plax) to five weeks of a placebo rinse. Three investigators rated plaque accumulation (Simplified Oral Hygiene Index) and gingival health (modified O'Leary Index) prior to treatment and after each five week session. Because one child exited from the project and three children did not satisfactorily comply with the treatment protocol, sixteen children were used for the analysis. Although both treatment groups showed plaque and gingival improvement from pretreatment scores, no differences in plaque accumulation ratings and gingival health ratings were noted between the active and placebo rinse treatments.

  12. Reduction in static friction by deposition of a homogeneous diamond-like carbon (DLC) coating on orthodontic brackets.

    Science.gov (United States)

    Akaike, Shun; Hayakawa, Tohru; Kobayashi, Daishiro; Aono, Yuko; Hirata, Atsushi; Hiratsuka, Masanori; Nakamura, Yoshiki

    2015-01-01

    In orthodontics, a reduction in static friction between the brackets and wire is important to enable easy tooth movement. The aim of this study was to examine the effects of a homogeneous diamond-like carbon (DLC) coating on the whole surfaces of slots in stainless steel orthodontic brackets on reducing the static friction between the brackets and the wire. The DLC coating was characterized using Raman spectroscopy, surface roughness and contact angle measurements, and SEM observations. Rectangular stainless steel and titanium-molybdenum alloy wires with two different sizes were employed, and the static friction between the brackets and wire was measured under dry and wet conditions. The DLC coating had a thickness of approximately 1.0 μm and an amorphous structure was identified. The results indicated that the DLC coating always led to a reduction in static friction.

  13. Botox: In orthodontics

    Directory of Open Access Journals (Sweden)

    Harshal Ashok Patil

    2016-01-01

    Full Text Available Botulinum toxin type A (BTX-A (Botox, Allergan, Irvine, CA, USA has been studied since the late 1970s for the treatment of several conditions associated with excessive muscle contraction. Smile esthetics has become a major concern among patients and orthodontists. This article describes the efficient, nonsurgical, and less invasive use of BTX-A injection for the correction of a gummy smile in orthodontics.

  14. Oral health: orthodontic treatment.

    Science.gov (United States)

    Martonffy, Andrea Ildiko

    2015-01-01

    Improper tooth alignment due to crowding, malocclusion, and missing teeth can cause difficulties with eating and speech, and premature wear. It is estimated that more than 20% of children would benefit from orthodontic treatment to correct these conditions, many of which will persist into adulthood if not corrected. Orthodontic care is gaining popularity among adults for similar concerns, as well as for correction of cosmetic issues. The psychological effects of malocclusion should not be ignored. The American Association of Orthodontists recommends that all children undergo evaluation at the first recognition of an orthodontic condition and no later than age 7 years. Some children will need early treatment to help eliminate developing conditions and improve the foundations of the bite, which can ease later treatment in adolescence. For others, treatment in adolescence without early treatment is recommended. Standard cemented braces or clear, removable aligners may be used, depending on the patient's corrective needs. Average treatment time is approximately 2 years; this may be shortened by the use of accelerative techniques. Routine preventive dental care should be continued during the treatment period. Written permission from the American Academy of Family Physicians is required for reproduction of this material in whole or in part in any form or medium.

  15. Optimal management of orthodontic pain

    Directory of Open Access Journals (Sweden)

    Topolski F

    2018-03-01

    Full Text Available Francielle Topolski,1 Alexandre Moro,1,2 Gisele Maria Correr,3 Sasha Cristina Schimim1 1Department of Orthodontics, Positivo University, Curitiba, Paraná, Brazil; 2Department of Orthodontics, Federal University of Paraná, Curitiba, Paraná, Brazil; 3Department of Restorative Dentistry, Positivo University, Curitiba, Paraná, Brazil Abstract: Pain is an undesirable side effect of orthodontic tooth movement, which causes many patients to give up orthodontic treatment or avoid it altogether. The aim of this study was to investigate, through an analysis of the scientific literature, the best method for managing orthodontic pain. The methodological aspects involved careful definition of keywords and diligent search in databases of scientific articles published in the English language, without any restriction of publication date. We recovered 1281 articles. After the filtering and classification of these articles, 56 randomized clinical trials were selected. Of these, 19 evaluated the effects of different types of drugs for the control of orthodontic pain, 16 evaluated the effects of low-level laser therapy on orthodontic pain, and 21 evaluated other methods of pain control. Drugs reported as effective in orthodontic pain control included ibuprofen, paracetamol, naproxen sodium, aspirin, etoricoxib, meloxicam, piroxicam, and tenoxicam. Most studies report favorable outcomes in terms of alleviation of orthodontic pain with the use of low-level laser therapy. Nevertheless, we noticed that there is no consensus, both for the drug and for laser therapy, on the doses and clinical protocols most appropriate for orthodontic pain management. Alternative methods for orthodontic pain control can also broaden the clinician’s range of options in the search for better patient care. Keywords: tooth movement, pain control, drug therapy, laser therapy

  16. The differences of orthodontic tooth movement on menstrual and ovulation cycle

    Directory of Open Access Journals (Sweden)

    Sonya Grecila Susilo

    2014-12-01

    Full Text Available Background: Estrogens are sex hormon that play an important role in bone metabolism, including in bone remodeling during orthodontic treatment. Women has a monthly cycle which is affected by fluctuations of estrogen that is menstruation and ovulation. Purpose: The study was aimed to determine the differences of orthodontic tooth movement during menstrual an ovulation cycle. Methods: Five women were given ± 100 g orthodontic force using fixed orthodontic appliance with straight wire technique at the time of menstruation and ovulation with an interval of 1.5 months. Orthodontic tooth movement and levels of estrogen were measured during menstruation and ovulation. Results: Statistical results showed a significant differences between estrogen levels and orthodontic tooth movement (p < 0.05. When estrogen levels decline as in menstruation, tooth movement as results of orthodontic force would increase, whereas when estrogen levels increase as the time of ovulation, tooth movement would decrease. Conclusion: The estrogen level in menstruation and ovulation cycle may affect the tooth movement on ortodontic treatment.Latar belakang: Estrogen merupakan hormon seks yang mempunyai peran penting dalam metabolisme tulang termasuk dalam remodeling tulang selama perawatan ortodonti. Wanita memiliki siklus bulanan yang dipengaruhi oleh fluktuasi estrogen yaitu menstruasi dan ovulasi. Tujuan: Penelitian ini bertujuan untuk mengetahui perbedaan pergerakan gigi akibat gaya ortodonti pada siklus menstruasi dan ovulasi. Metode: Lima orang wanita diberikan gaya ortodonti ±100 gr menggunakan alat orthodontik cekat dengan teknik straight wire pada saat menstruasi dan ovulasi dengan selang waktu 1,5 bulan. Selain itu subyek juga diukur kadar estrogennya saat menstruasi dan ovulasi. Hasil: Hasil statistik menunjukan kadar estrogen berbanding terbalik dengan pergerakan gigi ortodonti (p < 0,05. Saat kadar estrogen menurun seperti pada menstruasi, maka pergerakan gigi

  17. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: skim1@lsuhsc.edu [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  18. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  19. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee

    2012-01-01

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  20. An evaluation of two types of nickel-titanium wires in terms of micromorphology and nickel ions? release following oral environment exposure

    OpenAIRE

    Ghazal, Abdul Razzak A.; Hajeer, Mohammad Y.; Al-Sabbagh, Rabab; Alghoraibi, Ibrahim; Aldiry, Ahmad

    2015-01-01

    Background This study aimed to compare superelastic and heat-activated nickel-titanium orthodontic wires? surface morphology and potential release of nickel ions following exposure to oral environment conditions. Methods Twenty-four 20-mm-length distal cuts of superelastic (NiTi Force I?) and 24 20-mm-length distal cuts of heat-activated (Therma-Ti Lite?) nickel-titanium wires (American Orthodontics, Sheboygan, WI, USA) were divided into two equal groups: 12 wire segments left unused and 12 s...

  1. Lingual orthodontic education: An insight

    Directory of Open Access Journals (Sweden)

    Surya Kanta Das

    2016-01-01

    Full Text Available Despite increasing demand for lingual orthodontics, the technique is not very popular among the orthodontists in general. Lingual orthodontics differs from the conventional labial technique in all aspects. Lack of comprehensive training in this field is a major obstacle in popularizing this science of invisible orthodontics. At present, short-term courses and part-time degree programs are the means to learn this technique and the demand for more comprehensive lingual orthodontic education is on a rise among orthodontists. Lingual orthodontics as a super specialty discipline with full-time residency program can be a step forward. This will groom orthodontists to acquire the finest skills to finish lingual cases but also help to the science to grow with dedicated research work.

  2. Clear aligners in orthodontic treatment.

    Science.gov (United States)

    Weir, T

    2017-03-01

    Since the introduction of the Tooth Positioner (TP Orthodontics) in 1944, removable appliances analogous to clear aligners have been employed for mild to moderate orthodontic tooth movements. Clear aligner therapy has been a part of orthodontic practice for decades, but has, particularly since the introduction of Invisalign appliances (Align Technology) in 1998, become an increasingly common addition to the orthodontic armamentarium. An internet search reveals at least 27 different clear aligner products currently on offer for orthodontic treatment. The present paper will highlight the increasing popularity of clear aligner appliances, as well as the clinical scope and the limitations of aligner therapy in general. Further, the paper will outline the differences between the various types of clear aligner products currently available. © 2017 Australian Dental Association.

  3. Mechanical evaluation of space closure loops in Orthodontics

    OpenAIRE

    Rodrigues, Eduardo Uggeri; Maruo, Hiroshi; Guariza Filho, Odilon; Tanaka, Orlando; Camargo, Elisa Souza

    2011-01-01

    This study evaluated the mechanical performance of teardrop-shaped loops and teardrop-shaped loops with helix used in orthodontic space closure. Sixty retraction loops made with 0.019" x 0.025" stainless steel (SS) and beta-titanium (BT) wires were used. They were attached to a testing machine to measure the magnitudes of the sagittal force and the load-deflection ratio necessary for 1 mm, 2 mm and 3 mm activation. The results demonstrated that the BT alloy presented significantly smaller mea...

  4. Wire bonding in microelectronics

    CERN Document Server

    Harman, George G

    2010-01-01

    Wire Bonding in Microelectronics, Third Edition, has been thoroughly revised to help you meet the challenges of today's small-scale and fine-pitch microelectronics. This authoritative guide covers every aspect of designing, manufacturing, and evaluating wire bonds engineered with cutting-edge techniques. In addition to gaining a full grasp of bonding technology, you'll learn how to create reliable bonds at exceedingly high yields, test wire bonds, solve common bonding problems, implement molecular cleaning methods, and much more. Coverage includes: Ultrasonic bonding systems and technologies, including high-frequency systems Bonding wire metallurgy and characteristics, including copper wire Wire bond testing Gold-aluminum intermetallic compounds and other interface reactions Gold and nickel-based bond pad plating materials and problems Cleaning to improve bondability and reliability Mechanical problems in wire bonding High-yield, fine-pitch, specialized-looping, soft-substrate, and extreme-temperature wire bo...

  5. Current advances in orthodontic pain.

    Science.gov (United States)

    Long, Hu; Wang, Yan; Jian, Fan; Liao, Li-Na; Yang, Xin; Lai, Wen-Li

    2016-06-30

    Orthodontic pain is an inflammatory pain that is initiated by orthodontic force-induced vascular occlusion followed by a cascade of inflammatory responses, including vascular changes, the recruitment of inflammatory and immune cells, and the release of neurogenic and pro-inflammatory mediators. Ultimately, endogenous analgesic mechanisms check the inflammatory response and the sensation of pain subsides. The orthodontic pain signal, once received by periodontal sensory endings, reaches the sensory cortex for pain perception through three-order neurons: the trigeminal neuron at the trigeminal ganglia, the trigeminal nucleus caudalis at the medulla oblongata and the ventroposterior nucleus at the thalamus. Many brain areas participate in the emotion, cognition and memory of orthodontic pain, including the insular cortex, amygdala, hippocampus, locus coeruleus and hypothalamus. A built-in analgesic neural pathway-periaqueductal grey and dorsal raphe-has an important role in alleviating orthodontic pain. Currently, several treatment modalities have been applied for the relief of orthodontic pain, including pharmacological, mechanical and behavioural approaches and low-level laser therapy. The effectiveness of nonsteroidal anti-inflammatory drugs for pain relief has been validated, but its effects on tooth movement are controversial. However, more studies are needed to verify the effectiveness of other modalities. Furthermore, gene therapy is a novel, viable and promising modality for alleviating orthodontic pain in the future.

  6. Water Desalination with Wires

    NARCIS (Netherlands)

    Porada, S.; Sales, B.B.; Hamelers, H.V.M.; Biesheuvel, P.M.

    2012-01-01

    We show the significant potential of water desalination using a novel capacitive wire-based technology in which anode/cathode wire pairs are constructed from coating a thin porous carbon electrode layer on top of electrically conducting rods (or wires). By alternately dipping an array of electrode

  7. Are claims made in orthodontic journal advertisements evidence-supported?

    NARCIS (Netherlands)

    Livas, Christos; Kouskoura, Thaleia; Ren, Yijin; Katsaros, Christos; Pandis, Nikolaos

    Objective: To examine the supporting evidence of advertisements published in six leading orthodontic journals. Materials and Methods: The 2012-2013 printed issues of American Journal of Orthodontics and Dentofacial Orthopedics, Australian Orthodontic Journal, Journal of Orthodontics, European

  8. Intracranial Migration of K-wire in a Bilateral Cleft Lip and Palate Patient

    Directory of Open Access Journals (Sweden)

    G Vimala

    2014-01-01

    A 16-year-old female patient with bilateral cleft lip and palate reported for orthodontic treatment. Upon routine investigations, presence of a K-wire that was fixed when patient was around 6 months old, and now had migrated intracranially was made. As K-wire is notorious for its migration to distant places and, that any further impending migration, may in future present a serious problem, the wire was removed after necessary precautions. This case report should be an eye opener and post a caution to general, medical, surgical practitioners and orthodontists.

  9. An evaluation of two types of nickel-titanium wires in terms of micromorphology and nickel ions' release following oral environment exposure.

    Science.gov (United States)

    Ghazal, Abdul Razzak A; Hajeer, Mohammad Y; Al-Sabbagh, Rabab; Alghoraibi, Ibrahim; Aldiry, Ahmad

    2015-01-01

    This study aimed to compare superelastic and heat-activated nickel-titanium orthodontic wires' surface morphology and potential release of nickel ions following exposure to oral environment conditions. Twenty-four 20-mm-length distal cuts of superelastic (NiTi Force I®) and 24 20-mm-length distal cuts of heat-activated (Therma-Ti Lite®) nickel-titanium wires (American Orthodontics, Sheboygan, WI, USA) were divided into two equal groups: 12 wire segments left unused and 12 segments passively exposed to oral environment for 1 month. Scanning electron microscopy and atomic force microscopy were used to analyze surface morphology of the wires which were then immersed in artificial saliva for 1 month to determine potential nickel ions' release by means of atomic absorption spectrophotometer. Heat-activated nickel-titanium (NiTi) wires were rougher than superelastic wires, and both types of wires released almost the same amount of Ni ions. After clinical exposure, more surface roughness was recorded for superelastic NiTi wires and heat-activated NiTi wires. However, retrieved superelastic NiTi wires released less Ni ions in artificial saliva after clinical exposure, and the same result was recorded regarding heat-activated wires. Both types of NiTi wires were obviously affected by oral environment conditions; their surface roughness significantly increased while the amount of the released Ni ions significantly declined.

  10. Induced magnetic moment in stainless steel components of orthodontic appliances in 1.5 T MRI scanners

    Science.gov (United States)

    Rollins, Nancy K.; Liang, Hui; Park, Yong Jong

    2015-01-01

    Purpose: Most orthodontic appliances are made of stainless steel materials and induce severe magnetic susceptibility artifacts in brain MRI. In an effort for correcting these artifacts, it is important to know the value of induced magnetic moments in all parts of orthodontic appliances. In this study, the induced magnetic moment of stainless steel orthodontic brackets, molar bands, and arch-wires from several vendors is measured. Methods: Individual stainless steel brackets, molar bands, and short segments of arch-wire were positioned in the center of spherical flask filled with water through a thin plastic rod. The induced magnetic moment at 1.5 T was determined by fitting the B0 map to the z-component of the magnetic dipole field using a computer routine. Results: The induced magnetic moment at 1.5 T was dominated by the longitudinal component mz, with a small contribution from the transverse components. The mz was insensitive to the orientation of the metal parts. The orthodontic brackets collectively dominated the magnetic dipole moment in orthodontic appliances. In brackets from six vendors, the total induced mz from 20 brackets for nonmolar teeth ranged from 0.108 to 0.158 (median 0.122) A ⋅ m2. The mz in eight molar bands with bracket attachment from two vendors ranged from 0.0004 to 0.0166 (median 0.0035) A ⋅ m2. Several full length arch wires had induced magnetic moment in the range of 0.006–0.025 (median 0.015) A ⋅ m2. Conclusions: Orthodontic brackets collectively contributed most to the total magnetic moment. Different types of brackets, molar bands, and arch wires all exhibit substantial variability in the induced magnetic moment. PMID:26429261

  11. PS wire chamber

    CERN Document Server

    1970-01-01

    A wire chamber used at CERN's Proton Synchrotron accelerator in the 1970s. Multi-wire detectors contain layers of positively and negatively charged wires enclosed in a chamber full of gas. A charged particle passing through the chamber knocks negatively charged electrons out of atoms in the gas, leaving behind positive ions. The electrons are pulled towards the positively charged wires. They collide with other atoms on the way, producing an avalanche of electrons and ions. The movement of these electrons and ions induces an electric pulse in the wires which is collected by fast electronics. The size of the pulse is proportional to the energy loss of the original particle.

  12. [Opportunities and challenges during the development of the orthodontic invisible aligner technique].

    Science.gov (United States)

    Bai, Yu-Xing; Wang, Bang-Kang

    2007-12-01

    The bracketless invisible aligner technique has been considered as a new developed orthodontic technique since its appearance during the period of late 1990s. It is characterized with the advantages of more aesthetic, comfortable, simple, high-efficient and predictable compared with current traditional orthodontic techniques depending on brackets and wires for orthodontic tooth movements. There have been many opportunities for further development and clinical application for the technique with the developments of material sciences, computer software and hardware technology, rapid prototyping techniques, et al. Nevertheless, kinds of difficulties and challenges have been and should be met either at present or in the future for this relatively new technique which just occurred around 10 years ago. The histories, developments with opportunities and challenges and prospects of the technique will be reviewed and discussed in this paper.

  13. Torque differences due to the material variation of the orthodontic appliance: a finite element study.

    Science.gov (United States)

    Papageorgiou, Spyridon N; Keilig, Ludger; Vandevska-Radunovic, Vaska; Eliades, Theodore; Bourauel, Christoph

    2017-12-01

    Torque of the maxillary incisors is crucial to occlusal relationship and esthetics and can be influenced by many factors. The aim of this study was to assess the relative influence of the material of the orthodontic appliance (adhesive, bracket, ligature, and wire) on tooth displacements and developed stresses/strains after torque application. A three-dimensional upper right central incisor with its periodontal ligament (PDL) and alveolus was modeled. A 0.018-in. slot discovery® (Dentaurum, Ispringen, Germany) bracket with a rectangular 0.018 x 0.025-in. wire was generated. The orthodontic appliance varied in the material of its components: adhesive (composite resin or resin-modified glass ionomer cement), bracket (titanium, steel, or ceramic), wire (beta-titanium or steel), and ligature (elastomeric or steel). A total of 24 models were generated, and a palatal root torque of 5° was applied. Afterwards, crown and apex displacement, strains in the PDL, and stresses in the bracket were calculated and analyzed. The labial crown displacement and the palatal root displacement of the tooth were mainly influenced by the material of the wire (up to 150% variation), followed by the material of the bracket (up to 19% variation). The magnitude of strains developed in the PDL was primarily influenced by the material of the wire (up to 127% variation), followed by the material of the bracket (up to 30% variation) and the ligature (up to 13% variation). Finally, stresses developed at the bracket were mainly influenced by the material of the wire (up to 118% variation) and the bracket (up to 59% variation). The material properties of the orthodontic appliance and all its components should be considered during torque application. However, these in silico results need to be validated in vivo before they can be clinically extrapolated.

  14. Torque differences due to the material variation of the orthodontic appliance: a finite element study

    Directory of Open Access Journals (Sweden)

    Spyridon N. Papageorgiou

    2017-02-01

    Full Text Available Abstract Background Torque of the maxillary incisors is crucial to occlusal relationship and esthetics and can be influenced by many factors. The aim of this study was to assess the relative influence of the material of the orthodontic appliance (adhesive, bracket, ligature, and wire on tooth displacements and developed stresses/strains after torque application. Methods A three-dimensional upper right central incisor with its periodontal ligament (PDL and alveolus was modeled. A 0.018-in. slot discovery® (Dentaurum, Ispringen, Germany bracket with a rectangular 0.018 x 0.025-in. wire was generated. The orthodontic appliance varied in the material of its components: adhesive (composite resin or resin-modified glass ionomer cement, bracket (titanium, steel, or ceramic, wire (beta-titanium or steel, and ligature (elastomeric or steel. A total of 24 models were generated, and a palatal root torque of 5° was applied. Afterwards, crown and apex displacement, strains in the PDL, and stresses in the bracket were calculated and analyzed. Results The labial crown displacement and the palatal root displacement of the tooth were mainly influenced by the material of the wire (up to 150% variation, followed by the material of the bracket (up to 19% variation. The magnitude of strains developed in the PDL was primarily influenced by the material of the wire (up to 127% variation, followed by the material of the bracket (up to 30% variation and the ligature (up to 13% variation. Finally, stresses developed at the bracket were mainly influenced by the material of the wire (up to 118% variation and the bracket (up to 59% variation. Conclusions The material properties of the orthodontic appliance and all its components should be considered during torque application. However, these in silico results need to be validated in vivo before they can be clinically extrapolated.

  15. Efficacy of protection by latex gloves during orthodontic therapy.

    Science.gov (United States)

    Doll, G M; Zentner, A; Balan, R; Sergl, H G

    2000-01-01

    The wearing of gloves during orthodontic or dental treatment is generally indicated for reasons of hygiene and protection against infection. This study was aimed at determining the extent and localization of perforations caused by the various orthodontic treatment techniques and interrupting the infection barrier. The impermeability was tested by means of a water retention test according to European standard EN 455, Part 1, performed on 1600 Centramed (Centramed, Koblenz), Tekmedic and SafeEx non-sterile disposable latex gloves (both by Safe Med, Switzerland) and Safe Gan latex gloves with an additional acrylate coating (also by Safe Med). The perforation rate in unused gloves was between 0.5% and 7.5%, rising on average to 11% with increasing use. 36% of the total number of lesions resulted from handling removable appliances, and 57% from handling fixed appliances, especially when replacing arch wires and elastics. Most lesions were in the thumb, index finger and palm region. Only 18% of the defects were noticed by the dentists themselves. The gloves worn by beginners in their first year of postgraduate orthodontic training had about twice as many defects as those worn by qualified orthodontists. When patients with an increased risk of infection are to be treated, additional hand disinfection measures should be taken and 2 pairs of gloves worn in view of the relatively unreliable protection offered by commercially available latex gloves.

  16. Fracture strength of different soldered and welded orthodontic joining configurations with and without filling material

    Directory of Open Access Journals (Sweden)

    Jens Johannes Bock

    2008-10-01

    Full Text Available The aim of this study was to compare the mechanical strength of different joints made by conventional brazing, TIG and laser welding with and without filling material. Five standardized joining configurations of orthodontic wire in spring hard quality were used: round, cross, 3 mm length, 9 mm length and 7 mm to orthodontic band. The joints were made by five different methods: brazing, tungsten inert gas (TIG and laser welding with and without filling material. For the original orthodontic wire and for each kind of joint configuration or connecting method 10 specimens were carefully produced, totalizing 240. The fracture strengths were measured with a universal testing machine (Zwick 005. Data were analyzed by ANOVA (p=0.05 and Bonferroni post hoc test (p=0.05. In all cases, brazing joints were ruptured on a low level of fracture strength (186-407 N. Significant differences between brazing and TIG or laser welding (p<0.05, Bonferroni post hoc test were found in each joint configuration. The highest fracture strength means were observed for laser welding with filling material and 3 mm joint length (998 N. Using filling materials, there was a clear tendency to higher mean values of fracture strength in TIG and laser welding. However, statistically significant differences were found only in the 9-mm long joints (p<0.05, Bonferroni post hoc test. In conclusion, the fracture strength of welded joints was positively influenced by the additional use of filling material. TIG welding was comparable to laser welding except for the impossibility of joining orthodontic wire with orthodontic band.

  17. Orthodontic Management in Aggressive Periodontitis

    Science.gov (United States)

    Bhattarai, Bhagabat

    2017-01-01

    Aggressive periodontitis is a type of periodontitis with early onset and rapid progression and mostly affecting young adults who occupy a large percentage of orthodontic patients. The role of the orthodontist is important in screening the disease, making a provisional diagnosis, and referring it to a periodontist for immediate treatment. The orthodontist should be aware of the disease not only before starting the appliance therapy, but also during and after the active mechanotherapy. The orthodontic treatment plan, biomechanics, and appliance system may need to be modified to deal with the teeth having reduced periodontal support. With proper force application and oral hygiene maintenance, orthodontic tooth movement is possible without any deleterious effect in the tooth with reduced bone support. With proper motivation and interdisciplinary approach, orthodontic treatment is possible in patients with controlled aggressive periodontitis. PMID:28299350

  18. Orthodontic Management in Aggressive Periodontitis

    Directory of Open Access Journals (Sweden)

    Rajesh Gyawali

    2017-01-01

    Full Text Available Aggressive periodontitis is a type of periodontitis with early onset and rapid progression and mostly affecting young adults who occupy a large percentage of orthodontic patients. The role of the orthodontist is important in screening the disease, making a provisional diagnosis, and referring it to a periodontist for immediate treatment. The orthodontist should be aware of the disease not only before starting the appliance therapy, but also during and after the active mechanotherapy. The orthodontic treatment plan, biomechanics, and appliance system may need to be modified to deal with the teeth having reduced periodontal support. With proper force application and oral hygiene maintenance, orthodontic tooth movement is possible without any deleterious effect in the tooth with reduced bone support. With proper motivation and interdisciplinary approach, orthodontic treatment is possible in patients with controlled aggressive periodontitis.

  19. Northcroft lecture: how has the spectrum of orthodontics changed over the past decades?

    Science.gov (United States)

    Melsen, Birte

    2011-06-01

    Three aspects have had a significant impact on orthodontics during the last few decades: the appliances being used, the anchorage being used and finally the distribution of patients being treated. Firstly, the marketing of appliances is increasingly leading the orthodontist to outsource important aspects of treatment such as wirebending and bracket positioning. Brackets and wires are being presented as the solution to all problems and metaphysical terms such as 'intelligent design,' 'working brackets' and 'intelligent wires' are dominating advertising and reducing the impact of evidence-based treatment approaches. Secondly, the introduction of skeletal anchorage has potentially widened the spectrum of orthodontics, allowing for treatments that could not be done with conventional appliances. Biomechanical knowledge is, however, mandatory if we agree that the system should not be abused. Thirdly, the orthodontic population comprises an increasing number of adult patients, many of whom are characterized by a degenerated dentition. The treatment of these patients requires a thorough knowledge not only of biomechanics but also of the reaction of the periodontal tissues to various types of loading. They can be treated only with custom-made appliances adapting the force systems and magnitude to the patient-specific treatment goal. In summary, the orthodontic world is being split between 'appliance-driven fast-food orthodontics' where the results to a large extent are dependent on both growth and function and 'orthodontist-driven' 'slow-food' treatments attempting to push the limits of the possible in relation to complicated problems and reversal of degeneration in adult patients. The latter treatments are performed with individualized appliances adapting the force system to the patient. This paper will attempt to summarize the bearing of these factors on present orthodontics.

  20. Lingual orthodontics in private practice

    OpenAIRE

    S B V Ramana Reddy; J V N Sravanthi

    2016-01-01

    Adult patients show reluctance for labial fixed orthodontic treatment owing to poor esthetics. This increased esthetic demand even during treatment led to the development of invisible bracket systems. The best appliance to meet the esthetic requirements and to give complete three-dimensional control to correct any kind of malocclusion is a fixed lingual appliance. However, one of the challenging aspects of lingual orthodontics is anterior torque control. This torque control can be achieved by...

  1. Quick response codes in Orthodontics

    Directory of Open Access Journals (Sweden)

    Moidin Shakil

    2015-01-01

    Full Text Available Quick response (QR code codes are two-dimensional barcodes, which encodes for a large amount of information. QR codes in Orthodontics are an innovative approach in which patient details, radiographic interpretation, and treatment plan can be encoded. Implementing QR code in Orthodontics will save time, reduces paperwork, and minimizes manual efforts in storage and retrieval of patient information during subsequent stages of treatment.

  2. Development of lingual brachet technique. (Esthetic and hygienic approach to orthodontic treatment) (Part 1) Background and design.

    Science.gov (United States)

    Fujita, K

    1978-04-01

    The present study relates to a development of the new technique and the new appliances, for the treatment of malocclusion and minor tooth movement. The primary purpose of the present study consists in to reduce mental burden of the patients receiving orthodontic treatment and to improve effect of the treatment further by making the appliance invisible when mouth is opened. The second purpose of the study is in orthodontic treatment carried out from lingual side, to control all teeth movement in oral cavity in three dimensions so that the normal occlusion may be operated. The third purpose of the present study is to make the exchange of wire readily when the wire with bigger elasticity is exchanged by turns during the process of the treatment. The background and the design of appliances for the lingual-bracker technique(lingual-bracket mushroom arch wire technique) is found out in this report.

  3. Evaluation of the Effects of Fluoride Prophylactic Agents on Mechanical Properties of Nickel Titanium Wires using Scanning Electron Microscope.

    Science.gov (United States)

    Gupta, Ajay K; Shukla, Gita; Sharma, Poonam; Gupta, Amit K; Kumar, Amit; Gupta, Deepika

    2018-03-01

    Orthodontic treatment these days is increasing in demand, and therefore, it is relatively imperative for the orthodontist to prescribe the use of fluoride-containing products, such as mouthwashes and gels, to help prevent dental caries and maintain healthy oral health. The aim of the study was to assess and evaluate the effects of fluoride prophylactic agents on mechanical properties of nickel titanium (NiTi) wires during orthodontic treatment using scanning electron microscope (SEM). We used the commercially available round preformed NiTi orthodontic archwire (3M company) and three different mouthwash solutions, i.e., Phos-Flur gel (1.1% sodium acidulated phosphate fluoride, APF, 0.5% w/v fluoride, pH = 5.1; Colgate Oral Pharmaceuticals) and Prevident 5000 (1.1% sodium fluoride neutral agent, 0.5% w/v fluoride, pH = 7; Colgate Oral Pharmaceuticals). All the specimens were subjected to a three-point bending test on a universal testing machine. To observe the surface morphological changes, one wire from each group was randomly selected and observed under a SEM. It was observed that there was not much difference in the values of both modulus of elasticity and yield strength obtained after loading of stress on the wires in all the three experimental conditions. A significant difference in both modulus of elasticity and yield strength was observed during unloading of stress. Further, when the surface characteristics were observed for all the specimens using SEM images, it was observed that NiTi wires treated with Phos-Flur showed large surface defects which appeared as round, pitted areas depicting corrosion, numerous white inclusions, and overall damaged surface structure of the wire as compared with the control. Thus, fluoridated mouthwashes are essential to maintain good oral hygiene and decrease instance of caries in patients undergoing orthodontic treatment. The prophylactic usage of topical fluoride agents on NiTi wire seems to diminish the mechanical properties

  4. Tensile test and interface retention forces between wires and composites in lingual fixed retainers.

    Science.gov (United States)

    Paolone, Maria Giacinta; Kaitsas, Roberto; Obach, Patricia; Kaitsas, Vasilios; Benedicenti, Stefano; Sorrenti, Eugenio; Barberi, Fabrizio

    2015-06-01

    In daily orthodontic clinical practice retention is very important, and lingual retainers are part of this challenge. The failure of lingual retainers may be due to many factors. The aim of this study was to assess the retention forces and mechanical behavior of different types of wires matched with different kinds of composites in lingual retainers. A tensile test was performed on cylindrical composite test specimens bonded to orthodontic wires. The specimens were constructed using four different wires: a straight wire (Remanium .016×.022″ Dentaurum), two round twisted wires (Penta One .0215″ Masel, Gold Penta Twisted .0215″ Gold N'braces) and a rectangular braided wire (D-Rect .016×.022″ Ormco); and three composites: two micro-hybrids (Micro-Hybrid Enamel Plus HFO Micerium, and Micro-Hybrid SDR U Dentsply) and a micro-nano-filled composite (Micro-Nano-Filled Transbond LR 3M). The test was performed at a speed of 10mm/min on an Inström device. The wire was fixed with a clamp. The results showed that the bonding between wires and composites in lingual fixed retainers seemed to be lowest for rectangular smooth wires and increased in round twisted and rectangular twisted wires where the bonding was so strong that the maximum tension/bond strength was greater than the ultimate tensile strength of the wire. The highest values were in rectangular twisted wires. Concerning the composites, hybrid composites had the lowest interface bonding values and broke very quickly, while the nano- and micro-composites tolerated stronger forces and displayed higher bonding values. The best results were observed with the golden twisted wire and reached 21.46 MPa with the Transbond composite. With the rectangular braided wire the retention forces were so high that the Enamel Plus composite fractured when the load exceeded 154.6 N/MPa. When the same wire was combined with the Transbond LR either the wire or the composite broke when the force exceeded 240 N. The results of this

  5. The Effect of Orthodontic Forces on Tooth Response to Electric Pulp Test

    OpenAIRE

    Modaresi, Jalil; Aghili, Hosein; Dianat, Omid; Younessian, Farnaz; Mahjour, Faranak

    2015-01-01

    Introduction: The current study investigated the pulp response to electric pulp testing (EPT), before, upon initiation and one month after the start of orthodontic tooth movement. Methods and Materials: A total of 402 anterior teeth from 39 patients (mean age of 16.8?2.7 years) were examined in this non-controlled prospective study. The aligning forces were administered using initial NiTi archwires ligated on fixed appliances by using the MBT straight wire technique. The electrical stimulatio...

  6. French Board of Orthodontics.

    Science.gov (United States)

    De Sousa Beltrao, Paulo Augusto

    2010-09-01

    A. February 2001 (15.11 y). Molar Class I, skeletal Class I, normodivergent, anterior deficiency: -17 mm, bimaxillary protrusion. Preparation of arches (alignment, levelling, canine retraction). Correction of arches (space closure). Occlusal finishing (artistic bends). B. POSTTREATMENT RECORDS: February 2003 (17.11 y). Maxillary Hawley plate for nighttime use and bonded lingual wire from 33 to 43. C. POSTRETENTION RECORDS: December 2003 (18.9 y). Copyright © 2010 CEO. Published by Elsevier Masson SAS. All rights reserved.

  7. Evaluation of tensile strength of different configurations of orthodontic retraction loops for obtaining optimized forces.

    Science.gov (United States)

    Blaya, Miceli Beck Guimaraes; Westphalen, Graziela Henriques; Guimaraes, Magali Beck; Hirakata, Luciana Mayumi

    2009-01-01

    The aim of this study was to analyze the mechanical behavior of different orthodontic retraction loops. Two designs of orthodontic loops for closing space were analyzed: teardrop-shaped (T) and circle-shaped loop (C), of two different heights (6 and 8 mm), and two types of orthodontic wires (stainless steel - 0.19' x 0.25'; TMA - titanium molybdenum alloy - 0.016' x 0.016'). The sample consisted of 80 loops, divided into 8 groups determined by the combination shape/height/type of wire, which were submitted to tensile testing at a speed of 2 mm/min., to measure the quantity of force generated when activated in the interval of 0.75 mm and 2.25 mm. The results were submitted to the ANOVA and Tukey statistical tests to compare the groups, and the Student's-t test to compare the means of two groups. Statistically higher values were observed for the size 6 mm, circle shape and stainless steel composition. The group "teardrop-8 mm-TMA" together with the group "circle-8 mm-TMA" presented the lowest mean value, differing statistically from all of the other groups. It was concluded that the alloy of the wire and the height of the loop would be more important than the loop design.

  8. Novel universal system for 3-dimensional orthodontic force-moment measurements and its clinical use.

    Science.gov (United States)

    Mencattelli, Margherita; Donati, Elisa; Cultrone, Massimo; Stefanini, Cesare

    2015-07-01

    Orthodontic treatment is an important part of dental health care in Europe: the percentages of the population undergoing therapy vary from 10% to 55%. Therefore, quantifying effective orthodontic loads is a challenging topic with regard to the predictability of tooth movements and the reduction of traumatic side effects. A customized measuring platform was developed and used for detecting orthodontic forces in a range between 0.1 and 2 N. The system consists of 6 load cells, each equipped with 6 strain gauges. The tests were conducted on a 3-dimensional printed malocclused mouth model and on a plaster cast. Four types of superelastic ligation and 2 types of invisible aligners were tested to analyze, respectively, a malocclusion with a high maxillary canine, and the effects on the axial rotation of a maxillary central incisor with and without a divot in the invisible aligners. Optimal treatment forces are exerted by low-friction wires, especially if they are partially engaged. Moreover, by reducing the treatment force, there is less necessity of anchoring to surrounding teeth, thus decreasing the side effects. The efficacy of using invisible aligners with a divot was validated. This platform allowed measurement, at the radicular level, of the resultant forces of orthodontic treatments performed with different orthodontic appliances. In addition to customizing and calibrating the therapy for each patient, this platform could be used to develop new specific instruments able to exert lower treatment forces, thus preventing irreversible damages. Copyright © 2015 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.

  9. DNA damage in oral mucosa cells of patients with fixed orthodontic appliances.

    Directory of Open Access Journals (Sweden)

    Farzin Heravi

    2013-12-01

    Full Text Available The release of toxic metal ions from orthodontic alloys has induced concerns regarding the biocompatibility of fixed appliances. This study investigated the genotoxic effect of metal appliances in a sample of patients undergoing fixed orthodontic treatment.The study included twenty-five healthy individuals requiring orthodontic therapy in both jaws. The patients were treated by stainless steel orthodontic brackets and nickel-titanium or stainless steel arch wires. The oral mucosa cells were gathered just before the appliance placement and 9 months later. The cells were centrifuged, fixed and dropped onto slides. After staining, the micronucleus (MN assay was used to determine genome alteration. The data were analyzed by paired sample t-test.The mean micronuclei frequency in the buccal mucosa was 10.6 ± 5.7 per 1000 cells before the appliance placement and 9.2 ± 6.37 per 1000 cells 9 months later. No significant difference was found in the MN count before and 9 months after therapy (p=0.336.Under the conditions used in this study, application of fixed orthodontic appliances did not expose healthy individuals to increased risk of DNA damage in oral mucosa cells.

  10. A Clinical Assessment of Corticotomy Facilitated Orthodontics in the Retraction of Maxillary Anterior Segment

    Directory of Open Access Journals (Sweden)

    Chagam Manjunatha Reddy

    2014-01-01

    Full Text Available Corticotomy facilitated orthodontics has been practising for longer periods, but a novel approach of a periapical incision to make horizontal cuts 5 mm above the apex of the maxillary anteriors along with vertical cuts requires a detailed investigation. The purpose of this study was to assess the outcome of skeletal cases with spacing in the anteriors using a novel method of modified surgical approach utilizing the corticotomy facilitated orthodontics. Patients for this study were randomly selected from a very intensive screening in the Department of Orthodontics, Saveetha Dental College and Hospital, Chennai, out of which seven patients were selected for this procedure. The patients were subjected for corticotomy procedure under local anesthesia after the leveling and aligning stage (0.019" × 0.025" stainless steel wire, and the retraction was continued still the space was closed. AutoCAD and palatal rugae assessment programs were used to assess the orthodontic tooth movement. The results of the study demonstrated that when compared to conventional orthodontics alone, the corticotomy facilitated approach produced faster tooth movements in all the seven patients reducing the overall treatment time by 60%. The use of this modified technique of labial, palatal and apical cuts could be beneficial for adult patients with difficult surgical access from the lingual side.

  11. Towards plant wires

    OpenAIRE

    Adamatzky, Andrew

    2014-01-01

    In experimental laboratory studies we evaluate a possibility of making electrical wires from living plants. In scoping experiments we use lettuce seedlings as a prototype model of a plant wire. We approximate an electrical potential transfer function by applying direct current voltage to the lettuce seedlings and recording output voltage. We analyse oscillation frequencies of the output potential and assess noise immunity of the plant wires. Our findings will be used in future designs of self...

  12. Periodontally accelerated osteogenic orthodontics (PAOO) - a review

    OpenAIRE

    Amit, Goyal; JPS, Kalra; Pankaj, Bhatiya; Suchinder, Singla; Parul, Bansal

    2012-01-01

    With an increasing number of adult patients coming to the orthodontic clinic, the orthodontic professional is constantly looking for ways to accelerate tooth movement. Surgical intervention to affect the alveolar housing and tooth movement has been described in various forms for over a hundred years. However, it is the spirit of interdisciplinary collaboration in orthodontics has expanded the realm of traditional orthodontic tooth movement protocols. Periodontal accelerated osteogenic orthodo...

  13. Periodontally accelerated osteogenic orthodontics (PAOO) - a review

    OpenAIRE

    Amit, Goyal; Pankaj, Bhatiya; Suchinder, Singla; Parul, Bansal

    2012-01-01

    With an increasing number of adult patients coming to the orthodontic clinic, the orthodontic professional is constantly looking for ways to accelerate tooth movement. Surgical intervention to affect the alveolar housing and tooth movement has been described in various forms for over a hundred years. However, it is the spirit of interdisciplinary collaboration in orthodontics has expanded the realm of traditional orthodontic tooth movement protocols. Periodontal accelerated osteog...

  14. Periodontal status of Pakistani orthodontic patients

    OpenAIRE

    MOOSA, Yousuf; HAN, Ling Na; SAFDAR, Jawad; SHEIKH, Omair Ahmed; PAN, Ya Ping

    2015-01-01

    The objective of this study was to evaluate and compare the periodontal status of orthodontic patients and non-orthodontic patients, aged 15–28 years, of both genders. The cross-sectional study included 100 orthodontic and 100 non-orthodontic patients evaluated using a Community Periodontal Index for Treatment Need (CPITN) probe on the index teeth. A questionnaire was distributed to the participants to assess and evaluate the use of oral hygiene aids. The data were analyzed using SPSS v...

  15. Photovoltaic Wire, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — This Small Business Innovation Research Phase I project will investigate a new architecture for photovoltaic devices based on nanotechnology: photovoltaic wire. The...

  16. Photovoltaic Wire Project

    Data.gov (United States)

    National Aeronautics and Space Administration — This Small Business Innovation Research Phase I project will investigate a new architecture for photovoltaic devices based on nanotechnology: photovoltaic wire. The...

  17. Charpak hemispherical wire chamber

    CERN Document Server

    1970-01-01

    pieces. Mesures are of the largest one. Multi-wire detectors contain layers of positively and negatively charged wires enclosed in a chamber full of gas. A charged particle passing through the chamber knocks negatively charged electrons out of atoms in the gas, leaving behind positive ions. The electrons are pulled towards the positively charged wires. They collide with other atoms on the way, producing an avalanche of electrons and ions. The movement of these electrons and ions induces an electric pulse in the wires which is collected by fast electronics. The size of the pulse is proportional to the energy loss of the original particle.

  18. 1998 wire development workshop proceedings

    International Nuclear Information System (INIS)

    1998-04-01

    This report consists of vugraphs of the presentations at the conference. The conference was divided into the following sessions: (1) First Generation Wire Development: Status and Issues; (2) First Generation Wire in Pre-Commercial Prototypes; (3) Second Generation Wire Development: Private Sector Progress and Issues; (4) Second Generation Wire Development: Federal Laboratories; and (5) Fundamental Research Issues for HTS Wire Development

  19. Wire Array Photovoltaics

    Science.gov (United States)

    Turner-Evans, Dan

    Over the past five years, the cost of solar panels has dropped drastically and, in concert, the number of installed modules has risen exponentially. However, solar electricity is still more than twice as expensive as electricity from a natural gas plant. Fortunately, wire array solar cells have emerged as a promising technology for further lowering the cost of solar. Si wire array solar cells are formed with a unique, low cost growth method and use 100 times less material than conventional Si cells. The wires can be embedded in a transparent, flexible polymer to create a free-standing array that can be rolled up for easy installation in a variety of form factors. Furthermore, by incorporating multijunctions into the wire morphology, higher efficiencies can be achieved while taking advantage of the unique defect relaxation pathways afforded by the 3D wire geometry. The work in this thesis shepherded Si wires from undoped arrays to flexible, functional large area devices and laid the groundwork for multijunction wire array cells. Fabrication techniques were developed to turn intrinsic Si wires into full p-n junctions and the wires were passivated with a-Si:H and a-SiNx:H. Single wire devices yielded open circuit voltages of 600 mV and efficiencies of 9%. The arrays were then embedded in a polymer and contacted with a transparent, flexible, Ni nanoparticle and Ag nanowire top contact. The contact connected >99% of the wires in parallel and yielded flexible, substrate free solar cells featuring hundreds of thousands of wires. Building on the success of the Si wire arrays, GaP was epitaxially grown on the material to create heterostructures for photoelectrochemistry. These cells were limited by low absorption in the GaP due to its indirect bandgap, and poor current collection due to a diffusion length of only 80 nm. However, GaAsP on SiGe offers a superior combination of materials, and